WorldWideScience

Sample records for baba2 primer aislamiento

  1. High Prevalence of cagA- and babA2-Positive Helicobacter pylori Clinical Isolates in Taiwan

    OpenAIRE

    Lai, Chih-Ho; Kuo, Chun-Hsien; Chen, Ya-Chi; Chao, Fang-Yu; Poon, Sek-Kwong; Chang, Chi-Sen; Wang, Wen-Ching

    2002-01-01

    Two virulence markers, cagA and babA2, were characterized by PCR in 101 Helicobacter pylori isolates from a population in Taiwan. cagA was detected in 99% of the isolates, while babA2 was present in all of the isolates. Base deletions and substitutions at the forward babA2 primer annealing sites were found. Given their high prevalence, cagA and babA2 cannot be useful markers for predicting the high-risk patients of H. pylori infection in Taiwan.

  2. Clinical relevance of Helicobacter pylori babA2 and babA2/B in Costa Rica and Japan

    Institute of Scientific and Technical Information of China (English)

    Sergio; A; Con; Hiroaki; Takeuchi; Mitsuaki; Nishioka; Norihito; Morimoto; Tetsuro; Sugiura; Nobufumi; Yasuda; Reinaldo; Con-Wong

    2010-01-01

    AIM:To evaluate the prevalence of Helicobacter pylori(H.pylori ) babA2 ,babB and a recombinant gene between babA2 and babB(babA2/B ),and their role in the development of atrophic gastritis in Costa Rican and Japanese clinical isolates.METHODS:A total of 95 continuous H.pylori-positive Costa Rican(41 males and 54 females;mean age,50.65 years;SD,± 13.04 years) and 95 continuous H.pylori-positive Japanese(50 males and 45 females;mean age,63.43;SD,± 13.21 years) patients underwent upper endoscopy from October 2...

  3. Mastitis bovina por Prototheca zopfii: primer aislamiento en Chile Bovine mastitis caused by Prototheca zopfii: first isolation in Chile

    Directory of Open Access Journals (Sweden)

    L Zaror

    2011-01-01

    Full Text Available El género Prototheca está formado por microalgas unicelulares sin clorofila, ampliamente distribuidas en el medio ambiente, algunas de las cuales pueden ser patógenas para el hombre y animales. Sin embargo, no existen antecedentes bibliográficos previos sobre la existencia de estas algas patógenas para el hombre y animales en Chile. Se examinó bacteriológicamente un total de 200 muestras de leche provenientes de 150 vacas lecheras con mastitis clínica, las cuales fueron sembradas en medio PIM modificado, selectivo para Prototheca. Se aisló Prototheca spp. en dos ocasiones consecutivas de una misma vaca muestreada con un intervalo de dos meses. El examen microscópico directo de las muestras de leche en fresco reveló la presencia células características de Prototheca spp. Mediante asimilación de fuentes de carbono se identificó la especie como P. zopfii, constituyendo el primer aislamiento de este agente a partir de un cuadro de mastitis clínica bovina en Chile. Este hallazgo es relevante para los programas de control de mastitis bovina en los rebaños lecheros ya que es un organismo poco frecuente y desconocido que no responde a los tratamientos antibióticos convencionales.The genus Prototheca includes unicellular achlorophyllous microalgae widely distributed in the environment, some of which could be pathogenic for human and animals. However, there is no previous report regarding these pathogenic microalgae causing infections in man or animals in Chile. Two-hundred milk samples collected from 150 dairy cows with clinical mastitis were inoculated onto PIM modified medium. Prototheca spp was isolated on two consecutive occasions from one cow sampled two months apart. Direct microscopic examination of wet smears made from milk samples revealed typical Prototheca cells. Biochemical tests based on carbon source assimilation identified the organism as Prototheca zopfii. This finding represents the first isolation of this environmental

  4. Primer informe sobre el aislamiento de Helicobacter pylori asociado a enfermedades digestivas en Ciudad de La Habana

    Directory of Open Access Journals (Sweden)

    Beatriz Gutiérrez

    2001-03-01

    Full Text Available La infección por Helicobacter pylori desempeña un papel fundamental en el desarrollo de diversas enfermedades digestivas. Actualmente se acepta que este microorganismo está relacionado con la gastritis crónica activa, la úlcera péptica (tanto gástrica como duodenal, el adenocarcinoma gástrico y el linfoma gástrico de células B del tejido linfoide asociado a mucosa (Linfoma MALT. Se estudiaron 121 pacientes, 53 con diagnóstico endoscópico de gastritis, 21 con úlcera péptica, 20 úlceras duodenales, 3 adenocarcinomas del antro gástrico, 5 neoplasias de esófago y 19 panendoscopias normales (dispépticos. A todos los pacientes se les practicó una gastroscopia y se tomaron cuatro fragmentos de biopsias distribuidas entre las regiones de antro y cuerpo gástrico. Para el diagnóstico y aislamiento de H. pylori se empleó la prueba de la ureasa rápida, la tinción de gram, y el cultivo en agar cerebro corazón con suero de caballo 10%, extracto de levadura 0,25% más suplemento Dent (OXOID SR 147 durante 7 días a 37 ºC en jarra en atmósfera de microaerofilia. También se evaluó la presencia de catalasa y oxidasa. Se observó una prevalencia de la infección del 79,2% en la gastritis crónica, un 100% en los pacientes con úlcera duodenal y un 90,4% en relación con la úlcera gástrica, lo que coincide con lo reportado por otros autores. En el 100% de los casos de adenocarcinoma gástrico y en el 60% de los casos de neoplasias de esófago se aisló el microorganismo. El aislamiento de H. pylori en el 78,9% de endoscopias realizadas e informadas como normales es una alerta de la prevalencia en pacientes dispépticos.

  5. Helicobacter pylori vacA i region polymorphism but not babA2 status associated to gastric cancer risk in northwestern Iran.

    Science.gov (United States)

    Mottaghi, Batool; Safaralizadeh, Reza; Bonyadi, Morteza; Latifi-Navid, Saeid; Somi, Mohammad Hossein

    2016-02-01

    Helicobacter pylori-specific genotypes have been strongly associated with an increased risk of gastric cancer (GC). The aim of the present work was to study the associations of H. pylori virulence factors, vacA i region polymorphisms and babA2 status with GC risk in Azerbaijan patients. The DNA extracted from gastric biopsy specimens was used to access the babA2 and vacA genotypes. Overall, babA2 was present in 85.39 % (76/89) of H. pylori strains: 19 out of 24 (79.16 %) strains from GC, 16 out of 17 (94.14 %) strains from peptic ulcer disease (PUD) and 41 out of 48 (85.14 %) strains from chronic gastritis. No significant association was found between babA2 genotype and clinical outcomes (P > 0.05). i1 vacA polymorphism was detected in 46/89 (51.68 %) strains: in 21/24 (87.5 %), 6/17 (35.29 %) and 19/48 (39.58 %) patients with GC, PUD and chronic gastritis, respectively. i2 allele was detected in 43 (48.31 %) out of all 89 strains examined: 3 (14.28 %) of 24 strains from GC, 11 (64.71 %) of 17 from PUD, and 29 (60.42 %) of 48 strains from chronic gastritis. In this study, multiple linear regression analysis confirmed the strong association of i1 allele with GC (partial regression correlation 0.455 ± 0.101; P = 0). Results of multiple logistic regression analysis showed that vacA i1 genotype was significantly associated with GC compared with a control group (gastritis) (odds ratio 13.142, 95 % CI 3.116-55.430; P = 0). Findings from the measurement of H. pylori babA2 and vacA genotypes indicate a strong correlation between the vacA i1 allele and GC risk in the Azerbaijan area of Iran. PMID:25472424

  6. de diversas fuentes de aislamiento

    Directory of Open Access Journals (Sweden)

    María Guadalupe Morales Meza

    2006-01-01

    Full Text Available En este estudio se determinó la resistencia antimicrobiana de cepas de Staphylococcus aureus obtenidas de diversas fuentes de aislamiento para comparar los patrones de resistencia alcanzados de acuerdo con su origen y así establecer si la resistencia a los antibióticos está asociada al origen de aislamiento. Para esto se aislaron 187 cepas a partir de 483 muestras que incluyeron alimentos, ambiente, portadores sanos y portadores enfermos; se realizó la identificación de las cepas por métodos bioquímicos y aquéllas confirmadas como S.aureus se conservaron a –20°C. Con las cepas obtenidas se realizaron pruebas de susceptibilidad antimicrobiana por el método de Bauer-Kirby a los antibióticos comúnmente utilizados para Gram (+. Después de interpretar la prueba se realizó un análisis estadístico de los resultados mediante la prueba c2 de Pearson. La frecuencia de aislamiento fue de 38.7% de S.aureus de todas las muestras manejadas, lo que confirma el hecho de que esta bacteria se encuentra ampliamente distribuida. De los antibióticos probados, en la dicloxacilina, tetraciclina y eritromicina, según el análisis estadístico, se encontró que la resistencia es dependiente del origen de aislamiento. En el caso de la dicloxacilina, este es un antibiótico muy usado en animales, lo que selecciona cepas resistentes que se mantienen en productos de origen animal como los cárnicos y lácteos. El origen de las cepas resistentes a la tetraciclina y eritromicina se considera humano, ya que éstas se encontraron en los alimentos que tienen mucha manipulación durante su proceso y comercialización (jamón, tocino. Para otros antibióticos como lo fueron la penicilina, pefloxacina, cefuroxima, gentamicina, cefotaxima, ampicilina, ceftazidima y cefalotina se encontró que la resistencia es independiente del origen, lo que implica que los genes de resistencia en las cepas de S. aureus para estos antibióticos están ampliamente distribuidos

  7. Reporte histórico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de cólera en el Perú ‑ 1991 Historical report: first isolation of Vibrio cholera serogroup O1 biovar El Tor serovar Inaba during the cholerae epidemic in Perú ‑ 1991

    Directory of Open Access Journals (Sweden)

    Nora Bravo Cruz

    2011-03-01

    Full Text Available Hace 20 años apareció una enfermedad diarreica nueva en el Perú y el Laboratorio de Referencia de Enteropatógenos del Instituto Nacional de Salud, cumplió una labor destacada en el aislamiento e identificación rápida y oportuna del Vibrio cholerae. La enfermedad del cólera no se había presentado anteriormente, pero en la última semana de enero de 1991 se detectó un brote epidémico de diarrea aguda con deshidratación intensa y algunos casos de fallecidos. La epidemia afectó, al comienzo, varias localidades del litoral peruano. Equipos de trabajo de la Oficina General de Epidemiología y de los laboratorios del Instituto Nacional de Salud obtuvieron muestras fecales de pacientes con diarrea aguda procedentes de las ciudades de Chancay, Chimbote, Piura y algunos hospitales de Lima. Las muestras colectadas en el medio de transporte de Cary y Blair fueron procesadas en el Laboratorio Nacional de Referencia de Enteropatógenos (LANARE del Instituto Nacional de Salud. De todas las muestras se aisló e identificó Vibrio cholerae serogrupo O1 biovar El Tor serovar Inaba que mostró ser sensible a la tetraciclina y a otros antibióticos. Esta investigación confirmó el primer brote epidémico de cólera en el Perú.20 years ago, a new diarrheal disease was introduced in Peru and the Enteropathogens Reference Laboratory of the Instituto Nacional de Salud had an outstanding role in the isolation and rapid and timely identification of Vibrio cholerae. Cholera had not been seen before, but during the last week of January 1991 an outbreak of acute diarrhea was detected, presenting intense dehydration and some deaths. The epidemic affected, in the beginning, many locations of the peruvian coast. Some working teams of the General Office of Epidemiology and of the Instituto Nacional de Salud obtained fecal samples from patients with acute diarrhea coming from the cities of Chancay, Chimbote, Piura and some hospitals in Lima. The collected samples

  8. Association Between Helicobacter pylori cagA, babA2 Virulence Factors and Gastric Mucosal Interleukin-33 mRNA Expression and Clinical Outcomes in Dyspeptic Patients.

    Science.gov (United States)

    Shahi, Heshmat; Reiisi, Somayeh; Bahreini, Rasol; Bagheri, Nader; Salimzadeh, Loghman; Shirzad, Hedayatollah

    2015-01-01

    Helicobacter pylori (H. pylori) infection has been reported in more than half of the world human population. It is associated with gastric inflammation and noticeable infiltration of the immune cells to the stomach mucosa by several cytokines secretion. IL-1β, IL-18 have been shown to contribute to H. pylori induced gastritis, but the details of inflammation and association of virulence factors remain unclear. IL-1 cytokine family has a new additional cytokine, Interleukin-33 (IL-33), which is contemplated to have an important role for host defense against microorganisms. H. pylori virulence factors important in gastritis risk are the cag pathogenicity island (cag-PAI) and babA. This study evaluated IL-33 mucosal mRNA expression levels in infected and uninfected patients and its relationship with bacterial virulence factors cagA, babA2 and type of gastritis. Total RNA was extracted from gastric biopsies of 79 H. pylori-infected patients and 51 H. pylori-negative patients. Mucosal IL-33 mRNA expression levels in gastric biopsies were assessed using real-time PCR. Existence of virulence factors were detected by PCR. IL-33 mRNA expression was significantly higher in biopsies of H. pylori-infected patients compared to H. pylori-uninfected patients (Pchronic gastritis patients compared with patients with active gastritis (Pchronic gastritis and severity of inflammatory changes in the gastric mucosa. PMID:27014647

  9. Contención sin aislamiento

    OpenAIRE

    Mario Sánchez Gumiel

    2013-01-01

    En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, c...

  10. Contención sin aislamiento

    Directory of Open Access Journals (Sweden)

    Mario Sánchez Gumiel

    2013-02-01

    Full Text Available En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, como el Atlántico después de la Segunda Guerra Mundial, en el nuevo escenario geopolítico del siglo XXI.Palabras Clave: Estados Unidos, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Contención, Aislamiento, Corea, Vietnam, Tian’anmen, URSS, Comunismo, Capitalismo.___________________Abstract:On February 2012 took place the fourtieth anniversary of President Nixon’s visiting to China and, as a consequence, of the resumption of the Sino-American relations which had been interrupted in 1949. Since then, the United States and China have experienced a reciprocal policy of containment without isolation, both being aware of their mutual differences but knowing of the necessity of mutual understanding as well. As a result, the Pacific ocean is making changes, just as the Atlantic after the Second World War, in order to become the new geopolitical place of the Twenty First century.Keywords: United States, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Containment, Isolation, Korea, Vietnam, Tian’anmen, USSR, Communism, Capitalism.

  11. Phonics Primer

    Science.gov (United States)

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  12. Sensibilidad al fluconazol de aislamientos de Trichophyton rubrum

    Directory of Open Access Journals (Sweden)

    Norma T Gross-Martínez

    2014-03-01

    Full Text Available Antecedentes: Trichophyton rubrum es el dermatofito más frecuentemente aislado a nivel mundial y afecta principalmente: piel glabra, uñas de las manos y de los pies. El fluconazol es utilizado con frecuencia para el tratamiento de las onicomicosis en nuestra población, por lo que el objetivo de la presente investigación fue estudiar la sensibilidad a este antifúngico, de aislamientos costarricenses de T. rubrum. Métodos: se investigó la sensibilidad in vitro al fluconazol de 80 aislamientos de T. rubrum, obtenidos de muestras de piel y sus anexos. El método utilizado fue el de microdilución M-38A, descrito por el “National Committee for Clinical Laboratory Standards”. Las diluciones finales del fluconazol fueron de 0,25 a 128 μg/ml. Resultados: la mayoría de los aislamientos fueron obtenidos de uñas de los pies (68,75%. El 86,25% de los aislamientos analizados presentaron una concentración mínima inhibitoria entre 0,25-8 μg/ml, el 8,75% entre 16-32 μg/ml y un 5% > 64 μg/ml. De estos aislamientos resistentes, dos fueron de uñas de los pies y dos de plantas de pie. Conclusión: debido a que la mayoría de los aislamientos de T. rubrum demostraron ser sensibles al fluconazol, solo se recomienda realizar la prueba de sensibilidad a este antifúngico en casos de falla terapéutica, especialmente en pacientes con onicomicosis en la cual el tratamiento es prolongado.

  13. Control activo no lineal de edificios con aislamiento de base

    OpenAIRE

    Barbat Barbat, Horia Alejandro; Molinares, N.; Rodellar Benedé, José

    1994-01-01

    Se consideran edificios con sistema de aislamiento histerético y friccional, se desarrollan sus ecuaciones del movimiento y se describen procedimientos de cálculo numérico de la respuesta del sistema aislado. A continuación se estudia la posibilidad de desarrollo de sistemas de aislamiento de base activos (sistemas híbridos). Después de describir una nueva estrategia de control activo que se propone, se incluye un estudio numérico de simulación de la respuesta sísmica de edificios con sistema...

  14. Pathogenic and Genetic Diversity among Iranian Isolates of Macrophomina phaseolina Diversidad Patogénica y Genética entre Aislamientos Iraníes de Macrophomina phaseolina

    Directory of Open Access Journals (Sweden)

    Siavosh Rayatpanah

    2012-03-01

    Full Text Available Charcoal rot, caused by Macrophomina phaseolina (Tassi Goid., is an economically important disease of oilseed plants in Northern Iran. Seventy isolates of M. phaseolina were obtained from different hosts, including soybean (Glycine max L., and sunflower (Helianthus annuus L. in the northern oilseed planting regions of Iran. RAPD-PCR amplification profiles, by using of six random OPA primers (kit A showed polymorphisms among the isolates. The primer OPA-13 (5'_ CAGCACCCAC_3' amplified the genomic DNA of all isolates of M.phaseolina producing 4-12 bands of sizes between 0.25 and 2.3 kb. Unweighted pair-group method with arithmetic mean (UPGMA analysis classified the isolates into the nine major groups with 64% similarity. Pathogenicity of isolates was evaluated at seedling stage of soybean, sunflower, and maize (Zea mays L. plants under in vitro conditions. None of the isolates were pathogenic on corn, while all of the isolates infected soybean and sunflower seedlings. Isolates were more virulent on soybean than sunflower. The disease index on sunflower and soybean varied between 19-24 and 27-30 respectively. These results indicated a significant pathogenic and genetic variability within the Iranian isolates of M. phaseolina. Cultivation with crop rotation was probably tended to induce less diversity of the pathogen isolates.Pudrición carbonosa, causada por Macrophomina phaseolina (Tassi Goid., es una enfermedad de importancia económica de las plantas de semillas oleaginosas en el norte de Irán. Setenta aislamientos de M. phaseolina se obtuvieron de diferentes hospederos, incluyendo soya (Glycine max L. y girasol (Helianthus annuus L. en las regiones de plantación de semillas oleaginosas del norte de Irán. Perfiles RAPD-PCR de amplificación, utilizando primers aleatorios de seis OPA (kit A mostraron polimorfismos entre los aislamientos. El primer OPA-13 (5'-CAGCACCCAC-3' amplificó el ADN genómico de todos los aislamientos de M. phaseolina

  15. Primer aislamiento de Ornithobacterium rhinotracheale en Argentina

    OpenAIRE

    Uriarte, Javier; Píscopo, Miguel V.; Origlia, Javier; Gornatti Churria, Daniel; Cerdá, Raúl Oscar; Herrero, María Alejandra; Petruccelli, Miguel Ángel

    2009-01-01

    Ornithobacterium rhinotracheale (ORT) es una bacteria gram negativa, cocobacilar, pleomórfica que fue aislada de parvadas de pavos y pollos parrilleros en muchos países del mundo y de América Latina como México, Brasil y Perú. Las aves afectadas con ORT presentan signología respiratoria, acompañada con un incremento en la mortalidad y disminución en la ganancia de peso. Pollos parrilleros con signos respiratorios fueron enviados desde una granja ubicada en la Provincia de Buenos Aires, Argent...

  16. Mediciones in situ del aislamiento acústico al ruido aéreo y de impacto entre locales superpuestos.

    OpenAIRE

    Díaz Sanchidrián, César; Pedrero González, Antonio

    2001-01-01

    Se muestran los resultados de las mediciones in situ del aislamiento a ruido aéreo y del aislamiento acústico de suelos al ruido de impactos entre varias decenas de locales superpuestos, mediante aplicación de las Normas UNE-EN ISO 140-4: Medición in situ del aislamiento a ruido aéreo entre locales y UNE-EN ISO 140-7: Medición in situ del aislamiento acústico de suelos al ruido de impactos. Las magnitudes globales del aislamiento a ruido aéreo y a ruido de impactos se han obtenido por dos pro...

  17. Identificación por PCR-SSCP de genes de cefotaximasas en aislamientos hospitalarios de Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    José Ramón Mantilla Anaya

    2009-10-01

    Full Text Available Las cefotaximasas (CTX-M son las beta-lactamasas de espectro extendido más ampliamente diseminadas entre especies de la familia Enterobacteriaceae, y son la causa principal de resistencia en aislamientos causantes de infección intrahospitalaria. El objetivo del presente trabajo fue identificar variantes de cefotaximasas del grupo CTX-M-1 mediante el análisis del polimorfismo conformacional de cadena sencilla (SSCP de frag-mentos de restricción provenientes de los productos de la amplificación por PCR de los genes blaCTX-M. Con el procedimiento PCR-SSCP estandarizado, en este trabajo se analizaron 49 aislamientos de enterobacterias recolectados en 8 hospitales de Bogotá, D.C., adscritos a la Secretaría Distrital de Salud. Se detectaron las variantes CTX-M-12, CTX-M-15, CTX-M-12a, y CTX-M-1 y una nueva variante denominada CTX-M-60. Todas las variantes fueron detectadas tanto en aislamientos intrahospitalarios como de la comunidad, lo que indica posible movilidad de estos genes desde y hacia los centros hospitalarios. Esta publicación constituye el primer reporte en Colombia de la variante CTXM-12a y la nueva variante evolutiva CTX-M-60. Palabras clave: resistencia microbiana; cefotaximasas (CTX-M; polimorfismo conformacional de cadena sencilla (SSCP; beta-lactamasas de espectro extendido (BLEE; infección hospitalaria. Abstract CTX-M cefotaximases are the most widely distributed extended-spectrum beta-lactamases among Enterobacteriaceae and they are an important cause of microbial resistance in nosocomial infection-causing isolates. The object of this work was to identify group 1 CTX-M cefotaximase variants from PCR amplified blaCTX-M genes by single-stranded conformational polymorphism of restriction fragments (RF-SSCP. We analysed 49 Enterobacteria isolates using the RF-SSCP procedure standardised in this work; isolates were collected from eight hospitals attached to the Bogota Health Secretariat (Secretaría Distrital de Salud. CTX-M-12

  18. AISLAMIENTO Y CARACTERIZACIÓN DE CEPAS DE Gluconacetobacter diazotrophicus

    Directory of Open Access Journals (Sweden)

    Yoania Ríos Rocafull

    2016-01-01

    Full Text Available Gluconacetobacter diazotrophicus es un microorganismo endófito que presenta, dentro de sus características, mecanismos directos e indirectos de estimulación del crecimiento vegetal. A pesar de sus grandes perspectivas para constituir el principio activo de un bioproducto de uso agrícola, en Cuba no existe ninguno elaborado a partir de esta especie bacteriana. El aislamiento de cepas del microorganismo y su caracterización constituyen pasos importantes para la obtención de un biopreparado, pues permiten la selección inicial de cepas que tengan características adecuadas para la estimulación del crecimiento. En la presente investigación se purificaron 85 aislados de microorganismos endófitos, a partir de los diferentes órganos de 24 especies vegetales. Cuatro de ellos fueron identificados como Gluconacetobacter diazotrophicus, al comparar sus características con las de cepas patrones de la especie bacteriana. Los microorganismos seleccionados provenían de frutos de guayaba (Psidium guajava L. y mango (Mangifera indica L., así como de tallos de yuca (Manihot esculenta Crantz. y remolacha (Beta vulgaris L.. Se destacó la presencia del microorganismo en los dos primeros cultivos para Cuba y el aislamiento en la guayaba a nivel internacional. Las cuatro cepas mostraron diferencias en su capacidad de solubilizar fósforo, producir ácido indol acético y en su actividad antagonista frente a Fusarium moniliforme y Fusarium incarnatum. Al agruparse las cepas por sus características, se diferenciaron los microorganismos provenientes de mango y remolacha, los que se consideran promisorios para realizar estudios en condiciones in vivo del efecto de su interacción con otros cultivos.

  19. Compatibilidad fisiológica y sensibilidad a fungicidas de aislamientos de phytophthora capsici Leo

    OpenAIRE

    Luis Pérez Moreno; Luisa Josefina Durán Ortiz; Rafael Ramírez Malagón; Jesús Ricardo Sánchez Pale; Víctor Olalde Portugal

    2003-01-01

    Para determinar el grupo de compatibilidad y sensibilidad a fungicidas de aislamientos de Phytophthora capsici presentes en el estado de Guanajuato, México, en 1999 se colectaron raíces de chile infectadas por este patógeno en cuatro localidades de los municipios de Salvatierra y Silao. De este material se obtuvieron ocho aislamientos, los cuales se cultivaron en medio de jugo de tomate-agar para la producción de oosporas, y en harina de maíz agar para la producción de esporangios. Del total ...

  20. Caracterización de integrones de clase I en aislamientos hospitalarios de acinetobacter baumannii

    OpenAIRE

    Gáfaro Montejo, Alexis

    2012-01-01

    Se analizaron 129 aislamientos de Acinetobacter baumannii obtenidos de hospitales colombianos de tercer nivel con el objetivo de detectar y caracterizar integrones de tipo I (elementos genéticos importantes por la capacidad de adquirir determinantes genéticos de resistencia a los antibióticos) y su relación con el fenotipo de resistencia antibiótica. De los aislamientos estudiados el 24% fueron positivos para la presencia del integrón de tipo I. La caracterización de estos últimos demostró...

  1. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  2. Primer informe sobre el aislamiento de Helicobacter pylori asociado a enfermedades digestivas en Ciudad de La Habana

    OpenAIRE

    Beatriz Gutiérrez; Teresita Vidal; Carlos E. Valmaña; Nancy Santiesteban.; Nery González; Ibrahim Leonard; Julián Ruiz; Osvaldo Díaz-Canel; Rolando Martínez; María del Pilar Escobar; Bienvenido Grá; Enrique Galbán; Miguel González; Gustavo Sierra

    2001-01-01

    La infección por Helicobacter pylori desempeña un papel fundamental en el desarrollo de diversas enfermedades digestivas. Actualmente se acepta que este microorganismo está relacionado con la gastritis crónica activa, la úlcera péptica (tanto gástrica como duodenal), el adenocarcinoma gástrico y el linfoma gástrico de células B del tejido linfoide asociado a mucosa (Linfoma MALT). Se estudiaron 121 pacientes, 53 con diagnóstico endoscópico de gastritis, 21 con úlcera péptica, 20 úlceras duode...

  3. Migración irregular y aislamiento social. Los jornaleros tamaulipecos indocumentados en los Estados Unidos

    Directory of Open Access Journals (Sweden)

    Izcara-Palacios, Simón Pedro

    2010-08-01

    Full Text Available “Social isolation” is a concept poorly developed in the analysis of poverty. “Social exclusion” and “marginality” are concepts more frequently used. “Social isolation” refers to an erosion of the relational sphere of the individual (i.e.: it is a lack of familial support and/or social networks, and an absence of social activity and recreational interaction. Moreover, “social isolation” is associated with anxiety and depression symptoms. This paper analyses the situation of “social isolation” of Tamaulipas’ undocumented farm workers employed in the United Stated.

    El concepto de “aislamiento social” ha sido insuficientemente utilizado en el análisis de la pobreza. “Exclusión social” y “marginalidad” son dos conceptos más desarrollados. El “aislamiento social” hace referencia a una erosión de las esferas relacionales del individuo (esto es, a una falta de soporte familiar y/o redes sociales, y a una ausencia de actividad social e interacción recreacional. Más aún, el “aislamiento social” está asociado a síntomas de ansiedad y depresión. Este artículo analiza la situación de aislamiento social de los jornaleros indocumentados tamaulipecos empleados en los Estados Unidos.

  4. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  5. Primer on Social Economics.

    Science.gov (United States)

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  6. Aislamiento acústico a ruido aéreo en techos con materiales ecológicos

    OpenAIRE

    Martínez de Adrianza, Ede Coromoto

    2015-01-01

    El incremento de la contaminación acústica se ha convertido en un problema medioambiental lo cual ha generado un aumento en la demanda del aislamiento de los edificios para lograr el confort acústico. Existen métodos de medición de aislamiento acústico a ruido aéreo de fachadas bajo ensayo “in situ” pero no para techos. El objetivo de esta investigación consiste en determinar el aislamiento acústico de prototipos de techos ecológicos multicapas adaptando la metodología recomendada por normas...

  7. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  8. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  9. Resistencia a antimicrobianos en aislamientos de Escherichia coli de origen animal Antimicrobial resistance of Escherichia coli isolated from animals

    OpenAIRE

    G. Carloni; De Pereyra, A.; Denamiel, G.; Gentilini, E.

    2011-01-01

    Se determinó el perfil de susceptibilidad a antimicrobianos de 100 aislamientos de E.coli provenientes de diversas patologías en bovinos, equinos, caninos y felinos, siguiendo metodología del Clinical and Laboratory Standards Institute y detectando la aparición de aislamientos multiresistentes. El panel de antibióticos ensayados incluyó amicacina, ampicilina/sulbactama, cefotaxima, ciprofloxacina, cloranfenicol, colistina, estreptomicina, gentamicina, nitrofurantoína, tetraciclina, trimetopri...

  10. Control biológico del marchitamiento vascular del clavel miniatura ocasionado por fusarium oxysporum f. sp. dianthi con aislamientos no patógenos de fusarium oxysporum

    OpenAIRE

    Rodríguez, Juan Carlos; Rodríguez, Pedro; Arbeláez, Germán

    2011-01-01

    Tres aislamientos no patogénicos de Fusarium oxysporum se evaluaron en su antagonismo a Fusarium oxysporum f. sp.dianthi en dos variedades de clavel miniatura, bajo condiciones de invernadero. Los tres aislamientos antagonistas ocasionaron diferentes niveles de control de la enfermedad, pero todos presentaron alguna patogenicidad en las dos variedades declavel inoculadas. La aplicación al suelo del aislamiento C14 de F. oxysporum un mes antes de la siembra y a los esquejesinmediatamente antes...

  11. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  12. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  13. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  14. Solarium primer. [Monograph

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    Solaria can be used to collect solar energy for space heating and provide an open environment. This primer introduces the basic concepts of an energy-efficient solarium and provides information on the practical aspects of siting, design, and construction. The horticultural use of a solarium as a greenhouse is not dealt with except in explaining the influence this may have on its design and operation. The book shows the characteristics of different types of solaria, their advantages as well as their limitations. It also explains the prerequisite of a successful addition to an existing home. Design and construction details accompany the text. 73 references, 2 tables.

  15. Aislamiento y caracterización de bacterias quitinolíticas ruminales

    OpenAIRE

    Piloni Martini, Javier

    2012-01-01

    Los principales objetivos del presente estudio fueron aislar y seleccionar bacterias ruminales quitinolíticas con alta capacidad para degradar quitina pura y caparazón de camarón in vitro, e identificar genéticamente a las bacterias seleccionadas usando secuencias de su gen 16S rARN amplificado mediante PCR. El aislamiento de las bacterias ruminales se inicio con un cultivo mixto liofilizado de bacterias quitinolíticas (CMBQ) obtenido de borregos alimentados con una dieta con 25% de caparazón...

  16. Aislamiento y reciblaje para reducir el consumo energético de las viviendas en Andalucia.

    OpenAIRE

    Marrero Meléndez, Madelyn Rosa

    2011-01-01

    Se han realizado dentro del proyecto de investigación Aislamiento y Reciclaje para Reducir el Consumo Energético de las Viviendas en Andalucía (ARCEVA) diversos trabajos relacionados con la solución de fachadas. Se identifican cuatro trabajos principales: desarrollo de materiales de construcción reciclados que incluyen paneles de yeso y placas de hormigón, evaluación del consumo energético de las nuevas fachadas y finalmente evaluación de los impactos, técnico, ambiental, económico y social, ...

  17. Efectos del aislamiento en la adultez sobre el dolor y la frustración

    OpenAIRE

    Giselle Kamenetzky; Alba Mustaca; Sandro Fosacheca; Lucas Cuenya

    2011-01-01

    Los animales que viven aislados en la adultez presentan indicadores conductuales de estrés crónico, ansiedad e hipoalgesia. Si bien existe una amplia gama de tratamientos que evidencian las relaciones entre la frustración, el dolor y la ansiedad, pocos trabajos estudiaron el efecto que podría tener el aislamiento en la adultez sobre las respuestas de los animales ante la devaluación de incentivos. Se evaluaron ratas aisladas (Aislados) y agrupadas (Agrupados) a partir de los 60 días de edad e...

  18. Caracterización de aislamientos atípicos de Candida dubliniensis

    OpenAIRE

    Albaina Bacaicoa, Olatz

    2014-01-01

    241 p. : il., gráf Las especies del género Candida son hongos oportunistas que viven en equilibrio con el huésped. A veces, factores tanto endógenos como exógenos alteran este equilibrio y permiten su conversión en especies patógenas, favoreciendo de este modo la infección en humanos. Candida dubliniensis, es una especie identificada recientemente cuya patogénesis se asocia principalmente con la candidiasis oral en pacientes con VIH. El aumento del número de aislamientos clínicos de C. dub...

  19. Patogenicidad de cuatro aislamientos mexicanos Sclerotium cepivorum Berk. En tres cultivares de ajo (Allium sativum L.)

    OpenAIRE

    Jesús Ricardo Sánchez Pale; Emma Zavaleta Mejía; Gustavo Mora Aguilera; Luis Pérez Moreno

    2002-01-01

    Cuatro aislamientos de S. cepivorum obtenidos de cuatro regiones productoras de ajo en el Centro Norte de México (San Juan de Acozac, Pue., Calera de Rosales, Zac., Salamanca, Gto., y San Miguel de Allende, Gto.), fueron inoculados en los genotipos de ajo Chileno Santa Martha, Pocitas-0 y Pocitas 750-4. Hubo diferencias significativas en la intensidad y tasas de avance de la enfermedad, así como en la supervivencia del inóculo en el suelo y en su habilidad para macerar tejidos, indicando una ...

  20. Aislamiento y caracterización de micromicetos biodegradadores de polietileno

    OpenAIRE

    Carmen R. Méndez; Germán Vergaray; Vilma R. Béjar; Karina J. Cárdenas

    2013-01-01

    La biodegradación del polietileno por microorganismos es una solución para la reducción de la contaminación por plásticos. En el presente trabajo se muestran los resultados del aislamiento y caracterización de cepas de hongos capaces de degradar el polietileno, así como la determinación de las condiciones de pH y temperatura en las que se logran la mayor actividad. Los hongos fueron aislados de productos elaborados con polietileno obtenidos de relleno sanitario, la identificación taxonómica e...

  1. Detección y aislamiento de fallas en el sistema térmico IFATIS

    OpenAIRE

    Salvador Saucedo-Flores; Efraín Alcorta-García

    2011-01-01

    Se resuelve el problema de detección y aislamiento de fallas para una planta piloto no lineal, orientada a desarrollar algoritmos de tolerancia a las fallas, auspiciada por la Unión Europea. Se retoma una forma novedosa de modelar las fa- llas de los sensores, de manera que cada falla física sea aso- ciada a un conjunto adecuado de fallas matemáticas. Ello permite, mediante geometría diferencial, diseñar un FDI no lineal ligeramente extendido para tomar en cuenta la estruc- tura del sistema. ...

  2. Aislamiento de Escherichia coli K88 en diarreas de cerdos y niños

    OpenAIRE

    Manzullo, Alfredo; Borsella, Maria Graciela

    1985-01-01

    En los últimos años, en los países menos desarrollados, han aparecido brotes, cada vez con mayor frecuencia, de diarreas infantiles, considerados por algunos autores, como uno de los problemas sanitarios más complejos por su diversidad etiológica, hecho este, que puede provocar repetidos episodios diarreicos en el mismo grupo poblacional sensible, generalmente en los primeros dos años de vida. La presente comunicación, tiene por objeto relatar el aislamiento de Escherichia coli enterotóxica (...

  3. Streptococcus pneumoniae: vigilancia molecular de aislamientos invasivos resistentes a penicilina recuperados de julio 2003 a junio 2004 en Colombia

    Directory of Open Access Journals (Sweden)

    Moreno Jaime

    2005-07-01

    Full Text Available Las infecciones neumocócicas afectan principalmente a niños y ancianos. Además, por el incremento de aislamientos resistentes a penicilina, S. pneumoniae es considerado como uno de los principales problemas de salud pública. El objetivo fue determinar las relaciones genéticas de los aislamientos
    invasores de S. pneumoniae con susceptibilidad disminuida a penicilina (SDP recuperados de julio-2003 a junio-2004. Se estudiaron 66 aislamientos utilizando la técnica de electroforesis de campo pulsado (PFGE, los patrones electroforéticos se compararon según los criterios de
    Tenover y se analizaron con el programa Fingerprinting TMII 3.0. En 12 aislamientos se identificaron los perfiles PBP, con la técnica del polimorfismo en la longitud de los fragmentos de restricción (RFLP de los genes pbp 2b, 2x y 1a, los cuales se interpretaron según lo establecido por el laboratorio. Las relaciones entre los grupos clonales y las características demográficas de los pacientes se analizaron con los programas EpiInfo 6.04 y MVSP 3.1. La mayoría de los aislamientos (71%
    presentaron el patrón PFGE B relacionado con el clon 3-España9V, seguido por los patrones C (6% agrupado con el clon 26-Colombia23F, D (4% con el clon 2-España6B y A (2% con el clon 1-España23F, los aislamientos restantes se distribuyeron en diez patrones no relacionados con clones internacionales. En los aislamientos relacionados con los clones 1, 2, y 26 se identificó el mismo perfil PBP del clon y los relacionados con el clon 3 presentaron una variante del perfil
    PBP del clon 3. En Colombia la prevalencia de aislamientos invasores resistentes a penicilina se debe a la circulación de los clones internacionales 1-España23F, 2-España6B, 3-España9V y
    26-Colombia23F.

  4. Aislamiento a ruido aéreo entre locales: estimación de la incertidumbre de medida

    OpenAIRE

    Pendán Rebollo, Borja

    2011-01-01

    Este documento trata de analizar la incertidumbre de medida asociada a la realización de un ensayo de aislamiento acústico a ruido aéreo entre locales. Para ello, se calcula la incertidumbre de medida que introduce cada una de las diferentes magnitudes medibles que definen los distintos índices de valoración de aislamiento a ruido aéreo entre locales. Previamente, se define el concepto conocido como incertidumbre de medida en líneas generales y se ilustra un ejemplo sencillo para que el lecto...

  5. AISLAMIENTO Y CARACTERIZACIÓN DE RIZOBIOS DE Crotalariasp. EN EL SUR DE ECUADOR

    Directory of Open Access Journals (Sweden)

    Francisco Guamán Díaz

    2016-01-01

    Full Text Available La presente investigación tuvo como objetivos aislar y caracterizar cepas nativas de bacterias diazotróficas y evaluar su efecto en la nodulación y el crecimiento de Crotalaria sp. Para el aislamiento se tomaron muestras de plantas de Crotalaria con presencia de nódulos en sus raíces, en diferentes condiciones agroclimáticas de la provincia de Loja, Ecuador. Se realizó una caracterización morfo-cultural, bioquímica y fisiológica de los aislados y se evaluó el efecto de cada uno de los aislados sobre las variables de nodulación, crecimiento y biomasa de Crotalaria en condiciones de invernadero. De los aislamientos realizados se obtuvieron 10 cepas con características correspondientes al orden Rhizobiales. Todos los aislados evidenciaron la capacidad de nodular la planta hospedante. Se destacaron los resultados en tres de los aislados por su mayor capacidad de nodulación y eficiencia en la inoculación de las plantas. Estos resultados constituyen un punto de partida en la obtención de inoculantes y su posible efecto sobre plantas de Crotalaria, utilizadas como fijadoras de N2 en condiciones de campo.

  6. AISLAMIENTO DE Bacillus SOLUBILIZADORES DE FOSFATOS ASOCIADOS AL CULTIVO DEL ARROZ

    Directory of Open Access Journals (Sweden)

    Berto Tejera-Hern\\u00E1ndez

    2013-01-01

    Full Text Available El objetivo de este trabajo fue determinar la capacidad de bacterias del género Bacillus pro- venientes del cultivo del arroz (Oryza sativa L. en solubilizar fosfatos. Los aislamientos se obtuvieron utilizando el modelo Microcosmos de los cultivares Iacuba 30 y Perla, en el año 2008 en Bauta, La Habana, Cuba. Hubo 58 aislados, tanto rizosféricos como endófitos de la raíz y de la parte aérea, que presentaban características distintivas del género Bacillus, como respuesta positiva a la tinción de Gram, forma bacilar y formación de endospora. Se realizó la detección cualitativa en cuanto a la capacidad de solubilización de fosfatos. Solo 19 aislamientos mostraron solubilización en medio sólido NBRIP y en algunos casos cambiaron la coloración del medio de azul a amarillo, lo que indica la producción de ácidos. Se seleccionaron los positivos para la cuantificación en medio líquido. Las cepas mostraron un comportamiento diferente cuando se midió el fosfato solubilizado a distintos tiempos, variando el máximo de solubilización.

  7. Caracterización molecular de un aislamiento cubano de parvovirus canino

    Directory of Open Access Journals (Sweden)

    Anniet Fresneda-Disotuar

    2015-12-01

    Full Text Available El parvovirus canino tipo 2 (VPC-2 es el agente causal de una enfermedad infecto-contagiosa que produce gastroenteritis aguda hemorrágica que afecta a caninos jóvenes. El VPC-2 es un virus con genoma ADN, pequeño, desnudo y muy resistente a las condiciones ambientales que emergió y se expandió rápidamente a fines de la década de los años 70. En los años 80 surgieron consecutivamente dos variantes antigénicas, denominadas VPC-2a y VPC-2b. En el 2000 se detectó una nueva variante antigénica llamada VPC-2c, reportándose con frecuencia en comunidades caninas de varios países del mundo. El objetivo de este trabajo consistió en caracterizar un aislamiento cubano de parvovirus canino, atenuado y adaptado a cultivo celular. El material genético fue amplificado por reacción en cadena de la polimerasa y secuenciado posteriormente. Las secuencias obtenidas fueron analizadas y comparadas con secuencias de aislados y cepas conocidas depositadas en las bases de datos, donde se evidenció que el aislamiento cubano era del tipo VPC-2.

  8. Nuevo método para el aislamiento y la cuantificación de insectos del orden Collembola

    Directory of Open Access Journals (Sweden)

    Kalyanne Fernández

    2000-01-01

    significativamente el tiempo de aislamiento de los individuos (cinco minutos vs cinco días, sino también porque permite cuantificar mayor cantidad de éstos, inclusive vivos y por tanto con mayor calidad biológica

  9. Melioidosis en Costa Rica: Reporte del primer caso

    Directory of Open Access Journals (Sweden)

    Alfredo Messino Julio

    2000-09-01

    Full Text Available Melioidosis es una enfennedad infecciosa causada por la Burkholderia pseudomallef. Esta enfermedad es endémica en áreas tropicales de Asia y Australia y ha habido reportes aislados en Centro y Sur América. Aquí nosotros informamos del primer caso probado de melioidosis en Costa Rica, correspondiendo a un paciente sin historia de viajes a lugares endémicos. El paciente consultó por una bronconeumonía de adquisición comunitaria y sepsis. El hecho que el aislamiento bacteriano sea tan inusual en nuestro país implicó un retraso subsecuente en el inicio del tratamiento antibiótico específico en este caso, lo cual pudo influir en la evolución tan tórpida del paciente. Esto nos plantea el interrogante de si esta enfermedad debe ser incluida en el diagnóstico diferencial de sepsis de adquisición comunitaria en nuestro país.Melioidosis in an infectious disease caused by Burkholderia pseudomallei. This disease is endemie in areas of tropical Asia and Australia; there have been isolated reports of the disease in Central and South America. Here we report the first documented case of Melioidosis in Costa Rica in a patient without a history of traveling lo endemic areas. The patient was seen at the hospital because of sepsis and a community acquired bronchopneumonia. Due lo the rareness of this bacterial isolation in our country the corroboration of the diagnosis was delayed and subsequently the specific antibiotics were started 5 days later after the admission, this could have influenced the torpid evolution the patient had. This case should alert us and points lo the need of including this rare disease in the differential diagnosis of community acquired sepsis in our country.

  10. Primer caso de detección de blaKpc en Chile: desde Italia a un hospital público de Santiago First isolation of kpc in Chile: from Italy to a public hospital in Santiago

    OpenAIRE

    Marcela Cifuentes; Patricia García; Paola San Martín; Francisco Silva; Jennifer Zúñiga; Sergio Reyes; Rodrigo Rojas; Rodrigo Ponce; Raúl Quintanilla; Luis Delpiano; Marcelo Wolff

    2012-01-01

    La resistencia a carbapenémicos en enterobacterias es un fenómeno emergente en el mundo. Entre los mecanismos implicados se encuentra la producción de BLEE o AmpC asociados a alteraciones de las porinas o la presencia de carbapenemasas. Entre éstas, las de tipo KPC han cobrado especial relevancia dada su rápida diseminación. Se presenta el primer caso de aislamiento de una cepa de Klebsiella pneumoniae productora de KPC en un hospital de Santiago- Región Metropolitana, en un paciente traslada...

  11. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  12. Diversidad genética de aislamientos de Phytophthora infestans en plantaciones de papa en Costa Rica con el uso de RAPDs

    OpenAIRE

    Oswaldo P\\u00E1ez; Roberto Valverde; Luis G\\u00F3mez; Arturo Brenes

    2005-01-01

    Para determinar la diversidad genética de Phytophthora infestans en Costa Rica, 62 aislamientos de este patógeno fueron recolectados en plantaciones de papa en las zonas de Cartago, Zarcero, Fraijanes y Heredia durante 1999-2001 y analizados con el uso de RAPDs. Todos los aislamientos fueron previamente evaluados para el tipo de apareamiento y la resistencia al metalaxyl. Se seleccionó 11 imprimadores con los cuales fue posible formar 17 grupos RAPD cuyas frecuen...

  13. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads;

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  14. A Primer on Multilevel Modeling

    Science.gov (United States)

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  15. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  16. A classical primer for QCD

    International Nuclear Information System (INIS)

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  17. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  18. La situación sociolaboral de los migrantes internacionales en la agricultura: irregularidad laboral y aislamiento social

    Directory of Open Access Journals (Sweden)

    Simón Pedro Izcara Palacios

    2009-01-01

    Full Text Available Los jornaleros inmigrantes constituyen uno de los grupos sociales más pobres de las comarcas agrarias de Estados Unidos y España. Los trabajadores agrarios migratorios viven en áreas remotas y sufren de malnutrición, salarios bajos, alta movilidad laboral, condiciones laborales precarias y ambientes laborales inadecuados. Por una parte, el sector agrario, que constituye un refugio laboral para los trabajadores ilegales, opera fuera del mercado laboral formal; por otra parte, los jornaleros padecen un grave problema de "aislamiento social", esto ha sido señalado como una de las principales causas de falta de bienestar de éstos. El artículo analiza, de modo comparativo, la situación de irregularidad laboral y aislamiento social de los jornaleros tamaulipecos empleados en la agricultura estadounidense y los trabajadores marroquíes empleados en el sector agrario andaluz.

  19. Biological characterization of Citrus tristeza virus strains in lemon in Tucumán, Argentina Caracterización biológica de aislamientos del virus de la tristeza de los cítricos de limoneros en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Julia Figueroa

    Full Text Available Tucumán province is the largest lemon producer in the world, with a production of 1.3 million tons. Unfotunality, tristeza disease has been present in Argentina since 1930 and is endemic. Citrus tristeza virus isolates from the main lemon varieties in Tucumán province were biologically characterized on the basis of vein clearing, vein corking, leaf cupping, stunting, stem pitting and other symptoms using standard indicator plants. The lemon varieties were: Frost Eureka, Frost Lisbon, Limoneira 8A and Genoa EEAT. The indicator plants used were Mexican lime, Eureka lemon, Duncan grapefruit, Pineapple sweet orange and sour orange seedlings, plus Ruby Blood sweet orange budded on sour orange rootstock. Symptoms on each of the indicator plants were rated from 0 (no reaction to 5 (most severe. A total rating for each isolate was obtained by summing the ratings on each indicator plant. Differences among lemon isolates were observed. Genoa isolate induced least growth while Limoneira isolate induced the most severe stem pitting. Little difference was observed between Eureka and Lisbon isolate.La Argentina es el primer país productor de limón en el mundo y la provincia de Tucumán lidera esta producción con 1,3 millones de toneladas. Desafortunadamente la tristeza de los cítricos es una enfermedad endémica en la Argentina desde 1930. En el presente trabajo se informa sobre la caracterización biológica realizada a distintos aislamientos del virus de la tristeza de los cítricos de las principales variedades comerciales de limoneros. Las variedades de limoneros estudiadas fueron: Eureka Frost, Lisboa Frost, Lisboa Limoneira 8 A y Génova EEAT. La caracterización se realizó en las plantas indicadoras estándares para este tipo de pruebas y fueron: plantines de lima mexicana, limón Eureka, pomelo Duncan, naranjo dulce Pineapple y naranjo agrio; y plantas injertadas de naranjo dulce Ruby Blood en naranjo agrio. Los principales síntomas evaluados

  20. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE Herpesvirus bovino TIPO 1

    Directory of Open Access Journals (Sweden)

    Vera V.

    2005-11-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  1. Aislamiento en pacientes psiquiátricos Seclusion of psychiatric patients

    Directory of Open Access Journals (Sweden)

    Franklin Escobar Córdoba

    2009-01-01

    Full Text Available El objetivo del presente artículo es aportar pautas para la evaluación y tratamiento de pacientes agresivos mediante el uso del aislamiento. A esos efectos, se realizó una revisión narrativa de la literatura, basada en la búsqueda mediante la combinación de las palabras "seclusion" y/o "patient seclusion" y/o "Restraint, Physical" y/o "Mentally Ill Persons", en las bases de datos MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED y Latindex. Se seleccionaron 12 de 8.418 artículos de mayor relevancia para su aplicación en nuestro medio, teniendo como límites de la búsqueda revisiones, metanálisis, estudios controlados aleatorizados y estudios clínicos, adultos, ambos géneros, humanos, idioma inglés y español, de los años 2002 a 2007. Se halló un conocimiento amplio en el tratamiento del paciente agresivo. Las indicaciones del aislamiento no difieren con respecto a las de restricción, siendo importantes los riesgos de hetero o autoagresividad y de daño al entorno físico. Las contraindicaciones y consideraciones éticas, médicas y legales son claras y se deben implementar para una adecuada práctica clínica. El uso adecuado del aislamiento por parte del personal de salud debe formar parte de un plan terapéutico adecuado y tener en cuenta las recomendaciones para su uso en el contexto local.The objective of the present study is to contribute rules for the evaluation and treatment of an aggressive patient by means of seclusion. We searched the literature in the MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED and Latindex databases, using the combination of the following words: "seclusion" and/or "patient seclusion" and/or "restraint, physical" and/or "mentally ill persons". Twelve out of 8,418 articles were selected for their application in Colombia according to the following limits of the search: clinical trial, meta-analysis, randomized controlled trial, review of the literature, adults, both genders, published between 2002 and

  2. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  3. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    Science.gov (United States)

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  4. Selección de aislamientos de Trichoderma spp. con potencial biocontrolador de Rhizoctonia solani Kühn en papa bajo condiciones de casa de malla

    Directory of Open Access Journals (Sweden)

    Garcés de Granada Emira

    2005-07-01

    Full Text Available El hongo fitopatógeno Rhizoctonia solani afecta raíces, tallos y tubérculos de papa, logrando reducir los rendimientos del cultivo hasta en un 50%. Con el propósito de ofrecer una alternativa biológica para el manejo de este problema, se evaluaron diez cepas nativas del hongo biocontrolador
    Trichoderma spp. Inicialmente se evaluó la actividad patogénica de dos aislamientos de R. solani (Rh005 y Rh006 inoculando suelo en proporciones del 2,5 y 10% peso a peso (p/p donde posteriormente fueron transplantadas plántulas de papa producidas in vitro, encontrando con ambos aislamientos 100% de incidencia de la enfermedad. Sin embargo, fue seleccionado el aislamiento Rh005 ya que presentó mayor porcentaje de daño expresado como volcamiento de las plantas. Como prueba preliminar de antagonismo, en recipientes con suelo se enterraron bolsas de muselina que contenían esclerocios de este último aislamiento y se trataron
    individualmente con suspensiones de los diferentes  aislamientos de Trichoderma spp.ajustadas a una concentración de 107conidios.ml-1, estableciéndose que los aislamientos de Trichoderma Th002, Th003, Th007, Th034 y Th181 parasitaron y degradaron más del 50% de los esclerocios. En el ensayo de protección al evaluar estos últimos aislamientos en casa de malla en donde se inoculó suelo con Rh005 (2% p/p se seleccionaron los aislamientos Th003 y Th034 por presentar diferencias con respecto a mayores pesos de biomasa fresca y seca en comparación con los restantes biocontroladores y los tratamientos químico, patógeno y testigo. Aunque no se logró disminuir la incidencia de la enfermedad, los aislamientos de Trichoderma seleccionados permitieron reducir el daño en las plantas observando mayor vigor, tallos normales con abundante follaje y mejor crecimiento radical.

  5. Aislamiento e identificación de una cepa de levadura con efecto killer

    Directory of Open Access Journals (Sweden)

    Xiomara Alvarez

    2007-01-01

    Full Text Available La Colección de Microorganismos ICIDCA brinda, entre otros, servicios de aislamiento, identificación y guardería de cepas de interés industrial. La carencia de sistemas de enfriamientos en la mayoría de las destilerías cubanas y las elevadas temperaturas impuestas por nuestro clima tropical, aumentan el interés por la utilización de cepas de naturaleza termófila, de mayor viabilidad bajo estas condiciones. Se aisló, a partir de un cultivo de cachaza a 50 °C, una cepa de levadura termófila identificada como Saccharomyces cerevisiae la cual fue nombrada XI. Se realizaron corridas, a escala de banco, para la producción de etanol a partir de miel clarificada con la cepa aislada. Se obtuvieron valores de 5.4 y 5.0 % de etanol, rendimientos del 43.5 y 42 % y eficiencia de 67.4 y 65.0 %, a 37 y 40 °C respectivamente. Estos resultados se comparan con los reportados por nuestras destilerías. Otro aspecto importante que presenta esta cepa es el carácter killer, factor que puede ser de interés en la fermentación alcohólica ya que impediría el desarrollo de microorganismos no deseados en dicho proceso.

  6. Estudio sobre las relaciones filogenéticas entre diversos aislamientos del hongo Paracoccidioides brasiliensis

    Directory of Open Access Journals (Sweden)

    Juan McEwen

    2003-01-01

    Full Text Available Aunque es poco lo que se conoce acerca de la biología evolutiva
    del hongo P. brasiliensis, varios estudios moleculares han demostrado que existen variaciones en secuencias de ADN entre sus aislamientos, las que se correlacionan con el origen geográfico de las mismas y con diferencias en su virulencia para modelos murinos (1,2. Se desconoce si estas variaciones son el resultado final de un proceso de especiación alopátrica que daría origen a especies aisladas genéticamente provistas de características fenotípicas (patogenicidad, inmunogenicidad y genotípicas diferentes, las que podrían ser usadas como una alternativa para mejorar e innovar los métodos actuales de diagnóstico. Por lo tanto, proponemos como objetivo general estudiar un aspecto fundamental de la biología evolutiva del hongo patógeno humano P. brasiliensis como es la especiación.

  7. Aislamiento de algas del embalse del Neusa por medio de cultivos In Vitro

    Directory of Open Access Journals (Sweden)

    Moreno E.

    2000-12-01

    Full Text Available

    EI cultivo de algas a nivel mundial es un oficio de vieja data, pero en Colombia se encuentra en sus primeras etapas de desarrollo. El presente trabajo desarrollado en el Laboratorio de Bioensayos, Departamento de Biología, Universidad Nacional de Colombia está encaminado a aportar técnicas en el desarrollo del cultivo de algas. En la parte practica del trabajo se utilizaron muestras de agua del embalse del Neusa las cuales se cultivaron en medios líquido y solido. Se observo un mejor crecimiento de cianofíceas filamentosas en medio solido y algas verdes en medio líquido. Las clamidomonas se ven favorecidas en ambos medios, hecho que permitió aislar una sepa pura de este tipo de algas. Las diatorneas por el hecho de crecer en relación con algas verdes generan un problema metodológico para su aislamiento, que aun se encuentra sin resolver.

  8. Loop Quantum Geometry: A primer

    CERN Document Server

    Corichi, A

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  9. Sample Return Primer and Handbook

    Science.gov (United States)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  10. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  11. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  12. Loop Quantum Geometry: A primer

    OpenAIRE

    Corichi, Alejandro

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  13. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  14. Algorithms and Software for PCR Primer Design

    OpenAIRE

    Huang, Yu-ting

    2015-01-01

    Polymerase Chain Reaction (PCR) is a widely used technology in molecular bi-ology for DNA amplification. To generate multiple copies of a DNA molecule, a pair ofprimers (two synthesized DNA sequences with a total length of 15-30 bases) are annealedto the boundaries of the targeted DNA molecule. Then, the new replicated DNA fragmentelongates from one primer to the other.Though primers always hybridize to their respective complements within DNAsequences, primer pairs for targeted DNA sequences ...

  15. Brief exegesis on the existing legislation and the application of thermal insulation in the world - proposal for Mexico; Breve exegesis sobre legislacion existente en la aplicacion de aislamientos termicos en el mundo - propuesta para Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)

    1992-12-31

    -economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.

  16. Aislamiento y serotipificación de Salmonella sp. en estanques con Crocodylus intermedius y testudines cautivos en Villavicencio - Colombia

    Directory of Open Access Journals (Sweden)

    Diana Pachón C.

    2011-05-01

    Full Text Available Objetivo. Determinar la presencia de microorganismos del género Salmonella sp. en el ambiente acuático de los ejemplares Crocodylus intermedius y testudines en la Estación de Biología Tropical Roberto Franco (EBTRF. Materiales y métodos. En este estudio se utilizó la metodología estándar para aislar e identificar microorganismos del género Salmonella sp., a partir de muestras de agua y sedimento de 52 estanques (nEstanques Crocodylus=25; nEstanques testudines=27; se procedió a serotipificar los aislamientos por el método convencional de Kaufmann-White y se realizaron pruebas de sensibilidad a antimicrobianos por la técnica de Kirby Bauer. Resultados. Se determinó la presencia de Salmonella sp., en un 33% del total de estanques muestreados. El 29% de los aislamientos de Salmonella sp. serotipificados, correspondió al serogrupo B; los serogrupos C, C1, C2 y D1 presentaron menores porcentajes. Con las pruebas de sensibilidad a antimicrobianos se determinó que el 100% de los aislamientos fueron sensibles a norfloxacina. Conclusiones. La ocurrencia de Salmonella sp., en los estanques de la EBTRF fue del 33%, con la mayor presencia del serogrupo B, donde se encuentran especies con características ampliamente zoonóticas. Con los resultados obtenidos es necesario el seguimiento de las normas de bioseguridad establecidas en la estación para el manejo de las poblaciones allí mantenidas y evitar de esa manera la ocurrencia de cuadros zoonóticos.

  17. El Aislamiento de las Venas Pulmonares como Tratamiento de la Fibrilación Auricular Refractaria

    Directory of Open Access Journals (Sweden)

    Fernando Scazzuso

    2011-12-01

    Full Text Available Introducción. La fibrilación auricular (FA es la arritmia sostenida más común. En pacientes seleccionados, se realiza ablación por catéter a nivel de las venas pulmonares, en donde se genera actividad ectópica que la produce. Se presenta la experiencia en el tratamiento de la FA mediante el aislamiento de venas pulmonares en 152 casos consecutivos. Materiales y métodos. La población estuvo constituida por 152 pacientes (122 hombres, edad promedio de 55.58 años. El 81.9% de la población no presentaba cardiopatía estructural. La forma de presentación fue paroxística en el 65.95% de los casos, con una historia de arritmia de 7 años en promedio, habiendo cumplido tratamiento con 3 fármacos antiarrítmicos diferentes. Se realizó mapeo no fluoroscópico y ablación de la porción antral de cada vena pulmonar, en forma secuencial. Resultados. La tasa de éxito durante el procedimiento fue del 97.87%. Se presentaron 12 complicaciones, 4 de ellas derrame pericárdico; ninguno requirió cirugía correctiva. El seguimiento promedio fue de 18±6 meses. En 24 pacientes se presentó recurrencia de la FA después del tercer mes de seguimiento; es decir, la tasa de éxito global primario a 12 meses fue 84.04%, 88.32 para el grupo sin cardiopatía y del 64.8 para el grupo con cardiopatía. Conclusión. El aislamiento de las venas pulmonares es una modalidad de tratamiento con una aceptable tasa de éxito primario en casos seleccionadosIntroduction. Atrial fibrillation (AF is the most common sustained cardiac arrhythmia. In selected patients, catheter ablation was performed at the sites of the pulmonary veins where ectopic activity triggers AF. Our experience with AF treatment by pulmonary vein isolation in 152 consecutive cases is presented and discussed. Methods. Our population consisted mainly of men (122 of 152 patients, with an average age of 55.6 years. Paroxysmal AF was present in 65.9% of the cases and 81.9% of the population had a

  18. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  19. URPD: a specific product primer design tool

    Science.gov (United States)

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  20. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  1. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  2. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  3. Aislamiento y caracterización de Mycoplasma sp.de pulmones de cerdos provenientes de mataderos

    OpenAIRE

    Copes, Julio; Nievas, Fabián; Cerdá, Raúl Oscar; Perfumo, Carlos J.

    1995-01-01

    Se realizó un estudio microbiológico de 100 pulmones obtenidos al azar provenientes de capones y hembras sin servicio faenados en diferentes mataderos. Estos fueron clasificados macroscópicamente en pulmones con lesiones neumónicas (CLN) (43) y sin lesiones neumónicas (SLN) (57). Las muestras fueron procesadas para realizar el aislamiento y caracterización de microorganismos perteneciente al género Mycoplasma, en particular Mycoplasma hyorhinis y Mycoplasma hyosynoviae. De casos seleccionados...

  4. Ambiente genético del gen blactx-m-12 en aislamientos hospitalarios de klebsiella pneumoniae

    OpenAIRE

    Celis Bustos, Yamile Adriana; Pulido Manrique, Ingrid Yamile; Valenzuela de Silva, Emilia María; Reguero Reza, María Teresa; Mantilla Anaya, José Ramón

    2009-01-01

    The blaCTX-M-12 gene’s genetic environmnt in Klebsiella pneumoniae hospital isolates Resumen: En Colombia se han detectado genes del grupo CTX-M-1 con alta frecuencia en aislamientos de Klebsiella pneumoniae causantes de infección intrahospitalaria. El conocimiento de los factores genéticos que pueden favorecer la diseminación de estos genes entre especies bacterianas es un aspecto importante para el control de la resistencia. En este estudio se identificaron los plásmidos portadores del ge...

  5. Ambiente genético del Gen blaCTX-M-12 en aislamientos hospitalarios de Klebsiella pneumoniae

    OpenAIRE

    Yamile Adriana Celis Bustos; Ingrid Yamile Pulido Manrique; Emilia María Valenzuela de Silva; María Teresa Reguero Reza; José Ramón Mantilla Anaya

    2009-01-01

    The blaCTX-M-12 gene’s genetic environmnt in Klebsiella pneumoniae hospital isolates Resumen: En Colombia se han detectado genes del grupo CTX-M-1 con alta frecuencia en aislamientos de Klebsiella pneumoniae causantes de infección intrahospitalaria. El conocimiento de los factores genéticos que pueden favorecer la diseminación de estos genes entre especies bacterianas es un aspecto importante para el control de la resistencia. En este estudio se identificaron los plásmidos portadores del ge...

  6. Resistencia a antimicrobianos en aislamientos de Escherichia coli de origen animal Antimicrobial resistance of Escherichia coli isolated from animals

    Directory of Open Access Journals (Sweden)

    G. Carloni

    2011-12-01

    Full Text Available Se determinó el perfil de susceptibilidad a antimicrobianos de 100 aislamientos de E.coli provenientes de diversas patologías en bovinos, equinos, caninos y felinos, siguiendo metodología del Clinical and Laboratory Standards Institute y detectando la aparición de aislamientos multiresistentes. El panel de antibióticos ensayados incluyó amicacina, ampicilina/sulbactama, cefotaxima, ciprofloxacina, cloranfenicol, colistina, estreptomicina, gentamicina, nitrofurantoína, tetraciclina, trimetoprima/ sulfametoxazol. El mayor porcentaje de resistencia (R se detectó frente a tetraciclina en aislamientos de todas las especies animales (entre 34% en los de origen felino y 75% de origen equino. En las cepas de origen canino y felino se encontraron porcentajes considerables frente ampicilina/ sulbactama (27% de caninos y 53% de felinos y ante ciprofloxacina (30% y 67% respectivamente. En estos aislamientos también, se detectó el mayor porcentaje de multiresistencia (29% en caninos y 67% en felinos. La presión selectiva originada por la aplicación inadecuada de antibióticos puede resultar un factor, aunque no el único, responsable de la aparición de R. Además existe la posibilidad de que E.coli pueda constituirse en un eslabón de transmisión de genes de R a antimicrobianos, aunque no se conoce hasta el momento, el origen de ellos, humano o animal y, su permanencia en el tiempo.Antimicrobial susceptibility tests were determined in 100 isolates of E.coli from differents patologies in cattle, horses, dogs and cats, according to Clinical and Laboratory Standards Institute. Multiresistance isolates were detected in this assay. The antibiotics selected were amikacin, ampicillin /sulbactam, cefotaxime, ciprofloxacin, chloramphenicol, colistin, gentamicin, nitrofurantoin, streptomycin, tetracycline, trimethoprim/sulfamethoxazole. The antibiotic with the highest resistance was tetracycline (34% in cats and 75% in dogs. In isolated strains from dogs

  7. Identificación por PCR-SSCP de genes de cefotaximasas en aislamientos hospitalarios de Enterobacteriaceae

    OpenAIRE

    José Ramón Mantilla Anaya; Emiliano Barreto Hernández; María Teresa Reguero Reza; Daniel Augusto Velandia Rodríguez

    2009-01-01

    Las cefotaximasas (CTX-M) son las beta-lactamasas de espectro extendido más ampliamente diseminadas entre especies de la familia Enterobacteriaceae, y son la causa principal de resistencia en aislamientos causantes de infección intrahospitalaria. El objetivo del presente trabajo fue identificar variantes de cefotaximasas del grupo CTX-M-1 mediante el análisis del polimorfismo conformacional de cadena sencilla (SSCP) de frag-mentos de restricción provenientes de los productos de la amplificaci...

  8. Aislamiento y caracterización de micromicetos biodegradadores de polietileno

    Directory of Open Access Journals (Sweden)

    Carmen R. Méndez

    2013-05-01

    Full Text Available La biodegradación del polietileno por microorganismos es una solución para la reducción de la contaminación por plásticos. En el presente trabajo se muestran los resultados del aislamiento y caracterización de cepas de hongos capaces de degradar el polietileno, así como la determinación de las condiciones de pH y temperatura en las que se logran la mayor actividad. Los hongos fueron aislados de productos elaborados con polietileno obtenidos de relleno sanitario, la identificación taxonómica en base a características macroscópicas del crecimiento en placa petri y el estudio microscópico empleando la técnica de microcultivo en lámina. La actividad biodegradadora se determinó con la técnica de Kavelman y Kendrick, a temperaturas entre 20 y 30 °C y a pH 4,5 – 8,0. Veinte cepas de micromicetos fueron aisladas e identificadas, en 5 (25% se evidencio la capacidad de biodegradar el polietileno a 20 °C, siendo el pH 6,5 el óptimo, la cepa de mayor rendimiento pertenece a la especie de Aspergillus flavus. A temperatura de 30 °C, 6 (30% cepas evidenciaron actividad degradadora, siendo pH 6,5 el óptimo, la cepa de mayor rendimiento fue la misma del caso anterior.

  9. Caracterización de aislamientos de usarium spp. obtenidos de zonas productoras de uchuva (Physalis peruviana) en Cundinamarca y Boyacá

    OpenAIRE

    Rodríguez Velásquez, Edwin Alirio

    2013-01-01

    La marchitez vascular causada por Fusarium sp.es la enfermedad más importante para el cultivo de uchuva, sin embargo la información sobre aspectos taxónomicos y patógenicos es reducida. 25 aislamientos de Fusarium sp fueron obtenidos de tejido sintomático de uchuva (Physalis peruviana) en los departamentos de Cundinamarca y Boyacá, estos aislamientos se identificaron basándose en rasgos morfológicos y análisis de secuencia de los genes Factor de elongación 1α (EF1), Citocromo Oxidasa 1 (CO1),...

  10. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  11. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  12. Sistemas de conntrol pasivos y activos de aislamiento de base para edificios sometidos a acciones sísmicas

    Directory of Open Access Journals (Sweden)

    Nelson Molinares Amaya

    2003-01-01

    Full Text Available En este arUculo se examina la eficacia de los sistemas de control de aislamiento de base, tanto pasivos como activos, y se propone uno híbrido que aplica una fuerza sobre la base. La componente pasiva del sistema propuesto está constituida por un aparato de apoyo que puede ser de tipo histerético, friccional o una combinación de ambos. La fuerza de control activo tiene como objetivo la reducción del desplazamiento de la base y se calcula mediante una ley de control que garantiza un comportamiento estable del sistema estructura - aislamiento de base frente a una amplia clase de incertidumbres tanto del modelo dinámico como de la excitación s{smica. Mediante un amplio estudio numérico se muestra que el sistema propuesto mejora el comportamiento global del edificio, especialmente para excitaciones con frecuencias predominantes, para las cuales la respuesta de la estructura con control pasivo es máxima.

  13. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia

    Directory of Open Access Journals (Sweden)

    Muñoz Flórez Jaime Eduardo

    2008-09-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a –20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.

  14. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  15. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  16. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly......Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...

  17. AISLAMIENTO Y EVALUACIÓN IN VITRO DE ANTAGONISTAS DE Botrytis cinerea EN MORA

    OpenAIRE

    Jos\\u00E9 Alonso Calvo-Araya; Germ\\u00E1n Rivera-Coto; Steffany Orozco-Cayasso; Rafael Orozco-Rodr\\u00EDguez

    2012-01-01

    El objetivo de este estudio fue determinar la capacidad antagónica de hongos a Botrytis cinerea en el cultivo de la mora en Costa Rica. Durante el primer semestre del 2009 se aislaron 35 hongos filamentosos habitantes del carpoplano de frutos de mora, de los cuales seis cepas de Trichoderma fueron seleccionadas para su evaluación in vitro contra B. cinerea por medio de la técnica de cultivos duales. En la evaluación se determinó la competencia por sustrato y el efecto antibiótico. Para evalua...

  18. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    OpenAIRE

    Nomin Batnyam; Jimin Lee; Jungnam Lee; Seung Bok Hong; Sejong Oh; Kyudong Han

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR-...

  19. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  20. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  1. The thermal insulating materials and its coatings for underground piping; Los aislamientos termicos y sus recubrimientos para tuberias subterraneos

    Energy Technology Data Exchange (ETDEWEB)

    Salcido Lopez, Salvador [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    Energy Saving through the adequate selection and application of the thermal insulating materials, as well as its coatings for underground piping conducting fluids, both at high and at low temperature. The benefits are outlined at economical level for the investor as well as at ecological level (of vital importance today) and are observed as practical examples in industrial and commercial processes. [Espanol] Ahorro de energeticos mediante la adecuada seleccion y aplicacion de los aislamientos termicos, asi como de sus recubrimientos para tuberias subterraneas que conducen fluidos tanto en alta como en baja temperatura. Los beneficios son destacados tanto a nivel economico para el inversionista, como a nivel ecologico (de vital importancia en la actualidad), y son observados con ejemplos practicos en procesos industriales y comerciales.

  2. Relevancia clínica de los aislamientos de micobacterias no tuberculosas Clinical relevance of nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Y. Salicio

    2008-04-01

    Full Text Available Fundamento. El aislamiento de micobacterias no tuberculosas (MNT se ha incrementado en los últimos años debido en gran parte a la utilización de medios de cultivo líquidos. Estos aislamientos carecen en muchos casos de relevancia clínica, por lo que la valoración de su significado debe realizarse en base a unos criterios clínicos internacionales. En el presente trabajo hemos estudiado el impacto que supondría la aplicación de los criterios que la American Thoracic Society (ATS ha establecido para diferenciar en muestras respiratorias una infección de una colonización por MNT. Métodos. Estudio microbiológico y clínico de los pacientes con aislamientos repetidos de MNT en muestras respiratorias registrados en nuestro laboratorio entre los años 2000-2004. Resultados. Se obtuvieron 116 cultivos positivos de MNT aisladas repetidamente en 46 episodios correspondientes a 42 pacientes. Se identificaron 11 especies distintas: M. xenopi (16 casos, M. avium (12, M. kansasii (7, M. fortuitum (5, M. malmoense (2 y finalmente 1 de cada una de las siguientes: M. genavense, M. simiae, M. gordonae y M. lentiflavum. Se pudieron estudiar 36 pacientes, de los que 17 cumplían los criterios de la ATS y, de estos, sólo 12 recibieron tratamiento específico. En los casos que no se cumplían los criterios de la ATS los aislamientos no tuvieron ninguna repercusión clínica. En ambos grupos, tratados y no tratados, no se observó una evolución claramente diferenciada. Conclusiones. Ante la dificultad de atribuir a una MNT de muestras respiratorias un papel etiológico, es necesario atenerse a criterios internacionales como los de la ATS antes de iniciar un tratamiento específico para evitar tratamientos incorrectos a los pacientes.Background. The isolation of nontuberculous mycobacterias (NTM has increased in recent years largely due to the use of liquid cultivation media. In many cases such isolations lack clinical relevance, which is why the

  3. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2007-02-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  4. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  5. Ensayo de aislamiento acústico a ruido aéreo de los cerramientos exteriores y particiones realizados con paneles de madera

    Directory of Open Access Journals (Sweden)

    Pacios Álvarez, Antonia

    2007-06-01

    Full Text Available The house prototype of the Provisional Emergency House System uses wood and its derivatives for the facades, floor structure, roofing and partitions.  The extensive use of wooden panels for the construction and the lack of data, in Spain, about their acoustic behavior bring up the necessity to make in situ measurements of the acoustic isolation to airborne sound. Panels used for facades and partitions are built with a wooden framework and membrane of oriented strand board in both sides, for the facades, and of laminated plaster boards for the inner partitions. With the objective of verifying the sound insulation of the facades according to Spanish Standard UNE EN ISO 140-5, in situ measurements of airborne sound insulation of facade elements and facades have been made; according to Spanish Standard UNE EN ISO 140-4, in situ measurements of airborne sound insulation between rooms for internal walls have also been made. The procedure of the global insulation has been followed to measure the acoustic insulation of complete facades without making distinction between the elements that form it.El prototipo de vivienda del Sistema de Vivienda Provisional de Emergencia utiliza principalmente la madera y sus derivados tanto en los cerramientos y particiones como en el forjado y la cubierta. El empleo de soluciones constructivas ligeras y la falta de datos en España acerca del comportamiento acústico de los mismos plantea la necesidad de realizar mediciones in situ del aislamiento acústico a ruido aéreo. El panel base de cerramiento y particiones se construye partiendo de un entramado de montantes de madera con membrana en ambas caras de tableros de virutas de madera orientadas, para el caso de los cerramientos exteriores, y de tableros laminados de yeso para las particiones interiores. Con el objeto de comprobar el aislamiento acústico de dichos cerramiento se han realizado ensayos siguiendo la Norma UNE EN ISO 140-5 para la medición in situ del

  6. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-06-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  7. Development of Specific Primer for Tricholoma matsutake

    OpenAIRE

    Kim, Jang-Han; Han, Yeong-Hwan

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used ...

  8. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  9. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  10. Aislamiento rápido del virus dengue 3 por el método de shell vial en el brote de dengue en Lima

    OpenAIRE

    Victoria Gutiérrez P; Miryam Palomino R; Marcela Olivares S; Gissella Noroña C

    2005-01-01

    El aislamiento de virus dengue con los métodos tradicionales demora hasta un mes, en situaciones de emergencia como el brote de dengue clásico en el distrito de Comas-Lima entre abril y mayo de 2005, es necesario un diagnóstico precoz. Se procesaron 117 muestras de sueros de pacientes con diagnóstico clínico de dengue clásico en fase virémica procedentes la zona del brote, mediante el método de shell vial para el aislamiento del virus dengue en la línea celular C6-36, se identificó el serotip...

  11. AISLAMIENTO DE CLONES CON ACTIVIDAD ENDO-b-1,4-GLUCANASA A PARTIR DE UN SEGMENTO DE ADN DE 13KB DE Clostridium sp IBUN22A

    Directory of Open Access Journals (Sweden)

    I. Roncancio-Sánchez

    2006-06-01

    Full Text Available La producción de combustibles, solventes y algunos productos químicos a partir de sustratos celulósicos usando microorganismos ofrece una ventaja frente a los de origen fósil. Un acercamiento prometedor ha sido la implementación de ingeniería genética utilizando genes de enzimas involucradas en la degradación de desechos celulósicos. En la última década se han generado bibliotecas genéticas para proveer enzimas celulolíticas, que hagan el proceso más rentable, lo cual permitiría aprovechar mejor residuos celulósicos disponibles. Este trabajo describe el aislamiento de dos fragmentos de ADN que expresan actividad endo-β-1,4-glucanasa, a partir de un segmento ADN de 13Kb (clon 02080-25 aislado de una biblioteca genómica de la cepa nativa Clostridium sp IBUN22A. El aislamiento de la región codificadora se realizó a través de pruebas de inducción de la actividad, análisis por restricción del segmento y de una sub-biblioteca con la enzima Sau3A I. 325 clones fueron obtenidos, de los cuales 271 tenían inserto. El tamizaje molecular de estos últimos mostró que siete clones presentaron tamaños entre 3500pb y 7000pb y el tamizaje enzimático con carboximetilcelulosa como sustrato permitió el aislamiento de los clones pBSh-37 y pBSh-26 con la actividad endo-β-1,4-glucanasa original, de tamaños de inserto de 627pb y 879pb respectivamente. Este trabajo es el punto de partida para el aislamiento de enzimas de alto potencial biotecnológico.

  12. Primer Design Assistant (PDA): a web-based primer design tool

    OpenAIRE

    Chen, S. H.; Lin, C. Y.; Cho, C.S.; Lo, C.Z.; Hsiung, C. A.

    2003-01-01

    Primer Design Assistant (PDA) is a web interface primer design service combined with thermodynamic theory to evaluate the fitness of primers. It runs in a Linux–Apache–MySQL–PHP structure on a PC equipped with dual CPU (Intel Pentium III 1.4 GHz) and 512 Mb of RAM. A succinct user interface of PDA is accomplished by built-in parameters setting. Advanced options on 5′ GC content, 3′ GC content, dimer check and hairpin check are available. The option of covered region constrains the PCR product...

  13. Voltage pre-regulator without insulation with high efficiency; Pre-regulador de tension sin aislamiento con alta eficiencia

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ramos, Octaviano

    2003-04-15

    esta tesis se propone una nueva topologia de pre-regulador para fuentes de alimentacion con una alta eficiencia ({eta}), debido a una estrategia novedosa de manejo de la energia; asimismo corrige el FP. Esto representa un avance en lo que respecta a la investigacion sobre fuentes de alimentacion, debido a que normalmente dos parametros estan en oposicion: cuando se mejora la eficiencia ({eta}) se descuida el factor de potencia (FP), asimismo cuando se corrige el FP se descuida la {eta}, sin embargo es posible mejorar estos dos parametros al mismo tiempo aprovechando el concepto de pasar parte de la energia de entrada directo a la salida. El nuevo pre-regulador puede combinarse con reguladores tradicionales con aislamiento como el convertidor CD/CD flyback, o bien combinarse con reguladores de alta eficiencia como el llamado reductor de dos entradas. El regulador es necesario para obtener una fuente de alimentacion regulada con un alto factor de potencia y buena eficiencia. El documento de tesis esta organizado en cuatro capitulos. En el primer capitulo se examinan las propuestas de diversos autores, y finaliza con el planteamiento de la topologia propuesta para este trabajo de investigacion. El capitulo dos, titulado Teoria de operacion, analisis y diseno de la solucion propuesta, muestra las ecuaciones de diseno y formas de onda del convertidor propuesto que ayudan a entender su funcionamiento. En el capitulo tres, titulado Estrategia de control, se justifica el uso de un control no lineal debido a las caracteristicas de la topologia y el por que la utilizacion de modos deslizantes (SMC), se plantea el analisis y diseno de la etapa de control del convertidor propuesto por modos deslizantes. Ademas se presenta la forma en que se implemento fisicamente dicho control. El capitulo cuatro, titulado Analisis de resultados, se divide en dos partes: simulaciones y resultados experimentales. Adicionalmente se presenta un analisis comparativo entre la topologia propuesta y el

  14. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  15. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420. ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.712, year: 2014

  16. Ambiente genético del Gen blaCTX-M-12 en aislamientos hospitalarios de Klebsiella pneumoniae

    Directory of Open Access Journals (Sweden)

    Yamile Adriana Celis Bustos

    2009-06-01

    Full Text Available The blaCTX-M-12 gene’s genetic environmnt in Klebsiella pneumoniae hospital isolates Resumen: En Colombia se han detectado genes del grupo CTX-M-1 con alta frecuencia en aislamientos de Klebsiella pneumoniae causantes de infección intrahospitalaria. El conocimiento de los factores genéticos que pueden favorecer la diseminación de estos genes entre especies bacterianas es un aspecto importante para el control de la resistencia. En este estudio se identificaron los plásmidos portadores del gen blaCTX-M-12 en 21 aislamientos clínicos de K. pneumoniae. Se evaluó por conjugación la transferencia de resistencia a antibióticos. Integrones, secuencias de inserción y otros elementos genéticos fueron detectados por amplificación del ADN plasmídico con la reacción en cadena de la polimerasa (PCR. Mediante análisis por PCR se determinó la relación entre el gen blaCTX-M-12 y los elementos genéticos detectados. En todos los aislamientos, el gen blaCTX-M-12 se encontró en plásmidos conjugativos de tamaños entre 65 y 106 kpb. La transferencia por conjugación de estos elementos móviles puede explicar la amplia diseminación de este gen entre enterobacterias causantes de infección nosocomial en hospitales de Bogotá, Colombia. El gen blaCTX-M-12 se encontró corriente abajo de ISEcp1, secuencia de inserción que se ha asociado con la movilización de determinantes genéticos de resistencia. Los promotores de ISEcp1, detectados por análisis de secuencia, pueden facilitar la expresión de la cefotaximasa codificada por este gen.Palabras clave: resistencia a antibióticos; elementos genéticos móviles; gen blaCTX-M-12; plásmidos conjugativos;  Klebsiella pneumoniae. Abstract: Genes from CTX-M-1 group have been detected with great frequency in Colombia in intrahospital infection-causing Klebsiella pneumoniae isolates. Knowledge regarding the genetic factors favouring such genes’ dissemination amongst bacterial species is an

  17. Loop-Mediated Amplification Accelerated by Stem Primers

    Directory of Open Access Journals (Sweden)

    Laurence Tisi

    2011-12-01

    Full Text Available Isothermal nucleic acid amplifications (iNAATs have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility.

  18. Loop-mediated amplification accelerated by stem primers.

    Science.gov (United States)

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  19. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  20. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  1. Caries inhibition by fluoride-releasing primers.

    Science.gov (United States)

    Kerber, L J; Donly, K J

    1993-10-01

    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  2. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Ortiz Rojas Luz Yineth

    2012-03-01

    Full Text Available

    El análisis molecular del cistron, (ue codica para la proteina de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la pre- sencia de 65 nucleotidos adicionales (ue codican para (uince aminoãcidos, en la region amino de la secuencia de la proteina de la cubierta del aislamiento mexicano identicado con el nümero de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento DDDF6F, reportado en 1FF1 en Estados Unidos. El anãlisis logenHtico de 1I5  secuen- cias de la proteína de la cubierta de SCMV reportadas de Asia, África, Brasil y Argentina, entro otros, sugiere diJerentes origenes logeogrãcos de los aislamientos mexicanos. El aislamiento mexicano GU6N6OP5 es filogeneticamente mãs cercano a aislamientos de QCWV de Brasil X de EE.UU., mien- tras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son

    logenHticamente mãs cercanas al aislamiento mexicano EUDF1DN5. Las caracteristicas particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México X Brasil, sugieren un baYo control tosanitario en el intercambio de material vegetal.

  3. Frecuencia de Aislamientos de Staphylococcus spp Meticilina Resistente en el Hospital Pediátrico "William Soler".

    Directory of Open Access Journals (Sweden)

    Leonora González

    2005-01-01

    Full Text Available Los Staphylococcus spp meticilina resistentes (SMR son importantes patógenos causantes de morbi-mortalidad en todo el mundo. Esta resistencia es mediada por la producción de una proteína de unión a penicilina alterada (PBP 2a, la cual tiene baja afinidad por los antibióticos beta-lactámicos y esta codificada por el gen mecA. Unos pocos antimicrobianos están disponibles para el tratamiento de estas infecciones, hoy en día la mayoría de los aislados permanecen sensibles vancomicina, única opción terapéutica en nuestro país, para el tratamiento de infecciones causadas por SMR. El presente estudio tuvo como objetivo determinar la frecuencia de aislamientos de SMR en el hospital pediátrico "William Soler". Fueron estudiados 128 aislados de Staphylococcus spp provenientes de muestras clínicas (32 Staphylococcus aureus y 96 Staphylococcus coagulasa negativos. La identificación de las especies se determino por el sistema Rapi Stha (Biomeriux. Los valores de concentración mínima inhibitoria (CMI, el crecimiento en placas de oxacilina y los patrones de resistencia de SMR a otros antimicrobianos, se realizaron siguiendo las recomendaciones de las guías NCCLS. Para la detección del gen mecA, se utilizo la reacción en cadena de la polimerasa. El 15% de los S. aureus y el 43% de los Staphylococcus coagulasa negativos fueron intrínsecamente resistentes a meticilina, CMI > 2 ¿g/mL y presentaban el gen mecA. Los SMR poseen resistencia cruzada a otras familias de antibióticos, especialmente macrolidos, no se encontró resistencia a vancomicina. Nosotros recomendados que se apliquen medidas de aislamientos a pacientes con infecciones por SMR, para evitar la diseminación de estos microorganismos.

  4. Characterization of some psorosis and concave gum isolates from northwestern Argentina Caracterización de aislamientos de psorosis y concave gum del noroeste argentino

    Directory of Open Access Journals (Sweden)

    Julia Figueroa

    Full Text Available The Citrus Sanitation Center of the Estación Experimental Agroindustrial Obispo Colombres in Tucumán, Argentina, has developed a virus bank of various graft-transmissible citrus pathogens found in northwestern Argentina. In this bank, several psorosis and concave gum isolates are maintained in Pineapple sweet orange seedlings. In order to characterize these pathogens, 11 isolates were indexed to seedlings of Pineapple sweet orange, Dweet tangor, Eureka lemon plus Etrog citron budded on rough lemon seedlings. Cross protection was applied for identifying psorosis-A. Symptoms obtained were variable and ranged from mild to very severe. A clear effect of temperature on symptom expression, and distinct differences in the reactions between psorosis-A and concave gum viruses were detected.El Centro de Saneamiento de Citrus de la Estación Experimental Agroindustrial Obispo Colombres, de Tucumán, Argentina, ha constituido un banco de virus de cítricos con material recolectado en la región noroeste del país. El mismo cuenta con varios aislamientos de psorosis y concave gum que se mantienen en plantas de naranjo dulce Pineapple. Con el objetivo de caracterizar biológicamente 11 de estos aislamientos, se inocularon plantines de naranjo dulce Pineapple, Dweet tangor, limonero Eureka y plantas injertadas de cidro Etrog en limoneros rugoso. Las pruebas con Pineapple se realizaron por duplicado bajo dos condiciones de temperatura: frías y calientes. La confirmación de psorosis A se realizó mediante prueba de protección cruzada con un aislamiento de psorosis B. Los resultados obtenidos muestran una amplia diversidad biológica entre los aislamientos, con expresión de síntomas que variaron desde suaves a muy severos. Se confirmó la presencia de psorosis A y se encontró que los aislamientos de "concave gum" del banco de virus no estaban en mezcla con psorosis. El efecto de la temperatura en la manifestación de los síntomas fue significativo y se

  5. MPprimer: a program for reliable multiplex PCR primer design

    OpenAIRE

    Wang Xiaolei; Hang Xingyi; Li Zhifeng; Wu Yonghong; Lu Yiming; Wang Wen; Qu Wubin; Shen Zhiyong; Zhao Dongsheng; Zhang Chenggang

    2010-01-01

    Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nons...

  6. Aislamiento e identificación de Bacillus cereus a partir de dos variantes de arroz comercial (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Irasema Pérez-Portuondo

    2011-01-01

    Full Text Available Bacillus cereus es una bacteria habitante común del suelo, de importancia tanto para la salud pública como para la Biotecnología. Con el objetivo de aislar ejemplares de esta bacteria para su utilización en estudios posteriores, así como de evaluar su permanencia en el arroz cocido, se desarrolló el protocolo propuesto por Kramer y cols. (1982. Con este fin, se tomaron muestras de arroz en grano con cáscara y de arroz cocido y se buscaron bacterias con propiedades hemolíticas y lecitinasa positiva. La identificación de los aislados se realizó mediante pruebas morfológicas y bioquímicas. Se obtuvieron 14 aislados, ocho de los cuales reunían las características distintivas de B. cereus, comparados con B. cereus ATCC 11778, incluida la resistencia a antibióticos. No se observó presencia de cuerpos parasporales típica de B. thuringiensis. Se comprobó que en el arroz cocido, transcurridas ocho horas de la cocción, pueden aislarse bacterias hemolíticas y lecitinasa positivas, en mayor número si este es conservado a temperatura ambiente, lo que convierte este alimento en potencialmente peligroso para su consumo. Estos resultados sugieren también la posibilidad de emplear al arroz como fuente para aislamiento de B. cereus.

  7. Técnicas de aislamiento y concentración de volátiles de aceites vegetales

    Directory of Open Access Journals (Sweden)

    Morales, M. T.

    1992-06-01

    Full Text Available One of the methods for food flavor evaluation is the analysis of volatile components. First step in this kind of analysis Is the isolation and concentration of volatiles. A review is carried out about different techniques applied in foods and especially in vegetable oils. Very different methods have been used, an explication of each one with its different cases are presented. Likewise the applications carried out in vegetable oils during last years are discussed.

    Uno de los métodos de evaluación del flavor de los alimentos consiste en la determinación de sus componentes volátiles. La primera etapa necesaria para realizar este tipo de análisis es el aislamiento y concentración de los mismos. Se ha realizado una revisión bibliográfica sobre las diferentes técnicas utilizadas para este fin en diferentes alimentos y especialmente en aceites vegetales. Los métodos utilizados son muy diversos, se ofrece una explicación de cada uno de ellos considerando las diferentes variantes existentes. Asimismo se detallan las aplicaciones realizadas en aceites vegetales durante los últimos años.

  8. Monte Carlo primer for health physicists

    International Nuclear Information System (INIS)

    The basic ideas and principles of Monte Carlo calculations are presented in the form of a primer for health physicists. A simple integral with a known answer is evaluated by two different Monte Carlo approaches. Random number, which underlie Monte Carlo work, are discussed, and a sample table of random numbers generated by a hand calculator is presented. Monte Carlo calculations of dose and linear energy transfer (LET) from 100-keV neutrons incident on a tissue slab are discussed. The random-number table is used in a hand calculation of the initial sequence of events for a 100-keV neutron entering the slab. Some pitfalls in Monte Carlo work are described. While this primer addresses mainly the bare bones of Monte Carlo, a final section briefly describes some of the more sophisticated techniques used in practice to reduce variance and computing time

  9. A primer for criticality calculations with DANTSYS

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D. [Univ. of New Mexico, Albuquerque, NM (United States). Nuclear Criticality Safety Group

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  10. A primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem

  11. Book review: feminist research practice: a primer

    OpenAIRE

    Smith, Emma

    2013-01-01

    The fully revised and updated Second Edition of Feminist Research Practice: A Primer, edited by Sharlene Nagy Hesse-Biber, draws on the expertise of a wide group of interdisciplinary scholars who aim to cover cutting-edge research methods and explore research questions related to the complex and diverse issues that deeply impact women’s lives. Emma Smith finds that it will be valuable for academics already working from or looking to develop their understanding and use of feminist research pra...

  12. Primer for the algebraic geometry of sandpiles

    OpenAIRE

    Perkinson, David; Perlman, Jacob; Wilmes, John

    2011-01-01

    The Abelian Sandpile Model (ASM) is a game played on a graph realizing the dynamics implicit in the discrete Laplacian matrix of the graph. The purpose of this primer is to apply the theory of lattice ideals from algebraic geometry to the Laplacian matrix, drawing out connections with the ASM. An extended summary of the ASM and of the required algebraic geometry is provided. New results include a characterization of graphs whose Laplacian lattice ideals are complete intersection ideals; a new...

  13. Weathered Hydrocarbon Wastes: A Risk Management Primer

    OpenAIRE

    Brassington, Kirsty J.; Hough, Rupert L.; Paton, Graeme I.; Semple, Kirk T.; Risdon, Graeme C.; Crossley, Jane; Hay, I; Askari, K.; Pollard, Simon J. T.

    2007-01-01

    We provide a primer and critical review of the characterization, risk assessment, and bioremediation of weathered hydrocarbons. Historically the remediation of soil contaminated with petroleum hydrocarbons has been expressed in terms of reductions in total petroleum hydrocarbon (TPH) load rather than reductions in risk. There are several techniques by which petroleum hydrocarbons in soils can be characterized. Method development is often driven by the objectives of published...

  14. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  15. Aplicación de las pruebas de PCR convencional simple y múltiple para la identificación de aislamientos de Leptospira spp. en Colombia Application of conventional and multiplex PCR assays for identification of isolates of Leptospira spp. in Colombia

    Directory of Open Access Journals (Sweden)

    Natali Moreno

    2010-12-01

    Full Text Available Debido a las dificultadas asociadas con la identificación serológica de aislamientos de Leptospira ssp, se genera gran interés en la pruebas moleculares por su poder discriminatorio, reproducibilidad y fácil interpretación. Objetivo. Aplicar y validar la prueba de PCR convencional, usando dos pares de iniciadores descritos previamente y dirigidos a los genes lipL32 (PCR simple y secY/flaB (PCR múltiple, con el fin de evaluar su aplicación para identificar especies patógenas y saprófitas de Leptospira spp. Materiales y métodos. Para la estandarización de las pruebas de PCR se usó 22 cepas de referencia internacional y 12 aislamientos colombianos. Se determinó el nivel de detección de cada pareja de iniciadores, su especificidad frente a otros microorganismos causantes de enfermedades endémicas en Colombia y su capacidad de identificar especies dentro del grupo de Leptospira. Resultados. El límite de detección de la PCR simple lipL32 fue una dilución 1:10000 y para la PCR múltiple secY/flaB fue una dilución 1:100 para el gen secY y 1:1000 para flaB. La especificidad de todos los iniciadores fue de 100%. La PCR simple lipL32, mostró amplificado específico para 21/22 cepas de referencia mientras que la PCR multiple secY/flaB lo fue para 18/22 cepas. De los 12 aislamientos colombianos, siete fueron positivos por PCR lipL32 y seis lo fueron por PCR secY/flaB. Conclusiones. Los resultados más consistentes fueron obtenidos con la PCR simple lipL32 tanto en límite de detección, especificidad y utilidad para la identificación de Leptospira spp, por lo que esta prueba es aplicable a la identificación molecular de aislamientos patógenos de Leptospira spp de diversas fuentes.Serological identification of Leptospira ssp isolates is difficult to achieve. Thus, molecular testing may be of great interest thanks to its high discrimination power, reproducibility and easy interpretation. Objective. To implement and validate conventional

  16. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  17. Aislamiento de "Micromonospora" de nódulos de leguminosas tropicales y análisis de su interés como promotor del crecimiento vegetal

    OpenAIRE

    Cerda Castillo, María Eugenia

    2008-01-01

    En el presente trabajo se plantea el aislamiento, caracterización e identificación de cepas de Micromonospora aisladas de nódulos fijadores de nitrógeno de las leguminosas tropicales Phaseolus vulgaris y Arachis hypogeae recogidas en Nicaragua y que son de importancia agrícola en toda América Latina. Posteriormente se realizarán experimentos de reinoculación en planta con el fin de ampliar nuestros conocimientos sobre el papel que pueden desempeñar estos microorganismos en la nodulación y fij...

  18. Aislamiento de Lactobacillus plantarum LPBM10 y caracterización parcial de su bacteriocina Isolation of Lactobacillus plantarum LPBM10 and partial characterization of its bacteriocin

    OpenAIRE

    Sandra ZAPATA; Juliana MUÑOZ; Orlando S RUIZ; Olga I. Montoya; PABLO A GUTIÉRREZ

    2009-01-01

    Las bacterias acidolácticas (BAL) son un grupo de microorganismos Gram positivos utilizados ampliamente en la preservación de alimentos debido a sus propiedades probióticas y su capacidad para producir bacteriocinas. Las bacteriocinas son compuestos antimicrobianos de naturaleza peptídica y han recibido gran atención por la industria de alimentos debido a su uso potencial como sustitutos de aditivos químicos. En este trabajo reportamos el aislamiento y caracterización de la cepa de Lactobacil...

  19. OPTIMIZACIÓN DE UN PROTOCOLO DEL AISLAMIENTO DEL ADN Y DE UN SISTEMA DE AMPLIFICACIÓN ISSR-PCR PARA Ceratozamia mexicana Brongn. (Zamiaceae).

    OpenAIRE

    Nadia Guadalupe Sánchez-Coello; Mauricio Luna-Rodríguez; Mario Vázquez-Torres; Lázaro Rafael Sánchez-Velásquez; Nancy Santana-Buzzy; Pablo Octavio-Aguilar; Lourdes Georgina Iglesias-Andreu

    2012-01-01

    La mayoría de las cícadas contienen altas concentraciones de aceites esenciales, flavonoides, polifenoles y polisacáridos que interfieren en la extracción de ADN, causando productos de amplificación errados o inhibiendo la PCR. La optimización del aislamiento del ADN y el empleo de iniciadores de secuencias intergénicas repetidas simples (ISSRs) se investigaron en Ceratozamia mexicana Brongn., una cícada mexicana en peligro de extinción. El ADN obtenido de tejido foliar fresco, con un amortig...

  20. Caracterización de los plásmidos presentes en tres aislamientos multirresistentes de: Acinetobacter baumannii, Acinetobacter nosocomialis y Acinetobacter pittii obtenidos en hospitales colombianos.

    OpenAIRE

    Rodríguez Méndez, Tatiana

    2014-01-01

    En las últimas décadas, el control de las infecciones asociadas al cuidado de la salud causadas por bacterias del género Acinetobacter se ha convertido en un problema global, ya que un gran porcentaje de aislamientos hospitalarios presentan resistencia a la mayoría de antibióticos de uso común, incluyendo: Penicilinas, cefalosporinas, aminoglicósidos, quinolonas, tetraciclinas, cloranfenicol y carbapenémicos; existen gran cantidad de estudios a nivel mundial que relacionan la presencia de ele...

  1. Aislamiento de Serpulina hyodysenteriae e innocens de cerdos con cuadros de disentería porcina

    OpenAIRE

    Moredo, Fabiana; Giacoboni, Gabriela; Sanguinetti, Héctor Ramón; T. Yamasaki

    1995-01-01

    A partir de muestras de materia fecal recolectada en bolsas de polietileno o hisopados rectales de cerdos con cuadro clínico-patológico de Disentería Porcina se aisló Serpulina hyodysenteriae y Serpulina innocens, esta última apatógena. De los tres medios de cultivos sólidos selectivos utilizados, el medio de Jenkinson et al. fue el que permitió el mayor número de aislamientos e inhibió la flora fecal normal. La identificación del género y especie se realizó sobre la base de las característic...

  2. Comportamiento "in vivo" de aislamientos de Trichomonas vaginalis, utilizando ratones NMRI como modelo experimental Behavior "in vitro" of isolations of Trichomonas vaginalis, using mice NMRI as experimental model

    OpenAIRE

    Lázara Rojas R.; Idalia Sariego R.; Carlos Sarría P.; Jorge Fraga N.

    2004-01-01

    Se estudió la correlación entre intensidad clínica de la tricomoniasis vaginal en adolescentes y la virulencia de Trichomonas vaginalis en un modelo experimental. Para ello fueron inoculados por vía intraperitoneal en ratones NMRI, 40 aislamientos de T. vaginalis obtenidas a partir de exudados vaginales provenientes de adolescentes, clínicamente clasificadas como asintomáticas, y sintomáticas leves, moderadas o severas, atendidas en las consultas Infanto-Juvenil, de Interrupción de Embarazo y...

  3. Aislamiento e identificación de patógenos de la estirpe silvestre del ajo (Allium sativum L.

    Directory of Open Access Journals (Sweden)

    Karina Astorga-Quirós

    2014-02-01

    Full Text Available El cultivo del ajo (Allium sativum L. en Costa Rica se podría convertir en una alternativa rentable para la producción y diversificación de los agricultores de hortalizas. Sin embargo, el tipo de reproducción vegetativa que presenta facilita la transmisión y diseminación de enfermedades, lo que provoca un debilitamiento progresivo de los bulbos. Actualmente, se buscan alternativas de manejo diferentes al control químico, para disminuir el impacto ecológico y ambiental de los patógenos que lo afectan. El control biológico es una de ellas, pero presenta dificultades para el aislamiento y la identificación certera de patógenos asociados a pudriciones que se dan en el suelo. Por lo anterior, el objetivo general de esta investigación consistió en aislar e identificar a nivel de especie cepas de Pseudomonas marginalis, Penicillium sp. y Sclerotium cepivorum a partir de material vegetativo de ajo en campo, para su utilización en futuros trabajos de control biológico de estas enfermedades. La metodología seguida permitió aislar e identificar con un alto porcentaje de certeza a P. marginalis, así como obtener cultivos monospóricos de Penicillium sp. y cultivos puros de S. cepivorum. Las técnicas descritas constituyen la base para futuros trabajos relacionados con las fitopatologías en el cultivo del ajo.

  4. AISLAMIENTO DE ADN GENÓMICO DE Myrciaria dubia (HBK “CAMU CAMU” APROPIADO PARA ANÁLISIS MOLECULARES

    Directory of Open Access Journals (Sweden)

    Juan Castro Gómez

    2012-06-01

    Full Text Available Myrciaria dubia “camu-camu”, una especie nativa de la Amazonía que produce frutos con alto contenido de vitamina C y otras sustancias importantes. Sin embargo, los estudios moleculares de esta planta son escasos, por falta de un protocolo reproducible para purificar sus ácidos nucléicos. El objetivo de este trabajo fue establecer un protocolo para aislar el ADN genómico a partir de hojas de M. dubia, apropiado para análisis moleculares. El ADN se purificó con un protocolo modificado, la calidad y cantidad se estimó por espectrofotometría y electroforesis en gel de agarosa. Adicionalmente, la calidad se evaluó mediante RAPD. El ratio de calidad (A260/A280 promedio del ADN fue 1.9±0.1 y el espectro de absorción UV/Vis presentó un único pico de máxima absorbancia a 260nm. Mediante electroforesis el ADN fue íntegro y sin ARN. También, la síntesis de amplicones RAPD nos sugiere ausencia de inhibidores para polimerasas. La concentración promedio del ADN fue 99±33 ng/ml y el rendimiento promedio fue 237±80 mg ADN/g hoja. En conclusión, se ha establecido un protocolo de aislamiento de ADN genómico a partir de hojas de Myrciaria dubia “camu camu”, caracterizado por permitirnos obtener ADN de alta calidad y cantidad suficiente para análisis moleculares como el RAPD.

  5. El aislamiento social como supuesto articulador de las teorías sobre la exclusión y el sinhogarismo: críticas y aportes etnográficos

    OpenAIRE

    Santiago Bachiller

    2010-01-01

    El objetivo del artículo es discutir con el supuesto del aislamiento social en tanto eje articulador de las teorías sobre la exclusión social en general, y de los modelos de análisis sobre quienes se ven forzados a residir en la vía pública en particular. En segunda instancia, se argumenta que las perspectivas centradas en el aislamiento social en buena medida son consecuencia de una opción metodológica: la mayoría de los estudios sobre la exclusión de las personas sin hogar únicamente tomaro...

  6. Transmisibilidad de aislamiento del Citrus Tristeza Virus (CTV) por áfidos y evaluación de la resistencia en cítricos tranformados con genes del CTV

    OpenAIRE

    Loeza Kuk, Emiliano

    2012-01-01

    La sintomatología en árboles infectados por el Citrus Tristeza Virus (CTV) es influenciada por factores como la población de variantes de secuencia presentes. Esta población es modificada en la transmisión por áfidos y la evidencia sugiere que la interacción del CTV con Toxoptera citricida, incrementa la frecuencia de los aislamientos severos. Se estudió una huerta en Yucatán con una incidencia inicial de 11 árboles positivos a CTV y con tres haplotipos de aislamientos no ...

  7. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  8. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  9. Primer izpeljave analize besedila v kvalitativni raziskavi

    OpenAIRE

    Roblek, Vasja

    2013-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  10. Primer izpeljave analize besedila v kvalitativni raziskavi:

    OpenAIRE

    Roblek, Vasja

    2009-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  11. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  12. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    OpenAIRE

    Luesken, F.A.; Zhu, B.; Alen, T.A. van; Butler, M.K.; Diaz, M. R.; Song, B.; Op den Camp, H.J.M.; M. S. M. Jetten; Ettwig, K.F.

    2011-01-01

    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment.

  13. AISLAMIENTO Y CARACTERIZACIÓN DE CEPAS DE Staphylococcus ENTEROTOXIGÉNICOS AISLADOS DE QUESOS EN BOGOTA

    OpenAIRE

    María Vanegas L; Lina González G; Aida Martínez L; Francisco Buitrago

    2008-01-01

    Objetivo. Caracterizar cepas de Staphylococcus aureus enterotoxigénicos provenientes de quesos distribuidos en supermercados, tiendas y en ventas callejeras en la ciudad de Bogota, Colombia. Materiales y métodos. Se ecolectaron muestras de quesos provenientes de tiendas, supermercados y ventas callejeras. Se detectó la presencia del gen para enterotoxina A usando un set de primers reportado en estudios previos. Un total de 50 quesos fueron analizados, 13 comercializados en tien...

  14. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  15. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  16. Coverage evaluation of universal bacterial primers using the metagenomic datasets

    Directory of Open Access Journals (Sweden)

    Mao Dan-Ping

    2012-05-01

    Full Text Available Abstract Background The coverage of universal primers for the bacterial 16S rRNA gene plays a crucial role in the correct understanding of microbial community structure. However, existing studies on primer coverage are limited by the lack of appropriate databases and are restricted to the domain level. Additionally, most studies do not account for the positional effect of single primer-template mismatches. In this study, we used 7 metagenomic datasets as well as the Ribosomal Database Project (RDP to assess the coverage of 8 widely used bacterial primers. Results The coverage rates for bacterial primers were found to be overestimated by previous studies that only investigated the RDP because of PCR amplification bias in the sequence composition of the dataset. In the RDP, the non-coverage rates for all primers except 27F were ≪6%, while in the metagenomic datasets, most were ≫10%. If one considers that a single mismatch near the 3′ end of the primer might greatly reduce PCR efficiency, then some phylum non-coverage rates would change by more than 20%. Primer binding-site sequence variants that could not pair with their corresponding primers are discussed. Conclusions Our study revealed the potential bias introduced by the use of universal bacterial primers in the assessment of microbial communities. With the development of high-throughput, next-generation sequencing techniques, it will become feasible to sequence more of the hypervariable regions of the bacterial 16S rRNA gene. This, in turn, will lead to the more frequent use of the primers discussed here.

  17. Evaluation of conservation programs: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Soderstrom, E.J.; Berry, L.G.; Hirst, E.; Bronfman, B.H.

    1981-07-01

    This primer is an introduction to the field of program evaluation. A considerable amount of information is included about the actual conduct of an evaluation. No specific activity is addressed, but rather an idea is provided of the issues and constraints characteristic of each phase and activity of an evaluation. Examples of how these issues arise and potential solutions are presented. Chapter 1 provides background on the origins and evolution of evaluation, focusing especially on why evaluation is currently receiving increased emphasis. Chapter 2 is an overview of the field of evaluation, especially as it relates to energy conservation. Chapter 3 is a consideration of the steps involved in conducting an evaluation from the planning stage to data analysis. Chapter 4 discusses managerial considerations in conducting an evaluation. Chapter 5 discusses evaluators as people; both in terms of organizational obstacles likely to be encountered by, and personal characteristics found in, good evaluators. An appendix includes suggested further readings.

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  19. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  20. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  2. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  3. Formaldehyde as hypothetical primer of biohomochirality

    Energy Technology Data Exchange (ETDEWEB)

    Goldanskii, V.I. [N. N. Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin Street 4, Moscow, 117334 (Russia)

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  4. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (keff). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple keff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  5. Selección de Aislamientos de Hongos Entomopatógenos para el Control de Huevos de la Polilla del Tomate, Tuta absoluta Meyrick (Lepidoptera: gelechiidae) Entomopathogenic Fungi Isolates Selection for Egg Control of Tomato Moth Tuta absoluta Meyrick (Lepidoptera: gelechiidae) Eggs

    OpenAIRE

    Marta Rodríguez S.; Marcos Gerding P.; Andrés France

    2006-01-01

    Se realizó un estudio en laboratorio sobre la patogenicidad de 64 aislamientos de Metarhizium anisopliae var. anisopliae y 70 de Beauveria bassiana, en huevos de polilla del tomate Tuta absoluta. La primera evaluación se realizó por aplicación directa de suspensiones de 10(7) conidias mL-1 para cada aislamiento, con el sistema de pulverización de la torre de Potter. La mortalidad y esporulación sobre huevos fueron significativamente mayores con los aislamientos M. anisopliae Qu-M558 y B. bass...

  6. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  7. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  8. UniFrag and GenomePrimer : selection of primers for genome-wide production of unique amplicons

    NARCIS (Netherlands)

    van Hijum, SAFT; de Jong, A; Buist, G; Kok, J; Kuipers, OP

    2003-01-01

    The complementary programs UniFrag and GenomePrimer were developed to provide a reliable high-throughput method to select the most unique regions within genomic DNA sequence(s) and design primers therein, involving minimal user intervention and maximum flexibility.

  9. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  10. AISLAMIENTO Y CARACTERIZACIÓN MORFOLÓGICA DE Rosellinia pepo Pat. EN PLANTAS DE MACADAMIA ISOLATION AND MORPHOLOGICAL CHARACTERIZATION OF Rosellinia pepo Pat. IN MACADAMIA PLANTS

    Directory of Open Access Journals (Sweden)

    Carmen Eliana Realpe Ortiz

    2006-12-01

    Full Text Available El hongo Rosellinia pepo Pat., causante de la llaga estrellada, se considera uno de los principales problemas fitosanitarios de la macadamia por ocasionar la muerte de la planta en su etapa productiva. Debido a que no existe una metodología de aislamiento confiable que asegure la recuperación del hongo con un porcentaje mínimo de contaminación y los estudios relacionados con este patógeno son escasos se planteó una investigación con el fin de perfeccionar una metodología de aislamiento y realizar algunas caracterizaciones morfológicas de este patógeno. La nueva metodología permitió obtener aislamientos con un 91,26% de pureza del hongo. La tasa de crecimiento fue de 4,68 mm día-1. Las colonias son de color blanco y apariencia algodonosa en su inicio, pero a medida que envejece el micelio toma un color café o negro y su apariencia se torna quebradiza. La observación de micelio blanco en forma de estrella en el lado interior del medio sintético permite diferenciarlo de otras especies como R. bunodes. Las mediciones microscópicas de los hinchamientos piriformes presentaron en promedio 106,4mm de largo y 75,3mm de ancho. Este trabajo también permitió determinar el nivel de inóculo infectivo.The fungus Rosellinia pepo Pat, the causal agent of star gall, is considered to be a main phytosanitary problem to the Macademia tree by causing the death of the tree while in its productive stage. Because no reliable isolation method exists that assures recovery of the mushroom with a minimum percentage of contamination and studies of this pathogen are scarce. This study was conducted to perfect an isolation methodology and permit some morphological characterizations of this pathogen. The new methodology allowed isolations with 91,26% purity of mushroom to be obtained. The rate of growth was 4,68 mm day-1. The colonies were of white color and cottony appearance in the beginning, but as the micelio aged it assumed a brown or black color and a

  11. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  12. A primer on climate relevant technology transfer

    International Nuclear Information System (INIS)

    The aim of this primer is to support technology transfer initiatives related to mitigation of emissions of greenhouse gases and adaptation to climate change in developing countries and economies in transition. It is meant to provide guidance to all parties involved in the transfer of climate relevant technologies, micluding government, business organisations and other non-governmental organizations representing all sectors relevant for climate change. The emphasis in this primer is on strategic and organisational issues related to the transfer of climate relevant technologies, in particular with a view to utilise climate-relevant technologies in the development process of developing countries and countries in economic transition. It builds upon insight gained in National Needs Assessments regarding the Transfer of Enviromentally Sound Technologies to developing countries. Chapter 2 deals with the technology transfer process for climate relevant technologies. It provides a framework for co-ordinated action of the stakeholders involved in the technology transfer process, with a view to improve the utilisation of climate relevant technologies in the development process of developing countries. It therefore proposes three main 'pillars' for climate relevant technology transfer, i.e. creating an enabling environment for stakeholders' participation, assessing mitigation and adaptation needs and opportunities, and implementing and evaluating mitigation and adaptation actions. Chapter 3 elaborates on creating an enabling environment for stakeholders' participation. It deals in particular with the selection of priority sectors and obtaining involvement of stakeholders representing these prioritised sectors, in order to start a roundtable process for the preparation of mitigation and adaptation actions. Chapter 4 covers the second pillar 'assessing mitigation and adaptation needs and opportunities'. This encompasses several assessment tasks including: identification and

  13. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  14. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  15. Aislamiento y caracterización de microorganismos con actividad lipolítica provenientes de sedimentos del Humedal El Jaboque (Bogotá, Colombia

    Directory of Open Access Journals (Sweden)

    Valencia Zapata Hernando

    2006-12-01

    Full Text Available En el humedal el Jaboque (Engativá Bogotá, Colombia, se aislaron microorganismos lipolíticos provenientes de
    sedimentos, mediante la utilización de medios de cultivo selectivos (agar tributirina, agar aceite de girasol. Primero se evaluó la concentración del sustrato (aceite de girasol en la cual se encontraba el mayor número de morfotipos aislados, luego se comparó la eficiencia de los dos medios de cultivo de acuerdo a la cantidad de morfotipos aislados. Se evaluaron tres concentraciones diferentes de sustrato. Se aisló un total de 18 cepas pertenecientes a los géneros Bacillus, Pseudomonas, Acinetobacter, Streptomyces, Penicillium, Alternaria. Los medios evaluados constituyen alternativas sencillas de aislamiento de microorganismos con actividad lipolítica en sedimentos.

  16. Utilización del medio mrs-s en el aislamiento de bacterias lácticas mesofilas en leche de cabra

    OpenAIRE

    Peña Rueda, Aurora; Fortes F., Celia L. de Luces

    2010-01-01

    Con el fin de evaluar el MRS-S (Sorbato al 0.10%) en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml), N-L (bacterias aromáticas), reducción de la leche tornasolada a 40 y 21oC y creci...

  17. Perfiles genéticos (IS6110 y patrones de resistencia en aislamientos de M. tuberculosis de pacientes con tuberculosis pulmonar. Lima Sur, Perú

    Directory of Open Access Journals (Sweden)

    Luis Capcha A

    2005-03-01

    Full Text Available Objetivos: Conocer los perfiles genéticos de M. tuberculosis y determinar el patrón de resistencia a drogas en una población de sujetos infectados provenientes del sur de Lima mediante el marcador genético IS6110 (RFLP-IS6110. Materiales y Métodos: Entre octubre de 2002 y abril de 2003 se incluyeron pacientes mayores de 15 años con tuberculosis (TB pulmonar frotis positivo procedentes de servicios de salud del distrito Villa María del Triunfo y del Hospital María Auxiliadora. Se realizó la prueba de sensibilidad a las cuatro drogas de primera línea rifampicina (RIF, isoniacida (INH, estreptomicina (SM y etambutol (EMB por el método de proporciones, y la genotipificación mediante el método estándar de RFLP-IS6110. Se recolectó información de los casos de los registros del establecimiento e historias clínicas. Resultados: De 118 aislamientos de M. tuberculosis se identificaron 97 perfiles genéticos variando entre 2 a 15 bandas por perfil. El 29,7% de los aislamientos dio origen a 14 grupos o clusters genéticos mientras que el resto mostró patrones variables de bandas. De otro lado, los perfiles de resistencia revelaron que cerca de 33% de los sujetos participantes nunca tratados presentaron resistencia a drogas y 58% de los tratados con anterioridad. La multidrogoresistencia fue de 8,42% y 36% en los nunca y anteriormente tratados respectivamente. Conclusiones: Nuestro análisis revela la existencia de grupos genéticos con relación epidemiológica o clonal sin evidencia de transmisión de cepas resistentes a múltiples drogas.

  18. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  19. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  20. PRIMER FOR FINANCIAL ANALYSIS OF POLLUTION PREVENTION PROJECTS

    Science.gov (United States)

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  1. Loop-Mediated Amplification Accelerated by Stem Primers

    OpenAIRE

    Laurence Tisi; Guy Kiddle; Olga Gandelman; Rebecca Jackson

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites ...

  2. PD5: A General Purpose Library for Primer Design Software

    OpenAIRE

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliab...

  3. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  4. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  5. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  6. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  7. Características de aislamientos de Rhizoctonia solani Huhn y su importancia como patógenos de Stylosanthes guianensis (Aubl. Sw.

    Directory of Open Access Journals (Sweden)

    Lenne Jilliam M.

    1986-06-01

    Full Text Available Se encontró considerable variación en el crecimiento, color, zonificación, esclerocios, textura del micelio y en la virulencia de siete aislamientos de R. solani. Como seis aislamientos fueron multinucleados y uno binucleado, se demostró que es indispensable determinar ésta característica en ensayos con R. solani. Los aislamientos se ubicaron en los grupos de anastomosis AG -1, AG-2, AG-4; pero en los ensayos con electroforesis de isoenzirnas los modelos de bandas para los a islamientos probadores de los AG y los probados en éste estudio fueron diferentes, lo que llevó a cuestionar la importancia de los AG. Los ecotípos de Centrosema spp y P. phaseoloides fueron más afectados que los de S. guianensis, D. ovalifolium y S. capitata. La reacción al daño de R. solani fue diferencial en los ecotipos CIAT 1283 (tardío y 184 (común y tuvo mucha relación con la edad; en general, la enfermedad se incrementó con la edad en el eco tipo tardío y disminuyó con ésta o fue independiente en el ecotipo común; el ecotipo más fectado fue el tardío; las pérdidas de forraje no fueron considerables, pero el efecto en la digestibilidad fue notorio; la capacidad de rebrote fue buena en 184. Se observó un estímulo en el crecimiento de las plantas de S.guianensis y D. ovalifolium.Considerable variation was found in the growth, color, zonation, sclerotia, mycelial texture and virulence of seven isolates of R. solani. Six multinuclease and one binuclease isolates were determined, demonstrating that it is indispensable to determine this characteristic in trials with this pathogen. The isolates were placed in three anastomosis group AG -1, AG -2 and AG -4; but with electrophoresis of isoenzymes it was found that the band models were different for the known rest AG iso lates and those isolates proven in this study which questions the importance of anastomosis qroups. Ecotypes of Centrosema spp. and P. phaseoloides were more affected than those of S

  8. Aislamiento de hongos solubilizadores de fosfatos de la rizósfera de Arazá (Eugenia stipitata, Myrtaceae Isolation of phosphate solubilizer fungi from Araza rhizosphere

    Directory of Open Access Journals (Sweden)

    Valencia Hernando

    2002-06-01

    Full Text Available Arazá (Eugenia stipitataMcVaugh, es una planta originaria de la región amazónica,que ha sido descrita como especie promisoria ya que su fruto comestible presentaexcelentes posibilidades de comercialización (Quevedo, 1995. El frutal muestra unaelevada productividad aún en suelos con muy bajo contenido de fósforo. La presenciade microorganismos solubilizadores de fosfatos podría contribuir a aumentar la dispo-nibilidad de este macroelemento. Dado que no se han publicado estudios al respecto,durante esta investigación se realizó el aislamiento y la caracterización de hongos so-lubilizadores a partir de 12 muestras de suelo en cultivos de Arazá, procedentes de 2Unidades Fisiográficas (paisajes del departamento del Guaviare (Colombia, utilizandoel método de lavado de suelo. Se obtuvieron 18 aislamientos de hongos a partir de1.152 agregados de suelo, los cuales demostraron capacidad de solubilizar fosfato nodisponible, procedente de 2 fuentes diferentes (hidrogenofosfato de calcio y fosfato dehierro III hidratados. Los principales solubilizadores del fosfato de calcio fueron Trichodermaaureoviride, Aspergillus aculeatus, Trichodermacepa 1 y Trichodermacepa 2 y para el fosfatode hierro: Aspergillus oryzae, Paecilomycescepa 3, Gongronella butleriy Fusarium oxysporum.Araza is an eatable plant, original from the Amazon region which has been describedas a promising species for commercialization (Quevedo 1995. This plant has highproductivity even in low content phosphate soil but the presence of phosphatesolubilizazing microorganisms may contribute to increase this element availability.In this study we report the isolation and characterization of solubilizing fungiprocessed using the soil washing method, from soil samples were Araza is cultivated attwo regions in Guaviare, Colombia. Eighteen isolates of fungi capable of solubilizingphosphate were obtained from 2 different sources. The most importat species that solubilized phosphate from

  9. Análisis de Vías Libres para mantenimiento partiendo de las Configuraciones de Aislamiento. // Analysis of free access for maintenance starting from isolation configurations.

    Directory of Open Access Journals (Sweden)

    A. Torres Valle

    2005-01-01

    Full Text Available La seguridad durante las intervenciones de mantenimiento se trata de manera limitada y en general independiente de lossistemas de gestión del mantenimiento. Esta variable está afectada por múltiples factores de tipo técnico o humano, muchasveces subjetivos y difíciles de cuantificar, lo que limita el diseño de planes preventivos. Sin embargo, algunos factoresconstituyen puntos comunes: las configuraciones de aislamiento durante las vías libres y los errores humanos asociados a suviolación. Esta característica permitió desarrollar el análisis de tales situaciones a través de la metodología de árboles defallos que vincula coherentemente fallos de equipos y errores humanos. La metodología ha sido automatizada dentro delcódigo MOSEG Win Ver 1.0 y la misma puede abarcar desde el análisis de una situación particular de vía libre hasta el deuna estrategia completa de mantenimiento desde el punto de vista de la seguridad del personal mantenedor.Palabras Claves: Vía libre, configuración de aislamiento, árbol de fallos, errores humanos, estrategias demantenimiento._____________________________________________________________________________Abstract.Safety during maintenance operations have been studied in a limited way and generally isolated from the maintenancemanagement system. Safety is affected by multiple both technical and human factors, of a subjective nature and difficult toquantify, this limits its value for designing preventive plans. However, some factors constitute common points namely:isolating configurations during the work protection code and human errors associated with its violation. Such situationswere able to be analyzed by following this feature through the fault tree methodology that matches equipment failures andhuman errors coherently. The methodology is automated as part of MOSEG Win Ver 1.0 code. It ranges from the analysisof particular situations up to complete maintenance strategy from the point of view of

  10. ESTUDIO DE ALGUNOS PARÁMETROS BIOECOLÓGICOS DE CUATRO AISLAMIENTOS DE DRESCHSLERA, PATÓGENO A Sorghum halepense (L Pers

    Directory of Open Access Journals (Sweden)

    F. Morell

    2004-01-01

    Full Text Available Las malezas están consideradas como la principal limitante biótica de la producción agrícola, por lo que se estiman como la plaga de mayor impacto en la actualidad; existen 205 especies de importancia económica. Varios investigadores informan el control biológico (uso de micoherbicidas como el método más económico y seguro, siempre que se use dentro de un programa de manejo integrado de plagas (MIP. Por la impor- tancia que presenta en la actualidad el uso del control biológico como método de lucha contra las malezas y en particular Sorghum halepense (L Pers , la maleza de mayor importancia económica a nivel mundial, es que se realizaron una serie de experimentos para comprobar el comportamiento en cuanto a crecimiento micelial y esporulación, de cuatro aislamientos del género Dreschslera patógenos a Sorghum halepense (L Pers ., someti- dos a diferentes valores de pH, así como también valorar su germinación en diferentes solventes y realizar la prueba de patogenicidad a diferentes especies agrícolas. El presente tra- bajo se realizó en el Laboratorio de Fitopatología en la Universi- dad Agraria de La Habana. Los pH evaluados fueron 5, 6, 7, 8 y agua corriente, agua destilada y agua destilada estéril como solventes. La prueba de patogenicidad se le realizó a los si- guientes cultivos: hierba de Guinea ( Panicun maximum , toma- te ( Lycopersicon esculentum , variedad Roma VF-P73, maíz ( Zea mays , variedad criolla, arroz ( Oryza sativa , variedad LP-7, in- cluyendo al Sorghum halepense (L Pers . Los resultados de- mostraron que los aislamientos en estudio se desarrollaron fa- vorablemente en los diferentes valores de pH a que fueron so- metidos, obteniéndose diferencias significativas en cuanto a su esporulación y germinación en diferentes solventes, así como una patogenicidad marcada para Sorghum halepense (L Pers , no siendo así para el resto de los cultivos, aspectos importantes a tener en cuenta en la obtención de

  11. Perfiles genéticos (RFLP-IS6110 y resistencia a drogas en aislamientos de M. tuberculosis de pacientes internados en un hospital referencial del Callao, Perú

    Directory of Open Access Journals (Sweden)

    Christian Baldeviano V

    2003-04-01

    Full Text Available Objetivo: evaluar la frecuencia y el agrupamiento de los perfiles genéticos (RFLP-IS6110 y los niveles de resistencia a drogas en aislamientos de M. tuberculosis de pacientes hospitalizados con tuberculosis pulmonar frotis positivo (TBP-FP en un hospital general de la provincia del Callao, Lima, Perú. Materiales y métodos: se incluyeron pacientes con TBP-FP hospitalizados en el Hospital Nacional Daniel A. Carrión entre agosto de 2000 y febrero de 2001. Se realizó la prueba de sensibilidad a las cuatro drogas de primera linea (INH, RIF, SM, EMB por el método de las proporciones y la genotipificación mediante el método estándar de RFLP-IS6110. Se recolectó la información de los pacientes de los registros de laboratorio e historias clínicas. Resultados: en 74 aislamientos, el número de bandas en los perfiles genéticos variaron entre 2 y 16, 4 perfiles (5,5% mostraron menos de 5 bandas. En total 50 perfiles genéticos fueron obtenidos de 70 pacientes. 34 aislamientos (48,6 % se agruparon en 14 "clusters" y 36 tuvieron ocurrencia única. La resistencia a drogas en pacientes nunca y antes tratados fue 45,2% y 71,1%, respectivamente. La multidrogorresistencia fue 16,1% y 36,8%, respectivamente. 10 de los 14 "clusters" incluyeron por lo menos un aislamiento resistente y un cluster agrupó 6 aislamientos resistentes. Conclusiones: No se encontró evidencia de algún genotipo predominante en la población estudiada. Sin embargo, se observaron «clusters» agrupando pacientes con TB sensible y resistente. Nuestros resultados sugieren que existen genotipos asociados a resistencia lo cual indicaría transmisión activa de cepas resistentes en la provincia del Callao. Es necesario llevar a cabo un estudio poblacional para confirmar nuestros resultados.

  12. Utilización del medio Mrs-s en el aislamiento de bacterias lácticas mesofilas en leche de cabra Utilización del medio Mrs-s en el aislamiento de bacterias lacticas mesofilas en leche de cabra

    OpenAIRE

    Fortes F. Celia L. de Luces; Peña Rueda Aurora

    1990-01-01

    Con el fin de evaluar el MRS-S (Sorbato al 0.10%) en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml), N-L (bacterias aromáticas), reducción de la leche tornasolada a 40 y 21oC y creci...

  13. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  14. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  15. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  16. Screening para el aislamiento y caracterización de microorganismos y enzimas potencialmente útiles para la degradación de celulosas y hemicelulosas

    Directory of Open Access Journals (Sweden)

    Mikán Venegas José Fernando

    2004-07-01

    Full Text Available Se presenta un modelo práctico de microbiología aplicada y biotecnología para aislar y caracterizar microorganismos, como una minús­cula muestra de la extensa biodiversidad de nuestros suelos. Se analiza su capacidad para producir depolimerasas e hidrolasas accesorias para la degradación de xiloglucanos-pectatos o glucoarabinoxilanos, con el fin de evaluar su potencial como degradadores de material vegetal. Se propone el uso del cultivo en paredes celulares vegetales como única fuente de carbono, como inductores de las actividades hidrolíticas, y el uso de las mismas paredes celulares y de xilano entrecruzado para purificar en forma rápida y económica enzimas degradadoras de celulosas y hemicelulosas. Con estos soportes de afinidad se logró un redimiento de purificación de xilanasas del 500% en un solo paso. Partiendo de 65 aislamientos se seleccionaron cinco, a los cuales se les hizo caracterización isoenzimática para celulasas y xilanasas. Se les sugiere como potencialmente útiles en compostaje y otros procesos industriales. Palabras clave: celulasas, hemicelulasas, cromatografía de afinidad, sustratos entrecruzados, diversidad microbiológica, compostaje.

  17. Aislamiento e identificación bioquímica de microorganismos bacterianos a partir de infecciones de piel en caninos

    Directory of Open Access Journals (Sweden)

    Iovana Castellanos L.

    2011-12-01

    Full Text Available Las dermatitis bacterianas o piodermas en caninos son ocasionadas por microorganismos patógenos, de los cuales el Staphylococcus intermedius es el más frecuente. Los tratamientos empíricos de este grupo de enfermedades permiten la proliferación de cepas resistentes de importancia en salud pública como es el caso del S. aureus. De igual forma, el riesgo de zoonosis reversa a partir de mascotas portadoras de cepas resistentes crea un serio problema de salud pública que requiere vigilancia epidemiológica. El objetivo de la investigación fue aislar e identificar bioquímicamente los microorganismos presentes en infecciones de piel en caninos; para esto se obtuvieron las muestras de caninos con problemas dermatológicos, y se identificaron los microorganismos bacterianos involucrados utilizando el kit de identificación rápida BBL Crystal para grampositivos. Los resultados obtenidos demostraron que el 80% de los aislamientos correspondieron a S. intermedius. Sin embargo, es necesario realizar estudios moleculares para relacionar la severidad de las lesiones dermatológicas con la identificación de los estafilococos presentes en el pioderma, y así establecer medidas de control, tratamiento y profilaxis.

  18. The insulation condition diagnosis of high tension generator stators; Diagnostico del estado de aislamiento de estatores de generadores de alta tension

    Energy Technology Data Exchange (ETDEWEB)

    Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1989-12-31

    The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.

  19. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not...... with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather...

  20. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    OpenAIRE

    Caty Martínez B; Luz Botero A; Oscar Vergara G

    2009-01-01

    Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC) y primer intervalo de parto (PIDP) en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de vari...

  1. Criminal Justice in the United States: A Primer

    OpenAIRE

    James B. Jacobs

    2007-01-01

    In this primer on the U.S. criminal justice system, James B. Jacobs, Warren E. Burger Professor of Law at New York University (NYU) and Director of the Center for Research in Crime and Justice at the NYU School of Law, explains the structure and basic jurisprudence of U.S. criminal law and criminal procedure.

  2. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  3. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  4. Detecting Lesch-Nyhan syndrome by solid phase primer extension

    Energy Technology Data Exchange (ETDEWEB)

    Shumaker, J.M.; Caskey, C.T. [Baylor College of Medicine, Houston, TX (United States); Metspalu, A.

    1994-09-01

    A mutation detection method based upon the wild type human HPRT sequence is presented for identification of Lesch Nyhan syndrome. The technique consists of performing a biotinlyated PCR amplification of the region of interest, followed by isolation and purification of single stranded template using magnetic separation. Allele-specific primers are annealed adjacent to the potential mutation site on the template. A terminal fluorescent deoxynucleotide addition is performed with a DNA template-dependent polymerase to distinguish between the mutant and wild-type sequence. The products are purified from unincorporated ddNTPs, eluted and finally analyzed on an ABI 373 to identify the mutation. The length of an extension primer is used as a position signature for mutations. The fidelity of nucleotide incorporation provides an excellent signal-to-noise ratio for the detection of nine HPRT mutations within eight cell lines. This method should detect all types of mutations except for repeated sequences that are longer than the primers. Moreover, the method is being extended to a solid support assay, whereby the extension primers are attached to a two-dimensional glass surface. Following extension, the solid support is analyzed for radioactive incorporation. We have shown the sequence determination of a five base region of a wild-type sequence and two different HPRT mutations. As more dense oligonucleotide arrays are produced, this method could be extended to sequence the complete coding region of HPRT.

  5. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  6. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  7. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  8. Análisis espacio-temporal de aislamientos del Citrus tristeza virus de Yucatán y Tamaulipas Spatio-temporal analysis of Citrus tristeza virus isolates from Yucatán and Tamaulipas

    Directory of Open Access Journals (Sweden)

    Patricia Rivas-Valencia

    Full Text Available Se estudiaron huertas comerciales de cítricos (Citrus sinensis L., ubicadas en las principales regiones productoras de Yucatán de 2003 a 2006 y en Tamaulipas en 2004. En Yucatán se realizó un estudio espacio-temporal de la dispersión de la tristeza de los cítricos, ocasionada por el Citrus tristeza virus, en presencia de Toxoptera citricida Kirkaldy. La incidencia inicial (X0 fue de 4.41% y la final (Xf de 39.33%. Los índices de agregación de Morisita y Lloyd dependientes del tamaño óptimo de cuadrante, mostraron un patrón agregado con valores entre 1.41 y 2.39. Además, se caracterizaron molecularmente aislamientos del Citrus tristeza virus, para examinar la diversidad del virus presente. Se analizaron aislamientos del virus con single-strand conformation polymorphism, observándose hasta dos haplotipos por aislamiento y tres tipos de patrones en Yucatán. En Tamaulipas, con la caracterización molecular, se identificaron tres haplotipos por aislamiento y siete patrones. El coeficiente de similaridad calculado para estas dos poblaciones de aislamientos fue de 0.7, asumiéndose un origen común de ambas poblaciones. El análisis de varianza molecular, indicó mayor variabilidad dentro de las poblaciones (69% y entre ellas (31%, comprobando que ambas regiones citrícolas, comparten variantes caracterizadas como de tipo moderado, mismo que puede justificar la ausencia de sintomatología atribuible a tristeza. Los análisis realizados para identificar el patrón de dispersión de los aislamientos en campo no evidenciaron la dispersión entre árboles e hileras.Citric (Citrus sinensis L. commercial vegetable gardens were studied, located in the main producing regions of Yucatán from 2003 to 2006 and in Tamaulipas in 2004. In Yucatán it was carried out a space-time study of dispersion of citric tristeza, caused by Citrus tristeza virus, in presence of Toxoptera citricida Kirkaldy. The initial incidence (X0 was of 4.41% and the final (Xf

  9. Aislamiento de Mycoplasma bovis en muestras de leche de estanque en rebaños lecheros del sur de Chile Detection of Mycoplasma bovis in bulk tank milk samples from herds in southern Chile

    Directory of Open Access Journals (Sweden)

    S. A SICKLES

    2000-01-01

    Full Text Available Durante el mes de julio de 1997 se realizaron exámenes bacteriológicos para el aislamiento de micoplasmas en 71 muestras de leche de estanque provenientes de rebaños lecheros del sur de Chile. Además, se cultivaron 53 muestras compuestas de leche de vacas con mastitis clínica o con elevado recuento de células somáticas. Los aislamientos de Mycoplasma se identificaron a nivel de especie mediante una prueba indirecta de inmunoperoxidasa. Mycoplasma bovis se aisló en 5 rebaños y Acholeplasma laidlawii en dos rebaños. De las muestras individuales de vaca sólo uno resultó positiva a A. laidlawii, siendo las 52 restantes negativas a Mycoplasma. Esta es la primera comunicación sobre aislamiento de micoplasmas de leche de vacas en Chile. Los médicos veterinarios y productores lecheros deberían tener presente que la mastitis por micoplasma, una enfermedad altamente contagiosa del bovino, está presente en los rebaños lecheros del sur de ChileDuring July 1997, 71 bulk tank milk samples from dairy herds located in southern Chile were examined for mycoplasma by bacteriological culture. Fifty-three composite milk samples from cows with clinical mastitis or high somatic cell counts were also examined. Isolates were differentiated to species level by an indirect immunoperoxidase test. Mycoplasma bovis was isolated from five herds while Acholeplasma laidlawii was isolated from two herds. Only one cow milk sample yielded A.laidlawii; the remaining 52 samples were negative for mycoplasma. This is the first report of isolation of mycoplasma from cow milk in Chile. Veterinarians and dairy farmers should be aware that mycoplasma bovine mastitis, a highly contagious disease, is present in dairy herds in Chile

  10. Energy saving by means of air conditioning equipment replacement and the household application of thermal insulation; Ahorro de energia electrica por reemplazo de equipos de aire acondicionado y aplicacion de aislamiento termico en viviendas

    Energy Technology Data Exchange (ETDEWEB)

    Peralta Solorio, Jose Luis [Fideicomiso para el Ahorro de la Energia (Mexico)

    2005-07-15

    An extension study of the Financing Program for Energy Saving looked for the evaluation of the electric energy saving potential obtained by the replacement of air conditioning equipment and the application of thermal insulation in 30 houses of two Mexican cities with warmth climate. In a joint effort with Comision Federal de Electricidad the consumption files of the users were analyzed and field measurements of electric demand and of refrigeration were made. As a following step the change of the refrigeration necessities derived from the application of thermal insulation were evaluated as well as the energy efficiency improvement obtained by the substitution of the air conditioning equipment and the favorable results obtained by the implementation of both measures - thermal insulation and change of air conditioning equipment in a joint form. This way, as a conclusion, the optimum sequence of application of these measures is revealed. [Spanish] Un estudio extension del Programa de Financiamiento para el Ahorro de Energia Electrica busco evaluar el potencial de ahorro de energia electrica alcanzado por el reemplazo de equipos de aire acondicionado y la aplicacion de aislamiento termico en 30 viviendas de dos ciudades mexicanas con clima calido. En un esfuerzo conjunto con la Comision Federal de Electricidad se analizaron los historiales de consumo de los usuarios y se efectuaron las mediciones de campo de demanda electrica y de refrigeracion. Como paso siguiente se valoro el cambio en las necesidades de refrigeracion derivado de la aplicacion de aislamiento termico al igual que la mejora en eficiencia energetica obtenida por la sustitucion de aire acondicionado y se identificaron los resultados favorecedores arrojados por la implementacion de ambas medidas -aislamiento termico y cambio de equipo de aire acondicionado- en forma conjunta. De esta manera, como conclusion, se devela la mas optima secuencia de aplicacion de estas medidas.

  11. PriSM: a primer selection and matching tool for amplification and sequencing of viral genomes

    OpenAIRE

    Yu, Qing; Ryan, Elizabeth M; Allen, Todd M.; Birren, Bruce W.; Henn, Matthew R.; Lennon, Niall J.

    2010-01-01

    Summary: PriSM is a set of algorithms designed to select and match degenerate primer pairs for the amplification of viral genomes. The design of panels of hundreds of primer pairs takes just hours using this program, compared with days using a manual approach. PriSM allows for rapid in silico optimization of primers for downstream applications such as sequencing. As a validation, PriSM was used to create an amplification primer panel for human immunodeficiency virus (HIV) Clade B.

  12. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    OpenAIRE

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam; Hwang, Chung-Ju

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconi...

  13. El cultivo "in vitro" como instrumento práctico para el diagnóstico y aislamiento primario de Leishmania braziliensis braziliensis. 2. Estudios en pacientes de áreas endémicas

    OpenAIRE

    C.A. Cuba Cuba; E. M. Netto; J. L. M. Costa; A.C. Barreto; Marsden, P D

    1986-01-01

    El cultivo "in vitro" de Leishmania braziliensis braziliensis constituye un método útil en el trabajo de campo, para el aislamiento primario de ésta subes-pécie de Leishmania. Cultivos en dos medios difásicos de agar sangre (DAB y EVANS) y dos medios líquidos (SCHNEIDER'S y AR-103) realizados en pacientes con lesiones cutáneas de Leishmaniasis Tegumentaria Americana (LTA) demostraron: 1) Similar sensibilidad de los medios DAB y Schneider's cuando utilizamos el procedimiento de aspiración de l...

  14. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DE Phytophthora infestans (Mont de Bary EN SOLANÁCEAS CULTIVADAS EN COLOMBIA GENETIC VARIABILITY OF ISOLATES OF Phytophthora infestans (Mont. de Bary IN SOLANACEOUS CROPS FROM COLOMBIA

    Directory of Open Access Journals (Sweden)

    Natalia Raigosa Gómez

    2009-06-01

    Full Text Available Se estudio el nivel de variabilidad genética de una población de 35 aislamientos de Phytophthora infestans obtenidos en diferentes hospedantes y regiones geográficas de Colombia, mediante las técnicas de haplotipos mitocondriales y RAPD. Los resultados encontrados sugieren la existencia en el país de los haplotipos mitocondriales Ia en los aislamientos que afectan tomate de árbol (Solanum betaceum y IIa en cultivos de papa; dichos haplotipos están asociados a los linajes genéticos EC-3 y EC-1, respectivamente. Sin embargo, tres aislamientos obtenidos en tomate de mesa (S. lycopersicum, pimentón (Capsicum sp. y pepino de agua (S. muricatum requieren de un análisis posterior, debido a la falta de correlación entre los perfiles de restricción generados con los cuatro pares de cebadores utilizados en esta prueba y los haplotipos mitocondriales mencionados en la literatura. De otra parte, mediante cuatro cebadores RAPD, fue posible encontrar variabilidad al interior de los dos linajes genéticos, siendo interesante el hecho que los aislamientos obtenidos en tomate de árbol (EC-3 fueron divididos en dos grupos, relacionados con una distancia genética de 0,17. Estos hallazgos indican que es importante contemplar las fuentes de variación asexual en el análisis de la estructura poblacional de este oomycete y por tanto en el diseño de las estrategias de control de las enfermedades que causa P. infestans en cultivos de solanáceas de importancia económica.The level of genetic variability of 35 isolates of Phytophthora infestans obtained from different hosts and geographical regions of Colombia was studied through mitochondrial haplotypes and RAPD techniques. Results suggested the existence of mitochondrial haplotypes Ia affecting tree tomato (Solanum betaceum and IIa in potato, which are associated with genetic lineages EC-3 and EC-1, respectively. However, three isolates obtained from tomato (S. lycopersicum, capsicum (Capsicum sp. and

  15. Caracterización morfológica, biológica y genética de un aislamiento Colombiano de granulovirus de Erinnyis ello (L.) (Lepidoptera: Sphingidae)

    OpenAIRE

    Gloria Patricia Barrera Cubillos; Juliana Gómez; Paola Cuartas; Guillermo León; Laura Fernanda Villamizar Rivero

    2014-01-01

    Título en español: Caracterización morfológica, biológica y genética de un aislamiento Colombiano de granulovirus de Erinnyis ello (L.) (Lepidoptera: Sphingidae)Título en ingles: Characterization of a Colombian isolate of Erinnyis ello granulovirus (L.) (Lepidoptera: Sphingidae)Titulo corto: Granulovirus de E. elloResumen: El gusano cachón Erinnyis ello (L.) es una plaga polífaga que puede causar graves pérdidas en cultivos de caucho. El uso de granulovirus representa una alternativa interesa...

  16. Selection of Native Fungi Strains Pathogenic to Vespula germanica (Hymenoptera: Vespidae Selección de Aislamientos Nativos de Hongos Patogénicos a Vespula germanica (Hymenoptera: Vespidae

    Directory of Open Access Journals (Sweden)

    Loreto Merino

    2007-12-01

    Full Text Available The yellowjacket wasp, Vespula germanica F., is considered a serious pest of productive and recreational activities worldwide. A pathogenicity study was carried out with 29 strains of Metarhizium anisopliae and 30 of Beauveria bassiana against worker and male wasps. Wasps of the same age were fed with liquid sugar baits containing 1 x 10(8 conidia mL-1 suspensions of each strain. The highest mortality and sporulation were obtained with the strains Qu-B941 and Qu-B933 of Beauveria bassiana, reaching 79 and 95% mortality for workers and 66 and 73% for males, respectively. The strains were tested on workers of V. germanica with increasing amounts of bait from 0 to 1 x 10(8 conidia mL-1. The results also showed that 1 x 10(8 conidia mL-1 increased up to 90 and 97% the mortality of workers with Qu-B941 and Qu-B933 strains, respectively.La avispa chaqueta amarilla, Vespula germanica F., es una especie cosmopolita, considerada en muchos países como un problema serio para el desarrollo de actividades productivas y recreativas. Entre las nuevas alternativas para el control de la plaga está el uso de hongos entomopatógenos. Se estudió la patogenicidad de 29 aislamientos de Metarhizium anisopliae y 30 de Beauveria bassiana, sobre obreras y machos de la avispa. La evaluación se realizó sobre adultos de igual edad, administrando dosis de 1 x 10(8 conidia mL-1 de cada aislamiento, en cebos líquidos azucarados. La mortalidad y esporulación de los aislamientos de Beauveria bassiana Qu-B941 y Qu-B933 fueron significativamente mayores, alcanzando porcentajes de mortalidad de 79 y 95% para obreras y de 66 y 73% para machos, respectivamente. Estos aislamientos fueron evaluados en cebos con suspensiones crecientes de 0 a 1 x 10(8 conidia mL-1 sobre obreras de V. germanica. Los resultados obtenidos muestran que mayores concentraciones de inóculo incrementan significativamente los índices de mortalidad, alcanzando 90 y 97% para Qu-B941 y Qu-B933

  17. Detección de umbrales de área y distancia de aislamiento para la ocupación de fragmentos de selva por monos aulladores, alouatta palliata, en los Tuxtlas, México

    OpenAIRE

    S. Mandujano; Estrada, A.

    2005-01-01

    ¿Existen umbrales de tamaño y distancias de aislamiento de fragmentos de selva a los cuales la ocupación de estos por monos aulladores decae significativamente? ¿Son estos umbrales similares independientemente de la localidad geográfica? Para responder estas preguntas comparamos las poblaciones de monos aulladores habitando dos paisajes con distinto grado de pérdida y fragmentación de la selva en Los Tuxtlas, Veracruz, México. Los paisajes investigados cubren áreas de 3200 ha y 4965 ...

  18. Aislamiento de Staphylococcus epidermidis portador de integrón clase 1 en un paciente con sepsis neonatal Isolation of Staphylococcus epidermidis strain carrier of the class one integron in a septic neonatal patient

    OpenAIRE

    Gladys Pinilla; Liliana Muñoz; Ariel Ivan Ruiz; Bibiana Chavarro; Yolanda Cifuentes

    2009-01-01

    Objetivo. Determinar la presencia y secuencia del integrón clase I en un aislamiento clínico de Staphylococcus epidermidis proveniente de un neonato con diagnóstico de sepsis. Materiales y métodos. En una cepa de S. epidermidis, aislada de una muestra de hemocultivo de un neonato, se realizaron las pruebas de identificación microbiológica, susceptibilidad antimicrobiana y la caracterización molecular de los genes aac6´-aph2´´, mecA, el gen de la integrasa intI1 y el gen casete aac6´. Resultad...

  19. Resolución numérica de fenómenos convectivos con condiciones de contorno periódicas. Aplicación a aislamientos transparentes

    OpenAIRE

    Quispe Flores, Marcos Oswaldo

    2003-01-01

    Se ha desarrollado una infraestructura numérica, que permite el estudio de problemas donde están presentes fenómenos periódicos espaciales, haciendo uso de dominios computacionales reducidos con condiciones de contorno periódicas. Se enfoca en particular el estudio de la convección natural del aire, numérica y experimentalmente, en estructuras honeycomb de tipo rectangular, de interés aplicativo en aislamientos transparentes para sistemas solares térmicos. Para abordar el estudio, la tesis se...

  20. RESPUESTA DE DOS AISLAMIENTOS CHILENOS DE Metarhizium anisopliae (METSCHNIKOFF) SOROKIN A LA ADICIÓN DE UN PROTECTOR SOLAR Response of two Chilean Metarhizium anisopliae (Metschnikoff) Sorokin isolates to the addition of a solar sunscreen

    OpenAIRE

    Luis Devotto M.; Marcos Gerding P

    2003-01-01

    Dos aislamientos chilenos de Metarhizium anisopliae (Metchsnikoff) Sorokin fueron expuestos a dosis crecientes de luz ultravioleta (UV), en condiciones de laboratorio. Conidias en suspensión acuosa fueron esparcidas en placas Petri con agar y éstas fueron puestas bajo una lámpara de luz UV-C (lambda = 254 nm). Sin el protector solar, la exposición de las conidias durante 40 s redujo su germinación de 80-95% a sólo 5-2%, para QU-M221b y QU-M363, respectivamente. Usando el protector solar Blank...

  1. Aislamiento y selección de una cepa bacteriana degradadora de hidrocarburos a partir de suelos contaminados con petróleo

    Directory of Open Access Journals (Sweden)

    Rosa María Pérez Silva

    2008-01-01

    Full Text Available El conocimiento científico acerca del papel que desempeñan los microorganismos en el tratamiento de agentes contaminantes del medio ambiente como el petróleo, es esencial para prevenir y controlar los daños que puedan ocasionar los derrames o fugas de estos contaminantes. La degradación de petróleo es un proceso que puede ocurrir de forma natural por los microorganismos nativos de las zonas contaminadas aprovechando sus rutas metabólicas. Por esta razón, en estos momentos se prevé que los microorganismos pueden ofrecer esta posibilidad en tecnologías basadas en el uso de estos en la remediación de la contaminación ambiental por petróleo y sus derivados. En el presente trabajo, se estudió la biodegradación de petróleo por cepas aisladas de suelos contaminados con petróleo, mediante un aislamiento realizado por enriquecimiento secuencial utilizando petróleo Mesa 30/Puerto escondido (80 : 20 como única fuente de carbono y energía. Se aislaron 9 cepas bacterianas, cinco Gram negativas y cuatro Gram positivas, que fueron identificadas según el Manual Bergey's, 1994. Las pruebas bioquímicas evaluadas confirmaron que las cepas aisladas AT14, AT15, AT16, AT17 y AT18 corresponden a Pseudomonas aeruginosa. En este estudio, se seleccionó la cepa Pseudomonas aeruginosa AT18, por mostrar mayor crecimiento sobre petróleo como única fuente de carbono y energía al obtenerse 1,83 g/L de biomasa celular, lo que representa un 57 % de biodegradación de petróleo.

  2. Análisis de la diversidad genética de 21 aislamientos del hongo Moniliophthora roreri basado en marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Boris Gutarra Castillo

    2013-12-01

    Full Text Available Objetivos: Estudiar la diversidad genética de 21 aislamientos del hongo que afecta al cultivo del cacao, Moniliophthora roreri, en tres zonas cacaoteras del Perú (Tocache, Mariscal Cáceres y Leoncio Prado. Métodos: Se utilizó 14 iniciadores RAPD (random amplified polymorphic DNA polimórficos y una pareja de oligonucleótidos, los que fueron empleados bajo condiciones de amplificación estandarizadas. Con los datos obtenidos se construyó un dendograma utilizando el coeficiente de Jaccard y el algoritmo UPGMA (Unweighted Pair-Group Method using Arithmetic Average. La estructura genética fue estimada en función del análisis molecular de variancia (AMOVA y la diversidad mediante los índices de Shannon y Nei. Resultados: Fueron conseguidas 59 bandas RAPD con un 73% de polimorfismo. El dendograma obtenido a un índice de similitud de 0,70, claramente dividió los individuos en tres grupos. El análisis de la diversidad genética mostró altos valores en las zonas estudiadas de acuerdo con el índice de Shannon (0,3936 y de Nei (0,2622, con mayor riqueza en Leoncio Prado. Estas zonas presentan alta variabilidad, y según el AMOVA realizado: 88% entre accesiones por zona y solo 12% entre zonas. Conclusiones: Existe más de un grupo genético de Moniliophthora roreri en la Amazonía del Perú. Estos grupos, provenientes del Ecuador, pudieron haber ingresado por el intercambio de semillas y/o de forma natural por medio de los ríos en común y estarían originando nuevos grupos genéticos locales.

  3. DETERMINACIÓN DE Escherichia coli 0157 A PARTIR DE PRODUCTOS CÁRNICOS Y LÁCTEOS ARTESANALES EMPLEANDO DOS SISTEMAS DE AISLAMIENTO

    Directory of Open Access Journals (Sweden)

    Franco U. Lina

    2001-06-01

    Full Text Available Con el objeto de determinar la presencia de E.coli 0157 en alimentos, se analizaron 300 muestras de productos cárnicos y lácteos artesanales. Para su aislamiento e identificación se utilizaron dos técnicas; una tradicional donde después de seis horas de incubación de la muestra en agua peptonada al 1% suplementada con novobiocina (20 mg!L se inocularon placas con agar Mac Conkey Sorbitol. Por medio de esta técnica se identificó Esclzericlzia coli 0157 a partir de una sola muestra (0.33% de las 300 analizadas correspondiente a un derivado cárnico (hamburguesa; también se identificó E.coli en un 1.6%. Simultáneamente se realizó una técnica rápida con Agar Fluorocult, para E.coli 0157: H7, y de las trescientas muestras aisladas se identificaron microorganismos como Esclzericlzia coli 0157 (0.33%, E. coli (25%, Slzigella sonnei (10% , E. aerogenes (9%, P. mirabilis (4% . De las dos técnicas ensayadas estas presentaron el mismo porcentaje de recuperación de Esclzericlzia coli 0157.El método rápido, utilizando Agar Fluorocult, para E. coli O157: H7 permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en 48 horas. En contraste el método tradicional utilizando agar Mac Conkey Sorbitol permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en cinco días. Los métodos y técnicas utilizadas permiten que este estudio pueda reproducirse fácilmente con resultados puntuales.

  4. Frequency of isolation of streptococus agalactiae in pregnant women and their offspring Frecuencia de aislamiento de Streptococcus agalactiae en un grupo de embarazadas y sus productos

    Directory of Open Access Journals (Sweden)

    Nancy E. Agudelo O.

    1989-02-01

    Full Text Available

    A group of 88 pregnant women and 61 of their newborn Infants was studied In order to determine the frequency of isolation of Streptococcus agalactiae; all genital maternal cultures were negative but 3 mothers and 2 Infants had positive pharyngeal secretions; no evidence of streptococcal disease was found in the colonized Infants. The frequency of colonization found in this study agrees with that reported by other authors but the reduced number of cases does not allow In depth epidemiological considerations.

    Se estudiaron 88 madres y 61 de sus recién nacidos con el fin de determinar la frecuencia de aislamiento de Streptococcus agalactiae (estreptococo beta hemolítico del grupo B; no se aisló el germen de ninguno de los cultivos tomados de las secreciones del cuello uterino pero sí a partir de las muestras faringeas, en tres de las madres (3.4% y en dos de sus hijos. El tercer niño no se estudió porque su nacimiento ocurrió por cesárea. Las cifras encontradas en el presente trabajo están de acuerdo con lo que relata la literatura, pero el bajo número de casos estudiado no permite hacer consideraciones epidemiológicas más profundas.

  5. SPECT single photon emission computed tomography: A primer

    International Nuclear Information System (INIS)

    This book aims to assist nuclear medicine technologists in expanding their knowledge of nuclear medicine to include SPECT. The text of this primer is written with the assumption that the reader is proficient in most elements of nuclear medicine technology; therefore, the information is limited to data that will answer the basic questions of single-photon emission computed tomography .... The authors' goal is to bring the basics of this material together in a manner that would answer the technologist's fundamental questions. The authors have designed this primer in a generic manner to be used as an extension of the manufacturer's operating manual .... A glossary is included which contains some of the terminology relevant to the specialty, and reading lists are provided at the end of each chapter to direct the reader to more comprehensive text on specific subjects

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  9. Utilización del medio Mrs-s en el aislamiento de bacterias lácticas mesofilas en leche de cabra Utilización del medio Mrs-s en el aislamiento de bacterias lacticas mesofilas en leche de cabra

    Directory of Open Access Journals (Sweden)

    Fortes F. Celia L. de Luces

    1990-12-01

    Full Text Available Con el fin de evaluar el MRS-S (Sorbato al 0.10% en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml, N-L (bacterias aromáticas, reducción de la leche tornasolada a 40 y 21oC y crecimiento a 45 y 10oC.Las cepas seleccionadas se sometieron a caracterización fisiológica y Bioquímica. El medio MRS-S mostró ser efectivo con un porcentaje de inhibición de la flora indeseable del 86.56%, y adecuado por el aislamiento de Lactococcus. De acuerdo con los perfiles taxonómicos se consiguió aislar de un total de 156 colonias dos Lactococcus lactis subsp. lactis y un Lactococcus lactis biovar diacetilactis.With the objective of evaluating the MRS-S (0.10% of sorbate in the isolation of lactic bacteria samples of raw goat milk were cultivated in MRS-S and PCA in deep and incubated in aerobic conditions for 48 hours al 32oC. Gram positive coccus, negative catalase which grew in MRS-S were isolated and preliminarly characterized through the growing process in agar MRS-S, MRS-T (O.20ltg/ml tetracycline, N-L (aromatic bacteria, litmus milk reduction at 40 and 210C and growing at 45 and 10oC. Selected strains were subject to the physiological and biochemical characterization. MRS-S media showed to be effective with an 86.56% of inhibition for indesirable bacteria and adequated for Lactococcus isolation. Related to taxonomic profiles from 156 colonies were isolated two lactococcus lactis subsp. lactis and one Lactococcus luctis biovar diacetilactis.

  10. MERS-CoV PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ...

  11. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  12. El primer llibre de la Biblioteca de Comunicació

    OpenAIRE

    Moragas Spà, Miquel de,

    2010-01-01

    El primer llibre va ser "El espíritu del tiempo", d'Edgar Morin. Un llibre sobre la cultura de masses i els mitjans de comunicació, mal vist en aquells anys 70 per la sociologia més acadèmica i oficial, però de fet un dels fundadors dels estudis interdisciplinaris de la comunicació

  13. Introduction to Command, Control, and Communications: a primer

    OpenAIRE

    Eidson, Edward H.

    1995-01-01

    This thesis is a primer for students in the Introduction to Command, Control, and Communications Courses at the Naval Postgraduate School. This document provide students a consolidated reference that emphasizes key concepts and ideas presented by the course instructor and required readings. Its organization closely parallels the course outline used for in-class instruction. It supports course objectives by providing an executive overview of a wide variety of C2 topics. These topics include: C...

  14. The Primer for Sports Medicine Professionals on Imaging

    OpenAIRE

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathol...

  15. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  16. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  17. Fundamentals of statistical evidence—a primer for legal professionals

    OpenAIRE

    Aitken, Colin; TARONI, FRANCO

    2008-01-01

    Criminal courts are today frequently confronted with statistical evidence, notably in relation to DNA profiling. Recent experience tends to confirm both widespread perceptions and more systematic research indicating that probability and statistics are not handled confidently, or always competently, by lawyers, judges, jurors or even by forensic scientists. Conceived as a primer for legal professionals, this article reviews basic statistical terminology and its forensic applications, and explo...

  18. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  19. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  20. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  1. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  2. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...... and chemically modified antisense oligonucleotides we found that interactions between the anticodon of tRNALys3 and an A-rich loop of viral RNA led to an important destabilization of the pre-primer binding site; this region became accessible to anti-pre-primer binding site oligonucleotides in a...

  3. Evaluation of antibacterial activity of three dentin primers using an in vitro tooth model.

    Science.gov (United States)

    Ohmori, K; Maeda, N; Kohno, A

    1999-01-01

    This study compared the antibacterial activities of three dentin primers and investigated a newly designed experimental system using a bovine tooth model method for evaluating antibacterial activity by comparing this method with a conventional disk diffusion method. The antibacterial activities of SA primer in Clearfil Liner Bond, LB primer in Clearfil Liner Bond II, and ED primer in Panavia 21 were evaluated using the conventional disk diffusion method. The 50 microliters aliquot of each primer was applied to three sterilized paper disks, then placed onto Tryptic Soy agar plates already inoculated with Streptococcus mutans. After anaerobic incubation for 48 hours, the diffusion of antibacterial components was determined using the inhibition zone produced around the paper disk. The diameter of the inhibition zones was measured and the average calculated. Standardized cavities (diameter 5.0 mm, depth 3.0 mm) were prepared on the labial surfaces of bovine teeth and inoculated with S mutans (10(6) CFU/microliter) following sterilization by 60Co gamma rays (50 KGy). The teeth were divided into four groups: SA primer, LB primer, ED primer, and a control group. Except for the control teeth, the cavity preparations were treated with the respective dentin primers, and then firmly sealed with a temporary sealing material. The teeth were placed in bottles containing melted Tryptic Soy agar. Five ml of Tryptic Soy broth was then added to the surface of the hardened Tryptic Soy agar. After 1 week's incubation of the teeth in the bottles at 37 degrees C, the number of bacteria remaining in each cavity was counted, except for eight specimens, which were used for SEM observation. The ED primer showed the widest inhibition zone in the disk diffusion test, which was significantly different from the other primers. Using the bovine tooth model, all dentin primers showed antibacterial activity, with significant differences found among the four groups. The results indicated that ED

  4. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  5. Caracterización genotípica y fenotípica de aislamientos clínicos de Vibrio cholerae provenientes de Sudáfrica

    Directory of Open Access Journals (Sweden)

    Edith Suzarte-Portal

    2011-01-01

    Full Text Available Numerosas epidemias de cólera causadas por cepas de Vibrio cholerae toxigénico del serogrupo O1 azotan a muchos países de Africa Subsahariana, sin embargo, existe poco conocimiento de las características de estas cepas epidémicas. El presente trabajo caracteriza un grupo de cepas de V. cholerae biotipo El Tor aisladas en pacientes de cólera en Sudáfrica durante 2003. Se estudió la producción de toxina colérica, la organización del profago CTX¿ en el genoma, el perfil proteico por SDS-PAGE, el polimorfismo de los fragmentos de restricción del gen que codifica para el ARN ribosomal 16S y la resistencia a tetraciclina. La cantidad de toxina producida en medio AKI por estos aislamientos, se determinó mediante un ensayo de GM1-ELISA y osciló entre 200 y 2 200 ng/mL, lo cual concuerda con las cantidades informadas para otras cepas El Tor cultivadas en las mismas condiciones. Todas las cepas analizadas mostraron resistencia a tetraciclina como consecuencia de la presencia del gen tetA en su genoma. Al analizar la organización del profago CTX¿ en el genoma de estas cepas, se pudo demostrar la existencia de una estructura particular de CTX¿ caracterizada por una o múltiples copias en tándem del profago integrado en el cromosoma II de V. cholerae y un RS1 independiente en el sitio dif del cromosoma I o mayor. Esta estructura difiere de la descrita para la mayoría de las cepas de V. cholerae El Tor. El perfil proteico en SDS-PAGE y el análisis de ribotipos en estas cepas mostró que todas conformaban un grupo fenotípicamente homogéneo con un posible origen clonal.

  6. Cuantificación, aislamiento e identificaciónde comunidades anaerobias amilolíticas de un manantial termomineral de Paipa, Boyacá

    Directory of Open Access Journals (Sweden)

    Posada Yully

    2004-12-01

    Full Text Available Se cuantif icaron microorganismos anaerobios termofílicos amilolíticos de un manantial termomineral en la región andina (5° 45' 69’’ N, 73° 6' 61’’ W, 2500 msnm a través del Número Más Probable (NMP. Los recuentos microbianos de las poblaciones presentaron valores entre 1,9*102 células/100 mL y 5.8*102 células/100 mL en presencia de almidón y tiosulfato como aceptor de electrones y 1,4*102células/100 mL y 3,4*102 células/100 mL en presencia solamente de almidón. Se realizaron aislamientos microbianos a partir de las últimas diluciones positivas del NMP y se aislaron 8 cepas bacterianas denominadas P4-6, P4-7, P4-8, P4-9, P4-10, P4-11, P4-12 y P4-13. Estas cepas crecieron a temperaturas óptimas entre 60 y 65 °C, y exhibieron un metabolismo fermentativo. El principal producto de fermentación fue etanol seguido de acetato, CO2 e hidrógeno. El tiosulfato fue utilizado como aceptor externo de electrones, pero el sulfato o el hierro férrico no fue reducido. La diversidad filogenética de estas 8 cepas fue evaluada por medio de geles de electroforesis de gradiente denaturalizante (DGGE. Se analizó la secuencia del gen 16S rRNA de dos de las cepas aisladas (P4-6 y P4-9 y el análisis indicó que éstas pertenecen a la familia Thermoanaerobiaceae del dominio Bacteria. Del análisis fenotípico y genotípico se deduce que estos organismos pertenecen al género Thermoanaerobacter, y con base en el análisis de las secuencias del 16S rDNA se observa una similitud del 98% con Thermoanaerobacter italicus y Thermoanaerobacter mathranii. Palabras clave: termofilia, manantiales termominerales, anaerobiosis, Thermoanaerobacter, DGGE.

  7. Susceptibilidad antimicrobiana de aislamientos clínicos en el Hospital "Jose Martí y Perez" de Sancti Spíritus, Cuba

    Directory of Open Access Journals (Sweden)

    Estrella Álvarez Varela

    2009-01-01

    Full Text Available Se realizó un análisis retrospectivo de la información de la base de datos de antibiogramas de un grupo de microorganismos aislados en el hospital "José Martí y Pérez" de la provincia de Sancti Spíritus, perteneciente a la Red Nacional del Sistema DIRAMIC, durante el periodo enero de 2000 a diciembre de 2007. El procesamiento de los datos de susceptibilidad se realizó utilizando el sistema de programas para la confección de los Mapas Microbianos versión 6.1. Fueron estudiadas un total de 4 695 cepas, de ellas 3 766 correspondientes a muestras procedentes de la consulta externa hospitalaria y 929 intrahospitalarias. Los gérmenes aislados con mayor frecuencia fueron Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa y Proteus mirabilis, provenientes de infecciones del tracto urinario, lesiones de la piel y partes blandas, secreciones óticas, bacteriemias e infecciones de las vías respiratorias superiores. Los aislados intrahospitalarios de Escherichia coli alcanzaron porcentajes de resistencia significativamente superiores (p = 0,02 con respecto a los de consulta externa hospitalaria para ampicilina (63,2 % contra 71,0 % y gentamicina (28,2 % contra 35,8 %. Los porcentajes de resistencia de Proteus mirabilis de consulta externa hospitalaria fueron superiores que los intrahospitalarios, siendo significativos para cefazolina (p = 0,02, 63,6 % contra 40,0 % y norfloxacina (p = 0,005, 26,7 % contra 12,5 %. Pseudomonas aeruginosa mostró porcentajes de resistencia superiores en el ámbito hospitalario, siendo significativo (p = 0,04 para gentamicina (26,3 % contra 37,8 %. Staphylococcus aureus resistente a oxacilina representa más del 70 % de los aislamientos, tanto de la consulta externa hospitalaria como de pacientes hospitalizados. Se hace necesario estrechar la vigilancia del comportamiento futuro de la susceptibilidad para los antibióticos estudiados.

  8. Determinación de la relación clonal de los aislamientos de Salmonella typhi recuperados en el programa de vigilancia por el laboratorio de EDA en Colombia durante el período 1997-2003 mediante la electroforesis en campo pulsado

    Directory of Open Access Journals (Sweden)

    Hidalgo Marylin

    2005-07-01

    Full Text Available La tipificación molecular de Salmonella typhi y paratyphi es necesaria para complementar los análisis epidemiológicos de las fiebres entéricas en Colombia. El objetivo del trabajo fue establecer la relación genética de los aislamientos de Salmonella typhi y paratyphi recuperados durante el período 1997-2003, en varias regiones del país. Se utilizaron 58 aislamientos de S. typhi, tres de S. paratyphi A, dos de S. paratyphi B y 1 de S. paratyphi C, recibidos por el programa de vigilancia de EDA del Instituto Nacional de Salud (INS. Para determinar la relación genética se empleó la electroforesis en gel de campo pulsado y se calculó un dendrograma; para evaluar la asociación entre los patrones electroforéticos obtenidos y las características de los aislamientos, como datos
    demográficos de los pacientes, tipo de muestra, año y procedencia, se utilizó un análisis de correspondencias. Los datos de S. typhi se analizaron en conjunto con 15  islamientos tipificados anteriormente en el INS. Se obtuvieron 36 patrones electroforéticos, 31/36 (86,1%, representados en 68/73 (93,1% aislamientos, estuvieron relacionados genéticamente. Los patrones S.Ty0001 y S.Ty0012 predominaron en el país. En el análisis de correspondencias, no se encontró asociación entre los patrones electroforéticos y las características de los aislamientos. Los aislamientos de S. paratyphi A estuvieron relacionados genéticamente mientras que los de S. paratyphi B no guardaron relación. A pesar de la considerable heterogeneidad de los aislamientos colombianos de Salmonella typhi, definida por el número de patrones electroforéticos, la mayoría de ellos guardan una relación genética, sugiriendo un origen común de los mismos.

  9. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  10. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  11. Bt-CoV HKU3 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  12. Bt-CoV HKU5 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU5 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU5 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU5 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...

  13. Debate del primer seminario de investigación

    OpenAIRE

    Ortega, Tomás

    2002-01-01

    Una vez concluidas las intervenciones de los tres ponentes del primer Seminario de Investigación (Dr. Moisés Coriat –U. Granada-, Dr. Alejandro Fernández –U. Valencia y José Carrillo -U. Huelva-), la réplica a sus informes, presentada por la Dra. Joana Brocardo, y la contrarréplica de los ponentes que siguió a la exposición de la Dra. Brocardo, comienza el debate propiamente dicho. en el que intervienen los asistentes presentes en la sala

  14. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  15. The primer for sports medicine professionals on imaging: the shoulder.

    Science.gov (United States)

    Farshad-Amacker, Nadja A; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  16. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  17. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  18. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  19. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  20. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  1. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  2. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  3. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  4. Selección de Aislamientos de Hongos Entomopatógenos para el Control de Huevos de la Polilla del Tomate, Tuta absoluta Meyrick (Lepidoptera: gelechiidae Entomopathogenic Fungi Isolates Selection for Egg Control of Tomato Moth Tuta absoluta Meyrick (Lepidoptera: gelechiidae Eggs

    Directory of Open Access Journals (Sweden)

    Marta Rodríguez S.

    2006-06-01

    Full Text Available Se realizó un estudio en laboratorio sobre la patogenicidad de 64 aislamientos de Metarhizium anisopliae var. anisopliae y 70 de Beauveria bassiana, en huevos de polilla del tomate Tuta absoluta. La primera evaluación se realizó por aplicación directa de suspensiones de 10(7 conidias mL-1 para cada aislamiento, con el sistema de pulverización de la torre de Potter. La mortalidad y esporulación sobre huevos fueron significativamente mayores con los aislamientos M. anisopliae Qu-M558 y B. bassiana Qu-B911, Qu-B912 y Qu-B928. Estos aislamientos fueron evaluados nuevamente en suspensiones crecientes de 0 a 10(8 conidias mL-1. Los aislamientos Qu-M558 y Qu-B912, produjeron los mayores porcentajes de mortalidad sobre la base del cálculo del área bajo la curva del progreso de mortalidad de huevos, 80 y 60%, respectivamente.A pathogenicity study of 64 Metarhizium anisopliae var. anisopliae and 70 Beauveria bassiana isolates against tomato moth Tuta absoluta eggs, was carried out under laboratory conditions. The first evaluation was accomplished by spraying suspensions of 10(7 conidias mL-1 of each isolate directly on eggs, through a Potter tower. Mortality and conidia production on the eggs were significantly higher with the isolates M. anisopliae Qu-M558 and B. bassiana Qu-B911, Qu-B912 and Qu-B928. These isolates were newly evaluated using increasing conidia concentrations (0 to 10(8 conidia mL-1 of each of the five selected isolates. The isolates Qu-B912 and Qu-M558 produced the highest mortality percentages based on the area under mortality progress curve for each concentration, 80 and 60%, respectively.

  5. Les primeres locutores de ràdio a Catalunya, dels inicis de l’invent al primer franquisme

    OpenAIRE

    Espinosa i Mirabet, Sílvia

    2009-01-01

    Aquest article posa de manifest el paper preponderant que tingueren les locutores en les emissores de ràdio que operaven a Catalunya sota l’epígraf EAJ durant els anys vint i trenta del segle XX. Les locutores foren les primeres professionals del mitjà que crearen programes (els femenins) amb un format que més endavant es coneixeria com a magazín, en un moment històric (anys vint) en el qual la ràdio estava plena de conferències i xerrades. La segona gran aportació de les dones a la història ...

  6. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  7. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  8. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  9. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  10. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be...... designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in...

  11. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  12. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites....... While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown...

  13. A method for predicting service life of zinc rich primers on carbon steel

    Science.gov (United States)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  14. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    OpenAIRE

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-01-01

    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). ...

  15. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  16. Predicting the success of primer extension genotyping assays using statistical modeling

    OpenAIRE

    Yuryev, Anton; Huang, Jianping; Pohl, Mark; Patch, Robert; Watson, Felicia; Bell, Peter; Donaldson, Miriam; Phillips, Michael S.; Boyce-Jacino, Michael T.

    2002-01-01

    Using an empirical panel of more than 20 000 single base primer extension (SNP-IT) assays we have developed a set of statistical scores for evaluating and rank ordering various parameters of the SNP-IT reaction to facilitate high-throughput assay primer design with improved likelihood of success. Each score predicts either signal magnitude from primer extension or signal noise caused by mispriming of primers and structure of the PCR product. All scores have been shown to correlate with the su...

  17. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  18. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  19. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    International Nuclear Information System (INIS)

    Research highlights: → Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. → The solvents of the primer are eco-friendly ones. → The primer adheres on galvanized steel and allows top-coating. → The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  20. Foamglas D. 1. T. N.° 19 Convalidación del Agrément 1. N. L n.° 1.031. Aislamiento de cubiertas isolation pour toitures roof insulation

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1968-11-01

    Full Text Available Not availableEl Foamglas es un material constituido por vidrio químicamente puro, de tipo boro-silicato, inorgánico, sin adición de aglomerante. Se presenta y utiliza en placas de diferentes dimensiones estandarizadas. Estas placas se colocan en cubiertas planas o con pendiente. Se unen con betún y se recubren con una impermeabilización. Otros empleos no considerados en el presente documento son: en el doblado de muros, en las cámaras frigoríficas, en las fachadas ligeras, falsos techos, en el aislamiento de depósitos de agua y tuberías.

  1. RESPUESTA FISIOLÓGICA Y CAPACIDAD ANTAGONISTA DE AISLAMIENTOS FILOSFÉRICOS DE LEVADURAS OBTENIDOS EN CULTIVOS DE MORA (Rubus glaucus Physiological Responses And Antagonistic Capacity Of Yeast Phyllospheric Isolates Obtained In Blackberry Crops (Rubus glaucus

    Directory of Open Access Journals (Sweden)

    CLAUDIA M MEDINA

    Full Text Available La filósfera es un ecosistema complejo que a pesar de contar con un gran número de microorganismos asociados, presenta pocos estudios diseñados para entender las características ecofisiológicas de los microorganismos que lo habitan. Las levaduras, como elemento importante de este hábitat, están expuestas a un ambiente variable afectado por la planta hospedera, edad y posición de la hoja, disponibilidad y calidad de nutrientes, temperatura, pH, radiación y actividad del agua. Estos factores producen una presión de selección para el establecimiento de poblaciones naturales o introducidas de levaduras que puedan desplazar otras poblaciones de hongos fitopatógenos. En este estudio se obtuvieron 80 aislamientos de levaduras filosféricas de dos cultivos de mora (Rubus glaucus, a las que se les determinó su nicho potencial en términos de su capacidad para crecer a diferentes condiciones de temperatura, pH, estrés osmótico y tolerancia a radiación UV. El estrés osmótico fue la condición evaluada más restrictiva para las levaduras obtenidas, ya que únicamente seis aislamientos presentaron un crecimiento superior a 0,3 unidades de DO a 405 nm, cuando fueron crecidas a 50% y 60% de glucosa. Este estudio permitió seleccionar diez aislamientos filosféricos de levaduras, destacados por su capacidad para crecer en un amplio rango de condiciones. De estos, cuatro aislamientos LvF 34, LvF 43, LvF 44 y LvF 50 se destacaron por su capacidad de antagonismo contra el hongo fitopatógeno Botritys cinérea. Su determinación taxonómica permitió reportar por primera vez las especies Candida kunwinensis y Rhodotorula colostri con potencial biocontrolador.The phyllosphere is a complex ecosystem in which despite of having a great number of associated microorganisms, few studies have been designed to understand the ecophysiological characteristics of the microorganism’s inhabitant. Yeasts, as an important element of this habitat, are exposed to

  2. MÉTODO EFECTIVO PARA LA DESINFECCIÓN TOTAL DE ESPORAS DE HONGOS MICORRIZÓGENOS ARBUSCULARES (HMA: AISLAMIENTO Y CARACTERIZACIÓN DE BACTERIAS ENDOSPÓRICAS EN Glomus clarum

    Directory of Open Access Journals (Sweden)

    Lorelí Mirabal

    2002-01-01

    Full Text Available Los hongos micorrizógenos arbusculares (HMA son endosimbiontes obligados, presentes en muchos ecosistemas naturales y agrícolas, con gran responsabilidad en la integridad fisiológica de la planta. Esta investigación se basa en la realización de diferentes aislamientos de Glomus clarum, proveniente de cultivos puros del cepario del INCA. Se aislaron y purificaron 25 cepas bacterianas endospóricas, a las cuales se les realizaron varias pruebas morfológicas y bioquímicas, siendo muy interesantes la aerobiosis y la capacidad nitrofijadora. Tres cepas bacterianas aisladas tienen características coincidentes con el endófito diazótrofo Gluconoacetobacter diazotrophicus. Además, se estableció un método efectivo para la desinfección total de la pared externa de las esporas de HMA.

  3. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  4. Aislamiento y caracterización de cepas nativas de Lactobacillus spp. para su uso como probióticos en la industria láctea

    Directory of Open Access Journals (Sweden)

    Sylvia Vázquez

    2011-05-01

    Full Text Available La utilización de fermentos en la elaboración de productos lácteos es una práctica diaria a nivel industrial. En nuestro país los mismos son comprados a multinacionales extranjeras que se dedican a producir y comercializar fermentos; muchos de los cuales incorporan bacterias probióticas. Los probióticos pueden definirse como microorganismos que luego de ser consumidos en cantidades adecuadas, confieren algún efecto benéfico en el huésped. En el presente trabajo se realizó el aislamiento de una cepa de Lactobacillus de origen humano. Se identificó por tinción gram, prueba catalasa, crecimiento en anaerobiosis y aerobiosis y un test API 50 CH. Con el objetivo de probar propiedades probióticas de la cepa se llevaron a cabo estudios de resistencia al pH, tolerancia a sales biliares y se realizó un Modelo Gástrico in vitro. Los resultados permiten afirmar que estamos en presencia de una cepa nativa de Lactobacillus acidophilus caracterizada fenotípicamente con un 97% de confianza. Presentaría la habilidad de sobrevivir al pasaje a través del tubo digestivo ya que resistió la exposición a un pH similar al estomacal, pudo crecer en un medio con sales biliares y sobrevivió a la acción conjunta de la pepsina y una simulación de jugo gástrico; características que permiten clasificarla como posible cepa probiótica.Abstract  The use of starters to elaborate dairy products is a current practice in the industry. In our Country we import these starters from foreign companies dedicated to make and sale it, and most of them include probiotic bacterias. Probiotics can be defined as microorganisms that after be consumed in adequate amount, can give some advantageous effect to the host. In this study a strain of Lactobacillus was isolated from a human. The identification was done through gram stain, catalase test, aerobic and anaerobic growth, and an API 50 CH test. In order to prove the probiotic properties of the strain, studies of p

  5. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  6. Detección de umbrales de área y distancia de aislamiento para la ocupación de fragmentos de selva por monos aulladores, alouatta palliata, en los Tuxtlas, México

    Directory of Open Access Journals (Sweden)

    S. Mandujano

    2005-01-01

    Full Text Available ¿Existen umbrales de tamaño y distancias de aislamiento de fragmentos de selva a los cuales la ocupación de estos por monos aulladores decae significativamente? ¿Son estos umbrales similares independientemente de la localidad geográfica? Para responder estas preguntas comparamos las poblaciones de monos aulladores habitando dos paisajes con distinto grado de pérdida y fragmentación de la selva en Los Tuxtlas, Veracruz, México. Los paisajes investigados cubren áreas de 3200 ha y 4965 ha, y están separados 60 km en dirección norte a sur. El paisaje norte tiene más cantidad de hábitat (838 ha y menos fragmentación (38 fragmentos en comparación al paisaje sur (543 ha y 92 fragmentos. El 55% y 20% del total de fragmentos estuvieron ocupados en los paisajes norte y sur, respectivamente. Empleando la prueba binomial no paramétrica del momento del cambio, detectamos que en el paisaje norte los umbrales de ocupación de los fragmentos ocurren cuando estos tienen 8 ha de área y 200 m de aislamiento; mientras que en el paisaje sur los umbrales fueron de 5 ha y 66 m. Estos resultados pueden tener aplicaciones para crear escenarios de conservación a nivel paisajístico, pero se recomienda probar su generalidad comparando más paisajes en distintas localidades geográficas.

  7. The impact of the use of thermal insulating materials in the global climatic change; El impacto del uso de los aislamientos termicos en el cambio de los climas globales

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)

    1996-12-31

    One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.

  8. Aislamiento de especies termotolerantes de Campylobacter de aguas fluviales utilizando dos métodos de colecta Isolation of thermotolerant species of Campylobacter from river water using two collection methods

    Directory of Open Access Journals (Sweden)

    H. FERNANDEZ

    2003-01-01

    Full Text Available Campylobacter jejuni y C. coli son agentes zoonóticos de infecciones intestinales que pueden contaminar cuerpos de agua. Varios brotes de gastroenteritis por Campylobacter asociados al consumo de agua han sido descritos. En este estudio se compara el rendimiento de los métodos de la tórula de Moore (MSM y de filtración por membrana para el aislamiento de Campylobacter en 181 muestras de agua obtenidas del curso urbano del río Calle-Calle. En el 24.3% de las muestras obtenidas por MSM y en el 7.2% de las obtenidas por MFM fue posible aislar especies termotolerantes de Campylobacter, siendo C. coli aislado en mayor proporción que C. jejuni. Los resultados sugieren que MSM es un método eficiente para el aislamiento de estas bacterias a partir de aguaCampylobacter jejuni and C. coli are zoonotic agents of intestinal infection that could contaminate water bodies. Several outbreaks of Campylobacter gastroenteritis associated with the consumption of contaminated water have been reported. Various methods have been described to determine the presence of these bacteria in water bodies. In this study the performance of the Moore swab (MSM and the filtration through membrane methods (MFM for the isolation of Campylobacter from 181 water samples obtained from the urban course of the Calle-Calle river water samples was compared. Campylobacter species were isolated in 24.3% of the samples obtained with MSM and in 7.2% of those processed by MFM thus, appearing MSM as an efficient method to isolate Campylobacter from river water samples

  9. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  10. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  11. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  12. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  13. ParaDiS-FEM dislocation dynamics simulation code primer

    International Nuclear Information System (INIS)

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  14. ParaDiS-FEM dislocation dynamics simulation code primer

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A

    2011-09-27

    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  15. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  16. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a t...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......-higher titers than those observed for the x2 primer with the tRNA(Pro) backbone. In summary, our results demonstrate flexibility in PBS and primer usage for SIVmac239, with PBS-primer complementarity being the major determinant, in analogy with previous findings for murine leukemia viruses and human...

  17. La Reforma Fiscal Durante el Primer Año de la Administración Bush

    OpenAIRE

    Crane, R

    1991-01-01

    LA REFORMA FISCAL DURANTE EL PRIMER AÑO DE LA ADMINISTRACIÓN BUSH Randall Crane* RESUMEN Este ensayo analiza las reformas de la política económica de Estados Unidos en el primer año de la administración del  ...

  18. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website for...

  19. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  20. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  1. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking region

  2. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information. PMID:26715801

  3. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    Science.gov (United States)

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  4. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    Science.gov (United States)

    Rhim, Lauren Morando; Kowal, Julie

    2008-01-01

    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  5. Determinación de la variabilidad genética entre aislamientos de Rosellinia sp. Rosellinia bunodes y Rosellinia pepo mediante la técnica de amplificación aleatoria de polimorfismos de DNA (RAPD y análisis de los espaciadores de transcritos internos (ITSS

    Directory of Open Access Journals (Sweden)

    Ángel Díaz Jorge Evelio

    2004-12-01

    Full Text Available Teniendo en cuenta que las medidas preventivas son las más eficientes para reducir la incidencia de muchas enfermedades, la implementación de estrategias que permitan el diagnóstico temprano y oportuno de fitopatógenos de cultivos, en especial aquellos de tardío rendimiento, es el objetivo principal de este trabajo. Los hongos fitopatógenos del género Rosellinia se consideran habitantes naturales del suelo. Sin embargo, su fase parasítica se asocia a la aparición de enfermedades radiculares principalmente en cultivos de café, papa y cacao, que generalmente se
    relaciona con el aumento en la oferta de materia orgánica, lo cual beneficia el crecimiento sus poblaciones y las de otros microorganismos que pueden ser patógenos. Con el fin de avanzar en el conocimiento de las especies Rosellinia sp., Rosellinia bunodes y Rosellinia pepo y de desarrollar estrategias de diagnóstico para evitar las pudriciones radiculares que estas ocasionan en cultivos de importancia agroeconómica y forestal, se utilizaron dos metodologías moleculares que permiten
    realizar un primer acercamiento a la variabilidad genética que presentan diferentes aislamientos de estas especies. Mediante el análisis de RAPD (Amplificación Aleatoria de Polimorfismos de ADN y la secuenciación de las regiones de rDNA-ITS (Espaciadores de Transcritos Internos fue posible establecer un alto grado de variabilidad entre las cepas, aún dentro de una misma especie. Dichas metodologías están basadas en la reacción en cadena de la polimerasa (PCR que ha sido extensamente utilizada tanto en la identificación de un organismo por medio de la amplificación selectiva de su ADN, como al ser aplicada para explorar la variabilidad que posee un genoma. Las cepas de Rosellinia sp. presentaron gran variación en los perfiles electroforéticos de RAPD constituyendo dos ramas aisladas en el dendrograma de similaridad construido a partir de matrices binarias. De la misma manera

  6. Degenerative primer design and gene sequencing validation for select turkey genes.

    Science.gov (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  7. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D.

    2003-01-17

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  8. Midwestern High-Level Radioactive Waste Transportation Primer

    International Nuclear Information System (INIS)

    The Midwestern High-level Radioactive Waste Transportation Primer was prepared for the purpose of identifying and analyzing regional issues pertaining to the transportation of high-level radioactive waste and to inform Midwestern state officials with respect to technical issues and regulatory concerns related to waste transportation. The report contains an introduction which presents historical information and a discussion of public opinion regarding nuclear power and its economic competitiveness. Section 1 discusses the Civilian Radioactive Waste Management Program including the need for a waste disposal program, requirements of the Nuclear Waste Policy Act (NWPA) as amended, and obstacles to implementing the NWPA. Section 2 presents the technical program with discussions of waste generators, the monitored retrievable storage facility, the geologic repository, and the transportation system. Section 3 discusses the institutional program with respect to the federal government; states, tribes, and other interested parties; and transportation issues including modal mix, highway routing, rail routing, safeguarding shipments, accident reporting, transporting defense wastes, emergency preparedness and response, training, liability, inspection and enforcement, and state, tribal, and local regulation of transportation. 165 refs., 20 figs., 29 tabs. (MB)

  9. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  10. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  11. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  12. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-10-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  13. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  14. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  15. Influence of Ortho Primer Morelli adhesion booster on orthodontic brackets shear bond strength

    Directory of Open Access Journals (Sweden)

    Sabrina de Mendonça Invernici

    2012-06-01

    Full Text Available OBJECTIVE: This work aimed at assessing the bond strength (AS, the site of the flaw and the relation between them and Ortho Primer Morelli® (OPM adhesion optimizer. METHODS: Sixty test specimens, made out of bovine permanent lower incisors, were divided into three groups: TXT Primer (control, in which a conventional adhesive system was applied (primer and paste; OPM, in which TXT primer was replaced by OPM; and TXT without Primer, in which only TXT paste was used. A shear force was applied at a speed of 0,5 mm/min. Failure site was assessed by the Remaining Adhesion Index (RAI. RESULTS: Kruskal-Wallis demonstrated that OPM (8.54 ± 1.86 MPa presented a statistically higher AS (p 0.05 between TXT with or without Primer (6.42 ± 2.12 MPa. Regarding the RAI, the K test demonstrated that TXT Primer and OPM (prevailing scores 2 and 3 showed higher values (p 0.05. CONCLUSION: OPM increases AS and presents the same bond failure location if compared to a conventional adhesive system; the use of the TXT adhesive system paste only was shown to have the same AS if compared to conventional systems, except it does not allow to predict the adhesive failure site; there is no correlation between AS and bond failure location, regardless of the use of any adhesion optimizer.

  16. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  17. Optimization of primer design for the detection of variable genomic lesions in cancer.

    Science.gov (United States)

    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet

    2007-11-01

    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  18. Guidelines for the tetra-primer ARMS-PCR technique development.

    Science.gov (United States)

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  19. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  20. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples 1

    OpenAIRE

    Alexandre R. Zuntini; Fonseca, Luiz Henrique M.; Lúcia G. Lohmann

    2013-01-01

    Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The sta...

  1. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  2. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    OpenAIRE

    Bruce Shiramizu; David Troelstrup; Melissa Agsalda; Ian Kusao

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH) genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer p...

  3. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  4. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  5. Silane primers rather than heat treatment contribute to adhesive bonding between tri-n-butylborane resin and a machinable leucite-reinforced ceramic

    OpenAIRE

    Sakai, Miyuki; Taira, Yohsuke; Sawase, Takashi

    2011-01-01

    The purpose of the present study was to evaluate the effects of silane primers with and without heat treatment on bonding between a resin and a leucite-reinforced ceramic (GN-Ceram). Six dental primers (GC Ceramic Primer, GP; Clearfl Ceramic Primer, CP; RelyX Ceramic Primer, RP; Tokuso Ceramic Primer, TP; Shofu Porcelain Primer, SP; and Porcelain Liner M, PM) and five experimental primers (MDS, MTS, MDES, MTES, and ATS) were evaluated. GN-Ceram specimen was primed, heated at 100°C for 60 min ...

  6. Resistencia a penicilina y otros antimicrobianos en 103 aislamientos clínicos de Streptococcus pneumoniae (2000-2001 Resistance to penicillin and other antimicrobials in 103 clinical isolations of Streptococcus pneumoniae (2000-2001

    Directory of Open Access Journals (Sweden)

    J.J. García-Irure

    2003-04-01

    Full Text Available Fundamentos. Conocer en nuestro hospital la sensibilidad a penicilina de aislamientos de Streptococcus pneumoniae, así como analizar la asociación de resistencia a penicilina y otros antimicrobianos y la actividad de cefotaxima y cefepima en cepas de Streptococcus pneumoniae resistentes a penicilina. Métodos. Se determinó la sensibilidad de 103 aislamientos de Streptococcus pneumoniae, procedentes de muestras clínicas durante los años 2000-2001, a penicilina, eritromicina, cloramfenicol, tetraciclina, cotrimoxazol, cefotaxima, cefepima y levofloxacino. Resultados. El 68% de los aislamientos fueron sensibles a penicilina, mientras que un 32% de las cepas de Streptococcus pneumoniae aisladas fueron resistentes a penicilina, presentando el 7,7% resistencia de alto grado a la misma. La resistencia a eritromicina, cloramfenicol, tetraciclina, cotrimoxazol y levofloxacino fue del 38,8; 9,7; 20,4; 25,2 y 2,9% respectivamente, incrementándose a valores del 66,6; 30,3; 48,5; 72,7 y 9,1% en las 33 cepas con resistencia a penicilina. La resistencia a cefotaxima y cefepima fue del 9,7 y 10,6% respectivamente. Conclusiones. Un alto porcentaje de cepas de Streptococcus pneumoniae presentaron algún grado de resistencia a penicilina, pero con cifras menores que las presentadas en otros estudios de ámbito nacional. Asimismo, se demostró que la resistencia a penicilina se asociaba significativamente (p Background. To determine in our hospital the sensitivity of isolations of Streptococcus pneumoniae to penicillin, as well as to analyse the association of resistance to penicillin and other antimicrobials and the activity of cefotaxime and cefepime in pencillin resistant strains of Streptococcus pneumoniae. Methods. The sensitivity was determined on 103 isolations of Streptococcus pneumoniae, from clinical samples from the years 2000-2001, to penicillin, eritromycine, cloramfenicol, tetracycline, cotrimoxazol, cefotaxime, cefepime and levofloxacine

  7. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    OpenAIRE

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; akiyama, Hiroko; Hayatsu, Masahito

    2011-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental sa...

  8. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  9. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  10. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Science.gov (United States)

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  11. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing of...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...... intensities were obtained in the 5500-10 300 m/z mass range by increasing the concentration of the longer SBE primers in the reaction. To validate the technique, 17 Y-chromosome SNPs were analyzed in 200 males. The precision and accuracy of the mass determination were analyzed by parametric statistic, and the...

  12. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere;

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required......, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used to...... investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed to...

  13. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  14. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  15. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  16. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven by...... cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  17. POT1–TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation

    OpenAIRE

    Latrick, Chrysa M; Cech, Thomas R.

    2010-01-01

    Telomerase contributes to chromosome end replication by synthesizing repeats of telomeric DNA, and the telomeric DNA-binding proteins protection of telomeres (POT1) and TPP1 synergistically increase its repeat addition processivity. To understand the mechanism of increased processivity, we measured the effect of POT1–TPP1 on individual steps in the telomerase reaction cycle. Under conditions where telomerase was actively synthesizing DNA, POT1–TPP1 bound to the primer decreased primer dissoci...

  18. Review of the PCR Primer Eesign Method%PCR引物设计方法综述

    Institute of Scientific and Technical Information of China (English)

    尤超; 赵大球; 梁乘榜; 周春华

    2011-01-01

    In order to obtain an ideal method of PCR primer design, the author completed primer design of target gene, using some databases and software tools for primer design, such as NCBI, Primer Premier 5.0 and so on, combined with the principle of primer design.Then made a research on optimization of conditions for PCR reaction after the designed primer was analyzed through BLAST comparison, comprehensive evaluation and gene retest analysis. The results indicated that primers designed through these databases and softwares could basically meet the requirements of following RTPCR reaction, and could make an in-depth study of molecular biology.%为了获得PCR引物设计的理想方法.笔者运用NCBI等数据库与引物设计软件Primer Premier 5.0等工具,结合引物设计的原则,完成目的基因的引物设计,并对设计后的引物进行BLAST比对、综合评价和基因的重新检测等分析,据此对PCR反应条件进行优化研究。结果表明,通过这些数据库和软件所设计的引物能基本满足后续的RT—PCR反应,可以进行进一步的分子生物学研究。

  19. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    OpenAIRE

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chlo...

  20. PCR primers that allow intergeneric differentiation of ascomycetes and their application to Verticillium spp.

    OpenAIRE

    Li, K N; Rouse, D. I.; German, T L

    1994-01-01

    A pair of conserved PCR primers, designated NMS1 and NMS2, that amplify a region in the mitochondrial small rRNA gene region were designed for fungi belonging to the class Ascomycetes. These primers were tested with members of eight fungal genera (Aspergillus, Fusarium, Magnaporthe, Mycospharella, Neurospora, Saccharomyces, Sclerotinia, Verticillium) and 10 Verticillium species (Verticillium albo-atrum, Verticillium chlamydosporium, Verticillium cinnebarium, Verticillium dahliae, Verticillium...

  1. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV) in...... undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary to...... findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  2. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  3. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  4. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  5. PRIMER HALLAZGO DE Cyclospora cayetanensis EN CONCEPCION, CHILE 1997

    Directory of Open Access Journals (Sweden)

    NANCY RIVERA

    1997-07-01

    Full Text Available Se describe el hallazgo de Cyclospora cayetanensis en una muestra de deposición, en la cual se observó también formas vacuoladas de Blastocystis hominis y trofozoítos y quistes de Entamoeba coli. La muestra provenía de un paciente de 50 Es importante señalar que la sola observación años de edad, de sexo femenino, quien había visitado Cuba, y que, a los 5 días de regreso a Chile, comenzó con sintomatología. El examen parasitológico seriado de deposición se llevó a cabo 30 días después de su regreso al país. Se realizó observación al fresco de heces preservadas en fijador PAF (fenol, alcohol, formalina con lugol, MIF (merthiolate, lugol, formol, y yodo de D'Antoni; al mismo tiempo se prepararon 3 frotis del sedimento fecal los que fueron teñidos mediante tinción de Ziehl Neelsen modificada, Kinyou y Safranina. Una proporción de los O quistes encontrados fueron medidos. La identificación de C. cayetanensis fue confirmada en esta muestra por el Center for Disease Control and Prevention (CDC Atlanta, Georgia, USA y por el Departamento de Parasitología del Hospital for Tropical Diseases (London UK. Este constituye el primer hallazgo de C. cayetanensis informado en Concepción, ChileThe finding of Cyclospora cayetanensis in a stool sample from a 50 year old Chilean female patient is reported. The patient had recently returned from a visit to Cuba and exhibited diarrhoeal symptons in the fifth day after arriving to Chile. The stool sample was obtained 30 days after her return to the country. Direct microscopic abservation were made in preparations of the stool sample preserved in phenol, alcohol, fonmalin (PAF with iodine, merthiolate, iodine-fonmalin (MIF and iodine de D'Antoni. In addition, three smears of the faecal sedimenl were stained with madified Ziehl-Neelsen, Kinyou, and Safranin. The oocyst sizes were measured. The identification of C. cayetanensis was confinmed in this sample by the Center for Disease control and

  6. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  7. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  8. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    Science.gov (United States)

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    Science.gov (United States)

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  11. Primer caso de detección de blaKpc en Chile: desde Italia a un hospital público de Santiago First isolation of kpc in Chile: from Italy to a public hospital in Santiago

    Directory of Open Access Journals (Sweden)

    Marcela Cifuentes

    2012-04-01

    Full Text Available La resistencia a carbapenémicos en enterobacterias es un fenómeno emergente en el mundo. Entre los mecanismos implicados se encuentra la producción de BLEE o AmpC asociados a alteraciones de las porinas o la presencia de carbapenemasas. Entre éstas, las de tipo KPC han cobrado especial relevancia dada su rápida diseminación. Se presenta el primer caso de aislamiento de una cepa de Klebsiella pneumoniae productora de KPC en un hospital de Santiago- Región Metropolitana, en un paciente trasladado desde Italia, con el antecedente de múltiples hospitalizaciones para tratamiento de un linfoma no Hodgkin y sometido a varios ciclos de quimioterapia y hemodiálisis. La cepa fue aislada desde un urocultivo al séptimo día de la llegada del paciente a Chile. Fue resistente a quinolonas, aminoglucósidos, cefalosporinas y carbapenémicos, sólo manteniendo sensibilidad a tige-ciclina y colistin. Por test fenotípicos resultó tener test de Hodge positivo y sinergia positiva con carbapenémicos más ácido borónico. Por reacción de polimerasa en cadena se demostró la presencia de β-lactamasas tipo TEM, SHV y KPC-2/KPC-3, no detectándose la presencia de otras serino-carbapenemasas de clase A o de metalo-β-lactamasas.Carbapenem resistance in Enterobacteriaceae is an emerging problem worldwide. Among the mechanisms involved are the production of ESBLs or AmpC associated with porins loss or the presence of carbapenemases. Among these, the KPC betalactamase has become especially relevant given its rapid spread.In this article we present the first case of isolation of a strain of KPC producer Klebsiella pneumoniae at a hospital in Santiago, in a patient coming from Italy, with a history of multiple hospitalizations for treatment of non-Hodgkin lymphoma and subjected to several cycles of chemotherapy and hemodialysis. The strain was isolated from a urine culture on the seventh day of the patient's arrival to Chile. The isolate was resistant to

  12. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  13. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  14. A new tetra-primer ARMS-PCR for genotyping bovine kappa-casein polymorphisms.

    Science.gov (United States)

    Fonseca, P A S; Rosse, I C; Demiranda, M; Machado, M A; Verneque, R S; Peixoto, M G C D; Carvalho, M R S

    2013-01-01

    Kappa-casein (κ-casein) is one of the most abundant milk proteins. Its main function is to avoid the aggregation of casein micelles, keeping them, and therefore calcium phosphate, in pockets in solution. In bovines, a κ-casein functional polymorphism has been associated with fat, calcium, and protein milk contents and faster curd contraction in cheese production. Quicker curd contraction reduces the loss of milk solids, enhancing cheese yield. This polymorphism induces a double amino acid substitution (Thr136Ile and Ala148Asp). The polymorphism is normally detected by PCR-RFLP, which is a laborious method. An interesting methodological alternative is the tetra-primer amplification refractory mutation system PCR (tetra-primer ARMS-PCR). A tetra-primer ARMS-PCR for the detection of this κ-casein polymorphism has been described. However, specificity was not achieved, probably due to problems with primer design. We developed a new tetra-primer ARMS-PCR for the detection of the κ-casein polymorphism. This new method was validated in a double-blind test, by comparison with the results obtained for 50 Guzerá bulls formerly genotyped by PCR-RFLP. This new method achieved 100% sensitivity and specificity. We conclude that this method is a useful, cost-efficient alternative for the detection of functional κ-casein polymorphisms. PMID:24390998

  15. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  16. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  17. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for...... automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the...... propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore...

  18. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  19. New primers for promising single-copy genes in fungal phylogenetics and systematics.

    Science.gov (United States)

    Schmitt, I; Crespo, A; Divakar, P K; Fankhauser, J D; Herman-Sackett, E; Kalb, K; Nelsen, M P; Nelson, N A; Rivas-Plata, E; Shimp, A D; Widhelm, T; Lumbsch, H T

    2009-12-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes and Sordariomycetes, indicate the utility of these loci for fungal phylogenetics at taxonomic levels ranging from genus to class. We also tested the new primers in silico using sequences of Saccharomycotina, Taphrinomycotina and Basidiomycota to predict their potential of amplifying widely across the Fungi. The analyses suggest that the new primers will need no, or only minor sequence modifications to amplify Saccharomycotina, Taphrinomycotina and Basidiomycota. PMID:20198159

  20. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...... most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we...

  1. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  2. Microsatellite primers in the weedy annual herb Anacyclus clavatus (Asteraceae) and four closely related species1

    Science.gov (United States)

    Agudo, Alicia; Picó, F. Xavier; Álvarez, Inés

    2013-01-01

    • Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. • Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. • Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus. PMID:25202498

  3. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  4. Microsatellite Primers in the Weedy Annual Herb Anacyclus clavatus (Asteraceae and Four Closely Related Species

    Directory of Open Access Journals (Sweden)

    Alicia Agudo

    2013-10-01

    Full Text Available Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus.

  5. The effect of dentin primer on the shear bond strength between composite resin and enamel.

    Science.gov (United States)

    Hadavi, F; Hey, J H; Ambrose, E R; Louie, P W; Shinkewski, D J

    1993-01-01

    The purpose of this study was to determine the effect of accidental dentin primer contact with etched enamel on shear bond strength of composite resin to enamel. Four dentin bonding systems were included in this study: GLUMA Dentin Bond, Scotchbond, and Prisma Universal Bond 2 and 3. Eighty extracted human permanent anterior teeth were used and divided in eight test groups. The vestibular surfaces were ground and acid etched. For each dentin bonding system 10 samples were treated with dentin primer prior to placement of resin. Shear bond testing showed that enamel contact with dentin primer in the above two systems decreased the shear bond strength between composite and enamel by 31 to 44%. PMID:8337183

  6. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  7. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  8. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    Science.gov (United States)

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  9. Queratitis por Acanthamoeba sp.: primer caso confirmado por aislamiento y tipificación molecular en Bahía Blanca, provincia de Buenos Aires, Argentina Acanthamoeba sp. keratitis: first case confirmed by isolation and molecular typification in Bahía Blanca, Buenos Aires Province, Argentina

    OpenAIRE

    M. L. Gertiser; E. Giagante; E. Sgattoni; N. Basabe; Rivero, F.; H. Luján; M. Occhionero; L. Paniccia; E. Visciarelli; S.R. Costamagna

    2010-01-01

    Algunas especies del género Acanthamoeba provocan queratitis amebiana (QA), una infección de la córnea muy dolorosa, generalmente unilateral, con compromiso importante de la visión. Se presenta el caso de una mujer de 31 años usuaria de lentes de contacto con hábitos inadecuados de higiene y conservación de las lentes. La paciente consultó por enrojecimiento y dolor intenso en el ojo derecho, de dos meses de evolución. Luego del examen oftalmológico y ante la sospecha de una etiología parasit...

  10. Energy consumption and the use of thermal insulating materials. A comparative analysis on the tendencies over the time; Consumo de energia y uso de aislamientos termicos - un analisis comparativo de tendencias en el tiempo

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    positivas y son semejantes a las tendencias en el consumo de aislamientos termicos y a cifras semejantes de otros paises. El analisis de estas cifras nos permiten detectar si se pueden correlacionar los esfuerzos de ahorro de energia con el consumo de aislamientos termicos y con el nivel de vida de un pais (determinado por su ingreso per capita), y establecer un indice futuro de efectividad de conservacion de energia por el uso adecuado de materiales de espesor economico. El indice propuesto en esta ponencia sirve este proposito y nos arroja resultados interesantes. A lo largo de los anos recientes y como resultado del cambio en el nivel de industrializacion y de vida en Mexico, el consumo de energeticos ha aumentado en proporcion mayor al crecimiento de poblacion, tomando como base las cifras de 1980. En ese mismo periodo, el producto interno bruto per capita ha aumentado en proporcion tambien ligeramente menor al crecimiento poblacional. Esto significa que la cifra de Intensidad Energetica, definida como la proporcion de consumo de energeticos sobre el producto interno bruto, ha aumentado ligeramente en el mismo periodo en consideracion, significando que el pais se ha vuelto mas ineficiente en anos recientes. Al mismo tiempo, la capacidad de produccion de materiales aislantes termicos ha permanecido constante desde 1980 hasta principios de 1994. Esto compara desfavorablemente con todos los paises desarrollados, en los cuales la intensidad energetica ha disminuido considerablemente en los ultimos anos, al tiempo que la produccion de materiales aislantes termicos ha crecido a un ritmo de proporciones semejantes.

  11. Efectividad de Aislamientos de Hongos Entomopatógenos Sobre Larvas de Polilla del Tomate Tuta absoluta Meyrick (Lepidoptera: Gelechiidae Effectivity of Entomopathogenic Fungus Strains on Tomato Moth Tuta absoluta Meyrick (Lepidoptera: Gelechiidae Larvae

    Directory of Open Access Journals (Sweden)

    Marta Rodríguez

    2006-06-01

    Full Text Available La polilla del tomate, Tuta absoluta Meyrick, es una plaga importante en el cultivo del tomate (Lycopersicon esculentum L. en Chile. Estudios de laboratorio fueron realizados para evaluar la virulencia y efectividad de Qu-M558 de Metarhizium anisopliae var. anisopliae y Qu-B912 de Beauveria bassiana. La primera evaluación fue realizada aplicando concentraciones de 0 a 10(8 conidia mL-1 directamente sobre larvas de tercer estadio mediante el sistema de pulverización torre Potter. Las comparaciones fueron realizadas calculando el área bajo la curva del progreso de la mortalidad a través del tiempo. No se observaron diferencias en las áreas entre aislamientos (P = 0,384. La CL50 y CL90 para Qu-B912 fue de 10(4,4 y 10(7,6 conidias mL-1, y para Qu-M558 de 10(5,4 y 10(9,1 conidias mL-1,respectivamente. Un segundo estudio fue realizado aplicando sobre hojas de tomate suspensiones de 0 a 10(8 conidias mL-1 del aislamiento Qu-B912, a través de la torre de pulverización Potter. Larvas del tercer estadio de T. absoluta fueron alimentadas con estas hojas infectadas. Trece días después de la inoculación los porcentajes de mortalidad alcanzaron un 68% a la máxima concentración de inóculo.The tomato moth, Tuta absoluta Meyrick, is a serious pest on tomatoes (Lycopersicon esculentum L. crops in Chile. Laboratory studies were conducted to evaluate the virulence and effectiveness of the isolates Metarhizium anisopliae var. anisopliae isolate Qu-M558 and Beauveria bassiana isolate Qu-B912, on third instar of T. absoluta larvae. The first evaluation was carried out spraying directly on third instar larvae, spore suspensions (0 to 10(8 conidia mL-1 of each isolate through a Potter tower. Comparisons were made by calculating the area under a mortality progress curve. Differences were not observed in the areas between isolates (P = 0.384. The LC50 and LC90 for Qu-B912 were 10(4.4 and 10(7.6 conidia mL-1, and for Qu-M558 were 10(5.4 and 10(9.1 conidia mL-1

  12. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation

  13. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola,Milla; Wheat, Christopher W; Rota, Jadranka

    2016-01-01

    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular sy...

  14. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana

    OpenAIRE

    Redondo Buey, Patricia

    2014-01-01

    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  15. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    OpenAIRE

    Javier Coloma; Johnson, Robert E.; Louise Prakash; Satya Prakash; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually e...

  16. Minimal sequence requirements of a functional human immunodeficiency virus type 1 primer binding site.

    OpenAIRE

    Wakefield, J K; Rhim, H; Morrow, C D

    1994-01-01

    The initiation of human immunodeficiency virus type 1 (HIV-1) reverse transcription occurs by the extension of a tRNA(3Lys) primer bound near the 5' end of the genomic RNA at a position termed the primer binding site (PBS). The PBS is an 18-nucleotide sequence of the HIV-1 genome which is complementary to the 3'-terminal 18 nucleotides of the tRNA(3Lys). To investigate the sequence specificity of the interaction between tRNA(3Lys) and the PBS, we have constructed proviral genomes containing m...

  17. Determinación de la actividad lignocelulolítica en sustrato natural de aislamientos fúngicos obtenidos de sabana de pastoreo y de bosque secundario de sabana inundable tropical Determination of lignocellulolytic activity in a natural substrate of native fungi strains obtained from savanna and of secondary forest from a tropical flooded savanna

    OpenAIRE

    Martha Lucía Ortiz Moreno; Daniel Uribe Vélez

    2010-01-01

    El objetivo de este trabajo fue identificar aislamientos de hongos ligninolíticos y celulolíticos que pudieran degradar desechos de cosecha y mejorar las características del suelo en los Llanos Orientales, se realizó un muestreo siguiendo la metodología de transepto y muestras integradas. Se obtuvo una cepa ligninolítica (005L Verticillium spp.) y 72 cepas celulolíticas. La comparación de los usos del suelo (sabana de pastoreo y bosque secundario) mostró que no existía una relación entre el n...

  18. Secuenciación y clonación de los genes dihidrofolatoreductasa (dhfr) y dihidropteroatosintetasa (dhps) de la cepa RH y de 2 aislamientos de Toxoplasma gondii / Sequencing and cloning dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes of the RH reference strain and two isolates of Toxoplasma gondii

    OpenAIRE

    Cortés Cortés, Liliana Jazmín

    2012-01-01

    El presente trabajo tuvo por objetivo realizar la clonación y secuenciación de los genes dihidrofolatoreductasa (dhfr) y dihidropteroatosintetasa (dhps) de la cepa de referencia RH y de dos aislamientos de Toxoplasma gondii obtenidos a partir de líquido céfalo-raquídeo (LCR) de pacientes HIV positivos con toxoplasmosis cerebral. Se realizó la optimización de las técnicas de extracción del DNA parasitario y de la Reacción en Cadena de la Polimerasa (PCR), la secuenciación de los productos puri...

  19. Análisis de la eficiencia del sistema de aislamiento de vibraciones de grupos electrógenos MAN 18 V48/60 B // Efficiency analysis of vibration isolation system installed on engine generator sets type MAN 18 V48/60 b

    Directory of Open Access Journals (Sweden)

    Evelio Palomino‐Marín

    2011-01-01

    Full Text Available Todo sistema de aislamiento de vibraciones está encaminado en primera instancia a aislarvibraciones como su propio nombre lo indica. En ocasiones es menester que a la máquina no laperturben vibraciones procedentes del entorno, como lo puede ser por ejemplo, el caso de unarectificadora en un taller de mecanizado. Así mismo, en otras ocasiones resulta necesario aislar lamáquina para evitar que las vibraciones producidas por ella misma afecten al entorno. Tal es el casode los grupos electrógenos MAN 18 V48/60 B, cuyos motores de combustión interna responden a undiseño de 18 cilindros en “V” distribuidos en 13 metros de longitud. El sistema de aislamiento deestos motores consta de 14 paquetes de ocho resortes cada uno, incluyendo un amortiguadorviscoso por cada calzo. Se efectuaron mediciones espectrales de vibraciones en cada uno de estoscalzos antivibratorios, sobre y debajo de estos respectivamente y se evaluó la eficiencia de estoscalzos en todo el espectro, determinándose aquellas frecuencias que por determinadas razones noalcanzan los niveles de eficiencia en el aislamiento establecidos a tales efectos. De esta manera, sepresenta una metodología para conducir este análisis.Palabras claves: calzos antivibratorios, aislamiento de vibraciones, grupos electrógenos.___________________________________________________________________AbstractA vibroisolation system has a priority goal which is isolate vibrations. Such vibrations can come fromthe environment and could affect the machine behavior and could affect its technological functionstoo. That’s the case of a machine tool, for instance. However, it is also possible that vibrations comefrom the own machine and in this case the main goal of vibroisolation system is to avoid thatvibrations go to machine foundations. This is the case on which this paper is focused. Twelvevibration isolators with eight springs each one including a viscous damper are mounted asvibroisolation system on

  20. Comparación de los resultados de las mediciones in situ del aislamiento acústico al ruido aéreo de fachadas, mediante la utilización de los métodos globales con altavoces y con ruido de aviones.

    OpenAIRE

    Díaz Sanchidrián, César; Pedrero González, Antonio

    2000-01-01

    En este trabajo se comparan los resultados experimentales de las mediciones in situ del aislamiento acústico al ruido aéreo de fachadas de recintos, por aplicación en cada uno de los recintos de dos métodos globales de la Norma EN ISO 140-5, Agosto 1998. Se han utilizado como fuentes de ruido un altavoz y el ruido de aeronaves. Las mediciones acústicas se han realizado en 26 dormitorios situados en viviendas de uso residencial privado.

  1. A low cost method to produce a gaseous environment for the isolation of Helicobacter pylori Un método de bajo costo para producir el ambiente gaseoso para el aislamiento de Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Francisco Hernández

    1992-04-01

    Full Text Available A low cost method (LCM to produce a gaseous environment for the isolation of Helicobacter pylori, was compared with the standard Gas Park system. The LCM uses a carbonated antacid tablet, a plastic bag with tap water, a candle, and a wide-mouthed glass jar provided with a tight-fitting metalic screw cap and a rubber gasket. Antral gastric biopsies from 153 cases were incubated by duplicate on blood agar plates and treated with the two methods. In 95 cases the agent was isolated from both, and only from the standard method in 10 cases; the opposite condition was found in five cases, and 43 were negative. That difference is not significant (Pearson's X²= 93.25 p > 0,05Se comparó un método de bajo costo (MBC para producir el ambiente gaseoso para el aislamiento de Helicobacter pylori, con el sistema estándar de gas Pak. El MBC usa una tableta carbonata de antiácido, una bolsa plástica con agua, una candela y un frasco de vidrio con boca ancha, provisto de tapa metálica de rosca con empaque de hule. Las biopsias de antro de 153 pacientes se inocularon por duplicado en platos de agar sangre y se incubaron bajo los dos sistemas. En 195 casos el agente se aisló de ambos platos, y sólo del incubado bajo el método estándar en diez casos; la condición opuesta se presentó en cinco casos; 43 casos fueron negativos. Esa diferencia no es significativa (X² de Pearson = 93,25 p > 0,05

  2. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y testudines de la Estación de Biología Tropical Roberto Franco en Villavicencio, Colombia

    Directory of Open Access Journals (Sweden)

    C. A. Moreno

    2010-04-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos enmamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal.La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programade recuperación del Caimán Llanero (Crocodylus intermedius, que se encuentra en inminentepeligro de extinción; adicionalmente cuenta con una colección viva de Testudinesque comprende más de 20 especies. Con el fin de determinar la presencia de potencialesenteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientalesy cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagarOrientaciónBD® para realizar los aislamientos y la identificación microbiológica. Los resultadosmuestran una mayor presentación de flora gram negativa predominando microorganismosde los géneros (28%, Klebsiella sp (26%, Salmonella sp.(6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del géneroEnterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todaslas muestras sin importar el origen de las mismas. Conscientes del riesgo que implica elaislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico,se dio inicio a la implementación de un manual de bioseguridad para la Estación con elfin disminuir el riesgo para la población humana y animal.

  3. Fractal analysis of the electrical discharges' surface paths in polymeric insulation considering different pollution levels; Analisis fractal de las trayectorias de descargas electricas superficiales en aislamiento polimerico considerando diferentes niveles de contaminacion

    Energy Technology Data Exchange (ETDEWEB)

    Palacios Lopez, Arturo

    2002-07-01

    In this thesis tree patterns of superficial breakdown in polymeric insulator of Silicon Rubber are generated. Experimental arrangement rod-rod was used on the basis of norm ASTM D 2303-85. Pollution levels on the basis of norm IEC 507 were also used. The experimental values of Fractal Dimension for each case of pollution were reported. A self similar method called Box Counting for the fractal dimension calculus and for the self affine methods an R/S and Variogram were used. According to the results, it was concluded that the tree patterns of superficial electric breakdown in Silicon Rubber is self similar and its value does not depend on the degree of pollution, that is equivalent to the concentration of salt for liter of water or to the Equivalent Salt Deposition (ESDD), in the surface of an insulator. [Spanish] En el presente trabajo se inducen descargas electricas superficiales en un aislamiento polimerico de Hule Silicon, el arreglo experimental que se utilice es punta-punta con base en la norma ASTM D 2303-85 y los niveles de contaminacion con base en la norma IEC 507. Se reportan los valores experimentales de la Dimension Fractal para cada caso de contaminacion, se utilice el metodo auto similar de conteo de cuadros, para el calculo de la Dimension Fractal y para metodos auto afines se utilice analisis R/S y variograma. Con los resultados obtenidos se concluye que la trayectoria de la descarga electrica superficial en un polimero de Hule Silicon es auto similar y su valor no depende del grado de contaminacion, el cual es equivalente a la concentracion de gramos de sal por litro de agua o a la densidad de sal depositada (DESD), en la superficie de un aislador.

  4. RESPUESTA DE DOS AISLAMIENTOS CHILENOS DE Metarhizium anisopliae (METSCHNIKOFF SOROKIN A LA ADICIÓN DE UN PROTECTOR SOLAR Response of two Chilean Metarhizium anisopliae (Metschnikoff Sorokin isolates to the addition of a solar sunscreen

    Directory of Open Access Journals (Sweden)

    Luis Devotto M.

    2003-10-01

    Full Text Available Dos aislamientos chilenos de Metarhizium anisopliae (Metchsnikoff Sorokin fueron expuestos a dosis crecientes de luz ultravioleta (UV, en condiciones de laboratorio. Conidias en suspensión acuosa fueron esparcidas en placas Petri con agar y éstas fueron puestas bajo una lámpara de luz UV-C (lambda = 254 nm. Sin el protector solar, la exposición de las conidias durante 40 s redujo su germinación de 80-95% a sólo 5-2%, para QU-M221b y QU-M363, respectivamente. Usando el protector solar Blankophor P167® al 1% p/v, la germinación de las conidias, tras 40 s de exposición, se redujo desde 68-82% a 50-33% para QU-M221b y QU-M363, respectivamente. Los resultados indican que este protector solar es un potencial adjuvante para ser usado en biopesticidas basados en M. anisopliae.Two Chilean isolates of Metarhizium anisopliae (Metschnikoff Sorokin (QU-M363 and QU-M221b were exposed to increasing doses of ultraviolet light (UV under laboratory conditions. Conidia suspended in aqueous solution were spread on Petri dishes containing agar-agar and were placed under a UV lamp (lambda = 254 nm. Without sunscreen, exposure of conidia to UV-C light reduced germination after 40 s from 80-95% to 5-2%, for QU-M221b and QU-M363, respectively. Using the solar screen Blankophor P167® at 1% w/v, conidia germination decreased after 40 s from 68-82% to 50-33% for QU-M221b and QU-M363, respectively. Results indicate that the sunscreen Blankophor P167 is a potential adjuvant to be used in biopesticides based on M. anisopliae.

  5. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  6. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  7. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  8. Virus detection and identification using random multiplex (RT-PCR with 3'-locked random primers

    Directory of Open Access Journals (Sweden)

    Eaton John W

    2007-06-01

    Full Text Available Abstract Background PCR-based detection and identification of viruses assumes a known, relatively stable genome. Unfortunately, high mutation rates may lead to extensive changes in viral nucleic acid sequences making dedicated PCR primer use problematic. Furthermore, in bioterrorism, viral consensus sequences can be genetically modified as a countermeasure to RT-PCR and DNA chip detection. Accordingly, there is a great need for the development of rapid and universal virus detection and identification technologies. Results We report herein that viral genomic DNA or RNA can be separated from host nucleic acids in plasma by filtration and nuclease digestion, and randomly amplified in a single PCR using a mixture of primers designed to be resistant to primer-dimer amplification (5'-VVVVVVVVAA-3', V = A, G or C; 38 or 6561 primers. We have termed this novel PCR method Random Multiplex (RT-PCR since hundreds of overlapping PCR amplifications occur simultaneously. Using this method, we have successfullydetected and partially sequenced 3 separate viruses in human plasma without using virus-specific reagents (i.e., Adenovirus Type 17, Coxsackievirus A7, and Respiratory Syncytial Virus B. The method is sensitive to ~1000 genome equivalents/ml and may represent the fastest means of detection of unknown viruses. Conclusion These studies suggest that the further development of random multiplex (RT-PCR may lead to a diagnostic assay that can universally detect viruses in donated blood products as well as in patients suffering with idiopathic disease states of possible viral etiology.

  9. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  10. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.

    Science.gov (United States)

    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R

    2016-02-01

    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  11. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  12. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Science.gov (United States)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  13. New primers for promising single-copy genes in fungal phylogenetics and systematics

    NARCIS (Netherlands)

    Schmitt, I.; Crespo, A.; Divakar, P.K.; Fankhauser, J.D.; Herman-Sackett, E.; Kalb, K.; Nelsen, M.P.; Nelson, N.A.; Rivas-Plata, E.; Shimp, A.D.; Widhelm, T.; Lumbsch, H.T.

    2009-01-01

    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes,

  14. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  15. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    Reverse transcription of RNA is an invaluable method for gene expression analysis by real-time PCR or microarray methods. Random primers of varying lengths were compared with respect to their efficiency of priming reverse transcription reactions. The results showed that l5-nucleotide-long random...

  16. Primer Dependent and Independent Forms of Soluble Starch Synthetase from Developing Barley Endosperms

    DEFF Research Database (Denmark)

    Kreis, M.

    1980-01-01

    purified by ammonium sulfate precipitation and DEAE-cellulose chromatography and separated into four fractions. In the absence of an added carbohydrate primer two of the four fractions catalized the synthesis of a methanol-precipitable agr-glucan when high concentrations of sodium citrate and bovine serum...

  17. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  18. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  19. Lives Intertwined: A Primer on the History and Emergence of Minority Serving Institutions

    Science.gov (United States)

    Gasman, Marybeth; Nguyen, Thai-Huy; Conrad, Clifton F.

    2015-01-01

    In this article, we provide an overview--a primer--of the rise of Minority Serving Institutions (MSIs) as context for understanding the contemporary place of these institutions in our broader system of higher education. We also demonstrate how the emergence and the evolution of MSIs stem from our nation's struggle to provide equal educational…

  20. Applicability of random primer R143 for determination of Aspergillus fumigatus DNA

    NARCIS (Netherlands)

    Erjavec, Z; Brinker, M; Apperloo-Renkema, HZ; Arends, Jan P; De Vries-Hospers, HG; Ruiters, MHJ

    1997-01-01

    The specificity of random primer R143 for Aspergillus fumigatus DNA was determined in order to test its usefulness in establishing the presence of A. fumigatus DNA in fungal cultures. When PCR reaction products of these cultures were compared with those of 21 other bacterial and fungal DNA samples,

  1. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  2. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  3. PERMANENT PRIMER/REPLACEABLE TOPCOAT AIRCRAFT COATING SYSTEM WITH MINIMUM VOC AND CHROMIUM EXPOSURE - PHASE I

    Science.gov (United States)

    In Phase I, Foster-Miller, Inc., will develop the permanent primer replacement topcoat (PPRT), produce coated test panels, and analyze test panels for key performance properties. Topcoat stripping also will be demonstrated. The team includes coating experts and an aircraft ...

  4. Primer concurso y exposición interamericana de fotografía digital

    OpenAIRE

    Banco Interamericano de Desarrollo (BID)

    2004-01-01

    Da a conocer el Acta del Jurado del Primer Concurso y Exposición Interamericana de Fotografía Digital organizado por el Centro Cultural del BID y copatrocinado por la División de Tecnología de la Información y Comunicación para el Desarrollo del BID.

  5. A Primer on Energy Efficiency for Municipal Water and Wastewater Utilities

    OpenAIRE

    Liu, Feng; Ouedraogo, Alain; Manghee, Seema; Danilenko, Alexander

    2012-01-01

    This primer is concerned with energy use and efficiency of network-based water supply and wastewater treatment in urban areas. It focuses on the supply side of the municipal water cycle, including the extraction, treatment, and distribution of water, and collection and treatment of wastewater-activities which are directly managed by Water and Wastewater Utilities (WWUs). The main challenge...

  6. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers

    Czech Academy of Sciences Publication Activity Database

    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, S.; Borovička, Jan; Gažo, J.; Miko, M.

    2011-01-01

    Roč. 318, č. 1 (2011), s. 84-91. ISSN 0378-1097 R&D Projects: GA ČR GAP504/10/0382 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z30130516 Keywords : nested PCR * ITS primers * Tuber mesentericum Subject RIV: EE - Microbiology, Virology Impact factor: 2.044, year: 2011

  7. Producció de matèries primeres. Curs 2007-2008

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2007-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2007-2008. Departament de Productes Naturals, Biologia Vegetal i Edafologia.

  8. Producció de matèries primeres. Curs 2008-2009

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2008-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2008-2009. Departament Productes Naturals, Biologia Vegetal i Edafologia.

  9. Producció de matèries primeres. Curs 2006-2007

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2006-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2006-2007. Departaments de Productes Naturals, Biologia Vegetal i Edafologia (UB)/ Ciència animal i dels Aliments (UAB)

  10. Producció de matèries primeres. Curs 2005-2006

    OpenAIRE

    Universitat de Barcelona. Facultat de Farmàcia

    2005-01-01

    Pla docent de l'assignatura Producció de matèries primeres de l'Ensenyament de Ciència i Tecnologia dels Aliments. Curs acadèmic 2005-2006. Departament de Productes Naturals, Biologia Vegetal i Edafologia.

  11. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  12. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae) para el Perú

    OpenAIRE

    Gomez-Puerta, Luis A.; Pedro A. Ospina; Ramirez, Mercy G.; Nelly G. Cribillero

    2014-01-01

    Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771). Seis nematodos (2 machos y 4 hembras) fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  13. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  14. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    Increasing evidence of the fungal diversity in deep-sea sediments has come from amplification of environmental DNA with fungal specific or eukaryote primer sets. In order to assess the fungal diversity in deep-sea sediments of the Central Indian...

  15. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  16. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  17. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  18. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  19. CARACTERIZACIÓN MOLECULAR DE AISLAMIENTOS DE ENTEROBACTER CLOACAE MULTIRRESISTENTES, PRODUCTORES â-LACTAMASAS PROVENIENTES DE PACIENTES DE UN HOSPITAL DE TERCER NIVEL DE BOGOTÁ Molecular characterizacion of multi-cephalosporin resistan Enterobacter cloacae isolates from a third level hospital in Bogota-Colombia

    Directory of Open Access Journals (Sweden)

    Ibonne Aydee García Romero

    2005-07-01

    Full Text Available Antecedentes. Las enterobacterias, antaño flora normal del tracto gastrointestinal, han cambiado su biología y emergido como agentes patógenos nosocomiales que se tornan resistentes los antibióticos conocidos. Objetivo. Realizar la caracterización epidemiológico-molecular de 20 aislamientos de Enterobacter cloacae resistentes a cefalosporinas de tercera generación; provenientes de un hospital de tercer nivel de Bogotá-Colombia. Material y métodos. Los aislamientos fueron identificados mediante sistemas automatizados Microscan y VITEK, se utilizó el Enterobacter asbureae como control externo inter-especie. La confirmación de resistencia se hizo por técnica de difusión en agar, y una vez establecida se realizó BLEE para comprobación. La determinación de puntos isoeléctricos se hizo, mediante lisis por ultrasonido y la genotipificación mediante la metodología para bacterias Gramnegativas propuesta por Versalovic. Resultados: Los aislamientos colectados durante un año fueron causantes de 15 casos de infección Intrahospitalaria y dos colonizaciones. Todos los aislamientos presentaron resistencia a cefotaxima, ceftazidima, ceftriaxona, aztreonam y ciprofloxacina, 95% a amikacina, gentamicina y cloranfenicol, 75% a trimetoprim/sulfametoxazol, 20% a cefepime y todos fueron sensibles a imipenem. Dos aislamientos fueron confirmados como productores de â-lactamasas de espectro extendido (BLEE por la técnica microbiológica de disco combinado. Por isoelectroenfoque presentaron dos â-lactamasas con puntos isoeléctricos (pI de 5,4 y 8,2. En los 18 aislamientos no inhibidos por ácido clavulánico, se detectaron entre 2 y 4 â-lactamasas con pI de 5,4; 6,0; 7,0; 8,2 y mayor que 8,2; la resistencia a cefalosporinas de tercera generación podría ser atribuida a la hiperproducción de AmpC; los valores de pI sugieren la producción simultánea de â-lactamasas tipo SHV y TEM. La genotipificación mediante tres metodologías de rep

  20. Primer caso de onicomicosis causada por Cylindrocarpon lichenicola, en un paciente inmunosuprimido en Costa Rica

    Directory of Open Access Journals (Sweden)

    Mauricio Lizano-Calvo

    2013-12-01

    Full Text Available Antecedentes: la onicomicosis es una infección fúngica de las uñas, que puede ser causada por dermatofitos, levaduras y hongos filamentosos no dermatofitos. El objetivo del presente trabajo fue identificar -morfológica y molecularmente- un aislamiento realizado a partir de la uña del dedo medio de la mano derecha de un paciente inmunosuprimido con trasplante renal. Métodos: a la muestra se le realizó un examen microscópico directo en KOH 40%, y las características de la colonia fueron evaluadas en medio de cultivo Agar Sabouraud Glucosado y Agar Mycosel. El hongo aislado se identificó molecularmente mediante la amplificación, por reacción en cadena de la polimerasa (PCR y secuenciación de la región espaciadora transcrita (ITS de los genes ribosomales y de una porción del gen del factor de elongación 1alfa (EF-1α. La secuencia de nucleótidos de cada región fue comparada con las secuencias publicadas en la base de datos del Banco de Genes del Centro Nacional para la Información Biotecnológica (NCBI. Resultados: las características macro y microscópicas de la colonia concordaron con las descritas para Cylindrocarpon lichenicola (sinónimo Fusarium lichenicola. La secuencia de nucleótidos, tanto de la región ITS (544 pb como de la porción del gen EF-1α (710 pb, presentó un 100% de similitud con secuencias de F. lichenicola. Conclusión: se identificó por primera vez en Costa Rica C. lichenicola asociado con onicomicosis en un paciente inmunosuprimido. Este tipo de pacientes deben ser instruidos sobre las posibles fuentes de agentes infecciosos.

  1. The effect of multiple primer-template mismatches on quantitative PCR accuracy and development of a multi-primer set assay for accurate quantification of pcrA gene sequence variants.

    Science.gov (United States)

    Ledeker, Brett M; De Long, Susan K

    2013-09-01

    Quantitative PCR (qPCR) is a critical tool for quantifying the abundance of specific organisms and the level or expression of target genes in medically and environmentally relevant systems. However, often the power of this tool has been limited because primer-template mismatches, due to sequence variations of targeted genes, can lead to inaccuracies in measured gene quantities, detection failures, and spurious conclusions. Currently available primer design guidelines for qPCR were developed for pure culture applications, and available primer design strategies for mixed cultures were developed for detection rather than accurate quantification. Furthermore, past studies examining the impact of mismatches have focused only on single mismatches while instances of multiple mismatches are common. There are currently no appropriate solutions to overcome the challenges posed by sequence variations. Here, we report results that provide a comprehensive, quantitative understanding of the impact of multiple primer-template mismatches on qPCR accuracy and demonstrate a multi-primer set approach to accurately quantify a model gene pcrA (encoding perchlorate reductase) that has substantial sequence variation. Results showed that for multiple mismatches (up to 3 mismatches) in primer regions where mismatches were previously considered tolerable (middle and 5' end), quantification accuracies could be as low as ~0.1%. Furthermore, tests were run using a published pcrA primer set with mixtures of genomic DNA from strains known to harbor the target gene, and for some mixtures quantification accuracy was as low as ~0.8% or was non-detect. To overcome these limitations, a multiple primer set assay including minimal degeneracies was developed for pcrA genes. This assay resulted in nearly 100% accurate detection for all mixed microbial communities tested. The multi-primer set approach demonstrated herein can be broadly applied to other genes with known sequences. PMID:23806694

  2. EFECTO SOBRE LA SARNA POLVOSA DE CUATRO AISLAMIENTOS DEL HONGO Trichoderma asperellum EN TRES TIPOS DE SUELO EFFECT ON THE POWDERY SCAB OF FOUR ISOLATES OF THE FUNGUS Trichoderma asperellum IN THREE TYPES OF SOILS

    Directory of Open Access Journals (Sweden)

    Elizabeth Gilchrist

    2009-06-01

    Full Text Available El protozoario Spongospora subterranea f. sp. subterranea es un parásito obligado que replica en raíces y tubérculos de papa causando la sarna polvosa. Esta enfermedad se ha difundido a escala global debido al comercio de tubérculos-semilla infectados y a la ausencia de tratamientos efectivos. En este trabajo se investigó la influencia sobre la sarna polvosa de cuatro aislamientos de Trichoderma asperellum en tres tipos de suelo: Andisol, Entisol e Inceptisol. Tubérculos de Solanum tuberosum variedad Diacol Capiro fueron plantados en parcelas infectadas con 1942 ± 226 quistosoros por gramo de suelo. No se observaron diferencias entre las plantas tratadas y no tratadas con T. asperellum. La superficie de raíz ocupada por agallas fue en promedio 2,2%, sin encontrarse diferencias significativas (PThe protozoan Spongospora subterranea f. sp. subterranea is an obligate parasite that replicates in roots and tubers of potato causing the powdery scab. This disease has disseminated on a global scale, because the commercial traffic of infected tubers used as seed and the absence of effective treatments. The present work investigated the effects of four isolates of Trichoderma asperellum in three soil types: Andisol, Entisol and Inceptisol. The soils were infected with 1942 ± 226 cystosori per gram of soil. It was used Solanum tuberosum variety Diacol Capiro. No differences were observed between treated and non treated plants with T. asperellum. The root surface affected by galls was an average of 2.2 %, and no significant differences (p<0.05 were observed among the soils. The reduction of plant growth was of 41, 32 and 28 % for the Andisol, Entisol and Inceptisol, respectively. The reduction in tubers production was of 40, 28 and 0,1% for the Andisol, Entisol and Inceptisol, respectively. Similar percent of root surface covered with galls resulted in production reduction of 40%, but also of 0,1%, indicating the necessity of other methods to

  3. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  4. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard;

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps...

  5. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  6. Una experiencia con QSB+ en Matemáticas de primer curso

    OpenAIRE

    Ordás Amo, Pilar; Ibar Alonso, Raquel; García Centeno, Mª Carmen; Gabriela M. Fernández Barberis; Escribano Ródenas, Mª Carmen; Calvo Martín, M.E.

    2001-01-01

    Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático senc...

  7. Detection of genetic variability in Chrysanthemum (Dendranthema grandiflora T. using ISSR primers

    Directory of Open Access Journals (Sweden)

    P. Lalitha Kameswari, Hameedunnisabegum, M. Pratap, and G.Anuradha

    2015-03-01

    Full Text Available The genetic diversity of 37 genotypes of Chrysanthemum was characterized using inter simple sequence repeats (ISSR technique. A total of 46 primers were screened, of which 10 polymorphic and informative patterns were selected to determine genetic relationships. Among 114 amplified DNA fragments obtained, 107 bands were polymorphic, accounting for 93.86% polymorphism. The percentage of polymorphism exhibited by different ISSR primers ranged from 71.43% (ISSR-825 to 100% (ISSR-808, 810, 812, 840 and 842. The similarity coefficient values ranged from 0.275 to 0.775 with a mean similarity matrix of 0.525. Among the 37 genotypes studied, the closest relationship was scored between Geetanjali and Red Stone with similarity level of 77.5% while, the most distantly related genotypes were Autumn Joy and Flirtation with the lowest similarity index of 0.275. The UPGMA dendrogram revealed that the chrysanthemum genotypes were grouped into ten clusters.

  8. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.

    Science.gov (United States)

    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian

    2004-06-01

    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  9. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    CERN Document Server

    Mix, L J; Mandell, A M; Mosier, A C; Raymond, J; Raymond, S N; Stewart, F J; Von Braun, K; Zhaxybayeva, O; Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Because of the great diversity of material, each section was written by a different author with a different expertise. The Primer was constructed collaboratively. Ninety researchers from around the world contributed information with regard to what they expected from other astrobiologists and what they would like to know themselv...

  10. Differentiation of five tuna species by a multiplex primer-extension assay.

    Science.gov (United States)

    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana

    2007-05-01

    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  11. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    Science.gov (United States)

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.

    2015-01-01

    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  12. INFLUENCIA DE LA GUARDERÍA EN EL PRIMER AÑO DE ED. INFANTIL

    OpenAIRE

    Fernández-Galán, Rebeca

    2012-01-01

    En este trabajo se aborda el tema referente a la influencia que tiene la guardería en la incorporación y la evolución del niño en el primer curso de educación infantil. Se pretende analizar en este proyecto cómo influye la guardería en el primer año escolar del niño y las diferencias que existen en el aprendizaje de distintos conceptos entre los niños que han asistido a la guardería y los que no. Para ello se han empleado fichas y cuestionarios, en una muestra realizada en un centro esc...

  13. Anticorrosion characteristics of a Zn-primer coating in a ballast tank under various chloride concentrations

    International Nuclear Information System (INIS)

    At an open-circuit potential, the anodic polarization curves had very similar values, and no significant differences were observed among the conditions. In the cathodic polarization curves, total residual chloride (TRC) reacted with the Zn-primer coating and created a film that had anticorrosion properties. Therefore, the anticorrosion property improved. With an increase in applied potential in the potentiostatic experiment, the observed surface corrosion occurred due to the dissolution reaction. From Tafel analysis, the corrosion current density had the highest value in natural seawater and the lowest value in the 2 ppm solution. Generally, metals corrode faster with increasing TRC concentration, but with the formation of Zn(OH)2, which has anticorrosion properties, the corrosion resistance of a Zn-primer-coated specimen in seawater can be improved.

  14. A primer on Return on Investment and real options for portfolio optimization

    OpenAIRE

    Mun, Johnathan; Housel, Thomas

    2006-01-01

    In this quick primer, advanced quantitative risk-based concepts will be introduced, namely, the hands-on application of Monte Carlo simulation, real options analysis, stochastic forecasting and portfolio optimization, and knowledge value added. These methodologies rely on common metrics and existing techniques (e.g., return on investment, discounted cash flow, cost-based analysis, and so forth), and complements these traditional techniques by pushing the envelope of analytics, and not to rep...

  15. Avulsión de canino y subluxación del primer premolar superiores derechos

    OpenAIRE

    Berástegui, Esther

    1996-01-01

    Se presenta un caso clínico de avulsión de canino y subluxación del primer remolar, superiores derechos, secundario a traumatismo por piedra lanzada al aire. El tiempo extraoral fue de cuatro horas en medio seco. Se trató con reimplante, ferulización y tratamiento endodóncico. Los controles posteriores a los cuatro años del tratamiento mostraron la evolución favorable del caso.

  16. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  17. An improved allele-specific PCR primer design method for SNP marker analysis and its application

    OpenAIRE

    Liu Jing; Huang Shunmou; Sun Meiyu; Liu Shengyi; Liu Yumei; Wang Wanxing; Zhang Xiurong; Wang Hanzhong; Hua Wei

    2012-01-01

    Abstract Background Although Single Nucleotide Polymorphism (SNP) marker is an invaluable tool for positional cloning, association study and evolutionary analysis, low SNP detection efficiency by Allele-Specific PCR (AS-PCR) still restricts its application as molecular marker like other markers such as Simple Sequence Repeat (SSR). To overcome this problem, primers with a single nucleotide artificial mismatch introduced within the three bases closest to the 3’end (SNP site) have been used in ...

  18. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    OpenAIRE

    Mix, Lucas J; Armstrong, John C; Mandell, Avi M.; Mosier, Annika C.; Raymond, Jason; Raymond, Sean N.; Stewart, Frank J; von Braun, Kaspar; Zhaxybayeva, Olga; Billings, Linda; Cameron, Vyllinniskii; Claire, Mark; Dick, Greg J; Domagal-Goldman, Shawn D.; Javaux, Emmanuelle

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endea...

  19. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  20. A historical primer on consumer credit reporting systems: A lesson for EU policy makers?

    OpenAIRE

    Ferretti, F

    2007-01-01

    This work investigates the cultural framework through the lens of history of consumer credit reporting in the lender-borrower relationship in order to inform European legislators when setting a future legal framework. It provides an historical primer of consumer credit reporting in the US where it first originated and how the system was transplanted in Europe without following that process of legitimisation and legislative procedure that was so crucial over more than 100 years of American hi...

  1. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    OpenAIRE

    Alex Galanis; Yiannis Kourkoutas; Chrysoula C. Tassou; Nikos Chorianopoulos

    2015-01-01

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers de...

  2. Hot Start PCR with heat-activatable primers: a novel approach for improved PCR performance

    OpenAIRE

    Lebedev, Alexandre V.; Paul, Natasha; Yee, Joyclyn; Timoshchuk, Victor A.; Shum, Jonathan; Miyagi, Kei; Kellum, Jack; Hogrefe, Richard I.; Zon, Gerald

    2008-01-01

    The polymerase chain reaction (PCR) is widely used for applications which require a high level of specificity and reliability, such as genetic testing, clinical diagnostics, blood screening, forensics and biodefense. Great improvements to PCR performance have been achieved by the use of Hot Start activation strategies that aim to prevent DNA polymerase extension until more stringent, higher temperatures are reached. Herein we present a novel Hot Start activation approach in PCR where primers ...

  3. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217. ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  4. Characterizing contrasting soils and sediments with semispecific actinomycete r-DNA PCR primers

    Czech Academy of Sciences Publication Activity Database

    Hill, P.; Krištůfek, Václav; Caballero, S.; Kroetsch, D. J.; Rauch, Ota

    České Budějovice: Institute of Soil Biology AS CR, 2004, s. 88-92. ISBN 80-86525-03-1. [Present methods for investigation of microbial community biodiversity in soils and substrates. Methodological workshop /9./. České Budějovice (CZ), 02.03.2004-03.03.2004] Institutional research plan: CEZ:AV0Z6066911 Keywords : contrasting soils * sediments * semispecific actinomycete r-DNA PCR primers Subject RIV: EH - Ecology, Behaviour

  5. Single primer amplification reaction methods reveal exotic and indigenous mulberry varieties are similarly diverse

    Indian Academy of Sciences (India)

    Esha Bhattacharya; S B Dandin; Shirish Anand Ranade

    2005-12-01

    Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the most two methods. However, no comprehensive study on a large number of varieties has been carried out. In present study, single primer amplification reaction (SPAR) methods have been used for determination of diversity in 27 mulberry varieties (exotic as well as indigenous), using four minisatellite core sequence primers for directed amplification of minisatellite DNA (DAMD), three simple sequence repeat (SSR) motifs as primers for inter simple sequence repeat (ISSR) and 20 arbitrary sequence decamer primers for random amplified polymorphic DNA (RAPD) reactions. The Jaccard coefficients were determined for the DAMD, ISSR and RAPD band data (total of 58, 39 and 235 bands respectively). All three methods revealed wide range of distances supporting a wide range of mulberry genetic diversity. A cumulative analysis of the data generated by three methods resulted in a neighbour-joining (NJ) tree that gave a better reflection of the relatedness and affinities of the varieties to each other. Comparison of the three methods by marker indices and the Mantel test of correlation indicated that though all methods were useful for the assessment of diversity in mulberry, the DAMD method was better. When considered as two groups (10 exotic and 17 indigenous varieties), the mulberry varieties in the exotic group were found to have slightly greater diversity than the indigenous ones. These results support the concept of naturalization of mulberry varieties at locales distant from their origins.

  6. Evaluation of polymeric coatings and primers against chloride ingress in concrete

    OpenAIRE

    Aguiar, J. L. Barroso de; Schueremans, Luc; Moreira, Pedro M.; Camões, Aires; Van Gemert, D.

    2007-01-01

    Nowadays, it is common knowledge that the biggest degradation of concrete is caused by outside to inside actions. Penetration of moisture, active gases and aggressive ions, as well as mechanical, physical and chemical causes frequently act together. A low porosity and low permeability of concrete to penetration of moisture and gases are the first lines of defence against several deterioration mechanisms. One of the possible ways to protect the concrete is using coatings and primers that act a...

  7. PCR differentiation of commercial yeast strains using intron splice site primers.

    OpenAIRE

    de Barros Lopes, M; Soden, A; Henschke, P. A.; Langridge, P

    1996-01-01

    The increased use of pure starter cultures in the wine industry has made it necessary to develop a rapid and simple identification system for yeast strains. A method based upon the PCR using oligonucleotide primers that are complementary to intron splice sites has been developed. Since most introns are not essential for gene function, introns have evolved with minimal constraint. By targeting these highly variable sequences, the PCR has proved to be very effective in uncovering polymorphisms ...

  8. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  9. Primer System for Single Cell Detection of Double Mutation for Tay-Sachs Disease

    OpenAIRE

    Liu, Ming Cheng; Drury, Kenneth C.; Kipersztok, Simon; Zheng, Wenrong; Williams, R. Stan

    2000-01-01

    Purpose: Nearly 100% of infantile Tay-Sachs disease isproduced by two mutations occurring in the alpha chain ofthe lysosomal enzyme beta-N-acetylhexosaminidase (HEXA)in the Ashkenazi Jewish population. Although others havedescribed primer systems used to amplify both sitessimultaneously, few discuss the allele dropout problems inherent inthis test. Our goal was to construct a more robust testenabling stronger signal generation for single cellpreimplantation genetic diagnosis and to investigat...

  10. Optimization of Annealing Temperature To Reduce Bias Caused by a Primer Mismatch in Multitemplate PCR

    OpenAIRE

    Ishii, Kousuke; Fukui, Manabu

    2001-01-01

    To reduce PCR bias derived from a primer mismatch, the effect of the annealing temperature on the product ratio was investigated by denaturing gradient gel electrophoresis analysis of PCR products from a mixture of perfect-match and one-mismatch templates. These templates were generated by PCR from Pediococcus acidilactici for one mismatch and Micrococcus luteus for the perfect match. PCRs showed that the bias was reduced at lower temperatures. An environmental sample was also examined.

  11. Aislamiento del virus de PRRS en México: Estudio clínico, serológico y virológico Isolation of PRRS virus in Mexico: A clinical, serological and virological study

    Directory of Open Access Journals (Sweden)

    N. Sierra

    2000-01-01

    Full Text Available La enfermedad de PRRS en México es reconocida por los clínicos de cerdos como un problema importante en la patología porcina nacional desde hace varios años. Los brotes surgidos por infecciones con PRRS en poblaciones susceptibles trae consigo efectos económicamente devastadores. Los objetivos del estudio fueron identificar los signos clínicos de cada granja y contrastarlos con los de otras para identificar un patrón de presentación clínica, realizar la integración sindrómica que nos permitiera conocer los síndromes predominantes en cada granja, además de conocer el nivel de anticuerpos de las granjas muestreadas y clasificarlas de acuerdo al rango S/P (muestra de suero/control positivo y, finalmente, intentar el aislamiento del virus. Se seleccionaron 8 granjas porcinas comerciales y se llevó a cabo un estudio clínico, serológico y virológico en todas las edades y etapas fisiológico-productivas. Se tomaron 100 muestras sanguíneas en promedio por granja para los estudios virológico y serológico. En los resultados, todas las granjas fueron seropositivas además de aislarse el virus, sin embargo, sólo una granja presentó falla reproductiva. El virus estuvo presente en todas las granjas, pero se manifestó de diferentes formas, por lo cual no pudimos establecer un patrón de presentación clínica ya que fue distinto para las 8 granjas. Respecto de la edad y etapa fisiológica productiva en la que se aisló el virus, llama la atención el haberse encontrado con mayor frecuencia en cerdas de sexto parto en 7 de las 8 granjas estudiadas; así como en lechones lactantes de un mes de edad en 6 de las 8 granjas. Lo anterior sugiere que las cerdas de sexto parto así como los lechones lactantes y de un mes de edad son los más adecuados para intentar el aislamiento viralThe PRRS disease is recognized in Mexico by the swine practitioners as an important problem within the national swine pathology since several years ago. The

  12. Effect of retaining preconsruction primer (PCP) on the quality of high performance protective coatings systems

    International Nuclear Information System (INIS)

    In construction of new ships and large steel bridges in Korea, pre-construction primers (PCP), also known as shop primer, are routinely used and retained as an integral part of the protective coating system. Retention of PCP's can significantly reduce building schedule and cost. Retaining PCP through the so-called 'sweep blasting' procedure eliminates or minimizes the necessity of a second blast operation, thus shortening overall schedule as well as reducing labor cost and hazardous waste disposal cost. This study evaluates the feasibility of retaining PCP as the part of primer for high performance protective coating systems applied to ships' hull, bottom and ballast tanks. Upon proving that the retention of the PCP is a viable option, the process of coating application can be improved significantly in terms of cost and working schedule of new ships and large steel bridges. Results indicate that use of the PCP via sweeping blasting in conjunction with standard high performance protective coating systems does not degrade the overall performance of the coating systems. At the same time, it is also highly recommended that the secondary surface preparation should consist of grit blasting of weld burnt and other damaged areas to SSPC SP-10 grade (Sa 2.5 Gr.), Near White Blast Cleaning with proper application and attention to detail

  13. Una experiencia con QSB+ en Matemáticas de primer curso

    Directory of Open Access Journals (Sweden)

    Ordás Amo, Pilar

    2001-01-01

    Full Text Available Nuestro objetivo con este trabajo es presentar una experiencia que hemos llevado a cabo con los alumnos de primer curso, en la asignatura de Matemáticas, de las Licenciaturas en Ciencias Económicas y Administración y Dirección de Empresas, durante los cursos 1999/2000 y 2000/2001. El propósito de la experiencia es que los alumnos de primer curso vean una parte de la optimización matemática, como es la programación lineal, y el método del Símplex, a través de un software informático sencillo como es el QSB+, en el aula de ordenadores. Para llevar a cabo la experiencia, se añadió una hora lectiva al horario de los alumnos implicados y de los profesores de Matemáticas de primer curso, con plan nuevo (plan 99, durante el segundo semestre, de forma totalmente voluntaria para los alumnos, aunque la materia explicada en estas clases “extras” formaba parte del examen final de la asignatura. El nombre oficial de la experiencia fue Seminario de Programación Lineal, y tuvo una duración aproximada de quince horas lectivas.

  14. DNA TYPING FOR HLA - DR ALLELES BY PCR - AMPLIFICATION WITH SEQUENCE- SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    谭建明; 谢桐; 徐琴君

    1999-01-01

    Ohjective To establish a rapid genetyping for HLA- DR alleles by polymerase chain reaction wiht sequence - specifie primers (PCR - SSP) for clinical application. Material and Methods The subjects of study included 69 recipients, 43 unrelated donors and 5 cell lines, Genomic DNA was prepared from peripheral blood leukoeytes by a salting- out method, Thirty primers designed according to the HLA- DRB nucleotide sequences, and synthesized on a 391 DNN synthesizer,Twenty separate PCR reactions were perfomed for each sample, The amplification was accomplished by 34 cycles consisting of denaturation at 94℃ for 30 seconds, annealing at 60℃ for 50 seconds and extension at 72℃ for 40 seconds The specificity of matching was determined by standard DNAs and Southem hybeidization using DIG labeling probes. Results All 112 samples and 5 cell lines were able to be typed by PCR-SSP,No false positive or false negative typing results were obtained. The reproducibility was 100 %,The size of the .specific product was in cnoccrdance with the size of the designed primers. The overall time for genotyping was 4 bours. The typing results were confirned by Southem hybridization.Conelusions Genotyping for HLA- DR by PCR- SSP is a rapid and accurate matching technique suited for clinical application.

  15. Development and characterization of DNA microsatellite primers for buriti (Mauritia flexuosa L.f.).

    Science.gov (United States)

    Menezes, E V; Souto, W F S; Ciampi, A Y; Azevedo, V C R; Valério, H M; Pimenta, M A S

    2012-01-01

    Mauritia flexuosa L. (Arecaceae) is a palm tree species known as buriti that occurs in the Cerrado biome. It is characteristic of the vereda, a typical ecosystem of central Brazil. In this phytophysiognomy, M. flexuosa and other groups of arboreal-herbaceous species develop in open fields with very humid soils. M. flexuosa can be found in forest borders and is a palm tree with a wide distribution in South America (Brazil, Colombia, Venezuela, French Guyana Ecuador, Peru, and Bolivia). The main objectives of this study were to develop simple sequence repeat marker-enriched libraries and to characterize these loci in buriti palm to facilitate future population studies. A total of 40 sequences derived from the microsatellite-enriched libraries were selected for primer design. The optimization results showed that 9 primer pairs could successfully amplify polymorphic target fragments of the expected sizes. The data also show that the described primers can be used in population genetic studies in M. flexuosa to obtain information that will inform conservation and management strategies. PMID:23079977

  16. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Science.gov (United States)

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  17. Primer effect in the detection of mtDNA heteroplasmy: insights from horse Cytochrome b gene.

    Science.gov (United States)

    Zhao, Qianjun; Kang, Ye; Pu, Yabin; Niu, Lili; Guan, Weijun; He, Xiaohong; Zhang, Hongping; Lim, Hyuntae; Ma, Yuehui; Zhong, Tao

    2015-04-01

    Heteroplasmy, the presence of bi-allelic mtDNA types within an individual, has been previously detected in the D-loop region and Cytochrome b gene (Cytb) of mitochondrial DNA using PCR-RFLP. However, heteroplasmy was absent in thousands of equine mtDNA sequences deposited in GenBank. To address whether heteroplasmy widely exists in mitochondria of Chinese indigenous horses, we generated the data set of the target sites in Cytb region with Sanger sequencing and PCR-RFLP method as well. In this study, 23 heteroplasmic individuals were detected in 430 Chinese local horses. Both site and length heteroplasmy were identified in horse Cytb, especially in Xinihe and Ujumqin breeds. Our data provide evidence that the forward and reverse primers seem to produce a similar approximation to the proportion of mutation base call. However, locations of primers affected the proper detection of mtDNA heteroplasmy. The data obtained in this study highlight the importance of the primers in the accurate detection of heteroplasmy. PMID:24409928

  18. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  19. New primers for sex identification in the Chinese egret and other ardeid species.

    Science.gov (United States)

    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian; Fang, Wenzhen; Chen, Xiaolin

    2011-01-01

    Using the universal P2/P8 primers, we were able to obtain the gene segments of chromo-helicase-DNA binding protein (CHD)-Z and CHD-W from ten species of ardeid birds including Chinese egret (Egretta eulophotes), little egret (E. garzetta), eastern reef egret (E. sacra), great egret (Ardea alba), grey heron (A. cinerea), Chinese pond-heron (Ardeola bacchus), cattle egret (Bubulcus ibis), black-crowned night-heron (Nycticorax nycticorax), cinnamon bittern (Ixobrychus cinnamomeus) and yellow bittern (I. sinensis). Based on conserved regions inside the P2/P8-derived sequences, we designed new PCR primers for sex identification in these ardeid species. Using agarose gel electrophoresis, the PCR products showed two bands for females (140 bp derived from CHD-W and the other 250 bp from CHD-ZW), whereas the males showed only the 250 bp band. The results indicated that our new primers could be used for accurate and convenient sex identification in ardeid species. PMID:21429119

  20. Tea stains-inspired initiator primer for surface grafting of antifouling and antimicrobial polymer brush coatings.

    Science.gov (United States)

    Pranantyo, Dicky; Xu, Li Qun; Neoh, Koon-Gee; Kang, En-Tang; Ng, Ying Xian; Teo, Serena Lay-Ming

    2015-03-01

    Inspired by tea stains, plant polyphenolic tannic acid (TA) was beneficially employed as the primer anchor for functional polymer brushes. The brominated TA (TABr) initiator primer was synthesized by partial modification of TA with alkyl bromide functionalities. TABr with trihydroxyphenyl moieties can readily anchor on a wide range of substrates, including metal, metal oxide, polymer, glass, and silicon. Concomitantly, the alkyl bromide terminals serve as initiation sites for atom transfer radical polymerization (ATRP). Cationic [2-(methacryloyloxy)ethyl]trimethylammonium chloride (META) and zwitterionic 2-methacryloyloxyethyl phosphorylcholine (MPC) and N-(3-sulfopropyl)-N-(methacryloxyethyl)-N,N-dimethylammonium betaine (SBMA) were graft-polymerized from the TABr-anchored stainless steel (SS) surface. The cationic polymer brushes on the modified surfaces are bactericidal, while the zwitterionic coatings exhibit resistance against bacterial adhesion. In addition, microalgal attachment (microfouling) and barnacle cyprid settlement (macrofouling) on the functional polymer-grafted surfaces were significantly reduced, in comparison to the pristine SS surface. Thus, the bifunctional TABr initiator primer provides a unique surface anchor for the preparation of functional polymer brushes for inhibiting both microfouling and macrofouling. PMID:25650890

  1. Single-Copy Nuclear Gene Primers for Streptanthus and Other Brassicaceae from Genomic Scans, Published Data, and ESTs

    Directory of Open Access Journals (Sweden)

    N. Ivalú Cacho

    2013-07-01

    Full Text Available Premise of the study: We report 11 primer sets for nine single-copy nuclear genes in Streptanthus and other Thelypodieae (Brassicaceae and their utility at tribal-level and species-level phylogenetics in this poorly resolved group. Methods and Results: We selected regions based on a cross-referenced matrix of previous studies and public Brassica expressed sequence tags. To design primers, we used alignments of low-depth-coverage Illumina sequencing of genomic DNA for two species of Brassica mapped onto Arabidopsis thaliana. We report several primer combinations for five regions that consistently amplified a single band and yielded high-quality sequences for at least 70% of the species assayed, and for four additional regions whose utility might be clade specific. Conclusions: Our primers will be useful in improving resolution at shallow depths across the Thelypodieae, and likely in other Brassicaceae.

  2. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P;

    2007-01-01

    template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. METHODOLOGY: We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the...... differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the...... distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power...

  3. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

    Science.gov (United States)

    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

    2012-06-01

    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals. PMID:23950044

  4. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493. ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  5. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob

    2015-12-22

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  6. The effect of resin cements and primer on retentive force of zirconia copings bonded to zirconia abutments with insufficient retention

    OpenAIRE

    Kim, Seung-Mi; Yoon, Ji-Young; Lee, Myung-Hyun; Oh, Nam-Sik

    2013-01-01

    PURPOSE The purpose of this study was to investigate the effect of resin cements and primer on the retentive force of zirconia copings bonded to zirconia abutments with insufficient retention. MATERIALS AND METHODS Zirconia blocks (Lava, 3M ESPE, St. Paul, MN, USA) were obtained and forty sets of zirconia abutments and copings were fabricated using CAD/CAM technology. They were grouped into 4 categories as follows, depending on the types of resin cements used, and whether the primer is applie...

  7. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  8. Hyperelasticity primer

    CERN Document Server

    Hackett, Robert M

    2016-01-01

    This book introduces the subject of hyperelasticity in a concise manner mainly directed to students of solid mechanics who have a familiarity with continuum mechanics.  It focuses on important introductory topics in the field of nonlinear material behavior and presents a number of example problems and solutions to greatly aid the student in mastering the difficulty of the subject and gaining necessary insight.  Professor Hackett delineates the concepts and applications of hyperelasticity in such a way that a new student of the subject can absorb the intricate details without having to wade through excessively complicated formulations.  The book further presents significant review material on intricately related subjects such as tensor calculus and introduces some new formulations.

  9. MATLAB Primer

    CERN Document Server

    Davis, Timothy A

    2010-01-01

    The eighth edition of this popular book provides a hands-on introduction to MATLAB[registered] that can be used at the undergraduate level. The new edition features the use of MATLAB 8.0, which will be introduced to the market in March 2010. It covers object-oriented programming in MATLAB and the improvements that have been made to the MATLAB desktop and programming tools. There is a new chapter that discusses MATLAB Central, a supporting website where users can exchange files, blogs, and links. In addition, the appendix of help topics has been updated to reflect only the most frequently used

  10. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.

    1980-10-01

    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  11. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  12. Validation of a primer optimisation matrix to improve the performance of reverse transcription – quantitative real-time PCR assays

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-06-01

    Full Text Available Abstract Background The development of reverse transcription – quantitative real-time PCR (RT-qPCR platforms that can simultaneously measure the expression of multiple genes is dependent on robust assays that function under identical thermal cycling conditions. The use of a primer optimisation matrix to improve the performance of RT-qPCR assays is often recommended in technical bulletins and manuals. Despite this recommendation, a comprehensive introduction to and evaluation of this approach has been absent from the literature. Therefore, we investigated the impact of varying the primer concentration, leaving all the other reaction conditions unchanged, on a large number of RT-qPCR assays which in this case were designed to be monitored using hydrolysis probes from the Universal Probe Library (UPL library. Findings Optimal RT-qPCR conditions were determined for 60 newly designed assays. The calculated Cq (Quantification Cycle difference, non-specific amplification, and primer dimer formation for a given assay was often dependent on primer concentration. The chosen conditions were further optimised by testing two different probe concentrations. Varying the primer concentrations had a greater effect on the performance of a RT-qPCR assay than varying the probe concentrations. Conclusion Primer optimisation is important for improving the performance of RT-qPCR assays monitored by UPL probes. This approach would also be beneficial to the performance of other RT-qPCR assays such as those using other types of probes or fluorescent intercalating dyes.

  13. Effect of Saliva Contamination on Shear Bond Strength of Orthodontic Brackets When Using a Self-Etch Primer

    Institute of Scientific and Technical Information of China (English)

    MAO Jing; QI Juan

    2005-01-01

    The effect of saliva contamination on the shear bond strength of orthodontic brackets, at various stages of the bonding procedure using a new self-etch primer was studied. The samples were divided into 4 groups according to 4 different enamel surface conditions: Group A: dry; Group B: saliva contamination before priming; Group C: saliva contamination after priming, and Group D: saliva contamination before and after priming. Stainless steel brackets were bonded in each test group with a light-cured composite resin (TransbondXT 3M). The shear bond strength was determined in the first 30 min after bonding. The analysis of variance indicated that the shear bond strengths of the 4 groups were significantly different (F= 11.89, P<0.05). Tukey HSD tests indicated that contamination both before and after the application of the acid-etch primer resulted in a significantly lower (=4.6± 1.7 MPa) shear bond strength than either the control group (= 8.8±1.9 MPa) or the groups where contamination occurred either before ( = 7.9± 2.0 MPa) or after (=6.9±1.5 MPa) the application of the primer. It was concluded that the new acid-etch primer could maintain adequate shear bond strength if contamination occurred either before or after the application of the primer. On the other hand, contamination both before and after the application of the primer could significantly reduce the shear bond strength of orthodontic brackets.

  14. A Pair of Novel Primers for Universal Detection of the NS1 Gene from Various Bluetongue Virus Serotypes

    Institute of Scientific and Technical Information of China (English)

    Hui-qiong YIN; Gai-ping ZHANG; Hong ZHANG; Jin-gang ZHANG

    2008-01-01

    Twenty five serotypes of Bluetongue virus (BTV) have been identified worldwide. Rapid and reliable methods of virus universal detection are essential for fighting against bluetongue (BT). We have therefore developed and evaluated a pair of primers which can detect various serotypes of BTV by RT-PCR. Analysis of the viral protein 7 (VP7) and the non-structural protein (NS1) gene from different serotypes of BTV by DNAstar showed that the 5' end of the NS1 gene is the most conserved region. The primer pairs (P1 and P2) were designed based on the highly conserved region of NS1. The novel primers were evaluated by detecting BTV serotypes 1, 3, 5, 8, 10, 11, 21 and 22. The specificity of the primers was estimated by comparing to gene sequences of viruses published in GenBank, and further assessed by detecting BTV serotype 1-12 and Epizootic hemorrhagic disease virus (EHDV) serotype 1-4. The sensitivity and repeatability of PCR with the novel primers were evaluated by successfully detecting the recombinant plasmid pGEM-T121 containing the diagnosed nucleotide sequence. Our results suggest that these unique primers can be used in high throughout and universal detection of the NS1 gene from various BTV serotypes.

  15. Detection of YMDD mutation using mutant-specific primers in chronic hepatitis B patients before and after lamivudine treatment

    Institute of Scientific and Technical Information of China (English)

    Cha-Ze Lee; Hsuan-Shu Lee; Guan-Tarn Huang; Pei-Ming Yang; Jin-Chuan Sheu

    2006-01-01

    AIM: To develop a PCR assay using mutant-specific primers to detect mutation of tyrosine-methionineaspartate-aspartate (YMDD) motif of HBV to tyrosinevaline-aspartate-aspartate (YVDD) or tyrosine-isoleucineaspartate-aspartate (YIDD).METHODS: Cloned wild-type and mutant HBV sequences were used as templates to test the sensitivity and specificity of the assay. A variety of primer construction, primer concentration, dNTP concentration,and annealing temperature of primers were systematically examined. Pair primers specific to rtL180M and rtM204V were selected for YVDD detection. Primer specific to rtM204I with an additional 3'-penultimate base mismatched to both the mutant and wild-type sequence was selected for YIDD detection. We applied this assay to study YMDD mutants in 28 chronic hepatitis B patients before and after lamivudine treatment.RESULTS: We could detect as little as 0.001%-0.00001%of mutant viruses coexisting in 108-109 copies of wildtype HBV using this assay. YMDD mutants were detected in 8 of 12 HBeAg-positive patients and 8 of 16 HBeAgnegative patients before lamivudine treatment. After treatment, two more patients in HBeAg-positive patients and seven more patients in HBeAg-negative patients developed YMDD mutations.CONCLUSION: We developed a highly sensitive and specific assay for detecting YMDD mutants. This assay can be applied to monitor chronic hepatitis B patients before and during lamivudine treatment.

  16. Primer Congreso Colombiano de Biotecnología: la biotecnología en el desarrollo del país

    OpenAIRE

    de Biotecnología Revista Colombiana

    2011-01-01

    L a biotecnología es la tecnología del siglo XXI. Se caracteriza por sus cambios rápidos, alta inversiónen capital de riesgo y considerables costos de investigación y desarrollo, acompañada con unatasa de retorno de la inversión muy atractiva. Esto ha sido posible gracias al desarrollo de dos tiposde procesos, el primero, encaminado a la búsqueda y aislamiento de nuevos organismos del medionatural que tengan propiedades útiles (industrializables), y el segundo, que involucra la aplicación dem...

  17. Fundación del primer bioterio MPF funcional de Colombia Foundation of a functional murine pathogen free animal facility in Colombia

    OpenAIRE

    Ómar Vesga; Salazar, Beatriz E; Wilson Galvis; Sergio A. Loaiza; María Agudelo; Andrés F. Zuluaga

    2003-01-01

    Cualquier investigación donde se experimente con modelos animales exige que el estado microbiológico y genético de los mismos sea definido desde el principio y verificado periódicamente para garantizar la fiabilidad y certeza de los datos. Buscando producir ratones libres de patógenos murinos en Colombia, se importaron 173 reproductores no emparentados suizos albinos de la cepa ICR que se hospedaron bajo condiciones protocolizadas de aislamiento microbiológico en el Bioterio MPF de la Faculta...

  18. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  19. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  20. Streptococcus salivarius ATCC 25975 possesses at least two genes coding for primer-independent glucosyltransferases.

    Science.gov (United States)

    Simpson, C L; Giffard, P M; Jacques, N A

    1995-01-01

    Fractionation of the culture medium showed that Streptococcus salivarius ATCC 25975 secreted a glucosyltransferase (Gtf) that was primer independent. On the basis of this observation, a gene library of S. salivarius chromosomal DNA cloned into lambda L47.1 was screened for a gene(s) coding for such an activity. As a result of this screening process, two new gtf genes, gtfL and gtfM, both of which coded for primer-independent Gtf activities, were isolated. GtfL produced an insoluble glucan that was refractory to digestion by the endo-(1-->6)-alpha-D-glucanase. of Chaetonium gracile, while GtfM produced a soluble glucan that was readily degraded by the glucanase. Comparison of the deduced amino acid sequences of gtfL and gtfM with 10 other available Gtf sequences allowed the relatedness of the conserved catalytic regions to be assessed. This analysis showed that the 12 enzymes did not form clusters based on their primer dependencies or on their product solubilities. Further analysis of the YG repeats in the C-terminal glucan-binding domains of GtfJ, GtfK, GtfL, and GtfM from S. salivarius showed that there was strong homology between a block of contiguous triplet YG repeats present in the four alleles. These blocks of YG repeats were coded for by a region of each gene that appeared to have arisen as a result of a recent duplication event(s). PMID:7822030

  1. Application of PCR fingerprinting using (GACA 4 primer in the rapid discrimination of dermatophytes

    Directory of Open Access Journals (Sweden)

    E Elavarashi

    2014-01-01

    Full Text Available Background: Superficial fungal infections have a major impact on cosmetic health, affecting more than 20-25% of the global population, which is predominantly caused by dermatophytes. As per literature search, molecular strain typing of dermatophytes has not been investigated in India. Therefore, the present study was carried out to characterise the dermatophyte species and strains by molecular methods. Objective: To analyse the genotype variability by applying polymerase chain reaction (PCR fingerprinting using a simple sequence repetitive oligonucleotide (GACA 4 primer to identify the species and strain variations among the dermatophytes isolated from a tertiary care centre in Chennai. Materials and Methods: From January 2010 to December 2010, 81 dermatophytes were isolated and included for the present study. A simple sequence repetitive oligonucleotide (GACA 4 was used as a single primer in the amplification process. Results: The (GACA 4 -based PCR successfully amplified all the clinical isolates. Trichophyton rubrum and T. rubrum var. raubitschekii produced identical band profiles, where the latter could not be differentiated from the T. rubrum, which are being reported for the first time from south India. Epidermophyton floccosum produced species-specific band profiles. Intra-species variability was not observed among the T. rubrum and E. floccosum isolates. T. mentagrophytes produced three simple, distinct band patterns, which are surprisingly different from the earlier studies. Conclusion: The PCR-based genotype using the short primer is rapid and precise in direct identification of dermatophyte isolates by one-step PCR to the species level and strain discrimination of the T. mentagrophytes variants.

  2. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  3. Primer reporte de la mancha bacteriana en parchita (Passiflora edulis Sims f. flavicarpa en Venezuela First report of bacterial blight of passion fruit (Passiflora edulis Sims f. flavicarpa in Venezuela

    Directory of Open Access Journals (Sweden)

    Yoleidy Escalona

    2011-04-01

    Full Text Available El cultivo de la parchita maracuyá es afectado por diversos tipos de enfermedades. La planta, en la localidad de Aroa (estado Yaracuy ha presentado daños en forma de manchas húmedas en las hojas. Con la finalidad de determinar la identidad del agente causal de esta enfermedad se llevó a cabo el presente trabajo. Hojas sintomáticas fueron llevadas al laboratorio, se desinfectaron con NaOCl al 2% y se obtuvo el aislamiento de una bacteria color amarillo pálido en los medios Agar nutritivo (AN y extracto de levadura-dextrosa-carbonato de calcio (YDC, la cual fue inoculada en plantas sanas de parchita. Una vez reproducidos los síntomas 15 días después de la inoculación, se procedió al reaislamiento obteniéndose colonias idénticas a las originales y se realizó la identificación de la bacteria mediante características culturales, morfológicas, fisiológicas y bioquímicas. Se encontró una bacteria con forma de bastón, Gram negativa, aeróbica, con reacción positiva a catalasa, hidrólisis del almidón, producción de H2S, crecimiento a 35°C, hidrólisis de esculina, licuefacción de gelatina y digestión de proteínas; con reacción negativa al bactofenol rojo dextrosa agar, oxidasa, producción de ureasa y reducción de nitratos; produjo ácidos a partir de arabinosa, glucosa, manosa, celobiosa, fructosa, galactosa y trehalosa; creció en los medios SX y Tween. Todas estas características permitieron identificar el agente causal como Xanthomonas axonopodis pv. passiflorae (Pereira Gonçalves & Rosato, constituyendo este trabajo el primer reporte de la bacteria en el cultivo de la parchita en Venezuela.The cultivated passion fruit (Passiflora edulis Sims f. flavicarpa is affected by several kinds of diseases. At the locality of Aroa, Yaracuy State, the plant has shown damages such as leaf spots, and this work was carried out to determine the identity of the causal agent of this disease. Symptomatic leaves were collected and

  4. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.

    Science.gov (United States)

    Ray, Thomas S

    2016-02-01

    The drug MDMA, commonly known as ecstasy, produces a specific and distinct open hearted mental state, which led to the creation of a new pharmacological class, "entactogens". Extensive literature on its mechanisms of action has come to characterize MDMA as a "messy" drug with multiple mechanisms, but the consensus is that the distinctive entactogenic effects arise from the release of neurotransmitters, primarily serotonin. I propose an alternative hypothesis: The entactogenic mental state is due to the simultaneous direct activation of imidazoline-1 (I1) and serotonin-2 (5-HT2) receptors by MDMA. This hypothesis emerges from "mental organ" theory, which embodies many hypotheses, the most relevant of which are: "Mental organs" are populations of neurons that all express their defining metabotropic receptor, and each mental organ plays a distinct role in the mind, a role shaped by evolution as mental organs evolve by duplication and divergence. Mental organs are the mechanism by which evolution sculpts the mind. Mental organs can be in or out of consciousness. In order for a mental organ to enter consciousness, three things must happen: The mental organ must be activated directly at its defining receptor. 5-HT2 must be simultaneously activated. One of the functions of activated 5-HT2 is to load other simultaneously activated mental organs fully into consciousness. In some cases THC must be introduced to remove long-term blocks mediated by the cannabinoid system. I propose the "primer/probe" method to test these hypotheses. A "primer" is a drug that selectively activates 5-HT2 (e.g. DOB or MEM) or serotonin-1 (5-HT1) and 5-HT2 (e.g. DOET or 2C-B-fly). A "probe" is a drug that activates a receptor whose corresponding mental organ we wish to load into consciousness in order to understand its role in the mind. The mental organ is loaded into consciousness when the primer and probe are taken together, but not when taken separately. For example, the blood pressure

  5. Optimal time of soybean seed priming and primer effect under salt stress conditions

    OpenAIRE

    Miladinov Zlatica J.; Balešević-Tubić Svetlana N.; Đorđević Vuk B.; Đukić Vojin H.; Ilić Aleksandar D.; Čobanović Lazar M.

    2015-01-01

    The aim of this study was to examine optimal time of soybean seed priming and effect of primers under salt stress conditions. Testing was performed at the Institute of Field and Vegetable Crops, Novi Sad, on Galina seed variety. Optimal priming time was determined by immersing seed into: KNO3 (1%), H2O2 (0.1%), and H2O with the duration of 6 h, 12 h, 18 h, and 24 h. After drying until the initial moisture, the seed was placed for germination and after eight...

  6. El primer tractat de gravat calcogràfic a España

    OpenAIRE

    Figueras Ferrer, Eva

    1992-01-01

    Els estudis sobre la història del gravat coincideixen a designar l'obra de Manuel de Rueda 'Instrucción para gravar en cobre', publicada l'any 1791, com el primer manual calcogràfic escrit a Espanya. Es tracta, bàsicament, d'una traducció de les fonts bibliogràfiques franceses, entre les quals cal destacar la d'Abraham Bosse. En aquest article tenim la satisfacció de publicar un manuscrit espanyol, inèdit fins ara, que precedeix un segle l'obra de Manuel de Rueda. Es titula 'Método para grava...

  7. Primer reporte de nidos depredados por la chachalaca vetula (Ortalis vetula)

    OpenAIRE

    Ángel A. Molina-García; César R. Maldonado Hernández; Adán Oliveras de Ita; Octavio R. Rojas-Soto

    2008-01-01

    Reportamos el primer registro de depredación de nidos realizada por la chachalaca vetula (Ortalis vetula) en La Mancha, Actopan, Veracruz; tal comportamiento se observó sobre tres nidos artificiales durante un estudio de supervivencia de nidos y se sustentó en tres evidencias: las marcas del pico, la presencia de plumas y mediante una observación directa de depredación. Discutimos la importancia de esta conducta originada probablemente en la necesidad que tienen las aves de fuentes alternas d...

  8. Primer registro de oso negro americano (Ursus americanus) para el estado de Hidalgo, México

    OpenAIRE

    Alberto Enrique Rojas-Martínez; Luis Antonio Juárez-Casillas

    2013-01-01

    Se documenta el primer registro del oso negro americano (Ursus americanus) para el estado de Hidalgo, México, mismo que representa el punto más sureño de la distribución de esta especie. El ejemplar se encontró muerto cerca del poblado El Aguaje de Cerro Prieto en un lugar conocido como La Joya, municipio de La Misión, en el norte del estado, a una altitud de 1 481 m, probablemente correspondía a un individuo errante proveniente del estado de Querétaro.

  9. Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection.

    Science.gov (United States)

    Avendaño-Herrera, Rubén; Magariños, Beatriz; Toranzo, Alicia E; Beaz, Roxana; Romalde, Jesús L

    2004-11-23

    In this study the specificity and sensitivity of 2 primer pairs, MAR1-MAR2 and Mar1-Mar2, for the detection of Tenacibaculum maritimum were evaluated in parallel using 79 T. maritimum strains isolated from different fish species, as well as 53 representatives of related and unrelated bacterial species. Both primer pairs were species-specific for T. maritimum, since no amplification products were obtained from chromosomal DNA of the non-T. maritimum bacteria tested. However, whereas MAR1-MAR2 identified all the T. maritimum strains studied, producing a unique and clear PCR band of the expected 1088 bp length, the Marl-Mar2 primer pair failed to amplify the 400 bp specific band in 3 sole isolates. To verify if these strains belonged to T. maritimum species, 2 endonucleases (PvuI and SacII) were selected as the most adequate enzymes to confirm the specificity of the MAR1-MAR2 amplified fragment. The digestion patterns obtained with both endonucleases supported the assignation of all the strains to T. maritimum. The sensitivity of both PCR detection methods was also different, showing a reduction of sensitivity in at least one order of magnitude of the Marl-Mar2 primer pair in comparison with MAR1-MAR2. When the MAR-MAR2 PCR protocol was applied to different seeded turbot tissues, the detection limit was 10(2) to 10(4) T. maritimum cells per reaction. In addition, a nested PCR protocol for detection of this pathogens based on MAR1-MAR2 was developed, which increased the sensitivity by approximately 2 orders of magnitude, ranging from 1 to 250 T. maritimum cells per reaction depending on the tissue employed. The tissues that allowed the most easy detection of T. maritimum were the skin and mucus. Based on the findings reported here, we propose the nested PCR protocol as the most adequate for an accurate detection of T. maritimum in diagnostic pathology as well as in epidemiological studies of gliding bacterial disease of marine fish. PMID:15648833

  10. Luis López-Ballesteros: primer traductor de las obras completas de Freud al castellano

    OpenAIRE

    Juan Manuel Martín Arias; Lorenzo Gallego Borghini

    2011-01-01

    El castellano fue el primer idioma al que se tradujeron las obras completas de Sigmund Freud. A ello contribuyeron diversos factores, entre los que se destaca la figura de Luis López-Ballesteros, a quien le encargó la traducción la editorial Biblioteca Nueva. En este artículo se esbozan someramente la recepción del psicoanálisis en España y las traducciones de Freud al español y se ofrece una breve semblanza de Luis López-Ballesteros. --------------------------------------------- Luis López-B...

  11. Primer caso de hemoglobina Köln (codon98 GTG>ATG en Costa Rica

    Directory of Open Access Journals (Sweden)

    Walter Cartín

    2010-03-01

    Full Text Available La exposición a ciertos medicamentos puede provocar anemia hemolítica con presencia de cuerpos de Heinz en sangre periférica. Esta anemia puede presentarse por sobredosis de medicamentos, tanto en individuos sanos como en personas con deficiencias enzimáticas como la glucosa-6-fosfato deshidrogenasa, o en presencia de hemoglobinas inestables. Este reporte muestra un caso de anemia hemolítica con cuerpos de Heinz, debido a la presencia de una hemoglobina inestable, cuyos estudios moleculares y HPLC confirmaron el primer caso descrito de hemoglobina Köln (Val98Met en Costa Rica.

  12. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  13. El primer caso de herejía en el Nuevo Mundo

    OpenAIRE

    Szászdi, István

    2001-01-01

    This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  14. El primer caso de herejía en el Nuevo Mundo

    Directory of Open Access Journals (Sweden)

    Szászdi, István

    2001-12-01

    Full Text Available This article tries to identify the self-styled heretic from among the 39 Spaniards that remained in Fortress of Nativity when Christopher Columbus came back to Spain after his first journey to the New World.

    Intento de identificar al supuesto hereje entre los 39 españoles que se quedan en el Fuerte de la Navidad cuando Cristóbal Colón vuelve a España después de su primer viaje al Nuevo Mundo.

  15. PRIPOVEDNE TRADICIJE VISOKEGA IN POZNEGA SREDNJEGA VEKA IZ MEDKULTURNE PERSPEKTIVE. PRIMER: PESEM O RONALDU.

    OpenAIRE

    Lebar, Robert

    2015-01-01

    Cilj magistrskega dela z naslovom Pripovedne tradicije visokega in poznega srednjega veka iz medkulturne perspektive. Primer: Pesem o Rolandu je priskrbeti vpogled v medkulturnost srednjeveške družbe in literature na nemškem govornem področju s pomočjo sodobnih kulturno in literarnozgodovinskih konceptov. V uvodnem delu so obravnavani temelji srednjeveške literature v kontekstu sočasnih družbenih struktur. V nadaljevanju je ta problematika razširjena z vprašanjem o vplivu francoske kulture na...

  16. Empresas nanotecnológicas en México: hacia un primer inventario

    OpenAIRE

    Edgar Záyago Lau; Guillermo Foladori; Richard P. Appelbaum; Edgar Ramón Arteaga Figueroa

    2013-01-01

    En este artículo presentamos un inventario inicial de compañías mexicanas que venden productos que son manufacturados a partir de nanotecnología, o que utilizan nanotecnología en sus operaciones. El inventario permite a los interesados identificar el número de empresas, su ubicación geográfica y los sectores industriales en los que se insertan. Esto es, de hecho, un primer acercamiento para el análisis los vínculos productivos de la nanotecnología en México. Los resultados muestran una alta c...

  17. Incidencia de los Movimientos Oculares en el proceso lector de alumnos de Primer ciclo de Primaria.

    OpenAIRE

    Alejo-Ramos, Cristina

    2013-01-01

    Los movimientos oculares en la lectura son importantes para el proceso de aprendizaje de los niños. Este trabajo de investigación tiene como objetivo, conocer la influencia de los movimientos oculares en la lectura. Para ello se llevó a cabo un estudio, con una muestra de 30 alumnos del Primer ciclo de Primaria, es decir, Primero y Segundo, del mismo centro educativo. Una vez que se realizaron las pruebas oportunas, se pudo comprobar cómo estaban relacionadas motricidad ocular y lectura...

  18. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    OpenAIRE

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solu...

  19. Las bibliotecas públicas durante el primer franquismo: entre la continuidad y la ruptura

    OpenAIRE

    Rodrigo Echalecu, Ana María

    2009-01-01

    En esta Memoria se analiza el concepto de biblioteca pública durante el primer franquismo, así como la organización bibliotecaria, los Centros Coordinadores de Bibliotecas, los diferentes tipos de bibliotecas públicas, así como el personal que las gestionó y sus instalaciones. Especial atención han recibido las bibliotecas municipales al estudiar el marco jurídico y su localización a través de una cartografía inédita.

  20. Reporte del primer hallazgo de puma (Puma concolor puma) infectado con Trichinella sp. en Chile

    OpenAIRE

    Hidalgo, A.; CA Oberg; F Fonseca-Salamanca; Vidal MF

    2013-01-01

    En la actualidad, Trichinella spiralis es la única especie que ha sido identificada en Chile como agente de la trichinellosis, tanto en hospedadores domésticos como silvestres. Estudios preliminares no han identificado aún la infección por Trichinella en animales nativos de Chile. La presente comunicación, informa del primer hallazgo de Trichinella sp. aislado en musculatura diafragmática e intercostales de un ejemplar de Puma (Puma concolor puma) encontrado muerto mediante seguimiento por te...