WorldWideScience

Sample records for baba2 primer aislamiento

  1. Primer aislamiento de Escherichia coli O157:H7 Enterohemorrágica en el Perú

    Directory of Open Access Journals (Sweden)

    Blanca Huapaya C

    2001-01-01

    Full Text Available En Febrero del año 2001 como parte del "Estudio transversal de los agentes etiológicos de diarrea aguda" en la Macrorregión Sur del país, el Laboratorio Referencial de Tacna aisló una cepa procedente de una muestra de heces de un lactante de 11 meses de edad con un cuadro de diarrea disentérica, identificándola como Escherichia coli O157. Esta cepa fue confirmada y caracterizada en el Instituto Nacional de Salud como E. coli O157:H7 toxina shiga tipo II, siendo el primer aislamiento reportado de Escherichia coli enterohemorrágica en el Perú.

  2. Frecuencia de los genotipos babA2, oipA y cagE de Helicobacter pylori en pacientes colombianos con enfermedades gastroduodenales.

    Directory of Open Access Journals (Sweden)

    Andrés Javier Quiroga

    2005-09-01

    Full Text Available Introducción. La infección con Helicobacter pylori está asociada con el desarrollo de diferentes enfermedades gastroduodenales. Varios genes de virulencia de H. pylori se han relacionado con mayor riesgo de enfermedad gástrica. Objetivos. El propósito de este trabajo fue determinar las posibles asociaciones entre la presencia de los genes vacA, cagA, cagE, babA2 y oipA en aislamientos de H. pylori de pacientes colombianos y las diferentes consecuencias clínicas de la infección. Materiales y métodos. Mediante PCR se evaluaron los genotipos cagA, vacA, cagE, oipA y babA2 en 166 aislamientos de H. pylori provenientes de 50 pacientes con úlcera péptica, 39 con gastritis crónica no atrófica, 26 con gastritis crónica atrófica, 26 con metaplasia intestinal y 25 con adenocarcinoma gástrico. Resultados. La frecuencia de los genotipos cagA, cagE, babA2 y oipA fue de 73%, 75%, 48% y 74%, respectivamente. El 64% (100/157 de los aislamientos presentó el genotipo citotóxico vacAs1m1/cagA positivo/cagE positivo. Se observó una mayor frecuencia de cepas citotóxicas en pacientes con cáncer (84%, metaplasia (91% y úlcera (81% en comparación con pacientes con gastritis no atrófica (50% (p=0,002, 0,008 y 0,007, respectivamente. La frecuencia de oipA y babA2 fue mayor en cepas citotóxicas que en cepas no citotóxicas (oipA: 81% vs. 52%, p=0,003; babA2: 58% vs. 12%, p=0,000. No se observaron diferencias significativas en la frecuencia de los genes oipA o babA2 solos o en asociación con vacA y cagA/cagE y las diferentes enfermedades gastroduodenales. Conclusiones. No se encontraron evidencias que sugieran que los genes babA2 u oipA puedan servir como marcadores de ulcerogénesis o carcinogénesis en esta población, solos o en asociación con cagA, cagE o vacA.

  3. Data of evolutionary structure change: 1BABA-2ZLWD [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 1BABA-2ZLWD 1BAB 2ZLW A D MELSPADKTNVKAAWGKVGAHAGEYGAEALERMFLSFPT...R VQLSGEEKAAVLALWDKVN--EEEVGGEALGRLLVVYPWTQRFFDSFGDLSNPGAVMGNPKVKAHGKKVLHSFGEGVHHLDNLKGTFAALSEL...dex> 2ZLW D 2ZLWD WD

  4. Primer aislamiento de Encephalitozoon intestinalis a partir de muestra de materia fecal de un paciente colombiano con sida

    Directory of Open Access Journals (Sweden)

    Ana Luz Galván

    2008-09-01

    Full Text Available Introducción. Los microsporidios son agentes de infecciones oportunistas en pacientes con sida y con trasplantes, principalmente. Enterocytozoon bieneusi y Encephalitozoon intestinalis son los más frecuentes, asociados con infecciones entéricas. Los cultivos celulares han contribuido al conocimiento de los microsporidios. En Colombia no se han obtenido aislamientos provenientes de pacientes con microsporidiosis y, por consiguiente, no existen cepas autóctonas de los mismos. Objetivo. Establecer el cultivo celular de microsporidios intestinales a partir de materia fecal de pacientes parasitados. Materiales y métodos. Se realizó concentración agua-éter de la materia fecal positiva para microsporidios y el sedimento resultante se trató con una mezcla de antibióticos y antimicóticos durante 18 horas a 37 oC. Se inocularon células Vero previamente cultivadas en placas de 24 pozos y en medio RPMI con suplemento de suero bovino fetal al 10% y antibióticos, con las esporas concentradas. Los cultivos se mantuvieron a 37 oC al 5% de CO2. Se cambió de medio cada dos días y se evaluó la presencia de esporas en los sobrenadantes mediante Gram-cromótropo rápido en caliente. Resultados. En la segunda semana después de la infección, se encontraron esporas de microsporidios con morfología y coloración características. Mediante PCR se determinó que el microsporidio encontrado correspondía a la especie E. intestinalis. Conclusión. Se estableció el cultivo in vitro de microsporidios de materia fecal. Este protocolo es importante para la obtención y el mantenimiento de cepas autóctonas en Colombia, y contribuirá a las investigaciones de aspectos bioquímicos, inmunológicos y epidemiológicos de dichas cepas.

  5. Primer aislamiento en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina

    Directory of Open Access Journals (Sweden)

    Laura Errecalde

    Full Text Available Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a la meticilina adquirido en la comunidad. Durante el tratamiento con vancomicina y daptomicina, se observó un aumento gradual de la CIM de vancomicina de 1 µg/ml (VSSA a 2 µg/ml (h-VISA y a 4 µg/ml (VISA, y la emergencia de no sensibilidad a daptomicina (CIM = 4 µg/ml. Al suspender la vancomicina y la daptomicina, la cepa revirtió al fenotipo de sensibilidad a ambas drogas. Es mandatorio evaluar por CIM la sensibilidad a vancomicina y a daptomicina intratratamiento cuando estas drogas se usan como terapia.

  6. Prevalence of Helicobacter pylori cagA, babA2, and dupA genotypes andcorrelation with clinical outcome in Malaysian patients with dyspepsia

    OpenAIRE

    OSMAN, HUSSEIN ALI; HASAN, HABSAH; SUPPIAN, RAPEAH; HASSAN, SYED; ANDEE, DZULKARNAEN ZAKARIA; MAJID, NOORIZAN ABDUL; ZILFALIL, BIN ALWI

    2015-01-01

    Background/aim: The severity of disease outcome in dyspepsia has been attributed to Helicobacter pylori virulence genes. The aim of this study was to determine the distribution of H. pylori virulence genes (cagA, babA2, and dupA) and to determine whether or not there arises a significant correlation with clinical dyspepsia outcomes. Materials and methods: H. pylori genotypes cagA, babA2, and dupA were identified by polymerase chain reactions from gastric biopsy samples in 105 H. pylori-posit...

  7. Prevalence of Helicobacter pylori cagA, babA2, and dupA genotypes and correlation with clinical outcome in Malaysian patients with dyspepsia.

    Science.gov (United States)

    Osman, Hussein Ali; Hasan, Habsah; Suppian, Rapeah; Hassan, Syed; Andee, Dzulkarnaen Zakaria; Abdul Majid, Noorizan; Zilfalil, Bin-alwi

    2015-01-01

    The severity of disease outcome in dyspepsia has been attributed to Helicobacter pylori virulence genes. The aim of this study was to determine the distribution of H. pylori virulence genes (cagA, babA2, and dupA) and to determine whether or not there arises a significant correlation with clinical dyspepsia outcomes. H. pylori genotypes cagA, babA2, and dupA were identified by polymerase chain reactions from gastric biopsy samples in 105 H. pylori-positive patients. The positive rates for cagA, babA2, and dupA genes in H. pylori dyspeptic patients were 69.5%, 41.0%, and 22.9%, respectivel cagA was more prevalent in Indians (39.7%), babA2 was more prevalent in Malays (39.5%), and dupA detection occurred more frequently in both Indians and Malays and at the same rate (37.5%). The Chinese inhabitants had the lowest prevalence of the three genes. Nonulcer disease patients had a significantly higher distribution of cagA (76.7%), babA2 (74.4%), and dupA (75.0%). There was no apparent association between these virulence genes and the clinical outcomes. The lower prevalence of these genes and variations among different ethnicities implies that the strains are geographically and ethnically dependent. None of the virulence genes were knowingly beneficial in predicting the clinical outcome of H. pylori infection in our subjects.

  8. Aislamiento acústico

    Directory of Open Access Journals (Sweden)

    Tobío, J. M.

    1970-07-01

    Full Text Available This is a very specific subject in the field of architectural acoustics, namely, insulation'. Emphasis is placed on the theoretical foundations of this phenomenon, and the most simple formula are developed to calculate easily the transmission losses of a material or the constructional insulating arrangements. The practical aspect of insulation can be considered by means of several graphs and charts, without the use of mathematics, and utilising common materials, that will not substantially increase the cost of the project. Finally this papers offers a critical discussion of building codes, and their reference to the acoustical insulation of dwellings, and data is included on the new regulations of the Madrid Municipality.Se trata un tema muy concreto de la Acústica Arquitectónica, el aislamiento, haciendo hincapié en los fundamentos teóricos del fenómeno y estableciendo las fórmulas más sencillas que permiten calcular fácilmente las pérdidas de transmisión de un material o disposición constructiva aislante. Varias gráficas y abacos permiten abordar, sin ningún tratamiento matemático, el problema práctico del aislamiento, aprovechando los materiales comunes y sin ocasionar gastos que graven sustancialmente el importe del proyecto. Por último, se hace un estudio crítico de las normas y su incidencia en los problemas del aislamiento de viviendas, incluyendo datos referentes a la nueva Ordenanza del Ayuntamiento de Madrid.

  9. Hombre, calor y aislamiento

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1961-11-01

    Full Text Available Con los nuevos tipos estructurales y con los adelantos de las ciencias biológicas en lo que se refiere a los procesos orgánicos, mis ideas sobre aislamiento, y las de casi todos los demás arquitectos y constructores, han sufrido una evolución interesantísima en los últimos veinticinco años. Y me complace subrayar que los que, como yo, estudiamos el decorado humano, podemos hacer mucho en beneficio de nuestros clientes. No hace aún mucho tiempo toda la protección de una casa contra el peligro de transferencia térmica se confiaba exclusivamente a muros y cubiertas no aislantes. Los propietarios se limitaban a culpar al tiempo de su falta de confort. Pero esta falta de comodidad en cuanto a calefacción no era la única consecuencia; tras ella aparecían daños de efectos duraderos y patológicos.

  10. Contención sin aislamiento

    OpenAIRE

    Mario Sánchez Gumiel

    2013-01-01

    En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, c...

  11. Aislamiento de tres cepas de leishmania

    Directory of Open Access Journals (Sweden)

    Florentino Rey

    1942-08-01

    Full Text Available Con el ánimo de estudiar el problema parasitológico de la Leishmaniasis cutánea en Colombia, emprendimos algunas experiencias al respecto. Este es un estudio de aislamiento de tres cepas de Leishmania obtenidas de tres enfermos de distintas regiones del país, Investigadores colombianos que se han ocupado con anterioridad de este problema, obtuvieron siempre resultados negativos. Comunicaciones posteriores informarán sobre estudios experimentales de las cepas mencionadas.

  12. Contención sin aislamiento

    Directory of Open Access Journals (Sweden)

    Mario Sánchez Gumiel

    2013-02-01

    Full Text Available En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, como el Atlántico después de la Segunda Guerra Mundial, en el nuevo escenario geopolítico del siglo XXI.Palabras Clave: Estados Unidos, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Contención, Aislamiento, Corea, Vietnam, Tian’anmen, URSS, Comunismo, Capitalismo.___________________Abstract:On February 2012 took place the fourtieth anniversary of President Nixon’s visiting to China and, as a consequence, of the resumption of the Sino-American relations which had been interrupted in 1949. Since then, the United States and China have experienced a reciprocal policy of containment without isolation, both being aware of their mutual differences but knowing of the necessity of mutual understanding as well. As a result, the Pacific ocean is making changes, just as the Atlantic after the Second World War, in order to become the new geopolitical place of the Twenty First century.Keywords: United States, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Containment, Isolation, Korea, Vietnam, Tian’anmen, USSR, Communism, Capitalism.

  13. Consideraciones sobre aislamientos térmicos

    Directory of Open Access Journals (Sweden)

    García Arroyo, A.

    1966-06-01

    Full Text Available The yearly change in ambient temperature, and also the daily variations, become notably evident inside buildings. In extreme cases they cause considerable discomfort. This can be avoided by two means: insulation and heating or air conditioning. As each of these factors covers a wide range of possibilities, a detailed study of the physical factors, such as location, cost, climate, etc., makes it possible to find the most suitable materials, with the best overall thermal transmission factor (Ue, and the cheapest thickness (te of the insulating material.La variación anual de la temperatura externa, así como la diaria, se manifiesta de una manera notable en el interior de los edificios creando, en condiciones extremas, un inconfort evitable mediante la combinación apropiada de dos elementos: aislamientos y sistemas de calefacción o aire acondicionado. Dada la extensa gama de variación de cada uno de estos factores, haciendo un estudio detallado de sus propiedades físicas, situación, costes y clima de la región, encontramos el material más idóneo a emplear, coeficiente global de transmisión térmica (Ue del aislamiento y espesor (te más económico del material aislante.

  14. Aislamiento de Sporothrix pallida complex en muestras clínicas y ambientales de Chile

    Directory of Open Access Journals (Sweden)

    Rodrigo M Cruz Choappa

    2014-12-01

    Full Text Available Se informa para Chile el aislamiento de S. pallida complex desde muestras médicas y del suelo del hogar de una paciente. Los hongos del complejo Sporothrix schenckii pueden causar distintas infecciones. En Chile, los aislamientos médicos y ambientales de este complejo son poco frecuentes. El objetivo de este trabajo fue identificar un agente atípico en un caso de onicomicosis y detectar su presencia en el suelo del jardín del hogar de la paciente. Para esto, las muestras clínicas se obtuvieron por raspado subungueal del primer dedo del pie derecho, y las muestras de suelo, de diferentes sectores del jardín. La identificación de las especies se realizó por morfofisiología y para la confirmación molecular se envió una de las cepas aisladas de la uña de la paciente al CBS (14.062. Se identificó S. pallida complex tanto de las muestras de uña como de aquellas provenientes del suelo del jardín.

  15. ESCUELAS-ISLA: UN AISLAMIENTO INSTITUCIONAL

    Directory of Open Access Journals (Sweden)

    Claudio Vergara Reyes

    2012-01-01

    Full Text Available Este trabajo trata acerca de un tipo de escuela en la realidad educativa chilena, denominada "escuela-isla", caracterizada por su aislamiento institucional del entorno social, económico, político, religioso y cultural. El concepto nace de una serie de reflexiones bajo el marco formativo de las prácticas pedagógicas tempranas, a partir de un conjunto de experiencias que configuran al centro de enseñanza y que resultan clave para la comprensión de la naturaleza del término. El documento hace una caracterización de este tipo de escuela, reconociendo cualidades que no son propias de una institución social. Asimismo, se propone y justifica la necesidad de un tipo de "alianza simbiótica" entre la organización educativa y el resto de organizaciones de la comunidad (red de enlace para complementar y potenciar su función educativa (formativa. Por último, se destaca la importancia de la interacción de la escuela con otras instituciones de la sociedad, y que tales vínculos constituyen una estrategia educativa para el desarrollo social y comunitario.

  16. Queratitis por Acanthamoeba sp.: primer caso confirmado por aislamiento y tipificación molecular en Bahía Blanca, provincia de Buenos Aires, Argentina Acanthamoeba sp. keratitis: first case confirmed by isolation and molecular typification in Bahía Blanca, Buenos Aires Province, Argentina

    Directory of Open Access Journals (Sweden)

    M. L. Gertiser

    2010-06-01

    Full Text Available Algunas especies del género Acanthamoeba provocan queratitis amebiana (QA, una infección de la córnea muy dolorosa, generalmente unilateral, con compromiso importante de la visión. Se presenta el caso de una mujer de 31 años usuaria de lentes de contacto con hábitos inadecuados de higiene y conservación de las lentes. La paciente consultó por enrojecimiento y dolor intenso en el ojo derecho, de dos meses de evolución. Luego del examen oftalmológico y ante la sospecha de una etiología parasitaria se realizó una biopsia de la zona lesionada, que se destinó al análisis bacteriológico y parasitológico en el laboratorio. También se remitieron los líquidos de lavado y el estuche de las lentes. No se detectó crecimiento bacteriano en las muestras. Los cultivos para la búsqueda de Acanthamoeba resultaron positivos en todos los especímenes analizados. Las amebas aisladas fueron clasificadas morfológica y molecularmente como pertenecientes al género Acanthamoeba. El presente trabajo muestra el primer caso de queratitis por Acanthamoeba de la ciudad de Bahía Blanca identificado por el laboratorio mediante procedimientos de alto valor diagnóstico.Some species of the Acanthamoeba genus cause keratitis, a very painful, most likely unilateral corneal infection , associated with eye and vision impairment. We here present a case of a 31-year-old female patient, a regular user of soft contact lenses without good practices of lens hygiene and handling. The patient attended medical consultation after two months of inflammation and pain in her right eye. After ophthalmological studies, and due to suspicion of a parasitic infection, a biopsy was performed and the sample submitted for bacteriological and parasitological analyses. Moreover, contact lens holders and lens cleaning solutions were studied. The samples yielded negative results for bacterial infection. However, cultivation of all samples showed the presence of amoeboid parasites

  17. Pathogenic and Genetic Diversity among Iranian Isolates of Macrophomina phaseolina Diversidad Patogénica y Genética entre Aislamientos Iraníes de Macrophomina phaseolina

    Directory of Open Access Journals (Sweden)

    Siavosh Rayatpanah

    2012-03-01

    Full Text Available Charcoal rot, caused by Macrophomina phaseolina (Tassi Goid., is an economically important disease of oilseed plants in Northern Iran. Seventy isolates of M. phaseolina were obtained from different hosts, including soybean (Glycine max L., and sunflower (Helianthus annuus L. in the northern oilseed planting regions of Iran. RAPD-PCR amplification profiles, by using of six random OPA primers (kit A showed polymorphisms among the isolates. The primer OPA-13 (5'_ CAGCACCCAC_3' amplified the genomic DNA of all isolates of M.phaseolina producing 4-12 bands of sizes between 0.25 and 2.3 kb. Unweighted pair-group method with arithmetic mean (UPGMA analysis classified the isolates into the nine major groups with 64% similarity. Pathogenicity of isolates was evaluated at seedling stage of soybean, sunflower, and maize (Zea mays L. plants under in vitro conditions. None of the isolates were pathogenic on corn, while all of the isolates infected soybean and sunflower seedlings. Isolates were more virulent on soybean than sunflower. The disease index on sunflower and soybean varied between 19-24 and 27-30 respectively. These results indicated a significant pathogenic and genetic variability within the Iranian isolates of M. phaseolina. Cultivation with crop rotation was probably tended to induce less diversity of the pathogen isolates.Pudrición carbonosa, causada por Macrophomina phaseolina (Tassi Goid., es una enfermedad de importancia económica de las plantas de semillas oleaginosas en el norte de Irán. Setenta aislamientos de M. phaseolina se obtuvieron de diferentes hospederos, incluyendo soya (Glycine max L. y girasol (Helianthus annuus L. en las regiones de plantación de semillas oleaginosas del norte de Irán. Perfiles RAPD-PCR de amplificación, utilizando primers aleatorios de seis OPA (kit A mostraron polimorfismos entre los aislamientos. El primer OPA-13 (5'-CAGCACCCAC-3' amplificó el ADN genómico de todos los aislamientos de M. phaseolina

  18. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  19. Heterocigosis y aislamiento: el caso de las poblaciones andinas

    Directory of Open Access Journals (Sweden)

    Acreche, Noemí

    2003-01-01

    Full Text Available Poblaciones de la Puna y del Valle Calchaquí de la Provincia de Salta, de las que se conoce su condición de aislamiento reproductivo, fueron estudiadas con el objeto de analizar si existe asociación entre los niveles de heterocigosis por individuo para grupos sanguíneos eritrocitarios y STRs y el lugar de origen de sus padres. A tales efectos se considera para acda individuo la proporción de loci heterocigotos y la pertenencia de sus padres a una de las siguientes categorías: ambos no migrantes, no migrante-migrante de corta distancia/migrante de larga distancia, ambos migrantes de larga distancia, migrante de corta distancia-migrante de larga distancia. Los grupos sanguíneos presentan mayor variabilidad en el Valle que en la Puna, de acuerdo a lo esperado por el grado de aislamiento y diferencias significativas en los promedios de heterocigosisi por individuo en ambas zonas. Por el contrario, los STRs mantienen valores constantes por lo que los análisis a partir de grupos sanguíneos reflejarían mejor las condiciones de aislamiento de las diferentes poblaciones. No se observó asociación entre las categorías definidas según la procedencia de los padres y la proporción de loci heterocigotos en los individuos.

  20. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    OpenAIRE

    Aura Lucía Leal; Castañeda Elizabeth

    1999-01-01

    Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

  1. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  2. Genotipificación de aislamientos clínicos del complejo Cryptococcus neoformans/Cryptococcus gattii obtenidos en el Hospital «Dr. Julio C. Perrando», de la ciudad de Resistencia (Chaco, Argentina

    Directory of Open Access Journals (Sweden)

    Maria E Cattana

    Full Text Available La criptococosis es una infección fúngica causada por levaduras del género Cryptococcus, particularmente las del complejo Cryptococcus neoformans/Cryptococcus gattii. El conocimiento sobre la casuística de la criptococosis en el nordeste argentino es exiguo y no se tiene información sobre los tipos moleculares circulantes. El objetivo de este estudio fue realizar la caracterización genética de los aislamientos pertenecientes al complejo C. neoformans/C. gattii obtenidos en el Hospital «Dr. Julio C. Perrando» de la ciudad de Resistencia (Chaco, Argentina, con el fin de determinar especie, variedad y genotipo. Durante dos años y un mes se estudiaron 26 aislamientos clínicos. Mediante métodos convencionales y moleculares, un aislamiento fue identificado como C. gattii genotipo VGI y los 25 restantes como C. neoformans var.grubii, 23 de los cuales correspondieron al genotipo VNI y dos al genotipo VNII. Estos datos son una contribución al conocimiento de la epidemiología de la criptococosis en la Argentina y el primer informe sobre genotipos del complejo C. neoformans/C. gattii de origen clínico en el nordeste argentino.

  3. Susceptibility trends of Bacteroides fragilis group isolates from Buenos Aires, Argentina Tendencias en el perfil de sensibilidad de aislamientos del grupo Bacteroides fragilis obtenidos en Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    L. Fernández Canigia

    2007-09-01

    Standards Institute (CLSI, anteriormente NCCLS. En los tres períodos considerados, los antibióticos más activos frente a aislamientos de la especie B. fragilis como así también frente a aislamientos pertenecientes a otras especies del grupo B. fragilis fueron imipenem, con 99,1 y 100% de actividad, respectivamente, y metronidazol, con 100% de actividad. Con ampicilina-sulbactama se observó a lo largo del tiempo una disminución de la sensibilidad, desde el 100% en el primer período hasta un 90,3 y 82,4% en el último, para B. fragilis y para especies del grupo distintas de B. fragilis, respectivamente. Cuando se consideraron los tres períodos juntos, se observaron diferencias significativas entre la especie B. fragilis y los restantes aislamientos del grupo para cefoxitina, piperacilina y clindamicina (84,2% vs. 56,5%; 85,9% vs. 66,7% and 88,8% vs. 64,7%, respectivamente, p< 0.05. Cefoxitina fue el antibiótico que mostró mayores variaciones a través del tiempo y entre especies. Las tasas de sensibilidad a clindamicina fueron bajas (alrededor del 60% entre los aislamientos no pertenecientes a la especie B. fragilis durante los últimos dos períodos. Las variaciones observadas en los perfiles de sensibilidad del grupo B. fragilis muestran la necesidad de vigilar periódicamente la emergencia de resistencia a los antimicrobianos, a fin de orientar el tratamiento de las infecciones por bacterias anaerobias.

  4. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

  5. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  6. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  7. Aspectos económicos del aislamiento acústico

    Directory of Open Access Journals (Sweden)

    Amarilla, Beatriz C.

    1990-12-01

    Full Text Available The general objective of this study was to analyze the soundproofing/cost ratio with different building alternatives for interior walls and floors. This technical-economic study was divided into three parts: — Dividing walls (environmental noises — Floors (impact noises — Special Solutions (double walls, floating floors, etcetera The results show that in developing countries the most costly solutions are not always the best for housing, as far as soundproofing is concerned. A good knowledge of the economic aspects related to this matter allows obtaining a good quality at a moderate cost, which is a priority in this type of country.

    El objetivo general de este trabajo fue el de analizar el comportamiento de la relación costo-aislamiento acústico en soluciones constructivas alternativas para muros interiores y entrepisos. Este estudio técnico-económico comprende tres partes: * Muros divisorios (ruidos aéreos. * Entrepisos (ruidos de impacto. * Soluciones especiales (muros de doble hoja, pisos flotantes, etc. Se llega a la conclusión que, en los países en desarrollo, no siempre las mejores soluciones para la vivienda, desde el punto de vista acústico, son las de mayor costo. Conocer en profundidad los aspectos económicos de esta cuestión significa poder lograr una buena calidad con costos moderados, lo cual constituye una prioridad en este tipo de países.

  8. Perfiles de resistencia a fluoroquinolonas en aislamientos clínicos de cocos Gram positivos provenientes de hospitales colombianos, 1994-2004

    Directory of Open Access Journals (Sweden)

    César A. Arias

    2008-06-01

    Conclusión. Los aislamientos colombianos de S. pneumoniae mantienen susceptibilidad a las fluoroquinolonas de última generación. La resistencia a fluoroquinolonas es alta en S. aureus, especialmente en aislamientos resistentes a la meticilina (cercana al 100%.

  9. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  10. Necesidad del aislamiento térmico en la edificación actual

    Directory of Open Access Journals (Sweden)

    Alamán, A.

    1972-09-01

    Full Text Available The author attempts to clear up a few ideas on this subject, as not everyone knows enough about its correct use: what is meant by thermal insulation and thermal conductivity, essential requirements with respect to material, lightweight and heavy insulation, justification of insulation for reasons of building evolution, comfort, economy and to avoid condensation, as well as the influence of openings in outside walls.El autor trata de aclarar algunos conceptos sobre esta materia, ya que, en realidad, no todos conocen adecuadamente su correcto empleo: qué se entiende por aislamiento térmico y por conductividad térmica, condiciones que deben exigirse a los materiales, aislamientos ligeros y pesados, justificación del aislamiento por razones de evolución de la construcción, de confort, de economía y para evitar condensaciones, así como la influencia de los huecos en las fachadas.

  11. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  12. Susceptibilidad in vitro de aislamientos colombianos de Plasmodium falciparum a diferentes antipalúdicos

    Directory of Open Access Journals (Sweden)

    Silvia Blair

    2008-06-01

    Conclusiones. La baja sensibilidad a la cloroquina concuerda con otros estudios in vitro y con la baja eficacia terapéutica in vivo. Aunque 96% de los aislamientos fueron sensibles a artesunato, éste y otros estudios han observado aislamientos con disminución de la sensibilidad a las artemisininas (CI50>10,5 nM, lo que sugiere que el uso indiscriminado de estos medicamentos pone en riesgo su efectividad y podría dejarnos sin opciones para el tratamiento del paludismo por P. falciparum.

  13. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DEL POTATO MOP-TOP VIRUS (PMTV)

    OpenAIRE

    In\\u00E9s Osorio-Giraldo; Pablo Guti\\u00E9rrez-S\\u00E1nchez; Mauricio Mar\\u00EDn-Montoya

    2013-01-01

    El objetivo de este trabajo fue evaluar los niveles de variación de aislamientos de PMTV en cultivos de papa de Colombia durante los años 2010 y 2011. Se obtuvieron secuencias de los genes de la cápside viral (CP, ARN 2) y del Triple Bloque de Genes (TGB2, ARN 3) de cepas de PMTV de los departamentos de Antioquia, Boyacá, Cundinamarca y Nariño. Adicionalmente, dos de los aislamientos fueron secuenciados en >83% de sus ARN 2 y 3. Los análisis filogenéticos basados en CP indicaron la presencia ...

  14. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  15. OPTIMIZACIÓN DE UN PROTOCOLO DEL AISLAMIENTO DEL ADN Y DE UN SISTEMA DE AMPLIFICACIÓN ISSR-PCR PARA Ceratozamia mexicana Brongn. (Zamiaceae.

    Directory of Open Access Journals (Sweden)

    Nadia Guadalupe Sánchez-Coello

    2012-01-01

    Full Text Available La mayoría de las cícadas contienen altas concentraciones de aceites esenciales, flavonoides, polifenoles y polisacáridos que interfieren en la extracción de ADN, causando productos de amplificación errados o inhibiendo la PCR. La optimización del aislamiento del ADN y el empleo de iniciadores de secuencias intergénicas repetidas simples (ISSRs se investigaron en Ceratozamia mexicana Brongn., una cícada mexicana en peligro de extinción. El ADN obtenido de tejido foliar fresco, con un amortiguador modificado de cetil trimetil amonio, nos permitió obtener un ADN de buena calidad, sin pigmentos coloridos o contaminantes. La modificación al protocolo de extracción de ADN, basado en CTAB, fue un prelavado por 1 h, del tejido foliar, con una solución de 0.7 M de NaCl, para facilitar la lisis celular. El ADN extraído exitosamente se amplificó por PCR, usando seis iniciadores arbitrarios ISSR. Se observaron productos de amplificación reproducibles en todas las reacciones de PCR. Nuestros resultados muestran que la implementación mejora significativamente la calidad del ADN obtenido, usando una concentración baja de iniciadores (25 pM. Se detectaron 23 bandas fuertes, nueve de las cuales fueron polimórficas. Los resultados indican que el protocolo de optimización del aislamiento del ADN y en el sistema de PCR es viable para futuros trabajos en esta especie. Este trabajo es el primer protocolo de extracción de ADN y de ISSR reportado para esta especie ornamental en peligro de extinción.

  16. Migración irregular y aislamiento social. Los jornaleros tamaulipecos indocumentados en los Estados Unidos

    Directory of Open Access Journals (Sweden)

    Izcara-Palacios, Simón Pedro

    2010-08-01

    Full Text Available “Social isolation” is a concept poorly developed in the analysis of poverty. “Social exclusion” and “marginality” are concepts more frequently used. “Social isolation” refers to an erosion of the relational sphere of the individual (i.e.: it is a lack of familial support and/or social networks, and an absence of social activity and recreational interaction. Moreover, “social isolation” is associated with anxiety and depression symptoms. This paper analyses the situation of “social isolation” of Tamaulipas’ undocumented farm workers employed in the United Stated.

    El concepto de “aislamiento social” ha sido insuficientemente utilizado en el análisis de la pobreza. “Exclusión social” y “marginalidad” son dos conceptos más desarrollados. El “aislamiento social” hace referencia a una erosión de las esferas relacionales del individuo (esto es, a una falta de soporte familiar y/o redes sociales, y a una ausencia de actividad social e interacción recreacional. Más aún, el “aislamiento social” está asociado a síntomas de ansiedad y depresión. Este artículo analiza la situación de aislamiento social de los jornaleros indocumentados tamaulipecos empleados en los Estados Unidos.

  17. "Encierro sobre el encierro" aislamiento por tuberculosis. Centro penitenciario Medellín Colombia

    Directory of Open Access Journals (Sweden)

    Laura María Almeida Rueda

    2016-04-01

    Full Text Available Introducción: Las personas privadas de la libertad diagnosticadas con tuberculosis son aisladas para evitar el contagio a otros internos y a los guardianes, a esta situación los participantes le dan significados que pueden ayudar en el diseño de programas para el control de la tuberculosis en centros penitenciarios. Objetivo: Comprender el significado que las personas privadas de la libertad, le dan al aislamiento a que se deben someter durante el tratamiento de la tuberculosis. Metodología: Se utilizó la investigación cualitativa con enfoque etnográfico, se realizaron 14 entrevistas y 400 horas de observación. Se llevó diario de campo. Hallazgos: Las personas privadas de la libertad diagnosticadas con tuberculosis son llevadas a un lugar de aislamiento que favorece la curación y al mismo tiempo genera discriminación. El aislamiento es considerado un "encierro sobre el encierro". Este trae consecuencias físicas, socio-culturales y psicológicas. Para disminuir el impacto buscan distracción y cuando ven síntomas de recuperación lo toman con paciencia. Conclusión: El aislamiento se ve desde dos perspectivas: la comodidad y tener que soportar el encierro y la discriminación. Genera conflictos y alteraciones en la salud física y mental

  18. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  19. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  20. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  1. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  2. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  3. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  4. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  5. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  6. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5 recuperados entre 1994 y 2004.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    2006-06-01

    Full Text Available Introducción. Streptococcus pneumoniae serotipo 5 es causa importante de enfermedad invasora en Colombia, donde se ha demostrado la circulación del clon 19-Colombia(5 susceptible a penicilina pero resistente a tetraciclina y a cloranfenicol. Objetivo. Establecer las relaciones genéticas de aislamientos invasores colombianos de S. pneumoniae serotipo 5 recuperados entre 1994 y 2004 con el clon 19-Colombia(5. Materiales y métodos. Se estudiaron 83 aislamientos que tenían datos de susceptibilidad a penicilina, vancomicina, ceftriaxona, eritromicina, trimetoprim sulfametoxazol, cloranfenicol y tetraciclina, de los cuales 29 fueron obtenidos de niños menores de cinco años. El patrón de restricción del ADN se determinó por electroforesis en gel de campo pulsado, usando la enzima Sma I. La similitud genética entre los aislamientos y el clon se estableció según los criterios de Tenover y utilizando el programa Fingerprinting II. Resultados. Todos los aislamientos se relacionaron con el clon 19-Colombia5 y se agruparon en el patrón electroforético A con 17 subtipos. El patrón A se estableció en 32 aislamientos (38,6%, el A8 en 18 (21,7% y el A5 en 10 (12%, los 15 patrones restantes agruparon los otros 23 aislamientos. Los 34 aislamientos resistentes a tetraciclina y cloranfenicol mostraron relación con los patrones electroforéticos A (n = 32, A16 (n = 1 y A28 (n = 1, caracterizados, al igual que el clon, por presentar una banda de 340 Kb. Conclusión. Estos resultados muestran la circulación continua en el país de aislamientos de S. pneumoniae serotipo 5 genéticamente relacionados con el clon 19-Colombia(5.

  7. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  8. Aislamientos de Staphylococcus aureus sensibles a meticilina relacionados genéticamente con el clon USA300, ¿origen de los aislamientos SARM de genotipo comunitario en Colombia?

    Directory of Open Access Journals (Sweden)

    Javier Antonio Escobar-Pérez

    2014-04-01

    Full Text Available Introducción. USA300 es un linaje genético que se encuentra en aislamientos de Staphylococcus aureus sensibles (SASM y resistentes a meticilina (SARM. Actualmente, en Colombia las infecciones por SARM en hospitales y en la comunidad son causadas principalmente por un clon con genotipo comunitario (SARM-GC relacionado genéticamente con el clon USA300. El origen de esta variante es aún desconocido. Objetivo. Identificar y caracterizar aislamientos de S. aureus resistentes y sensibles a meticilina con el fin de aportar información para establecer un posible origen de los aislamientos SARM-GC en Colombia. Materiales y métodos. Se realizó una caracterización de aislamientos SASM relacionados con el clon USA300 detectados a partir de un análisis de 184 aislamientos de S. aureus (90 SARM y 94 SASM causantes de infecciones. La relación genética de los aislamientos se determinó por electroforesis en gel de campo pulsado (PFGE, tipificación de secuencias multilocus (MLST y tipificación del gen de la proteína A (spa. Resultados. De los 184 aislamientos, 27 (14,7 % presentaron características moleculares y relación genética con el clon USA300, y de ellos, 18 fueron SARM y nueve fueron SASM. Todos los aislamientos SARM relacionados con este clon albergaban un casete estafilocócico cromosómico mec (SCCmec IVc (3.1.2. En ningún aislamiento SASM se detectaron secuencias remanentes de SCCmec o una duplicación del sitio attB que evidenciaran la pérdida del casete. Conclusión. El origen de los aislamientos SARM-GC en Colombia probablemente se encuentre en la diseminación de clones SASM relacionados con el clon USA300 que adquirieron el SCCmec IVc posteriormente.

  9. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  10. Medidas de aislamiento en enfermedades transmisibles dentro del ámbito hospitalario

    OpenAIRE

    Villanueva Rábano, Raúl

    2016-01-01

    En el ámbito hospitalario, son un problema frecuente las infecciones nosocomiales, causadas por las enfermedades transmisibles que pasan de unos pacientes a otros. Estas infecciones son potencialmente prevenibles, a través de medidas de aislamiento llevadas a cabo por el personal sanitario y no sanitario encargado de atender al paciente. En este aspecto, el papel del personal de enfermería es de fundamental importancia dado que mantienen un estrecho contacto con el paciente como cuidadores pr...

  11. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  12. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  14. Una revisión del fenómeno de aislamiento magnético

    Directory of Open Access Journals (Sweden)

    Zósimo Arévalo Velosa

    2007-09-01

    Full Text Available Los dispositivos de alta energía son diseñados para que funcionen con campos eléctricos y magnéticos extrema-damente altos. Debido a esto, dichos dispositivos presentan fenómenos y comportamientos no lineales, como el aislamiento magnético que altera el transporte de los electrones. La no linealidad ha obligado a analizar y revisar desde el punto de vista matemático las condiciones de frontera y las soluciones del problema. El objetivo de este trabajo es exponer el tema a un nivel que facilite su difusión entre la comunidad académica no familiarizada con el mismo. Para ello, el trabajo presenta una descripción de los fenómenos que se generan cuando hay campos eléctricos y magnéticos muy altos, tomando el caso de un diodo plano al vacío, así como las ecuaciones que modelan el fenómeno de aislamiento magnético; también demuestra la existencia de las soluciones y encuentra las positivas en base a los métodos de solución superior e inferior para problemas de valor de frontera, y pro-porciona algunos ejemplos de aplicación del fenómeno de aislamiento magnético.

  15. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos?

    Directory of Open Access Journals (Sweden)

    V. López

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.

  16. Resistencia antimicrobiana y epidemiología molecular de aislamientos de Staphylococcus pseudintermedius de muestras clínicas de caninos

    OpenAIRE

    Vigo, Germán B.; Giacoboni, Gabriela I.; Gagetti, Paula S.; Pasterán, Fernando G.; Corso, Alejandra C.

    2015-01-01

    Se estudiaron 28 aislamientos obtenidos de muestras clínicas de perros e identificados por espectrometría de masas (MALDI-TOF) como Staphylococcus pseudintermedius; el objetivo fue evaluar la sensibilidad a los antimicrobianos por el método de difusión y establecer la relación clonal entre aislamientos por electroforesis en campo pulsado (PFGE). La resistencia a meticilina se evaluó mediante PCR por amplificación del gen mecA y se observó en 3/28 aislamientos (10,7 %). Quince aislamientos (53...

  17. Serotipificación de aislamientos clínicos y del medio ambiente de Cryptococcus neoformans en Colombia

    Directory of Open Access Journals (Sweden)

    N. Ordóñez

    1994-09-01

    Full Text Available Se determinó l variedad y el serotipo de 192 aislamientos de Cryptococcus neoformans recuperados de 1972 a 1992; 163 de origen clínico y 29 del medio ambiente. En los aislamientos clínicos se determinaron las dos variedades de C. neoformans: la variedad neoformans en el 92,6% de los pacientes y la variedad gattii en el 7,4%. En el medio ambiente se encontró la variedad neoformans en el 100% de los aislamientos. El serotipo encontrado con más frecuencia fue el serotipo A, el cual se observó en el 92% de los aislamientos clínicos y en el 100% del medio ambiente, seguido por el serotipo B (6,8%; también, se determinaron aislamientos de los serotipos C (0,6% y D (0,6%. C. neoformans var. neoformans se recuperó en todos los años de los que se tuvieron aislamientos y C. neoformans var. gattii solamente se observó en aislamientos clínicos a partir de 1986. C. neoformans var. neoformans fue aislado durante los 12 meses del año y C. neoformans var. gattii se encontró distribuido en los meses defebrero, abril, junio, agosto, septiembre y diciembre. C. neoformans var. neoformans se observó en 109 (66,9% cepas de pacientes del sexo masculino y en 36 (22,1% del sexo femenino; C. neoformans var. gattii se observó en 5 (3% cepas de hombres y en 6 (3,7% mujeres.

  18. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  19. Sensibilidad antimicrobiana in vitro en aislamientos de Enterococcus faecalis y Enterococcus faecium obtenidos de pacientes hospitalizados

    Directory of Open Access Journals (Sweden)

    Manuel Medell

    2014-04-01

    Full Text Available Introducción. Actualmente se considera a Enterococcus spp. como uno de los agentes de infección hospitalaria más importantes, siendo su resistencia a los antibióticos un problema importante en los centros de salud. Objetivos. Caracterizar la resistencia antimicrobiana en 50 cepas de Enterococcus spp. aisladas de muestras clínicas de pacientes hospitalizados. Materiales y métodos. Se llevó a cabo un estudio de tipo descriptivo observacional de corte transversal en 50 aislamientos clínicos de estas especies microbianas. Se trabajó un aislamiento por paciente. La identificación y la sensibilidad a los antibióticos se realizaron por métodos automatizados y convencionales. El análisis fenotípico de los mecanismos de resistencia a glucopéptidos se hizo según las recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. Resultados. De 50 aislamientos, 30 (60,0 % y 20 (40,0 % pertenecían a las especies de Enterococcus faecalis y Enterococcus faecium, respectivamente. La resistencia global expresada por este género fue de 38/50 (76,0 % para ampicilina; 33/50 (66,0 % para gentamicina de alto nivel; 34/50 (68,0 % para estreptomicina de alto nivel; 26/50 (52,0 % para ciprofloxacina; 4/50 (8,0 % para linezolid; 17/50 (34,0 % para teicoplanina; 25/50 (50,0 % para vancomicina; 31/50 (62,0 % para minociclina; 34/50 (68,0 % para tetraciclina y 9/50 (18,0 % para nitrofurantoina. Frente a los glucopéptidos, 25/50 (50,0 % y 10/50 (20,0 % de los aislamientos presentaron los mecanismos Van A y Van B, respectivamente. Conclusiones. Podemos concluir que la mayoría de las veces, las cepas aisladas en el Hospital Hermanos Ameijeiras mostraron porcentajes de resistencia por encima de lo reportado en la literatura científica consultada. El alto porcentaje de cepas con resistencia a la vancomicina podría influir en la aparición de otros gérmenes Gram positivos con resistencia a este fármaco. Se reporta por

  20. Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos

    OpenAIRE

    Ospina Salazar, Daniel Iván; Hoyos Sánchez, Rodrigo Alberto; Arango Arteaga, Myrtha; Orozco Sánchez, Fernando; Ríos Salazar, Jhon Diego

    2014-01-01

    Título en español: Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos Título en ingles: Antifungal activity of neem cellular biomass extracts on dermatophytes isolates Título corto: Actividad antifúngica de extractos de biomasa celular de neem Resumen:  Las líneas celulares de neem (Azadirachta indica A. Juss.) cultivadas en suspensión líquida han demostrado producir metabolitos secundarios bioactivos, particularmente triterpenoides. E...

  1. Caracterización molecular de un aislamiento cubano de parvovirus canino

    Directory of Open Access Journals (Sweden)

    Anniet Fresneda-Disotuar

    2015-12-01

    Full Text Available El parvovirus canino tipo 2 (VPC-2 es el agente causal de una enfermedad infecto-contagiosa que produce gastroenteritis aguda hemorrágica que afecta a caninos jóvenes. El VPC-2 es un virus con genoma ADN, pequeño, desnudo y muy resistente a las condiciones ambientales que emergió y se expandió rápidamente a fines de la década de los años 70. En los años 80 surgieron consecutivamente dos variantes antigénicas, denominadas VPC-2a y VPC-2b. En el 2000 se detectó una nueva variante antigénica llamada VPC-2c, reportándose con frecuencia en comunidades caninas de varios países del mundo. El objetivo de este trabajo consistió en caracterizar un aislamiento cubano de parvovirus canino, atenuado y adaptado a cultivo celular. El material genético fue amplificado por reacción en cadena de la polimerasa y secuenciado posteriormente. Las secuencias obtenidas fueron analizadas y comparadas con secuencias de aislados y cepas conocidas depositadas en las bases de datos, donde se evidenció que el aislamiento cubano era del tipo VPC-2.

  2. Caracterización fenotípica de aislamientos ambientales de Cryptococcus neoformans.

    Directory of Open Access Journals (Sweden)

    Sandra Huérfano

    2003-09-01

    Full Text Available La criptococosis es causada por las tres variedades de Cryptococcus neoformans, las cuales presentan diferencias fisiológicas y de virulencia, algunas de las cuales se han estudiado para reconocer aspectos de su biología. Este trabajo evaluó las características fenotípicas de aislamientos ambientales de las variedades grubii y gattii, con el fin de establecer diferencias asociadas con el ciclo de vida y la virulencia. Se estudiaron 28 aislamientos serotipo A y 31 serotipo C. Se evaluaron la morfología macroscópica y microscópica de blastoconidias cultivadas en agar Sabouraud y suelos, el crecimiento a 37 °C, la producción de 22 enzimas extracelulares, la frecuencia del fenómeno de fructificación haploide, la pareja sexual, el patrón de sensibilidad a toxinas asesinas (killer y la virulencia en ratones Balb/c. No se observaron diferencias entre las dos variedades en la morfología macroscópica, la microscópica, ni en el crecimiento a 37 °C (p>0,05; sin embargo, se observó disminución del tamaño celular y capsular de blastoconidias cultivadas en suelo comparado con el tamaño en Sabouraud (p

  3. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  4. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  5. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  6. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  7. Caracterización de aislamientos clínicos de Leptospira para su uso en vacunas veterinarias

    Directory of Open Access Journals (Sweden)

    Yaritza Cuba-Romero

    2016-04-01

    Full Text Available Uno de los criterios más importantes para el desarrollo de inmunógenos de Leptospira es contar con cepas bien caracterizadas por su virulencia y representativa de los serogrupos circulantes desde el punto de vista clínico y veterinario. Todo lo cual permite garantizar inmunógenos capaces de proteger contra los serovares presente en la formulación y que afectan a los animales en riesgo. Este trabajo se realizó a partir de aislamientos del agente causal de cinco casos clínicos autóctonos de Leptospira en la provincia de Holguín, Cuba, mediante métodos convencionales: crecimiento a 13ºC, medio suplementado con 8-azaguanina y en presencia de cloruro de sodio. Además, los aislamientos se clasificaron hasta nivel de serogrupo mediante la técnica de microaglutinación. A partir de estos aislamientos fue seleccionada y caracterizada una cepa del serogrupo Ballum como candidato vacunal. Los aislamientos no mostraron crecimiento a 13ºC, ni cuando se le añadió al medio 8-azaguanina (2,25 mg/mL, mientras que todas las cepas mostraron conversión a forma esférica en presencia de cloruro de sodio (1M. La clasificación de los aislamientos permitió disponer de dos cepas pertenecientes al serogrupo Ballum y dos a Pomona. La cepa seleccionada mostró alta virulencia y patogenicidad en el biomodelo Hámster Sirio, además de buena estabilidad en los medios de cultivos. Su clasificación hasta el nivel de serovar mediante el uso de anticuerpos monoclonales determinó su pertenencia al serovar Ballum. El presente trabajo, por primera vez, sienta las bases para formulaciones vacunales novedosas en animales, conteniendo el serogrupo Ballum.

  8. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  9. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  10. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  11. Resistencia antimicrobiana en aislamientos clínicos de Klebsiella spp. y producción de B-lactamasas de espectro extendido en hospitales de Cuba

    OpenAIRE

    Quiñones Pérez, Dianelys; Carmona Cartaya, Yenisel; Zayas Illas, Arnaldo; Abreu Capote, Miriam; Salazar Rodriguez, Daniel; García Giro, Sandra; Torres Tamayo, Dalia; Kobayashi, Nobumichi; Valverde de Francisco, Aránzazu; del Campo Moreno, Rosa

    2014-01-01

    Introducción: el género Klebsiella causa brotes hospitalarios, por cepas multidrogorresistentes en diferentes continentes y conlleva a un aumento en la morbimortalidad. Objetivos: identificar las especies de Klebsiella causantes de infecciones en hospitales cubanos, determinar la procedencia de los aislamientos según el servicio, y la susceptibilidad antimicrobiana, conocer la prevalencia de aislamientos productores de ß-lactamasas de espectro extendido (BLEE), y tipos, así como la susceptibi...

  12. Genotipificación de aislamientos de Bartonella bacilliformis por amplificación de elementos repetitivos mediante el uso de REP-PCR y ERIC-PCR

    Directory of Open Access Journals (Sweden)

    Carlos Padilla R

    2003-07-01

    Full Text Available Objetivos: Genotipificar los aislamientos de Bartonella bacilliformis a través de la amplificación de elementos repetitivos mediante el uso de ERIC-PCR y REP-PCR, y determinar si existe variabilidad genética entre aislamientos de varias zonas endémicas. Materiales y Métodos: Se evaluaron mediante el uso del ERIC-PCR y REP-PCR 17 aislamientos de B. bacilliformis de Lima, Cusco y Ancash. Los aislamientos fueron realizados durante los años 1998 y 1999. Para el análisis de los patrones de bandas se usó el software GelCompar 4,0. Resultados: Fueron identificados en los 17 aislamientos 10 genotipos. Los genotipos D, E y H fueron detectados en Cusco; mientras que los genotipos B, C, G, J e I en Lima; y el genotipo F en Ancash. Conclusiones: Nuestros resultados sugieren que REP-PCR y ERIC-PCR son métodos útiles para genotipificar aislamientos de B. bacilliformis. La variabilidad genética debe ser tomada en cuenta en estudios epidemiológicos y clínicos de Bartonelosis; así como el desarrollo de nuevas técnicas diagnósticas y de vacunas.

  13. La situación sociolaboral de los migrantes internacionales en la agricultura: irregularidad laboral y aislamiento social

    Directory of Open Access Journals (Sweden)

    Simón Pedro Izcara Palacios

    2009-01-01

    Full Text Available Los jornaleros inmigrantes constituyen uno de los grupos sociales más pobres de las comarcas agrarias de Estados Unidos y España. Los trabajadores agrarios migratorios viven en áreas remotas y sufren de malnutrición, salarios bajos, alta movilidad laboral, condiciones laborales precarias y ambientes laborales inadecuados. Por una parte, el sector agrario, que constituye un refugio laboral para los trabajadores ilegales, opera fuera del mercado laboral formal; por otra parte, los jornaleros padecen un grave problema de "aislamiento social", esto ha sido señalado como una de las principales causas de falta de bienestar de éstos. El artículo analiza, de modo comparativo, la situación de irregularidad laboral y aislamiento social de los jornaleros tamaulipecos empleados en la agricultura estadounidense y los trabajadores marroquíes empleados en el sector agrario andaluz.

  14. Sensibilidad a fluconazol y voriconazol de aislamientos de Candida spp., obtenidos de mucosa oral de pacientes con sida

    OpenAIRE

    Gutiérrez, Carolina; de Bedout, Catalina; Tobón, Angela María; Cano, Luz Elena; Arango, Myrtha; Tabares, Angela María; Restrepo, Angela

    2007-01-01

    Se determinó la sensibilidad al fluconazol y al voriconazol de aislamientos de Candida spp. obtenidos de la mucosa oral de 54 pacientes con sida hospitalizados en la ESE Hospital La María (Medellín, Colombia). Además, se comprobó la especie de tales aislamientos. Los pacientes eran todos adultos (promedio de 40,5 años, rango de 23 a 56) y la mayoría (77,8%) hombres. En 40 (71,1%) de ellos se obtuvo crecimiento de Candida spp. y en 6 (11,1%) se aisló más de una especie de Candida. La clasifica...

  15. AISLAMIENTO DE MICROORGANISMOS INOCUOS PRODUCTORES DE SIDERÓFOROS PARA SISTEMAS DE FITORREMEDIACIÓN

    Directory of Open Access Journals (Sweden)

    Guillermo M. Carrillo-Castañeda

    2011-11-01

    Full Text Available La contaminación del suelo reduce la producción y calidad de los alimentos. Para la recuperación de suelos contaminados la fitorremediación compite favorablemente con costosos métodos físicos y químicos. En este trabajo fueron colectadas muestras de suelo y de raíz de plantas silvestres en nueve sitios en el predio del Colegio de Posgraduados, Campus Montecillo. Después de determinar el pH de las muestras de suelo, del sobrenadante se estriaron muestras en medio sólido B de King. Del ápice de raíces se obtuvieron muestras para estriarlas en el mismo medio y las cajas fueron incubadas a 26-28 °C. De 223 aislamientos bacterianos obtenidos, 23 fueron seleccionados por producir pigmentos fluorescentes y ser inocuos. Dos aislamientos de suelo (2S-10, 2S-9 y uno de raíz (2R-2 fueron los de mayor producción de pigmentos fluorescentes. La semilla de alfalfa inoculada con células de los aislamientos 2S-10, 2R-2, y 2S-9 germinó en 78, 56, y 88 %, respectivamente mientras que la semilla sin inocular germinó en 88 %. En una prueba preliminar, resaltó el mayor desarrollo de las plántulas inoculadas con el aislamiento 2S10. Mediante la interacción planta-microorganismo se logra acrecentar la potencialidad de las plantas para acumular metales y hacer más eficiente el proceso de fitorremediación.

  16. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5, recuperados entre 1994 y 2004

    Directory of Open Access Journals (Sweden)

    Sandra Carolina Firacative Ropero

    2006-01-01

    resistentes a tetraciclina y cloranfenicol, estuvieron relacionados con el patrón electroforético A (n=32 y los subtipos A16 (n=1 y A28 (n=1, caracterizados por presentar una banda de 340 Kb, al igual que el clon. Estos resultados muestran la prevalencia y circulación continua de aislamientos de S. pneumoniae serotipo 5, los cuales están genéticamente relacionados con el clon 19-Colombia.

  17. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  18. Evaluación de la técnica de MSP-PCR para la caracterización molecular de aislamientos de Rhodotorula mucilaginosa provenientes de la Patagonia noroccidental Assessment of the MSP-PCR technique for the molecular characterization of Rhodotorula mucilaginosa isolates from northwestern Patagonia

    Directory of Open Access Journals (Sweden)

    D. Libkind

    2007-09-01

    Full Text Available La identificación rápida de levaduras de origen ambiental o clínico es de importancia para el estudio de la biodiversidad de estos microorganismos y para la detección de posibles patógenos. Rhodotorula mucilaginosa es una levadura ubicua y pigmentada, capaz de producir infecciones en pacientes inmunocomprometidos. En este trabajo se evaluó la utilidad de la técnica de fingerprinting conocida como MSP-PCR (Micro/Minisatellite-Primed PCR en la caracterización e identificación de aislamientos ambientales de R. mucilaginosa provenientes de la Patagonia noroccidental. Sobre la base de sus caracteres fenotípicos, de un total de 200 levaduras pigmentadas se seleccionaron 110 aislamientos que presuntamente corresponderían a la especie R. mucilaginosa. Se evaluaron los iniciadores (GTG5, (GAC5 y M13 en aislamientos representativos, y se seleccionó el iniciador (GTG5 por ser el que permitió una mejor agrupación de los aislamientos pertenecientes a R. mucilaginosa y una mejor diferenciación de éstos con los de especies filogenéticamente próximas. Utilizando dicho iniciador, el 87% de los aislamientos de R. mucilaginosa presentó un perfil de MSP-PCR similar (> 60% al de la cepa de referencia CBS 316T de R. mucilaginosa. La técnica de MSP-PCR resultó efectiva, tanto para caracterizar e identificar un número elevado de aislamientos ambientales de R. mucilaginosa como para detectar polimorfismos en la especie.The rapid identification of environmental or clinical yeast isolates is important for biodiversity studies and the detection of probable pathogens. Rhodotorula mucilaginosa is a ubiquitous and pigmented yeast capable of infecting immunocompromised patients. In this study, we evaluated the Micro/mini satellite-primed PCR (MSP-PCR fingerprinting method for the characterization and identification of R. mucilaginosa isolates from natural environments in northwestern Patagonia. There were selected 110 putative R. mucilaginosa isolates

  19. Deteccion de citomegalovirus mediante la tecnica de inmunoperoxidasa y aislamiento viral Cytomegalovirus detection by Immunoperoxidase assay and viral isolation

    Directory of Open Access Journals (Sweden)

    Maritza Alvarez

    1991-06-01

    Full Text Available En el presente estudio se comparó la técnica de inmunoperoxidasa para la detección de citomegalovirus (IPCMV utilizando anticuerpos monoclonales que reconocen proteínas precoces virales con el método convencional de aislamiento viral en fibroblastos humanos. Un total de 150 muestras de orina fueron examinadas encontrando una sensibilidad de un 89.8% y una especificidad de 91.3% de la técnica de IPCMV comparada con el aislamiento viral. Una de las ventajas que presentó la IPCMV fue la rapidez con que fueron obtenidos los resultados (48 horas mientras que el aislamiento viral fue como promedio 14 días.An Immunoperoxidase assay was applied to detect early antigens of Cytomegalovirus (CMV in 150 urine samples from immunocompromised patients, using the commercial available monoclonal antibody against CMV El3. The detection of early antigen by IP (IPCMV is compared to the conventional cell culture isolation regarding specificity and sensitivity in order to evaluate is usefulness in the diagnostic of CMV infections. The IPCMV showed a sensitivity of 89.8% and a specificity of 91.3% when compared to the isolation method. The great advantage of the IPCMV is based on the shorter time results are achieved, since 48-72 Hs can be enough to provide evidence of CMV infection, while in the isolation technique cytopatho-genic effect was present around 14 days after sample inoculation.

  20. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE HERPESVIRUS BOVINO TIPO 1

    Directory of Open Access Journals (Sweden)

    D. Piedrahita

    2005-01-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  1. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE Herpesvirus bovino TIPO 1

    Directory of Open Access Journals (Sweden)

    Vera V.

    2005-11-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  2. Aislamiento en pacientes psiquiátricos Seclusion of psychiatric patients

    Directory of Open Access Journals (Sweden)

    Franklin Escobar Córdoba

    2009-01-01

    Full Text Available El objetivo del presente artículo es aportar pautas para la evaluación y tratamiento de pacientes agresivos mediante el uso del aislamiento. A esos efectos, se realizó una revisión narrativa de la literatura, basada en la búsqueda mediante la combinación de las palabras "seclusion" y/o "patient seclusion" y/o "Restraint, Physical" y/o "Mentally Ill Persons", en las bases de datos MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED y Latindex. Se seleccionaron 12 de 8.418 artículos de mayor relevancia para su aplicación en nuestro medio, teniendo como límites de la búsqueda revisiones, metanálisis, estudios controlados aleatorizados y estudios clínicos, adultos, ambos géneros, humanos, idioma inglés y español, de los años 2002 a 2007. Se halló un conocimiento amplio en el tratamiento del paciente agresivo. Las indicaciones del aislamiento no difieren con respecto a las de restricción, siendo importantes los riesgos de hetero o autoagresividad y de daño al entorno físico. Las contraindicaciones y consideraciones éticas, médicas y legales son claras y se deben implementar para una adecuada práctica clínica. El uso adecuado del aislamiento por parte del personal de salud debe formar parte de un plan terapéutico adecuado y tener en cuenta las recomendaciones para su uso en el contexto local.The objective of the present study is to contribute rules for the evaluation and treatment of an aggressive patient by means of seclusion. We searched the literature in the MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED and Latindex databases, using the combination of the following words: "seclusion" and/or "patient seclusion" and/or "restraint, physical" and/or "mentally ill persons". Twelve out of 8,418 articles were selected for their application in Colombia according to the following limits of the search: clinical trial, meta-analysis, randomized controlled trial, review of the literature, adults, both genders, published between 2002 and

  3. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  4. Aislamiento de algas del embalse del Neusa por medio de cultivos In Vitro

    Directory of Open Access Journals (Sweden)

    A. Maldonado

    2000-07-01

    Full Text Available EI cultivo de algas a nivel mundial es un oficio de vieja data, pero en Colombia se encuentra en sus primeras etapas de desarrollo. El presente trabajo desarrollado en el Laboratorio de Bioensayos, Departamento de Biología, Universidad Nacional de Colombia está encaminado a aportar técnicas en el desarrollo del cultivo de algas. En la parte practica del trabajo se utilizaron muestras de agua del embalse del Neusa las cuales se cultivaron en medios líquido y solido. Se observo un mejor crecimiento de cianofíceas filamentosas en medio solido y algas verdes en medio líquido. Las clamidomonas se ven favorecidas en ambos medios, hecho que permitió aislar una sepa pura de este tipo de algas. Las diatorneas por el hecho de crecer en relación con algas verdes generan un problema metodológico para su aislamiento, que aun se encuentra sin resolver.

  5. Estudio sobre las relaciones filogenéticas entre diversos aislamientos del hongo Paracoccidioides brasiliensis

    Directory of Open Access Journals (Sweden)

    Juan McEwen

    2003-01-01

    Full Text Available Aunque es poco lo que se conoce acerca de la biología evolutiva
    del hongo P. brasiliensis, varios estudios moleculares han demostrado que existen variaciones en secuencias de ADN entre sus aislamientos, las que se correlacionan con el origen geográfico de las mismas y con diferencias en su virulencia para modelos murinos (1,2. Se desconoce si estas variaciones son el resultado final de un proceso de especiación alopátrica que daría origen a especies aisladas genéticamente provistas de características fenotípicas (patogenicidad, inmunogenicidad y genotípicas diferentes, las que podrían ser usadas como una alternativa para mejorar e innovar los métodos actuales de diagnóstico. Por lo tanto, proponemos como objetivo general estudiar un aspecto fundamental de la biología evolutiva del hongo patógeno humano P. brasiliensis como es la especiación.

  6. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  7. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  8. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  9. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  10. Inhibición in vitro de aislamientos nativos de Trichoderma en presencia de la cepa comercial T22

    Directory of Open Access Journals (Sweden)

    Gabriela Hernández – Ramírez

    2013-01-01

    Full Text Available Título en ingles: In vitro inhibition from native isolates of Trichoderma against commercial strain T22.  Título corto: Inhibición in vitro de aislamientos nativos Resumen El objetivo de este trabajo fue evaluar 14 aislamientos nativos del género Trichoderma (Tn obtenidos de la rizósfera del cultivo de caña de azúcar de acuerdo con su efecto de inhibición In vitro en cultivos duales contra la cepa comercial de Trichoderma harzianum (T22. Los aislamientos nativos con mayor índice de inhibición fueron los denominados Palma (T12 y Hubero (T11, con un valor de 2, mientras que T01, T04, T05 y T08 presentaron un valor de 1. Además, el mayor porcentaje de inhibición fue causado por el aislamiento T03, con una media de 92.32 ± 2.64%, sin diferencias estadísticas con los nativos T07, con un valor inhibición de 88.99 ± 1.46%, T01 87.93 ± 2.28%, y T12; 87.71 ± 3.16. En este caso, los aislamientos T07 y T12 mostraron capacidad inhibitoria con mayores atributos para su selección como agentes de control biológico. Al evaluar la tolerancia In vitro de los aislamientos nativos de Trichoderma a la actividad del agua (aw, se observó efecto significativo sobre el desarrollo micelial de los aislamientos de Trichoderma nativo evaluados. Los aislamientos T03 (7919.3 ± 932.53 y T12 (6388.2 ± 623.40 presentaron el mejor desarrollo radial. Estos resultados sugieren que los aislamientos T03 y T12 podrían desarrollarse mejor bajo condiciones de estrés hídrico. Por lo anterior, concluimos que los aislamientos T07 y T12, son los mejores candidatos como agentes inhibidores y se sugiere evaluarlos In vitro o invernadero contra el agente causal de la enfermedad del muermo rojo en caña de azúcar (Colletotrichum falcatum. Palabras clave: Control Biológico; tolerancia;  ompetencia; estrés hídrico; actividad de agua. Abstract The objective of this work was to evaluate 14 native e Trichoderma genus isolates (Tn obtained from the rhyzosphere of

  11. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  12. Brief exegesis on the existing legislation and the application of thermal insulation in the world - proposal for Mexico; Breve exegesis sobre legislacion existente en la aplicacion de aislamientos termicos en el mundo - propuesta para Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)

    1993-12-31

    -economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.

  13. Brief exegesis on the existing legislation and the application of thermal insulation in the world - proposal for Mexico; Breve exegesis sobre legislacion existente en la aplicacion de aislamientos termicos en el mundo - propuesta para Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)

    1992-12-31

    -economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.

  14. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  15. Aislamiento de polisacáridos a partir de cordones umbilicales humanos

    Directory of Open Access Journals (Sweden)

    Guillermo Lago

    2002-12-01

    Full Text Available Se realizó el aislamiento y caracterización de polisacáridos obtenidos a partir de cordones umbilicales humanos mediante una modificación a la técnica de Danishevsky y Bella. Se trataron los cordones con solución de cloruro de sodio bajo condiciones de temperatura y agitación controlada y se precipitaron los polisacáridos mediante la adición de una disolución de bromuro de cetiltrimetilamonio al 1 %. Se resuspendió el sedimento obtenido en una solución de cloruro de sodio 0,4 mol/L eliminando algunas impurezas que no se solubilizan a esta fuerza iónica mediante centrifugación y se precipitó el producto de interés mediante la adición de etanol al sobrenadante, caracterizándose por métodos químicos. El producto puede ser empleado como materia prima para obtener un gel cicatrizante en la Industria Médico-Farmacéutica.The polysaccharides obtained from human umbilical cords by a modification of Danishevsky and Bella’s technique were isolated and characterized. The cords were treated with a sodium chloride solution under controlled temperature and agitation conditions. The polysaccharides were precipitated by adding a disolution of cetyltrimethylammonium 1 %. The sediment obtained in a sodium chloride solution 0.4 mol/L was resuspended, eliminating some impurities that were not soluble at this ionic force by centrifugation. The product of interest was precipitated by adding ethanol to the supernadant and it was characterized by chemical methods. This product may be used as a raw material to obtain a healing gel in the Medicopharmaceutical Industry.

  16. Aislamiento acústico a ruido aéreo en acristalamientos de vidrio

    Directory of Open Access Journals (Sweden)

    Escuder Silla, E.

    2007-08-01

    Full Text Available In this paper, the Ookura & Saito model is applied to determine the Airborne Sound Insulation of glazing systems. In particular, the calculations that appear are for monolithic glasses of different thicknesses and laminated glasses from different types. There are different prediction models of the airborne acoustic behaviour of multilayer panels (and the laminated glasses can be considered like such. In all of them, the input data are the elastic constants and the loss factor. The monolithic glasses and the intermediate layer have been characterized according to different Standards. The results are compared with experimental measurements and data of the study of Marsh (1, obtaining a range of acceptable adjustment.

    En este artículo se aplica el modelo de Ookura & Saito para determinar el aislamiento acústico a ruido aéreo de sistemas constructivos basados en vidrios. En concreto, los cálculos que se presentan son para vidrios monolíticos de distintos espesores y para vidrios laminados de diferentes tipos. Existen diferentes modelos de predicción del comportamiento acústico a ruido aéreo de estructuras multicapa (y los vidrios laminados pueden considerarse como tales. En todos ellos, los datos de entrada son las constantes elásticas y el factor de pérdidas. Tanto los vidrios monolíticos como la capa intermedia se han caracterizado siguiendo diferentes normativas. Los resultados se comparan con medidas experimentales y con datos recogidos del estudio de Marsh (1, obteniéndose un grado de ajuste aceptable.

  17. Aislamiento y caracterización de micromicetos biodegradadores de polietileno

    Directory of Open Access Journals (Sweden)

    Carmen R. Méndez

    2013-05-01

    Full Text Available La biodegradación del polietileno por microorganismos es una solución para la reducción de la contaminación por plásticos. En el presente trabajo se muestran los resultados del aislamiento y caracterización de cepas de hongos capaces de degradar el polietileno, así como la determinación de las condiciones de pH y temperatura en las que se logran la mayor actividad. Los hongos fueron aislados de productos elaborados con polietileno obtenidos de relleno sanitario, la identificación taxonómica en base a características macroscópicas del crecimiento en placa petri y el estudio microscópico empleando la técnica de microcultivo en lámina. La actividad biodegradadora se determinó con la técnica de Kavelman y Kendrick, a temperaturas entre 20 y 30 °C y a pH 4,5 – 8,0. Veinte cepas de micromicetos fueron aisladas e identificadas, en 5 (25% se evidencio la capacidad de biodegradar el polietileno a 20 °C, siendo el pH 6,5 el óptimo, la cepa de mayor rendimiento pertenece a la especie de Aspergillus flavus. A temperatura de 30 °C, 6 (30% cepas evidenciaron actividad degradadora, siendo pH 6,5 el óptimo, la cepa de mayor rendimiento fue la misma del caso anterior.

  18. Evaluación de aislamientos nativos de Beauveria Spp. sobre Tecia solanivora (Lepidoptera: Gelechiidae in vitro

    Directory of Open Access Journals (Sweden)

    Jorge Enrique Villamil

    2014-06-01

    Full Text Available Se evaluó la eficacia de hongos entomopatógenos nativos en el biocontrol de Tecia solanivora (Lepidoptera: Gelechiidae in vitro. Los aislamientos fueron obtenidos de larvas y adultos de gusano blanco Premmotrypes vorax, barrenador del curubo Aepytus sp, picudo de la palma Rinchophorus palmarum, broca del café Hypothenemus hampei, polilla guatemalteca Tecia solanivora y palomilla de la papa Phthorimaea operculella infectados, de los municipios de Ventaquemada, Umbita, Coper (Boyacá y San gil (Santander. El trabajo se realizó en el laboratorio de control biológico del Grupo Manejo Biológico de Cultivos en Tunja, Colombia. Se seleccionaron in vitro, de forma preliminar cinco de los siete aislamientos de hongos obtenidos: Bv01, Bv03, Bv04, Bv05 y Bv07, los cuales ocasionaron mortalidades superiores al 10%. De acuerdo con la caracterización morfológica realizada, los hongos encontrados pertenecen al género Beauveria. La evaluación de su eficacia se realizó con 10 larvas de T. solanivora desinfectadas y sumergidas en suspensión de 1x107esporas.mL-1, las cuales se observaron durante 32 días, registrando cada 8 días la mortalidad. Se empleó un diseño completamente al azar, con 6 tratamientos, 4 repeticiones y una prueba de separación de medias de Tukey. Los resultados mostraron que 32 días después de la inoculación los aislamientos Bv03 y Bv05 fueron los que produjeron la mayor mortalidad acumulada (7,4 y 8,5%, respectivamente. Se confirma el bajo potencial de los hongos entomopatógenos nativos para el control de larvas de T. solanivora.

  19. Aislamiento y serotipificación de Salmonella sp. en estanques con Crocodylus intermedius y testudines cautivos en Villavicencio - Colombia

    Directory of Open Access Journals (Sweden)

    Diana Pachón C.

    2011-05-01

    Full Text Available Objetivo. Determinar la presencia de microorganismos del género Salmonella sp. en el ambiente acuático de los ejemplares Crocodylus intermedius y testudines en la Estación de Biología Tropical Roberto Franco (EBTRF. Materiales y métodos. En este estudio se utilizó la metodología estándar para aislar e identificar microorganismos del género Salmonella sp., a partir de muestras de agua y sedimento de 52 estanques (nEstanques Crocodylus=25; nEstanques testudines=27; se procedió a serotipificar los aislamientos por el método convencional de Kaufmann-White y se realizaron pruebas de sensibilidad a antimicrobianos por la técnica de Kirby Bauer. Resultados. Se determinó la presencia de Salmonella sp., en un 33% del total de estanques muestreados. El 29% de los aislamientos de Salmonella sp. serotipificados, correspondió al serogrupo B; los serogrupos C, C1, C2 y D1 presentaron menores porcentajes. Con las pruebas de sensibilidad a antimicrobianos se determinó que el 100% de los aislamientos fueron sensibles a norfloxacina. Conclusiones. La ocurrencia de Salmonella sp., en los estanques de la EBTRF fue del 33%, con la mayor presencia del serogrupo B, donde se encuentran especies con características ampliamente zoonóticas. Con los resultados obtenidos es necesario el seguimiento de las normas de bioseguridad establecidas en la estación para el manejo de las poblaciones allí mantenidas y evitar de esa manera la ocurrencia de cuadros zoonóticos.

  20. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  1. Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos

    Directory of Open Access Journals (Sweden)

    Daniel Iván Ospina Salazar

    2014-07-01

    Full Text Available Título en español: Actividad antifúngica de extractos de biomasa celular de neem sobre aislamientos de dermatofitos Título en ingles: Antifungal activity of neem cellular biomass extracts on dermatophytes isolates Título corto: Actividad antifúngica de extractos de biomasa celular de neem Resumen:  Las líneas celulares de neem (Azadirachta indica A. Juss. cultivadas en suspensión líquida han demostrado producir metabolitos secundarios bioactivos, particularmente triterpenoides. En consecuencia, se han realizado estudios para el control de microorganismos de importancia médica, como los hongos dermatofitos. El objetivo principal de este trabajo fue evaluar a través de un método de referencia in vitro la actividad antifúngica de diferentes extractos de cultivos celulares de neem sobre varios aislamientos de Trichophyton mentagrophytes, Trichophyton rubrum y Epidermophyton floccosum. Se realizó un escalado de cultivos de suspensiones celulares de neem, a partir de los cuales se obtuvo un extracto crudo metanólico. Éste extracto fue fraccionado posteriormente por cromatografía en columna de silica gel. Con los extractos obtenidos se determinó la Concentración Mínima Inhibitoria (CMI, siguiendo el método de microdilución en caldo M38-A2, con cinco aislamientos de T. mentagrophytes, cinco de T. rubrum y tres de E. floccosum. Se usó como control positivo el antimicótico Terbinafina. Los resultados mostraron que el extracto crudo de biomasa celular de neem inhibe el crecimiento hasta en 100 % de T. mentagrophytes, T. rubrum y E.  floccosum. Al evaluar las fracciones por separado, se observó que las de menor polaridad exhibieron en general mayor actividad antifúngica (CMI=109 µg/mL que el extracto crudo per se (CMI=2500 µg/mL y las fracciones más polares (CMI=7000 µg/mL. Lo anterior indica que las células de neem cultivadas en suspensión producen compuestos con actividad antifúngica, siendo más bioactivos los presentes

  2. Aislamiento de microorganismos productores de biosurfactantes y lipasas a partir de efluentes residuales de camales y suelos contaminados con hidrocarburos

    OpenAIRE

    Lizzie Karen Becerra Gutiérrez; María Valeria Horna Acevedo

    2016-01-01

    Los biosurfactantes son moléculas anfipáticas que reducen la tensión en la interfase, incrementando así la solubilidad en agua y disponibilidad de compuestos orgánicos, son producidos por bacterias, hongos, y levaduras. Para el aislamiento de bacterias productoras de biosurfactante y lipasas, se sembró en medios inductores 10% de efluentes residuales procedentes de camales y suelos de grifos contaminados con hidrocarburos de la Provincia de Trujillo - Perú. Los cultivos aislados se sembraron ...

  3. Respuesta fisiológica y capacidad antagonista de aislamientos filosféricos de levaduras obtenidos en cultivos

    Directory of Open Access Journals (Sweden)

    Cluadia Milena Medina

    2009-09-01

    Full Text Available La filósfera es un ecosistema complejo que a pesar de contar con un gran número de microorganismos asociados, presenta pocos estudios diseñados para entender las características eco-fisiológicas de los microorganismos que lo habitan.  Las levaduras, como elemento importante de este hábitat, están expuestas a un ambiente variable afectado por la planta hospedera, edad y posición de la hoja, disponibilidad y calidad de nutrientes, temperatura, pH, radiación y actividad del agua.  Estos factores producen una presión de selección para el establecimiento de poblaciones naturales o introducidas de levaduras que puedan desplazar otras poblaciones de hongos fitopatógenos.  En este estudio se obtuvieron 80 aislamientos de levaduras filosféricas de dos cultivos de mora (Rubus glaucus, a las que se les determinó su nicho potencial en términos de su capacidad para crecer a diferentes condiciones de temperatura, pH, estrés osmótico y tolerancia a radiación UV.  El estrés osmótico fue la condición evaluada más restrictiva para las levaduras obtenidas, ya que únicamente seis aislamientos presentaron un crecimiento superior a 0.3 unidades de DO a 405nm, cuando fueron crecidas a 50% y 60% de glucosa.  Este estudio permitió seleccionar diez aislamientos filosféricos de levaduras, destacados por su capacidad para crecer en un amplio rango de condiciones.  De estos, cuatro aislamientos LvF 34, LvF 43, LvF 44 y  LvF 50 se destacaron por su capacidad de antagonismo contra el hongo fitopatogeno Botritys cinérea. Su determinación taxonómica permitió reportar por primera vez las especies Candida kunwinensis y Rhodotorula colostri con potencial biocontrolador.

  4. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  5. Caracterización de aislamientos del hongo entomopatógeno beauveria bassiana y su patogenicidad en hypothenemus hampei (coleoptera: curculionidae, scolytinae).

    OpenAIRE

    Cañizalez Briceño, Luis Miguel; Guedez de Olivar, Clemencia; Castillo, Carmen Elena; Olivar, Rafael

    2015-01-01

    La broca (Hypothenemus hampei) es insecto plaga que causa pérdidas considerables en café. El principal control ha sido el químico, sin embargo, actualmente se buscan alternativas más ecológicas. El objetivo fue caracterizar 12 aislamientos nativos de Beauveria bassiana y evaluar el control en la broca. La caracterización involucró la morfología, fisiología y patogenicidad de los aislamientos en adultos de H. hampei. El tamaño de los conidios osciló entre 2,55 y 2,42 micras. La ger...

  6. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  7. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  8. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  9. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  10. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  11. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  12. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  13. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  14. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  15. AISLAMIENTO Y PURIFICACIÓN DEL HONGO ECTOMICORRÍZICO Helvella lacunosa EN DIFERENTES MEDIOS DE CULTIVO

    Directory of Open Access Journals (Sweden)

    Daniel Domínguez Romero

    2013-04-01

    Full Text Available Helvella lacunosa (H. lacunosa adicionalmente a su importancia micorrízica tiene un alto valor comercial. La producción comercial de H. lacunosa tiene dos ventajas: Beneficio económico para las comunidades que sean capaces de producirlo y; conservación de la biodiversidad en el bosque al prevenir la sobre explotación de la especie y mantener la relación micorrízica hongo:planta. Es necesario, en principio, obtener el micelio puro (aislamiento, y a partir de éste buscar la técnica de micorrización más adecuada para su producción. El aislamiento de cepas, requiere de pruebas selectivas de diversos medios de cultivo lo que permite identificar los requerimientos potenciales para inducir el desarrollo del micelio. Se realizaron pruebas de crecimiento en cinco medios de cultivo con el objetivo de obtener cepas puras del hongo ectomicorrízico H. lacunosa. Mediante un Análisis de Covarianza se demostró que existe una relación lineal entre el tiempo de incubación y el diámetro, lo que indica que la velocidad de crecimiento acumulado del micelio, fue diferente entre los medios de cultivo (F4, 240 = 17.008; p

  16. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  17. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  18. Aislamiento de cryptococcus neoformans var. Grubii en un felino doméstico. Reporte de caso

    Directory of Open Access Journals (Sweden)

    Marlyn Zapata Montoya

    2009-12-01

    Full Text Available Se halló evidencia clínica, citológica y serológica de una infección natural con Criptococcus en un felino criollo proveniente de La Mesa, Cundinamarca (Colombia. C. neoformans var. grubii fue aislado del cultivo de secreciones nasales del paciente. Para el tratamiento específico se utilizó fluconazol, que mostró buenos resultados a partir del primer mes de haber iniciado su administración.

  19. Aislamiento de cryptococcus neoformans var. Grubii en un felino doméstico. Reporte de caso

    OpenAIRE

    Zapata Montoya, Marlyn; Galindo Zamora, Vladimir

    2009-01-01

    Se halló evidencia clínica, citológica y serológica de una infección natural con Criptococcus en un felino criollo proveniente de La Mesa, Cundinamarca (Colombia). C. neoformans var. grubii fue aislado del cultivo de secreciones nasales del paciente. Para el tratamiento específico se utilizó fluconazol, que mostró buenos resultados a partir del primer mes de haber iniciado su administración. Clinical, cytologic and serologic evidence of a natural infection with Criptococcus was identified ...

  20. Aislamiento de cryptococcus neoformans var. Crubii en un felino doméstico. Reporte de caso

    OpenAIRE

    Zapata Montoya, Marlyn; Galindo Zamora, Vladimir

    2009-01-01

    Se halló evidencia clínica, citológica y serológica de una infección natural con Criptococcus en un felino criollo proveniente de La Mesa, Cundinamarca (Colombia). C. neoformans var. grubii fue aislado del cultivo de secreciones nasales del paciente. Para el tratamiento específico se utilizó fluconazol, que mostró buenos resultados a partir del primer mes de haber iniciado su administración. Clinical, cytologic and serologic evidence of a natural infection with Criptococcus was identified ...

  1. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia

    Directory of Open Access Journals (Sweden)

    Diego Fernando Marmolejo

    2008-10-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a -20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.

  2. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia

    Directory of Open Access Journals (Sweden)

    Muñoz Flórez Jaime Eduardo

    2008-09-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a –20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.

  3. Aislamiento rápido del virus dengue 3 por el método de shell vial en el brote de dengue en Lima

    Directory of Open Access Journals (Sweden)

    Victoria Gutiérrez P

    2005-07-01

    Full Text Available El aislamiento de virus dengue con los métodos tradicionales demora hasta un mes, en situaciones de emergencia como el brote de dengue clásico en el distrito de Comas-Lima entre abril y mayo de 2005, es necesario un diagnóstico precoz. Se procesaron 117 muestras de sueros de pacientes con diagnóstico clínico de dengue clásico en fase virémica procedentes la zona del brote, mediante el método de shell vial para el aislamiento del virus dengue en la línea celular C6-36, se identificó el serotipo del virus mediante inmunofluorescencia indirecta (IFI empleando anticuerpos monoclonales. Se logró el aislamiento del virus DEN-3 al quinto día de cosecha en el 48,7% (57/117 de los sueros. Los resultados sugieren que el método de shell vial, por el menor tiempo de aislamiento que el método tradicional, puede ser implementado como método de diagnóstico y usado en la vigilancia epidemiológica del virus dengue.

  4. SUSCEPTIBILIDAD ANTIMICROBIANA DE AISLAMIENTOS DE Salmonella enterica PROVENIENTES DE PISOS, EQUIPOS, UTENSILIOS Y PRODUCTO TERMINADO EN PLANTAS DE BENEFICIO PORCINO EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    P. M. Bermúdez

    2016-01-01

    Full Text Available La diseminación de Salmonella spp. resistente a antimicrobianos en las cadenas productivas de alimentos de origen animal es una preocupación de salud pública de carácter mundial. Este estudio describe los patrones de resistencia antimicrobiana de 283 aislamientos de Salmonella enterica procedentes de plantas de beneficio porcino en Colombia. Se evaluó la susceptibilidad antimicrobiana frente a diez antimicrobianos mediante el método de difusión en disco: amoxacilina-ácido clavulánico (30 ug, ampicilina (10 ug, ceftiofur (30 ug, ciprofloxacina (5 ug, cloranfenicol (30 ug, florfenicol (30 ug, gentamicina (10 ug, sulfadiazina/trimetroprim (25 ug, tetraciclina (30 ug y tilmicosina (15 ug. Los resultados evidenciaron la presencia de 279 aislamientos multirresistentes de Salmonella enterica de origen porcino provenientes del ambiente y del producto terminado en las plantas de beneficio evaluadas (46,64% n: 132. Se detectaron 52 patrones de multiresistencia: el más común fue ceftiofur-tetraciclina-tilmicosina en el 9,89% (n: 28 de los aislamientos. Con referencia a estos antimicrobianos, 96,82% (n: 274 de los aislamientos fueron resistentes a tetraciclina, 73,14% (n: 207 a tilmicosina y 28,27% (n: 80 a ceftiofur. De especial interés fue la alta proporción de aislamientos resistentes a ceftiofur, debido a una posible resistencia cruzada con ceftriaxona. Los resultados obtenidos demuestran la necesidad de promover el diseño e implementación de un Programa oficial Integrado de Vigilancia de la Resistencia Antimicrobiana, además de sistemas de monitoreo voluntario en cada eslabón de la cadena productiva porcina, para contribuir a la prevención y control de la transmisión de microorganismos resistentes de origen alimentario en el marco del sistema de gestión de inocuidad alimentaria en Colombia.

  5. Determinación de la susceptibilidad a drogas de primera línea en aislamientos de mycobacterium tuberculosis por la técnica del tubo indicador de crecimiento micobacteriano

    OpenAIRE

    Sierra Parada, Claudia Rocío; Sánchez Morales, Édgar Alberto; Henao Riveros, Sandra Consuelo; Saavedra Rodríguez, Alfredo

    2010-01-01

    Antecedentes. La aparición de aislamientos de Mycobacterium tuberculosis resistentes a los medicamentos ha hecho que se busquen métodos más rápidos y confiables para la determinación de la susceptibilidad a las drogas antituberculosas. Objetivo. Determinación de la susceptibilidad a drogas antituberculosas de primera línea en aislamientos de M. tuberculosis utilizando el método del tubo indicador de crecimiento micobacteriano (MGIT). Material y métodos. Se estudiaron 49 aislamientos...

  6. DETERMINACIÓN DE LA SUSCEPTIBILIDAD A DROGAS DE PRIMERA LÍNEA EN AISLAMIENTOS DE MYCOBACTERIUM TUBERCULOSIS POR LA TÉCNICA DEL TUBO INDICADOR DE CRECIMIENTO MICOBACTERIANO

    OpenAIRE

    Claudia Rocío Sierra Parada; Édgar Alberto Sánchez Morales; Sandra Consuelo Henao Riveros; Alfredo Saavedra Rodríguez

    2008-01-01

    Antecedentes. La aparición de aislamientos de Mycobacterium tuberculosis resistentes a los medicamentos ha hecho que se busquen métodos más rápidos y confiables para la determinación de la susceptibilidad a las drogas antituberculosas. Objetivo. Determinación de la susceptibilidad a drogas antituberculosas de primera línea en aislamientos de M. tuberculosis utilizando el método del tubo indicador de crecimiento micobacteriano (MGIT). Material y métodos. Se estudiaron 49 aislamientos de...

  7. Diseño de dos metodologías moleculares para la rápida identificación de aislamientos de Staphylococcus aureus resistente a meticilina asociados a la comunidad en Colombia

    OpenAIRE

    Javier Antonio Escobar; Ingrid Tatiana Gómez; Martha Johanna Murillo; Betsy Esperanza Castro; Bibiana Chavarro; Ricaurte Alejandro Márquez; Natasha Vanegas

    2012-01-01

    Introducción. Los aislamientos de Staphylococcus aureus resistente a la meticilina asociado a la comunidad (SARM-AC), están aumentando la frecuencia de infecciones en personas sanas de la comunidad y en pacientes hospitalizados. En Colombia y en la región andina estos aislamientos tienen un componente genético relacionado con el clon pandémico USA300. Objetivo. Diseñar y estandarizar dos metodologías para la diferenciación rápida de aislamientos colombianos de S. aureus resistente a la me...

  8. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2007-02-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  9. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2005-07-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  10. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  11. The thermal insulating materials and its coatings for underground piping; Los aislamientos termicos y sus recubrimientos para tuberias subterraneos

    Energy Technology Data Exchange (ETDEWEB)

    Salcido Lopez, Salvador [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    Energy Saving through the adequate selection and application of the thermal insulating materials, as well as its coatings for underground piping conducting fluids, both at high and at low temperature. The benefits are outlined at economical level for the investor as well as at ecological level (of vital importance today) and are observed as practical examples in industrial and commercial processes. [Espanol] Ahorro de energeticos mediante la adecuada seleccion y aplicacion de los aislamientos termicos, asi como de sus recubrimientos para tuberias subterraneas que conducen fluidos tanto en alta como en baja temperatura. Los beneficios son destacados tanto a nivel economico para el inversionista, como a nivel ecologico (de vital importancia en la actualidad), y son observados con ejemplos practicos en procesos industriales y comerciales.

  12. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  13. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  14. Ensayo de aislamiento acústico a ruido aéreo de los cerramientos exteriores y particiones realizados con paneles de madera

    Directory of Open Access Journals (Sweden)

    Pacios Álvarez, Antonia

    2007-06-01

    Full Text Available The house prototype of the Provisional Emergency House System uses wood and its derivatives for the facades, floor structure, roofing and partitions.  The extensive use of wooden panels for the construction and the lack of data, in Spain, about their acoustic behavior bring up the necessity to make in situ measurements of the acoustic isolation to airborne sound. Panels used for facades and partitions are built with a wooden framework and membrane of oriented strand board in both sides, for the facades, and of laminated plaster boards for the inner partitions. With the objective of verifying the sound insulation of the facades according to Spanish Standard UNE EN ISO 140-5, in situ measurements of airborne sound insulation of facade elements and facades have been made; according to Spanish Standard UNE EN ISO 140-4, in situ measurements of airborne sound insulation between rooms for internal walls have also been made. The procedure of the global insulation has been followed to measure the acoustic insulation of complete facades without making distinction between the elements that form it.El prototipo de vivienda del Sistema de Vivienda Provisional de Emergencia utiliza principalmente la madera y sus derivados tanto en los cerramientos y particiones como en el forjado y la cubierta. El empleo de soluciones constructivas ligeras y la falta de datos en España acerca del comportamiento acústico de los mismos plantea la necesidad de realizar mediciones in situ del aislamiento acústico a ruido aéreo. El panel base de cerramiento y particiones se construye partiendo de un entramado de montantes de madera con membrana en ambas caras de tableros de virutas de madera orientadas, para el caso de los cerramientos exteriores, y de tableros laminados de yeso para las particiones interiores. Con el objeto de comprobar el aislamiento acústico de dichos cerramiento se han realizado ensayos siguiendo la Norma UNE EN ISO 140-5 para la medición in situ del

  15. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  16. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  17. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  18. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  19. PCR múltiple para la detección de los genes sea, seb, sec, sed y see de Staphylococcus aureus: Caracterización de aislamientos de origen alimentario Multiplex PCR for the detection of sea, seb, sec, sed and see genes of Staphylococcus aureus: Characterization of isolates from food

    Directory of Open Access Journals (Sweden)

    E. A. Manfredi

    2010-09-01

    Full Text Available La presencia de Staphylococcus aureus en los alimentos representa un riesgo potencial para la salud pública; sus enterotoxinas son el principal factor de virulencia. La detección de las enterotoxinas de S. aureus puede realizarse por ELISA, aunque sólo es posible detectar el pool de enterotoxinas SEA, SEB, SEC, SED y SEE. Los objetivos del presente trabajo fueron optimizar dos técnicas de PCR múltiple para la detección de los genes sea, seb, sec, sed y see de S. aureus y caracterizar un conjunto de 115 aislamientos de Staphylococcus spp. asociados a intoxicaciones alimentarias provenientes de diferentes provincias de Argentina. La caracterización se realizó por pruebas bioquímicas, ELISA y PCR. Sesenta y ocho aislamientos (59,1% fueron positivos por ELISA, mientras que 61 (53% fueron positivos por PCR. De los aislamientos positivos por PCR, 34 (55,7% portaron el gen sea, 9 (14,8% el gen seb, 5 (8,1% el gen see, 4 (6,5% el gen sec, 6 (9,9% los genes sea y seb, 2 (3,3% los genes sea y sec, y 1 (1,7% los genes sea y sed. Este es el primer estudio de caracterización genotípica de aislamientos de S. aureus asociados con brotes de intoxicación alimentaria registrados en distintas provincias argentinas.The presence of Staphylococcus aureus in food represents a potential risk to public health, being its enterotoxins the major virulence factor. Enterotoxin detection can be determined by ELISA, but only for the pool of enterotoxins SEA, SEB, SEC, SED and SEE. The main aims of this study were to optimize two PCR techniques for detection of S. aureus sea, seb, sec, sed and see, and to characterize Staphylococcus spp. isolates associated with food intoxication. Two PCR techniques were optimized and 115 Staphylococcus spp. isolates from Ciudad Autónoma de Buenos Aires, and Buenos Aires, Córdoba, and Neuquén provinces were characterized. The characterization was performed by biochemical tests, ELISA and PCR. Sixty-eight isolates (59.1% were

  20. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  1. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  2. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  3. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  4. Caracterización molecular de aislamientos de enterobacter cloacae multirresistentes, productores ß-Lactamasas provenientes de pacientes de un hospital de tercer nivel de Bogotá

    Directory of Open Access Journals (Sweden)

    Ibonne Aydee García Romero

    2005-07-01

    Full Text Available Antecedentes. Las enterobacterias, antaño flora normal del tracto gastrointestinal, han cambiado su biología y emergido como agentes patógenos nosocomiales que se tornan resistentes los antibióticos conocidos. Objetivo. Realizar la caracterización epidemiológico-molecular de 20 aislamientos de Enterobacter cloacae resistentes a cefalosporinas de tercera generación; provenientes de un hospital de tercer nivel de Bogotá-Colombia. Material y métodos. Los aislamientos fueron identificados mediante sistemas automatizados Microscan y VITEK, se utilizó el Enterobacter asbureae como control externo inter-especie. La confirmación de resistencia se hizo por técnica de difusión en agar, y una vez establecida se realizó BLEE para comprobación. La determinación de puntos isoeléctricos se hizo, mediante lisis por ultrasonido y la genotipificación mediante la metodología para bacterias Gramnegativas propuesta por Versalovic. Resultados: Los aislamientos colectados durante un año fueron causantes de 15 casos de infección Intrahospitalaria y dos colonizaciones. Todos los aislamientos presentaron resistencia a cefotaxima, ceftazidima, ceftriaxona, aztreonam y ciprofloxacina, 95% a amikacina, gentamicina y cloranfenicol, 75% a trimetoprim/sulfametoxazol, 20% a cefepime y todos fueron sensibles a imipenem. Dos aislamientos fueron confirmados como productores de â-lactamasas de espectro extendido (BLEE por la técnica microbiológica de disco combinado. Por isoelectroenfoque presentaron dos â-lactamasas con puntos isoeléctricos (pI de 5,4 y 8,2. En los 18 aislamientos no inhibidos por ácido clavulánico, se detectaron entre 2 y 4 â-lactamasas con pI de 5,4; 6,0; 7,0; 8,2 y mayor que 8,2; la resistencia a cefalosporinas de tercera generación podría ser atribuida a la hiperproducción de AmpC; los valores de pI sugieren la producción simultánea de â-lactamasas tipo SHV y TEM. La genotipificación mediante tres metodologías de rep

  5. Voltage pre-regulator without insulation with high efficiency; Pre-regulador de tension sin aislamiento con alta eficiencia

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ramos, Octaviano

    2003-04-15

    esta tesis se propone una nueva topologia de pre-regulador para fuentes de alimentacion con una alta eficiencia ({eta}), debido a una estrategia novedosa de manejo de la energia; asimismo corrige el FP. Esto representa un avance en lo que respecta a la investigacion sobre fuentes de alimentacion, debido a que normalmente dos parametros estan en oposicion: cuando se mejora la eficiencia ({eta}) se descuida el factor de potencia (FP), asimismo cuando se corrige el FP se descuida la {eta}, sin embargo es posible mejorar estos dos parametros al mismo tiempo aprovechando el concepto de pasar parte de la energia de entrada directo a la salida. El nuevo pre-regulador puede combinarse con reguladores tradicionales con aislamiento como el convertidor CD/CD flyback, o bien combinarse con reguladores de alta eficiencia como el llamado reductor de dos entradas. El regulador es necesario para obtener una fuente de alimentacion regulada con un alto factor de potencia y buena eficiencia. El documento de tesis esta organizado en cuatro capitulos. En el primer capitulo se examinan las propuestas de diversos autores, y finaliza con el planteamiento de la topologia propuesta para este trabajo de investigacion. El capitulo dos, titulado Teoria de operacion, analisis y diseno de la solucion propuesta, muestra las ecuaciones de diseno y formas de onda del convertidor propuesto que ayudan a entender su funcionamiento. En el capitulo tres, titulado Estrategia de control, se justifica el uso de un control no lineal debido a las caracteristicas de la topologia y el por que la utilizacion de modos deslizantes (SMC), se plantea el analisis y diseno de la etapa de control del convertidor propuesto por modos deslizantes. Ademas se presenta la forma en que se implemento fisicamente dicho control. El capitulo cuatro, titulado Analisis de resultados, se divide en dos partes: simulaciones y resultados experimentales. Adicionalmente se presenta un analisis comparativo entre la topologia propuesta y el

  6. Haemophilus influenzae : Caracterización de aislamientos recuperados de enfermedades invasivas en Cuba durante el período 2008-2011

    Directory of Open Access Journals (Sweden)

    Gilda Toraño

    2012-12-01

    Full Text Available Con el objetivo de caracterizar los aislamientos de Haemophilus influenzae, responsables de enfermedades invasivas en Cuba, en la etapa posterior a la vacunación se estudió el total de los recuperados durante el período 2008-2011, remitidos al Instituto "Pedro Kourí" desde diferentes provincias del país. La confirmación de especie y determinación de serotipos se realizó atendiendo al requerimiento de los factores V y X y empleando el método de aglutinación en lámina, respectivamente. Se definieron los biotipos a través de las pruebas de indol, urea y ornitina; se determinó la concentración mínima inhibitoria (CMI mediante la prueba del elipsómetro para la ampicilina, la ceftriaxona, el cloranfenicol y la rifampicina. Para 23 aislamientos se corroboró la identificación como H. influenzae : 21 fueron serotipables y 2 no tipables (HNT. El 90,4% de los serotipables fueron serotipo b y se detectaron dos serotipos a. Nueve aislamientos de H. influenzae b pertenecieron al biotipo I y los aislamientos, serotipo a y HNT, al biotipo II. En una cepa se demostró producción de la enzima ß-lactamasa y resistencia para la ampicilina y el cloranfenicol, con valores de CMI= 8 y 12 µg/mL, respectivamente. Se puso en evidencia que a pesar de la disminución de la incidencia de la enfermedad invasiva por Hib, este serotipo aún constituye el más frecuente y se alerta sobre la necesidad de una vigilancia sostenida que permita detectar fallos vacunales. La susceptibilidad antimicrobiana demostrada para este período pudiera considerarse como un beneficio adicional de la introducción de la vacunación en Cuba.

  7. Detección de un complejo clonal con el genotipo de Brucella abortus biovariedad 2 como fundador en aislamientos de B. abortus de Argentina

    Directory of Open Access Journals (Sweden)

    Daiana Hollender

    Full Text Available Brucella abortus es el agente causal de la brucelosis bovina, enfermedad zoonótica que se encuentra ampliamente distribuida en el mundo. Actualmente existen ocho biovariedades de B. abortus. En Argentina se encuentra con mayor frecuencia la biovariedad 1, pero también se suele aislar la biovariedad 2, que es más patogénica que la anterior. Resulta necesario contar con métodos de tipificación que tengan la resolución suficiente para permitir el seguimiento epidemiológico de los brotes de brucelosis y de los programas de control de la enfermedad. Debido a la gran homogeneidad genética que existe entre las distintas especies del género Brucella, ha sido dificultoso el desarrollo de herramientas moleculares para realizar el análisis epidemiológico de los aislamientos. La publicación del genoma de varias especies de Brucella facilitó el diseño de estas herramientas. El objetivo del presente trabajo fue emplear un esquema de análisis multilocus de VNTR en aislamientos de Argentina obtenidos en nuestro laboratorio. De los 56 aislamientos analizados se obtuvieron 47 perfiles genotípicos diferentes. El empleo de este esquema permitió asignarles a dichos aislamientos la biovariedad correspondiente. A través del análisis goeBURST se pudo relacionar a todos los genotipos entre sí, y además, proponer al genotipo de la biovariedad 2 como fundador.

  8. AISLAMIENTO DE CLONES CON ACTIVIDAD ENDO-b-1,4-GLUCANASA A PARTIR DE UN SEGMENTO DE ADN DE 13KB DE Clostridium sp IBUN22A

    Directory of Open Access Journals (Sweden)

    I. Roncancio-Sánchez

    2006-06-01

    Full Text Available La producción de combustibles, solventes y algunos productos químicos a partir de sustratos celulósicos usando microorganismos ofrece una ventaja frente a los de origen fósil. Un acercamiento prometedor ha sido la implementación de ingeniería genética utilizando genes de enzimas involucradas en la degradación de desechos celulósicos. En la última década se han generado bibliotecas genéticas para proveer enzimas celulolíticas, que hagan el proceso más rentable, lo cual permitiría aprovechar mejor residuos celulósicos disponibles. Este trabajo describe el aislamiento de dos fragmentos de ADN que expresan actividad endo-β-1,4-glucanasa, a partir de un segmento ADN de 13Kb (clon 02080-25 aislado de una biblioteca genómica de la cepa nativa Clostridium sp IBUN22A. El aislamiento de la región codificadora se realizó a través de pruebas de inducción de la actividad, análisis por restricción del segmento y de una sub-biblioteca con la enzima Sau3A I. 325 clones fueron obtenidos, de los cuales 271 tenían inserto. El tamizaje molecular de estos últimos mostró que siete clones presentaron tamaños entre 3500pb y 7000pb y el tamizaje enzimático con carboximetilcelulosa como sustrato permitió el aislamiento de los clones pBSh-37 y pBSh-26 con la actividad endo-β-1,4-glucanasa original, de tamaños de inserto de 627pb y 879pb respectivamente. Este trabajo es el punto de partida para el aislamiento de enzimas de alto potencial biotecnológico.

  9. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  10. Técnica para aislamiento de bacteriófagos específicos para E.coli DH5α a partir de aguas residuales

    Directory of Open Access Journals (Sweden)

    Gabriel Gaviria A.

    2012-04-01

    Full Text Available Objetivo. Establecer una técnica para el aislamiento de bacteriófagos a partir de aguas residuales específicos para E. coli DH5α. Materiales y métodos. Se tomó como base el método 1601 de la Agencia de Protección Ambiental de los Estados Unidos de América y un método de obtención de enterovirus a partir de aguas residuales. En el desarrollo del protocolo se realizaron múltiples pruebas utilizando como control positivo el bacteriófago T4 y los aislamientos de bacteriófagos obtenidos a partir de aguas residuales. Resultados. Se observó la formación de unidades formadoras de placa (UFP, se obtuvó la titulación de los bacteriófagos presentes en cada uno de los cultivos de E.coli DH5α, se determinaron las relaciones que existen entre la cuantificación de la formación de unidades formadoras de placa (UFP del tratamiento control y el tratamiento experimental y las respectivas características de las (UFP en cada uno de los experimentos realizados. Conclusiones. Se logró establecer un protocolo microbiológico para el aislamiento de bacteriófagos específicos para E. coli DH5α.

  11. Diseño de dos metodologías moleculares para la rápida identificación de aislamientos de Staphylococcus aureus resistente a meticilina asociados a la comunidad en Colombia

    Directory of Open Access Journals (Sweden)

    Javier Antonio Escobar

    2012-06-01

    Full Text Available Introducción. Los aislamientos de Staphylococcus aureus resistente a la meticilina asociado a la comunidad (SARM-AC, están aumentando la frecuencia de infecciones en personas sanas de la comunidad y en pacientes hospitalizados. En Colombia y en la región andina estos aislamientos tienen un componente genético relacionado con el clon pandémico USA300. Objetivo. Diseñar y estandarizar dos metodologías para la diferenciación rápida de aislamientos colombianos de S. aureus resistente a la meticilina asociado a la comunidad de los asociados al hospital (SARM-AH. Materiales y métodos. Se estandarizaron dos metodologías moleculares para la identificación de aislamientos de S. aureus resistente a la meticilina asociado a la comunidad. La primera se basa en la digestión diferencial con tres enzimas de restricción de los genes cinasa de carbamato (arcC y cinasa de guanilato (gmk para los tipos de secuencia 5 (ST5 y 8 (ST8, correspondientes a aislamientos de S. aureus resistente a la meticilina asociado al hospital y asociado a la comunidad, respectivamente. La segunda se basa en la amplificación por reacción en cadena de la polimerasa de cinco factores de virulencia que se encuentran de manera diferencial en estos aislamientos. Las dos metodologías fueron validadas en 237 aislamientos clínicos de S. aureus resistente a la meticilina. Resultados. Con la primera metodología se identificaron el 100 % y 93,2 % de los aislamientos de S. aureus resistente a la meticilina asociado a la comunidad y asociado al hospital, respectivamente. Con la segunda metodología se identificaron correctamente los dos tipos de aislamientos. Conclusiones. Estas dos metodologías son una buena alternativa en términos de ahorro en tiempo y dinero comparadas con otras técnicas, como la electroforesis en campo pulsado y la tipificación de secuencias multilocus para la rápida identificación de aislamientos de S. aureus resistente a la meticilina asociado a la

  12. Aislamiento microbiológico de Salmonella spp. y herramientas moleculares para su detección

    Directory of Open Access Journals (Sweden)

    Jose Gonzalez Pedraza

    2014-01-01

    Full Text Available Salmonella spp, es uno de los principales agentes causales de intoxicaciones alimentarías a nivel mundial, coloniza a la mayoría de los animales y el ser humano. No es detectable en muestras que tienen un bajo número de células y los métodos tradicionales para su aislamiento tienen baja especificidad, baja sensibilidad y consumen mucho tiempo. Esta revisión presenta un análisis sobre los métodos para la detección de Salmonella spp. y se profundiza en los estudios moleculares encaminados al diagnóstico de este microorganismo de importancia en salud pública. En los últimos años se han desarrollado diferentes protocolos utilizando métodos moleculares para la detección de Salmonella spp. a partir de muestras clínicas y alimentos. Los costos para la detección molecular de Salmonella spp. son elevados en com- paración con los métodos tradicionales, pero la alta sensibilidad y especificidad que ofrece la PCR, los beneficios al sector salud al lograr un diagnóstico rápido y preciso, la relación costo beneficio que otorga al sector productivo permitiendo liberar productos alimenticios al mercado con mayor rapidez, justifican la implementación de estas técnicas. La revisión de las ventajas y desventajas de los métodos microbiológicos tradicionales y moleculares para detectar Salmonella spp. en diferentes matrices, permite establecer la mejor estrategia a seguir en la detección y diagnóstico de microorganismos de difícil aislamiento. Dada la complejidad de las diferentes metodologías que existen para la detección de Salmonella spp, dichas técnicas serán presentadas en forma independiente.

  13. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Ortiz Rojas Luz Yineth

    2012-03-01

    Full Text Available

    El análisis molecular del cistron, (ue codica para la proteina de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la pre- sencia de 65 nucleotidos adicionales (ue codican para (uince aminoãcidos, en la region amino de la secuencia de la proteina de la cubierta del aislamiento mexicano identicado con el nümero de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento DDDF6F, reportado en 1FF1 en Estados Unidos. El anãlisis logenHtico de 1I5  secuen- cias de la proteína de la cubierta de SCMV reportadas de Asia, África, Brasil y Argentina, entro otros, sugiere diJerentes origenes logeogrãcos de los aislamientos mexicanos. El aislamiento mexicano GU6N6OP5 es filogeneticamente mãs cercano a aislamientos de QCWV de Brasil X de EE.UU., mien- tras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son

    logenHticamente mãs cercanas al aislamiento mexicano EUDF1DN5. Las caracteristicas particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México X Brasil, sugieren un baYo control tosanitario en el intercambio de material vegetal.

  14. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2012-01-01

    Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.

  15. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  16. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  17. CARACTERIZACIÓN DE AISLAMIENTOS DE Colletotrichum lindemuthianum DE ECUADOR Y GUATEMALA PARA IDENTIFICAR GENES DE RESISTENCIA

    Directory of Open Access Journals (Sweden)

    Halima Awale

    2008-01-01

    Full Text Available El objetivo de esta investigación fue determinar la variabilidad patogénica de C. lindemuthianum en zonas productoras de frijol común en Ecuador y Guatemala para identificar las combinaciones de genes de resistencia más efectivas para las condiciones locales. Aislamientos de antracnosis recolectados fueron caracterizados para la identifi cación de las razas presentes en estos países empleando el juego estándar de 12 cultivares diferenciales. De acuerdo a la evaluación, solamente dos razas (5, 9 mostraron estar presentes en los dos países. En Guatemala se registró una mayor diversidad patogénica (mayor número de razas que en Ecuador. Basados en esta información y en otros datos de estudios realizados anteriormente, sugerimos como la combinación genética más efectiva la piramidación de los genes Co-12 y Co-42. Esta combinación conferiría resistencia completa a casi todas las razas de C. lindemuthianum identifi cadas hasta el momento en los dos países.

  18. AISLAMIENTO DE CEPAS NATIVAS DE TRICHODERMA SPP DE SUELOS HORTICOLAS DEL VALLE DE TOLUCA, COMO BIOCONTROL POTENCIAL DE SCLEROTINIA

    Directory of Open Access Journals (Sweden)

    Hilda G. García-Nuñez

    2012-08-01

    Full Text Available Se evaluó la presencia de Trichoderma en siete localidades en la zona sur del Valle de Toluca, Estado de México. Esta es un área con un alto potencial en la producción de hortalizas. El estudio se dirigió al aislamiento de cepas nativas de Trichoderma a partir de muestras de suelo, identificación de factores fisiográficos, así como las propiedades físicas y químicas del suelo que determinan la ocurrencia de Trichoderma. Se evaluó el potencial de las cepas de Trichoderma para el control de Sclerotinia spp., hongo patógeno causante de la pudrición blanda en lechuga. Se aislaron once cepas, el mayor número de ellas asociadas al tipo de suelo se encontró en las localidades de San Francisco Putla y San Francisco Tetetla. El análisis de regresión logística mostró que no hay una relación entre las propiedades del suelo (materia orgánica y pH y la presencia de Trichoderma. La prueba de Tukey (p

  19. Técnicas de aislamiento y concentración de volátiles de aceites vegetales

    Directory of Open Access Journals (Sweden)

    Morales, M. T.

    1992-06-01

    Full Text Available One of the methods for food flavor evaluation is the analysis of volatile components. First step in this kind of analysis Is the isolation and concentration of volatiles. A review is carried out about different techniques applied in foods and especially in vegetable oils. Very different methods have been used, an explication of each one with its different cases are presented. Likewise the applications carried out in vegetable oils during last years are discussed.

    Uno de los métodos de evaluación del flavor de los alimentos consiste en la determinación de sus componentes volátiles. La primera etapa necesaria para realizar este tipo de análisis es el aislamiento y concentración de los mismos. Se ha realizado una revisión bibliográfica sobre las diferentes técnicas utilizadas para este fin en diferentes alimentos y especialmente en aceites vegetales. Los métodos utilizados son muy diversos, se ofrece una explicación de cada uno de ellos considerando las diferentes variantes existentes. Asimismo se detallan las aplicaciones realizadas en aceites vegetales durante los últimos años.

  20. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  1. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

  2. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  3. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  4. Aplicación de las pruebas de PCR convencional simple y múltiple para la identificación de aislamientos de Leptospira spp. en Colombia Application of conventional and multiplex PCR assays for identification of isolates of Leptospira spp. in Colombia

    Directory of Open Access Journals (Sweden)

    Natali Moreno

    2010-12-01

    Full Text Available Debido a las dificultadas asociadas con la identificación serológica de aislamientos de Leptospira ssp, se genera gran interés en la pruebas moleculares por su poder discriminatorio, reproducibilidad y fácil interpretación. Objetivo. Aplicar y validar la prueba de PCR convencional, usando dos pares de iniciadores descritos previamente y dirigidos a los genes lipL32 (PCR simple y secY/flaB (PCR múltiple, con el fin de evaluar su aplicación para identificar especies patógenas y saprófitas de Leptospira spp. Materiales y métodos. Para la estandarización de las pruebas de PCR se usó 22 cepas de referencia internacional y 12 aislamientos colombianos. Se determinó el nivel de detección de cada pareja de iniciadores, su especificidad frente a otros microorganismos causantes de enfermedades endémicas en Colombia y su capacidad de identificar especies dentro del grupo de Leptospira. Resultados. El límite de detección de la PCR simple lipL32 fue una dilución 1:10000 y para la PCR múltiple secY/flaB fue una dilución 1:100 para el gen secY y 1:1000 para flaB. La especificidad de todos los iniciadores fue de 100%. La PCR simple lipL32, mostró amplificado específico para 21/22 cepas de referencia mientras que la PCR multiple secY/flaB lo fue para 18/22 cepas. De los 12 aislamientos colombianos, siete fueron positivos por PCR lipL32 y seis lo fueron por PCR secY/flaB. Conclusiones. Los resultados más consistentes fueron obtenidos con la PCR simple lipL32 tanto en límite de detección, especificidad y utilidad para la identificación de Leptospira spp, por lo que esta prueba es aplicable a la identificación molecular de aislamientos patógenos de Leptospira spp de diversas fuentes.Serological identification of Leptospira ssp isolates is difficult to achieve. Thus, molecular testing may be of great interest thanks to its high discrimination power, reproducibility and easy interpretation. Objective. To implement and validate conventional

  5. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  6. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  7. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  8. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  9. Revisión sistemática de la farmacorresistencia en enterobacterias de aislamientos hospitalarios en Colombia

    Directory of Open Access Journals (Sweden)

    Leidy González

    2014-06-01

    Full Text Available Introducción. La resistencia bacteriana es un problema de salud pública a nivel mundial que compromete seriamente la capacidad de tratar las infecciones. Objetivo. Describir el perfil de resistencia a los antimicrobianos marcadores en enterobacterias identificadas en hospitales colombianos. Materiales y métodos. Se hizo una revisión bibliográfica sistemática de las publicaciones indexadas en Medline, Embase y Lilacs, además de la búsqueda manual de todos los números de revistas colombianas reconocidas en el campo de la infectología y otros afines para identificar referencias no disponibles electrónicamente. Resultados. Se identificaron 43 estudios y reportes de vigilancia epidemiológica con información sobre la resistencia de las enterobacterias en hospitales, principalmente de Bogotá, Cali y Medellín. La tasa de resistencia en Escherchia coli oscila entre 3 y 11 %, 5 y 20 % y 0,2 a 0,8 % para piperacilina-tazobactam, cefalosporinas de tercera generación y carbapenémicos, respectivamente. En aislamientos de Klebsiella pneumoniae, la resistencia oscila entre 21,8 y 48,1 % frente a piperacilina-tazobactam, 20 y 35 % frente a cefalosporinas de amplio espectro y 3 y 8 % frente a carbapenémicos, con variaciones importantes por ciudades, niveles de atención y circunstancias clínicas. Conclusiones. La diseminación de la resistencia bacteriana en enterobacterias aisladas en hospitales colombianos es un problema creciente que requiere medidas prontas para cortar las cadenas de transmisión.

  10. AISLAMIENTO DE ADN GENÓMICO DE Myrciaria dubia (HBK “CAMU CAMU” APROPIADO PARA ANÁLISIS MOLECULARES

    Directory of Open Access Journals (Sweden)

    Juan Castro Gómez

    2012-06-01

    Full Text Available Myrciaria dubia “camu-camu”, una especie nativa de la Amazonía que produce frutos con alto contenido de vitamina C y otras sustancias importantes. Sin embargo, los estudios moleculares de esta planta son escasos, por falta de un protocolo reproducible para purificar sus ácidos nucléicos. El objetivo de este trabajo fue establecer un protocolo para aislar el ADN genómico a partir de hojas de M. dubia, apropiado para análisis moleculares. El ADN se purificó con un protocolo modificado, la calidad y cantidad se estimó por espectrofotometría y electroforesis en gel de agarosa. Adicionalmente, la calidad se evaluó mediante RAPD. El ratio de calidad (A260/A280 promedio del ADN fue 1.9±0.1 y el espectro de absorción UV/Vis presentó un único pico de máxima absorbancia a 260nm. Mediante electroforesis el ADN fue íntegro y sin ARN. También, la síntesis de amplicones RAPD nos sugiere ausencia de inhibidores para polimerasas. La concentración promedio del ADN fue 99±33 ng/ml y el rendimiento promedio fue 237±80 mg ADN/g hoja. En conclusión, se ha establecido un protocolo de aislamiento de ADN genómico a partir de hojas de Myrciaria dubia “camu camu”, caracterizado por permitirnos obtener ADN de alta calidad y cantidad suficiente para análisis moleculares como el RAPD.

  11. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  12. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  13. Comportamiento de la infección experimental por aislamientos colombianos de Giardia duodenalis en el modelo animal del gerbo (Meriones unguiculatus.

    Directory of Open Access Journals (Sweden)

    Adriana Arévalo

    2005-09-01

    Full Text Available Introducción. Se han informado infecciones naturales y experimentales con Giardia sp. en bovinos, equinos, caprinos, caninos, felinos y roedores como ratones, ratas y gerbos; estos últimos son el modelo más adecuado para estudios de la infección por Giardia duodenalis y Giardia muris. Objetivo. Establecer el comportamiento de la infección con aislamientos colombianos de Giardia duodenalis en el modelo animal del gerbo. Materiales y métodos. Se purificaron mediante gradientes de sacarosa y percoll quistes del parásito obtenidos a partir de heces de pacientes sintomáticos infectados. La inoculación a los animales se realizó mediante sonda gástrica con 5x103 quistes. El curso de la infección se estableció mediante recuento diario de quistes y semanal de trofozoítos durante treinta días. Resultados. La eliminación de quistes presentó un patrón intermitente de excreción, con ausencia en la primera y cuarta semanas de infección, y presencia constante durante la segunda y tercera semanas, en número variable con promedio mínimo de 79 y máximo de 17.943 quistes liberados en heces recolectadas en un período de dos horas. Se observó colonización de los trofozoítos en el intestino delgado, en número que osciló entre 15.000 y 6'577.778 trofozoítos por ml. Conclusiones. En gerbos infectados con aislamientos de Giardia duodenalis circulantes en otras regiones geográficas, la resolución natural de la infección oscila entre 86 y 114 días mientras que los gerbos infectados con aislamientos colombianos del parásito la resuelven al día 30. El gerbo constituye un modelo animal adecuado para la infección con aislamientos colombianos de G. duodenalis. La infección experimental por Giardia en gerbo permite obtener quistes y trofozoítos del parásito en cantidades suficientes con la finalidad de ser utilizados como antígenos para la inmunización de animales y para la obtención de anticuerpos que puedan utilizarse para la detecci

  14. Caracterización fenotípica de aislamientos de Acinetobacter baumannii en una institución de salud de alta complejidad de Cali

    Directory of Open Access Journals (Sweden)

    Alfredo Prado

    2014-04-01

    Full Text Available Introducción. La caracterización fenotípica de las bacterias del género Acinetobacter mediante pruebas bioquímicas y microscópicas es posible. Varios estudios han demostrado que los aislamientos provenientes de infecciones asociadas a la atención en salud presentan una elevada resistencia a los antibióticos de primera elección. Objetivo. Describir los patrones de resistencia de los aislamientos de Acinetobacter baumannii obtenidos en una institución de salud, así como sus características fenotípicas y los posibles mecanismos de resistencia. Materiales y métodos. Se realizó un estudio descriptivo de corte transversal con 28 informes de muestras tomadas a pacientes hospitalizados con infección por A. baumannii. Las pruebas de sensibilidad para ceftazidime, cefepime, meropenem, amikacina y ciprofloxacina se realizaron con el sistema automatizado Vitek® y la clasificación de sensible, intermedia y resistente se hizo con base en el protocolo establecido por el Clinical and Laboratory Standards Institute para el año 2007. Resultados. El mayor porcentaje de aislamientos correspondió al sexo masculino (53,6 %, a la sala de infectología (28,5 % y al mes de septiembre (21,4 %; el tipo de muestra más frecuente fue el de secreción endotraqueal (53,6 %. A partir de los patrones de los perfiles de sensibilidad a los antibióticos empleados se obtuvieron 13 filotipos. Conclusión. Acinetobacter baumannii es un agente patógeno resistente a múltiples antimicrobianos, involucrado en brotes de infecciones asociadas a la atención en salud. Los patrones de los perfiles de resistencia permiten inferir que los posibles mecanismos de resistencia presentes en la mayoría de los aislamientos son la producción de betalactamasas de espectro extendido, las enzimas modificadoras del antibiótico y la modificación del sitio diana.

  15. Frecuencia de aislamientos microbiológicos y perfil de resistencia bacteriana en 13 clínicas y hospitales de alta complejidad en Santiago de Cali - Colombia

    OpenAIRE

    Martínez Buitrago, Ernesto; Hernández, Cristhian; Pallares, Cristhian; Pacheco, Robinson; Hurtado, Kelly; Recalde, Mónica

    2014-01-01

    Introducción: La resistencia bacteriana se consolida como una amenaza para los sistemas de salud en el manejo de las enfermedades infecciosas. La vigilancia epidemiológica de la resistencia bacteriana ha demostrado ser una estrategia efectiva para conocer los patrones de susceptibilidad a los antimicrobianos regionales para el desarrollo de medidas de contención y gestión del uso adecuado de antimicrobianos. Objetivo: Describir los aislamientos microbiológicos y perfiles de resistencia a los ...

  16. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  17. SELECCIÓN DE AISLAMIENTOS DE Beauveria bassiana (Bals.) Vuill. Y Metarhizium anisopliae Metsch. Sorokin (ASCOMYCOTA: HYPOCREALES) PATOGÉNICOS A GALLINA CIEGA Phyllophaga polyphylla (Bates) (COLEOPTERA: MELOLONTHIDAE) Y DISTRIBUCIÓN VERTICAL DE ESPORAS EN DIFERENTES TIPOS DE SUELO

    OpenAIRE

    CRUZ COTA, LIZETH RAMONA

    2012-01-01

    Los hongos entomopatógenos son una alternativa promisoria para el control de plagas agrícolas. En este estudio, se obtuvieron diversos aislamientos nativos de estos microorganismos provenientes de larvas de gallina ciega del género Phyllophaga sp., una de la plagas más importantes del cultivo de maíz en el estado de Guanajuato. En total se obtuvieron 16 aislamientos de hongos entomopatógenos, de los cuales ocho pertenecen a Beauveria bassiana (Bals.) Vuill. y el resto a Meta...

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  19. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  20. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  2. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  3. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  4. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  5. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  6. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  7. Caracterización de vidrios para la evaluación del aislamiento acústico a ruido aéreo

    Directory of Open Access Journals (Sweden)

    Alba Fernández, J.

    2012-08-01

    Full Text Available The main contribution of this paper is the formulation of an alternative to experimental determination of loss factor and, consequently, to improve the predictions of airborne sound insulation for any type of monolithic or laminated glass. In addition, a review of the standards related to measurement of mechanical parameters of glass is carried out, with particular interest in laminated glass. Indeed, one of the problems that arise in the current context of building acoustics is to meet the requirements of facades airborne sound insulation of existing Building Technical Code (BTC. It is known that the blind and the hollow part of the facade should be distinguished. The weakest part regarding to airborne sound insulation is the empty one (consisting of glass, woodwork and other elements. Choosing an adequate woodwork makes the glass surface become the limiting factor. The Constructive Elements Catalog (CEC of the BTC, the UNE-EN 12758:2011 standard, as well as some, increasingly, data vendors provide information about airborne sound insulation for monolithic glass, laminated glass and double glazing. In the case of laminated glass, these data are limited only to those with a single intermediate layer, and also nonacoustic. Can therefore be said that there is a gap of knowledge in this regard. To obtain reliable predictions of airborne sound insulation of multilayer partitions, such as laminated glass, mechanical characteristics must be known, being loss factor one of the most important.

    La principal aportación del trabajo es la formulación de una alternativa que facilita la determinación experimental del factor de pérdidas y, en consecuencia, mejorar las predicciones de aislamiento a ruido aéreo para vidrios con una o más capas intermedias sea cual fuere su naturaleza. Además, se realiza una revisión de las normativas relacionadas con los ensayos de los parámetros mecánicos necesarios para la caracterizar los vidrios, centr

  8. Aislamiento de microorganismos productores de biosurfactantes y lipasas a partir de efluentes residuales de camales y suelos contaminados con hidrocarburos

    Directory of Open Access Journals (Sweden)

    Lizzie Karen Becerra Gutiérrez

    2016-01-01

    Full Text Available Los biosurfactantes son moléculas anfipáticas que reducen la tensión en la interfase, incrementando así la solubilidad en agua y disponibilidad de compuestos orgánicos, son producidos por bacterias, hongos, y levaduras. Para el aislamiento de bacterias productoras de biosurfactante y lipasas, se sembró en medios inductores 10% de efluentes residuales procedentes de camales y suelos de grifos contaminados con hidrocarburos de la Provincia de Trujillo - Perú. Los cultivos aislados se sembraron en agar lecitina y agar rodamina para la determinación de productores de lipasas. Los microorganismos seleccionados se sembraron en agar sangre y agar Siegmund y Wagner (SW para la selección preliminar de bacterias biosurfactantes. Posteriormente se determinó a aquellos microorganismos productores de surfactantes mediante Índice de Emulsificación (IE y Medición de la Tensión superficial. Los cultivos positivos a estas pruebas fueron seleccionados e identificados mediante galerías API e identificación molecular por secuenciamiento de ADN. Los cultivos que redujeron en mayor medida la tensión superficial fueron P. aeruginosa y B. amyloliquefaciens, llegando a reducir la tensión superficial a 27,2 ± 0,4 y 31,03 ± 0,4 mN/m respectivamente, mientras que P. stutzeri y Pseudomonas sp. redujeron la tensión superficial a 48,3 y 52,6 ± 0,4 mN/m respectivamente. Se concluye, por tanto, que se obtuvo 49 cultivos productores de lipasas de la provincia de Trujillo, de los cuales se determinó que Pseudomonas stutzeri, Pseudomonas sp, Pseudomonas aeruginosa y Bacillus amyloliquefaciens son productores de biosurfactantes y pueden aplicarse en el área de la biotecnología ambiental para la remoción y biodegradación de contaminantes.

  9. Dinámica poblacional y aislamiento de bacterias ácido lácticas en lactosuero fermentado

    Directory of Open Access Journals (Sweden)

    Valeria Martínez-López

    2016-01-01

    Full Text Available Introducción: El consumo de queso producido con leche cruda puede causar daños a la salud debido a la carga microbiana presente en la leche bronca, que puede incluir microorganismos patógenos. Los cultivos iniciadores endémicos de los quesos artesanales podrían mejorar el sabor de quesos fabricados con leche pasteurizada. El objetivo de este trabajo fue estudiar la dinámica poblacional de bacterias ácido lácticas (BAL del suero fermentado de queso de hebra (SFQH y su aislamiento. Método: El suero de queso fue obtenido del proceso artesanal para la elaboración de queso de hebra usando leche cruda (Tuxtepec, Oaxaca, México. Durante 120 h, muestras de SFQH, que fueron obtenidas en diferentes tiempos, se utilizaron para determinar el pH del medio e inocular cajas con medios selectivos MRS, M17, APT y Elliker. Los aislados obtenidos se caracterizaron morfológica y molecularmente. Resultados: La población de BAL se modificó en función del tiempo de fermentación y del pH (4.05 a 3.4 del suero. Se aislaron 22 cepas catalasa negativas y Gram-positivo. El análisis filogenético (ADNr 16S indicó la presencia de cuatro cepas del género Enterococcus (VD, VH, VL, VB y una de Lactobacillus (VK. La cepa VH predominó sobre el resto de los aislados y junto con la cepa VK permanecieron durante todo el bioproceso. Discusión o Conclusión: El cambio en el pH del SFQH permitió aislar cepas de BAL, que podrían utilizarse como cultivos iniciadores para obtener queso de acuerdo a las especificaciones de la NOM-243-SSA1-2010, sin comprometer su calidad sensorial.

  10. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  11. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  12. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  13. Streptococcus pneumoniae: evolución de los serotipos y los patrones de susceptibilidad antimicrobiana en aislamientos invasores en 11 años de vigilancia en colombia (1994 -2004.

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo

    2006-06-01

    Full Text Available Introducción. Streptococcus pneumoniae es una las principales causas de morbilidad y mortalidad en niños y adultos en el mundo. Objetivo. Realizar un análisis de los datos de la vigilancia por el laboratorio de los aislamientos invasores de S. pneumoniae recuperados entre 1994 y 2004. Materiales y métodos. Se empleó la información de los aislamientos invasores de S. pneumoniae recibidos en el Grupo de Microbiología del Instituto Nacional de Salud durante la vigilancia de meningitis bacteriana aguda e infección respiratoria aguda entre 1994 y 2004. Los aislamientos contaban con datos epidemiológicos, serotipo, patrones de susceptibilidad antimicrobiana y algunos con tipificación molecular. Resultados. Se analizaron los datos de 2.022 aislamientos procedentes de 120 hospitales de diferentes regiones del país, recuperados principalmente de hemocultivos (50,7% y líquido cefalorraquídeo (42%. Los serotipos más importantes fueron el 14, 6B, 23F, 1, 5, 6A, 19F, 18C y 9V, los cuales corresponden al 83,6% en niños menores de 6 años, al 74,0% en el grupo de 6 a 14 años y al 61,4% en mayores de 14 años. El 29,8% de los aislamientos presentó susceptibilidad disminuida a la penicilina (SDP, 44,3% a trimetoprim-sulfametoxazol, 32,4% a tetraciclina, 8,2% a cloranfenicol, 3,8% a eritromicina; todos fueron sensibles a vancomicina y el 13% fue multirresistente. Se tipificaron 602 aislamientos con SDP, de los cuales 27 (4,5% se relacionaron con el clon 1-España23F, 38 (6,3% con el clon 2-España6B, 301 (50% con el 3- España9V y 75 (12,5% con el clon 26-Colombia23F, además, los 138 aislamientos con tipo capsular 5 se relacionaron con el clon 19-Colombia5. Conclusiones. Los resultados proporcionan información básica necesaria para el diseño e implementación de estrategias para la prevención de la enfermedad neumocócica en nuestro país.

  14. Aislamientos invasivos de Haemophilus influenzae en menores de 5 años: distribución de los serotipos y de la sensibilidad antimicrobiana, SIREVA II, Colombia 2002-2013

    Directory of Open Access Journals (Sweden)

    Mabel Karina Rodríguez

    Full Text Available Objetivo: Analizar del 2002 al 2013 los datos de la vigilancia de los serotipos y sensibilidad antimicrobiana de los aislamientos invasivos de Haemophilus influenzae ( H. influenzae en niños menores de 60 meses. Materiales y métodos: Se analizaron los datos demográficos, fuente y enfermedad asociada de los aislamientos invasivos de H. influenzae recibidos entre 2002 y 2013. Todos los aislamientos habían sido confirmados bacteriológicamente, tenían el dato del serotipo, el cual fue determinado por el método de aglutinación en lámina y PCR y los patrones de sensibilidad antimicrobiana por concentración inhibitoria mínima a ampicilina, SXT, cloranfenicol, cefuroxima y ceftriaxona. El análisis se realizó por periodos de 3 años. Resultados: Por enfermedad invasiva el 50,5% eran de pacientes con meningitis, 23,5% de neumonías, 19,5% de sepsis y bacteriemia, 2,0% de otros y 4,5% sin dato. Por procedencia se recibieron de Bogotá y Antioquia 55 aislamientos de cada uno, de Risaralda 24, de Valle 15, de Santander 11 y 40 de 14 departamentos. El serotipo predominante fue el Hib (40,5%, seguido de HiNT (38,0%, Hia (17,5%, Hid (2,0%, Hif (1,5% y Hie (0,5%. Del total de los aislamientos, 12,0% eran resistentes a ampicilina; 16,5% a SXT; 1,0% a cloranfenicol y 0,5% a ceftriaxona. Todos los aislamientos fueron sensibles a cefuroxima y a rifampicina. Conclusiones: La vigilancia por el laboratorio es una vigilancia pasiva voluntaria pero, no obstante el número reducido de aislamientos, permite determinar que Hib continúa circulando en esta población y que hay otros serotipos de H. influenzae que causan enfermedad invasiva. Por tanto es necesario mantener y fortalecer la vigilancia de este patógeno.

  15. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  16. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  17. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  18. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  19. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  20. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  1. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  2. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  3. AISLAMIENTO Y CARACTERIZACIÓN MORFOLÓGICA DE Rosellinia pepo Pat. EN PLANTAS DE MACADAMIA ISOLATION AND MORPHOLOGICAL CHARACTERIZATION OF Rosellinia pepo Pat. IN MACADAMIA PLANTS

    Directory of Open Access Journals (Sweden)

    Carmen Eliana Realpe Ortiz

    2006-12-01

    Full Text Available El hongo Rosellinia pepo Pat., causante de la llaga estrellada, se considera uno de los principales problemas fitosanitarios de la macadamia por ocasionar la muerte de la planta en su etapa productiva. Debido a que no existe una metodología de aislamiento confiable que asegure la recuperación del hongo con un porcentaje mínimo de contaminación y los estudios relacionados con este patógeno son escasos se planteó una investigación con el fin de perfeccionar una metodología de aislamiento y realizar algunas caracterizaciones morfológicas de este patógeno. La nueva metodología permitió obtener aislamientos con un 91,26% de pureza del hongo. La tasa de crecimiento fue de 4,68 mm día-1. Las colonias son de color blanco y apariencia algodonosa en su inicio, pero a medida que envejece el micelio toma un color café o negro y su apariencia se torna quebradiza. La observación de micelio blanco en forma de estrella en el lado interior del medio sintético permite diferenciarlo de otras especies como R. bunodes. Las mediciones microscópicas de los hinchamientos piriformes presentaron en promedio 106,4mm de largo y 75,3mm de ancho. Este trabajo también permitió determinar el nivel de inóculo infectivo.The fungus Rosellinia pepo Pat, the causal agent of star gall, is considered to be a main phytosanitary problem to the Macademia tree by causing the death of the tree while in its productive stage. Because no reliable isolation method exists that assures recovery of the mushroom with a minimum percentage of contamination and studies of this pathogen are scarce. This study was conducted to perfect an isolation methodology and permit some morphological characterizations of this pathogen. The new methodology allowed isolations with 91,26% purity of mushroom to be obtained. The rate of growth was 4,68 mm day-1. The colonies were of white color and cottony appearance in the beginning, but as the micelio aged it assumed a brown or black color and a

  4. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  5. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  6. Aislamiento de especies de enterococos causantes de infecciones y su sensibilidad a los antimicrobianos Isolation of enterococci species causative of infections and sensitivity to antimicrobial drugs

    Directory of Open Access Journals (Sweden)

    C. Toledo

    2004-03-01

    Full Text Available Entre abril de 1999 y julio de 2000 se obtuvieron 144 aislamientos sucesivos de enterococos (uno por paciente a partir de cultivos de una variedad de sitios anatómicos. La distribución de las diferentes especies fue: 119 (82,6% Enterococcus faecalis, 11 (7,6% E. faecium y 14 (9,7% otras especies (5 E. raffinosus, 4 E. avium, 3 E. casseliflavus, 1 E. pseudoavium y 1 E. dispar, las cuales estuvieron asociadas con infecciones clínicas. Los sitios más comunes de aislamiento fueron: tracto urinario 54,9%, cavidad abdominal 12,5%, heridas quirúrgicas 12,5%, abscesos 6,9% y pie diabético 6,2%. Se detectó alto nivel de resistencia a gentamicina, estreptomicina o ambos en 48,6% de los aislamientos. Los aislamientos de E. faecium y E. raffinosus fueron significativamente más resistentes a ampicilina e imipenem que E. faecalis. Ninguna de las cepas exhibió actividad de b-lactamasa. Una cepa de E. faecium (0,7% fue resistente a vancomicina y teicoplanina (fenotipo Van A y dos cepas de E. casseliflavus (1,4% mostraron bajo nivel de resistencia a vancomicina (fenotipo Van C. Debido a estos diversos mecanismos de resistencia antimicrobiana, el tratamiento exitoso y el control de las infecciones enterocócicas con agentes antimicrobianos corrientes se hace cada vez más dificultoso.Beetween April 1, 1999 and June 30, 2000, 144 isolates of enterococci (one per patient from cultures of several anatomic sites were collected . One hundred and nineteen (82.6% E. faecalis, 11 (7.6% E. faecium and 14 (9.7% of other species (5 E. raffinosus, 4 E. avium, 3 E. casseliflavus, 1 E. pseudoavium, and 1 E. dispar were associated with clinical infections. The most common sites of isolation were: the urinary tract 54.9%, abdominal cavity 12.5%, surgical wounds 12.5%, abscesses 6.9% and diabetic foot 6.2%. High-level resistance to gentamicin or streptomycin or both was detected in 48.6% of the isolates. E. faecium and E. raffinosus were significantly more resistant than

  7. Aislamiento y caracterización de microorganismos con actividad lipolítica provenientes de sedimentos del Humedal El Jaboque (Bogotá, Colombia

    Directory of Open Access Journals (Sweden)

    Lilia Carolina Mora Moreno

    2006-07-01

    sedimentos, mediante la utilización de medios de cultivo selectivos (agar tributirina, agar aceite de girasol. Primero se evaluó la concentración del sustrato (aceite de girasol en la cual se encontraba el mayor número de morfotipos aislados, luego se comparó la eficiencia de los dos medios de cultivo de acuerdo a la cantidad de morfotipos aislados. Se evaluaron tres concentraciones diferentes de sustrato. Se aisló un total de 18 cepas pertenecientes a los géneros Bacillus, Pseudomonas, Acinetobacter, Streptomyces, Penicillium, Alternaria. Los medios evaluados constituyen alternativas sencillas de aislamiento de microorganismos con actividad lipolítica en sedimentos.

  8. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  9. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  10. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  11. Resistencia a los antimicrobianos de aislamientos de Escherichia coli obtenidos de cerdos de la República Argentina Antimicrobial resistance of Escherichia coli isolated from pigs in Argentina

    Directory of Open Access Journals (Sweden)

    F.A. Moredo

    2007-12-01

    Full Text Available Se estudiaron 69 aislamientos de Escherichia coli provenientes de cerdos clínicamente sanos o con signología clínica no compatible con diarreas causadas por este microorganismo, con el objetivo de determinar el patrón de resistencia a los antimicrobianos frecuentemente utilizados en medicina veterinaria y humana. Se empleó el método de difusión en agar. Se observaron elevados porcentajes de resistencia frente a ampicilina, estreptomicina y tetraciclina, antimicrobianos utilizados en las explotaciones porcinas, y frente a trimetoprima-sulfametoxazol y cloranfenicol, compuestos que han dejado de utilizarse hace varios años. El 62% de los aislamientos mostró multirresistencia. Los resultados obtenidos en el presente trabajo corroboran la hipótesis de que la distribución fenotípica de la resistencia y, posiblemente, la de sus determinantes genéticos están directamente influenciadas por los tratamientos antimicrobianos utilizados.Sixty-nine Escherichia coli isolates from healthy pigs or with clinical signs non-compatible with diarrhea caused by this microorganism, were studied. The purpose was to determine the resistance profile against antimicrobials frequently used in veterinary and human medicine. The agar diffusion method was used. High resistance percentages against antimicrobials used in swine farms such as ampicillin, streptomycin and tetracycline were observed, as well as against trimetoprim-sulfametoxazole and chloramphenicol, compounds that were stopped being used several years ago. Sixty two percent of isolates showed multidrug-resistance. The results obtained in this work corroborate the hypothesis that the phenotypic distribution of resistance and possibly that of its genetic determinants, are directly influenced by the antimicrobial treatments used.

  12. Aislamiento de Cándida sp. en cultivos de catéteres intravasculares en un hospital de alta complejidad.: 2008 y 2009, Lima-Perú.

    Directory of Open Access Journals (Sweden)

    Katherine Sedano-Rojas

    2011-10-01

    Full Text Available Objetivo: Determinar la frecuencia de aislamiento de Cándida en cultivos de CIV en un hospital de alta complejidad entre los años 2008 y 2009 y describir las características clínicas de los pacientes. Material y métodos: Estudio descriptivo retrospectivo. Se revisaron 783 registros de cultivos de catéter intravascular (CIV de la sección microbiología del Laboratorio Central del Hospital Nacional Cayetano Heredia, desde enero de 2008 a diciembre de 2009, así como la historia clínica de los pacientes con cultivo positivo a Cándida sp. Para la estadística se utilizó la hoja de cálculo de Microsoft Excel 2007, así como el programa estadístico Epi Info versión 3.4.3. Resultados: Se encontraron 467 (59,6% cultivos positivos; 425 (91% fueron bacterias. S. epidermidis se aisló en 215/467 (46%, siendo predominante en la Unidad de Cuidados Intensivos de Recién Nacidos (UCI-RN. Cándida se aisló en 42 (9%; 43,8% Cándida sp, 25% C. albicans y 31,3% C. krusei. Conclusiones: La frecuencia de aislamiento de cándida en cultivos de CIV fue 9%, siendo la especie más frecuente C. krusei. El 18,7% fallecieron. (Rev Med Hered 2011;22:176-181..

  13. Frecuencia de aislamientos microbiológicos y perfil de resistencia bacteriana en 13 clínicas y hospitales de alta complejidad en Santiago de Cali - Colombia

    Directory of Open Access Journals (Sweden)

    Ernesto Martínez Buitrago

    Full Text Available Introducción: La resistencia bacteriana se consolida como una amenaza para los sistemas de salud en el manejo de las enfermedades infecciosas. La vigilancia epidemiológica de la resistencia bacteriana ha demostrado ser una estrategia efectiva para conocer los patrones de susceptibilidad a los antimicrobianos regionales para el desarrollo de medidas de contención y gestión del uso adecuado de antimicrobianos. Objetivo: Describir los aislamientos microbiológicos y perfiles de resistencia a los antimicrobianos de las principales bacterias gram-negativas y gram-positivas en clínicas y hospitales de alta complejidad de Santiago de Cali, Colombia. Metodología: Estudio descriptivo enmarcado en la estrategia de vigilancia epidemiológica de la resistencia bacteriana desarrollado entre el año 2010 al 2012 en 13 instituciones de alta complejidad. Se recolectaron archivos mensualmente en formato WHONET, se realizaron pruebas de calidad de datos. El análisis fue estratificado por tipos de localización hospitalaria, además de análisis de tendencia a través de los 3 años de seguimiento. Resultados: El 65% de los aislamientos son bacterias de la familia enterobacteriaceae y el 11,4% corresponden a Staphylococcus spp., Escherichia coli presenta hasta un 17% de resistencia a cefalosporinas de 3.ª generación mientras que Klebsiella pneumoniae ha incrementado su perfil de resistencia a carbapenémicos hasta un 2,7% en las UCI; Pseudomonas aeruginosa presenta un perfil MDR de hasta el 21% en UCI y salas de hospitalización general. Conclusiones: Existen altas prevalencias de resistencia a los antimicrobianos en la región; se requiere fortalecer estrategias de vigilancia, prevención y control de la resistencia bacteriana en ambientes hospitalarios y de la comunidad.

  14. Aislamiento y caracterización de Escherichia coliO157:H7 a partir de carne molida de bovino en Lima-Perú

    Directory of Open Access Journals (Sweden)

    Carmen R. Méndez

    2013-12-01

    Full Text Available El objetivo del estudio fue aislar y caracterizar E. coliO157:H7 a partir de carne molida fresca de bovino obtenida en diferentes mercados de abastos. Se analizaron 195 muestras; para el aislamiento y enumeración de E. coli se utilizó la técnica del Numero Más probable mediante tubos múltiples; para el aislamiento y caracterización de E. coliO157:H7 el enriquecimiento selectivo y el análisis bioquímico, las colonias características se confirmaron mediante pruebas serológicas. Para determinar la presencia de shigatoxina (stx1, stx2 e intimina (eae A se empleó la técnica de PCR multiplex en tiempo real y para enterohemolisina la prueba de hemólisis. El 87.18% de la muestras fue positivo para E. coliy el 77.95% presentó un recuento igual o superior a 50 NMP/g. Se obtuvieron 3 (1.54% cepas de E. coliO157:H7, una stx1 +/ stx2 +/ eaeA – y enterohemolisina -, una stx1 +/ stx2 -/ eaeA + y enterohemolisina – y la otra stx1 -/ stx2 -/ eaeA – y enterohemolisina +. También se obtuvieron 4 cepas (2.05% de E. coli O157 no H7, ninguna presentó factores de virulencia. El estudio reveló el riesgo potencial de que E. coliO157:H7 afecte a la población de Lima.

  15. Caracterización genotipica de aislamientos de Escherichia coli obtenidos de cerdos con diarrea posdestete y enfermedad de los edemas Genotypic characterization of toxigenic Escherichia coli isolated from pigs with postweaning diarrhea (PWD and edema disease (ED

    Directory of Open Access Journals (Sweden)

    Fabiana A Moredo

    2012-06-01

    Full Text Available El objetivo del trabajo fue caracterizar mediante PCR 47 aislamientos de Escheríchia coli recuperados de 32 cerdos con diagnóstico clínico de diarrea posdestete (DPD y de 3 cerdos con enfermedad de los edemas (ED. Sobre 44 aislamientos provenientes de cerdos con DPD, 42 (95,5 % fueron caracterizados como E. coli enterotoxigénicos (ETEC y 2 (4,5 % como E. coli productores de toxina Shiga (STEC. Catorce aislamientos de ETEC (33,3 % fueron positivos para los genes estl/estlI/fedA. El genotipo más complejo fue eltA/estll/east1/faeG/aidA. Los aislamientos provenientes de cerdos con ED se clasificaron como STEC porcinos y fueron portadores de stxJaidA. Once aislamientos (25 % fueron portadores del gen que codifica la expresión de la adhesina AIDA-I. Sin embargo, en ningún aislamiento se detectaron los genes que codifican la expresión de las adhesinas F5, F6, F41, de intimina y de "Paa". La prevención de la DPD y de la ED podría realizarse mediante el desarrollo de vacunas que generen anticuerpos contra las adhesinas de las cepas de E. coli prevalentes en la Argentina.The purpose of this work was to characterize 47 Escherichia coli strains isolated from 32 pigs diagnosed with postweaning diarrhea and tree pigs with edema disease by PCR. Forty two (95.5 % of the strains isolated from diarrheic pigs were characterized as enterotoxigenic E. coli (ETEC and 2 (4.5 % as Shiga toxin-producing E. coli (STEC. Fourteen (33.3 % ETEC strains were positive for est/estll/fedA genes. The most complex genotype was eltA/estl/faeG/aidA. Strains isolated from pigs with ED were classified as porcine STEC and were stxjaidA carriers. Eleven (25 % strains carried the gene encoding adhesln protein AIDA-I. However, genes coding for F5, F6, F41, intimin and Paa were not detected. The development of vaccines generating antibodies against prevalent E. coli adhesins in Argentina could be useful for the prevention of PWD and ED.

  16. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  17. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  18. Control biológico de la pudrición basal del tallo en Crisantemo (Dendranthema grandiflorum ocasionada por Sclerotinia sclerotiorum con algunos aislamientos de Trichoderma sp. y Gliocladium sp.

    Directory of Open Access Journals (Sweden)

    Valencia Jenny

    1999-12-01

    Full Text Available

    EI hongo Sclerotinia sclerotiorum ocasiona perdidas apreciables en diversos cultivos de flores y hortalizas. La investigación consistió en evaluar la capacidad antagónica de algunos aislamientos de Trichoderma sp. Y Gliocladium sp. Sobre Sclerotinia sclerotiorum, tanto in vitro, como en plantas de crisantemo. Los mejores antagonistas del patógeno in vitro fueron los aislamientos G-8B y G-98 de Gliocladium sp. y los aislamientos T-2IB y T-34B de Trichoderma sp. Los dos aislamientos de Gliocladium sp. Formaron un halo de inhibición alrededor de la colonia del patógeno, mientras que los aislamientos de Trichoderma sp. Produjeron esporulación abundante sobre las colonias del patógeno. Los mejores tratamientos en el control de la enfermedad en plantas de crisantemo fueron los aislamientos T-2IB y T-34B de Trichoderma sp. y el aislamiento G-8B de Gliocladium sp., con un menor índice y una menor severidad de la enfermedad. La metodología de evaluación in vitro utilizada en la investigación fue confiable, ya que los resultados encontrados en el laboratorio fueron bastante similares a los obtenidos en el ensayo de invernadero. Además, los aislamientos de Trichoderma y de Gliocladium utilizados ocasionaron un estimulo apreciable en el crecimiento de las plantas y un adelanto en la floración.

  19. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  20. El medio de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y otros hongos patógenos Modified Kaminski agar for the isolation of dermatophytes and some other pathogenic fungi

    Directory of Open Access Journals (Sweden)

    Fernando Montoya

    1989-01-01

    Full Text Available

    Se evaluaron 3 medios de cultivo de composición diferente (Mycobiotic agar, agar de Kaminski y agar de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y el reaislamiento de S. schenckii y hongos negros, agentes de cromomicosis. Con el objeto de puntualizar diferencias entre dichos medios se determinaron, para cada uno, la frecuencia de aislamiento de los hongos, sus características morfológicas y su tiempo de crecimiento, así como la rapidez e Intensidad de la contaminación bacteriana y/o micótica. Se estudiaron 150 muestras de pacientes con sospecha clínica de dermatofitosis y se hicieron 30 reaislamientos de S. schenckiiy 10 de agentes de cromomicosis. Se demostró la utilidad del agar de Kaminski modificado, tanto para el aislamiento como para el reaislamiento de los agentes señalados, a pesar de su mayor índice de contaminación microbiana. Fue, además, útil para el aislamiento de levaduras del género Candida.

    Three culture media with different composition (Mycobiotic agar, Kaminski agarand Kaminski agar modified with nystatin were evaluated for isolation of dermatophytes and reisolation of S. schenckiiand dematiaceous fungi. One hundred and fifty specimens of cases suspicious of dermatophytosis, as well as 30 strains of S. schenckiiand 10 of chromoblatomycosis agents were studied. The modified Kaminski agar was efficient for the isolation and reisolation of the tested agents, in spite of Its greater contamination rate; It was equally adequate for isolation of Candida species.

  1. Aislamiento y caracterización de Escherichia coli O157 en productos cárnicos bovinos y medias reses en la provincia de Tucumán

    Directory of Open Access Journals (Sweden)

    María A Jure

    2015-06-01

    Full Text Available Escherichia coli O157 es un patógeno emergente asociado a diarrea, colitis hemorrágica y síndrome urémico hemolítico. Los productos cárnicos constituyen una importante fuente de contaminación con este microorganismo. Los objetivos de este estudio fueron establecer la frecuencia de detección de E. coli O157 en productos cárnicos y media res en la provincia de Tucumán, caracterizar los factores de virulencia de los aislamientos obtenidos, establecer la relación clonal entre cepas regionales mediante electroforesis de campo pulsado y comparar con lo consignado en la base de datos nacional. Desde 2004 hasta 2013 se analizaron 169 muestras de carne picada, 35 embutidos y 216 esponjados de media res. Se identificaron 13 aislamientos de E. coli O157; 6 de ellos fueron O157:H7 productores de toxina Shiga y se caracterizaron como stx2c(vh-a/eae/ehxA (n = 5 y stx2/eae/ehxA (n = 1; los 7 aislamientos de E. coli O157 no toxigénicos fueron O157:NT(n = 4,O157:NM (n = 1,O157:ND (n = 1 y O157:H16 (n = 1. Los patrones de PFGE fueron diferentes entre sí y de los registrados en la base de datos nacional. Se concluye que existe gran diversidad genética en los aislamientos de E. coli O157 circulantes en nuestra región.

  2. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  3. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  4. Características de aislamientos de Rhizoctonia solani Huhn y su importancia como patógenos de Stylosanthes guianensis (Aubl. Sw.

    Directory of Open Access Journals (Sweden)

    Lenne Jilliam M.

    1986-06-01

    Full Text Available Se encontró considerable variación en el crecimiento, color, zonificación, esclerocios, textura del micelio y en la virulencia de siete aislamientos de R. solani. Como seis aislamientos fueron multinucleados y uno binucleado, se demostró que es indispensable determinar ésta característica en ensayos con R. solani. Los aislamientos se ubicaron en los grupos de anastomosis AG -1, AG-2, AG-4; pero en los ensayos con electroforesis de isoenzirnas los modelos de bandas para los a islamientos probadores de los AG y los probados en éste estudio fueron diferentes, lo que llevó a cuestionar la importancia de los AG. Los ecotípos de Centrosema spp y P. phaseoloides fueron más afectados que los de S. guianensis, D. ovalifolium y S. capitata. La reacción al daño de R. solani fue diferencial en los ecotipos CIAT 1283 (tardío y 184 (común y tuvo mucha relación con la edad; en general, la enfermedad se incrementó con la edad en el eco tipo tardío y disminuyó con ésta o fue independiente en el ecotipo común; el ecotipo más fectado fue el tardío; las pérdidas de forraje no fueron considerables, pero el efecto en la digestibilidad fue notorio; la capacidad de rebrote fue buena en 184. Se observó un estímulo en el crecimiento de las plantas de S.guianensis y D. ovalifolium.Considerable variation was found in the growth, color, zonation, sclerotia, mycelial texture and virulence of seven isolates of R. solani. Six multinuclease and one binuclease isolates were determined, demonstrating that it is indispensable to determine this characteristic in trials with this pathogen. The isolates were placed in three anastomosis group AG -1, AG -2 and AG -4; but with electrophoresis of isoenzymes it was found that the band models were different for the known rest AG iso lates and those isolates proven in this study which questions the importance of anastomosis qroups. Ecotypes of Centrosema spp. and P. phaseoloides were more affected than those of S

  5. Análisis de Vías Libres para mantenimiento partiendo de las Configuraciones de Aislamiento. // Analysis of free access for maintenance starting from isolation configurations.

    Directory of Open Access Journals (Sweden)

    A. Torres Valle

    2005-01-01

    Full Text Available La seguridad durante las intervenciones de mantenimiento se trata de manera limitada y en general independiente de lossistemas de gestión del mantenimiento. Esta variable está afectada por múltiples factores de tipo técnico o humano, muchasveces subjetivos y difíciles de cuantificar, lo que limita el diseño de planes preventivos. Sin embargo, algunos factoresconstituyen puntos comunes: las configuraciones de aislamiento durante las vías libres y los errores humanos asociados a suviolación. Esta característica permitió desarrollar el análisis de tales situaciones a través de la metodología de árboles defallos que vincula coherentemente fallos de equipos y errores humanos. La metodología ha sido automatizada dentro delcódigo MOSEG Win Ver 1.0 y la misma puede abarcar desde el análisis de una situación particular de vía libre hasta el deuna estrategia completa de mantenimiento desde el punto de vista de la seguridad del personal mantenedor.Palabras Claves: Vía libre, configuración de aislamiento, árbol de fallos, errores humanos, estrategias demantenimiento._____________________________________________________________________________Abstract.Safety during maintenance operations have been studied in a limited way and generally isolated from the maintenancemanagement system. Safety is affected by multiple both technical and human factors, of a subjective nature and difficult toquantify, this limits its value for designing preventive plans. However, some factors constitute common points namely:isolating configurations during the work protection code and human errors associated with its violation. Such situationswere able to be analyzed by following this feature through the fault tree methodology that matches equipment failures andhuman errors coherently. The methodology is automated as part of MOSEG Win Ver 1.0 code. It ranges from the analysisof particular situations up to complete maintenance strategy from the point of view of

  6. Experiencias en el diagnóstico del aislamiento de los generadores de potencia; Experiences in the diagnosis of the insulation of power generators

    Directory of Open Access Journals (Sweden)

    Santiago Alfredo Dorrbercker Drake

    2014-04-01

    Full Text Available El aislamiento de los generadores eléctricos de gran potencia (Turbogeneradores e Hidrogeneradores es el componente que más influye en su confiabilidad operacional, por lo cual es vital conocer su estado para aplicar las acciones correctivas requeridas. Para alcanzar tal fin, existen múltiples ensayos, controles y criterios relativos a inspecciones sensoriales, muchos de ellos concebidos hace más de medio siglo y que aún subsisten en variantes modernizadas, mientras que otros, más modernos, han sido generalizados y perfeccionados constantemente. Las técnicas y métodos para la aplicación de los ensayos, controles e inspecciones también han evolucionado. En este trabajo se resumen algunas experiencias en la aplicación de los ensayos más actuales relativos a la evaluación de la contaminación, la detección de deficiencias en la protección anticorona, la presencia de descargas parciales internas y la evaluación del envejecimiento del aislamiento, que son aplicados en las áreas de influencia de los autores.  The insulation of power generators (Turbogenerator and Hydrogenerators is the component that influences more in its operational reliability, thus is vital to know its state to apply corrective actions. In order to reach such aim, multiple tests, sensorial controls and criteria regarding inspection have been developed, many of conceived them for more than half century and that still subsists in modernized variants, whereas others, more modern, have been generalized and perfected constantly. The techniques and methods for the application of the tests, controls and inspection also have evolved. This work reviews some experiences in the application of recent improvements to insulation tests about the evaluation of contamination, detection problems in the anticorona slot protection, internal partial discharges and the evaluation of the aging, that are applied in the areas of influence of the authors.

  7. Experiencias en el diagnostico del aislamiento de los generadores de potencia Experiences in the diagnosis of the insulation of power generators

    Directory of Open Access Journals (Sweden)

    Julio Alberto Molé Menéndez

    2012-02-01

    Full Text Available El aislamiento de los generadores eléctricos de gran potencia (Turbogeneradores e Hidrogeneradores es el componente que más influye en su confiabilidad operacional, por lo cual es vital conocer su estado para aplicar las acciones correctivas requeridas. Para alcanzar tal fin, existen múltiples ensayos, controles y criterios relativos a inspecciones sensoriales, muchos de ellos concebidos hace más de medio siglo y que aún subsisten en variantes modernizadas, mientras que otros, más modernos, han sido generalizados y perfeccionados constantemente. Las técnicas y métodos para la aplicación de los ensayos, controles e inspecciones también han evolucionado. En este trabajo se resumen algunas experiencias en la aplicación de los ensayos más actuales relativos a la evaluación de la contaminación, la detección de deficiencias en la protección anticorona, la presencia de descargas parciales internas y la evaluación del envejecimiento del aislamiento, que son aplicados en las áreas de influencia de los autores.The insulation of power generators (Turbogenerator and Hydrogenerators is the component that influences more in its operational reliability, thus is vital to know its state to apply corrective actions. In order to reach such aim, multiple tests, sensorial controls and criteria regarding inspection have been developed, many of conceived them for more than half century and that still subsists in modernized variants, whereas others, more modern, have been generalized and perfected constantly. The techniques and methods for the application of the tests, controls and inspection also have evolved. This work reviews some experiences in the application of recent improvements to insulation tests about the evaluation of contamination, detection problems in the anticorona slot protection, internal partial discharges and the evaluation of the aging, that are applied in the areas of influence of the authors.

  8. Estandarización del método de centrifugación en placa para el aislamiento del virus dengue Rapid centrifugation assay standarization for dengue virus isolation

    Directory of Open Access Journals (Sweden)

    Miryam Palomino

    2010-03-01

    Full Text Available Se estandarizó el método de centrifugación en placa, para el aislamiento del virus dengue a partir de muestras de suero humano. Se utilizó la línea celular C6/36-HT determinándose los valores óptimos de velocidad de centrifugación, volumen de inóculo, dilución de suero y tiempo de incubación. Posteriormente, 22 muestras de suero con aislamiento viral positivo y cepas referenciales de los cuatro serotipos del virus dengue, fueron procesadas simultáneamente por el método de centrifugación en placa y el método convencional de cultivo en tubo, los aislamientos fueron tipificados mediante inmunofluorescencia indirecta empleando anticuerpos monoclonales. Se optimizó el método de centrifugación en placa inoculando 200 μL de diluciσn de suero 1/20, centrifugaciσn a 1600 rpm/30 min, presentando sensibilidad de 95,5% a cinco dνas postinoculación. Se concluye que el método de centrifugación en placa mejora el porcentaje de aislamiento, con significativa reducción en tiempo de aislamiento del virus dengue.The plate centrifugation assay was standardized for dengue virus isolation from serum samples. C6/36-HT cells were used determining the optimal values for centrifugation spin speed, inoculum, sera dilution, and incubation time. Then, 22 positive serum samples with viral isolation and viral strains of the four reference dengue virus serotypes were tested simultaneously by the standardized plate centrifugation method and the conventional tube culture. The isolations were typified by indirect immunofluorescent test using monoclonal antibodies. The plate centrifugation method was optimized to 200 μL of inoculum, dilution of sera 1/20, centrifugation speed at 1600 rpm/30 min, and sensitivity of 95,5% after 5 days post-inoculation. We concluded that the plate centrifugation method increased dengue virus isolation, with a significant reduction of the time of isolation for dengue virus.

  9. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  10. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  11. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  12. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  13. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  14. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  15. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  16. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  17. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  18. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  19. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  20. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  1. Caracterización de aislamientos de Vibrio cholerae no-O1, no-O139 asociados a cuadros de diarrea Characterization of Vibrio cholerae non-O1 and non-O139 isolates associated with diarrhea

    Directory of Open Access Journals (Sweden)

    S. González Fraga

    2009-03-01

    Full Text Available La infección por Vibrio cholerae, el agente causal del cólera, se trasmite al hombre por ingestión de agua y alimentos contaminados. Aunque son los serogrupos O1 y O139 los que habitualmente se asocian al cólera epidémico, los aislamientos de otros serogrupos también son causales de gastroenteritis e infecciones extra-intestinales. Durante el período 2003-2005, se investigó la presencia de V. cholerae en la materia fecal de niños con diarrea atendidos en el Hospital del Niño Jesús, Tucumán. Se recuperaron 34 aislamientos de V. cholerae no-O1, no-O139. Se determinaron sus perfiles de virulencia por PCR, la sensibilidad a los antimicrobianos y la diversidad genética por electroforesis en campo pulsado. Se obtuvieron ocho perfiles de virulencia, aunque ningún aislamiento fue positivo para la toxina colérica ni para la toxina termoestable. Cuatro aislamientos fueron positivos para el sistema de secreción de tipo tres. El 17,6% de los aislamientos fueron resistentes o de sensibilidad intermedia a ampicilina y el 5,9% fueron resistentes a trimetoprima-sulfametoxazol. Los aislamientos resultaron muy diversos: se hallaron 27 patrones distintos en 29 aislamientos tipificables por electroforesis en campo pulsado. A pesar de su baja incidencia, V. cholerae continúa siendo un agente causal de diarrea en niños, los que se ven afectados por una amplia variedad de cepas circulantes.Vibrio cholerae, etiologic agent of cholera, is transmitted to humans by ingestion of contaminated food or water. Even though serogroups O1 and O139 are the ones usually associated to epidemic cholera, isolates from other serogroups also cause gastroenteritis and extraintestinal infections. During the period 2003-2005, presence of V. cholerae in stools was investigated in children with diarrhea that seaked assistance at the Niño Jesús Hospital in Tucumán. Thirty four isolates of V. cholerae non-O1, non-O139 were recovered. We characterized the isolates studying

  2. The insulation condition diagnosis of high tension generator stators; Diagnostico del estado de aislamiento de estatores de generadores de alta tension

    Energy Technology Data Exchange (ETDEWEB)

    Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1990-12-31

    The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.

  3. The insulation condition diagnosis of high tension generator stators; Diagnostico del estado de aislamiento de estatores de generadores de alta tension

    Energy Technology Data Exchange (ETDEWEB)

    Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1989-12-31

    The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.

  4. Aislamiento e identificación bioquímica de microorganismos bacterianos a partir de infecciones de piel en caninos

    Directory of Open Access Journals (Sweden)

    Iovana Castellanos L.

    2011-12-01

    Full Text Available Las dermatitis bacterianas o piodermas en caninos son ocasionadas por microorganismos patógenos, de los cuales el Staphylococcus intermedius es el más frecuente. Los tratamientos empíricos de este grupo de enfermedades permiten la proliferación de cepas resistentes de importancia en salud pública como es el caso del S. aureus. De igual forma, el riesgo de zoonosis reversa a partir de mascotas portadoras de cepas resistentes crea un serio problema de salud pública que requiere vigilancia epidemiológica. El objetivo de la investigación fue aislar e identificar bioquímicamente los microorganismos presentes en infecciones de piel en caninos; para esto se obtuvieron las muestras de caninos con problemas dermatológicos, y se identificaron los microorganismos bacterianos involucrados utilizando el kit de identificación rápida BBL Crystal para grampositivos. Los resultados obtenidos demostraron que el 80% de los aislamientos correspondieron a S. intermedius. Sin embargo, es necesario realizar estudios moleculares para relacionar la severidad de las lesiones dermatológicas con la identificación de los estafilococos presentes en el pioderma, y así establecer medidas de control, tratamiento y profilaxis.

  5. Dos paradojas del multiculturalismo colombiano: la espacialización de la diferencia indígena y su aislamiento político

    Directory of Open Access Journals (Sweden)

    Diana Bocarejo

    2011-01-01

    Full Text Available La práctica del multiculturalismo en Colombia se ejerce en el contexto de complejas disputas y reclamos provenientes de diferentes actores sociales, beneficiarios o no de derechos diferenciales. En este artículo se estudian dos paradojas de los arreglos políticos del multiculturalismo en Colombia, relacionadas con la forma como se espacializa la diferencia indígena, y con ellas, se examinan sus implicaciones políticas. La primera paradoja es la forma como se juzga quién es o no un sujeto indígena legal, utilizando como una de las características predominantes el que un indígena viva en "su" resguardo rural. La segunda paradoja es el aislamiento político que se ha configurado entre indígenas y campesinos. De esta forma, se pretende demostrar la relevancia de estudiar no solo las políticas culturales, sino también la cultura política que posibilita y construye el multiculturalismo.

  6. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  7. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  9. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  13. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  14. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  15. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  16. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  17. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  18. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  19. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  20. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  1. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  2. Detección y expresión de superantígenos y de resistencia antimicrobiana en aislamientos obtenidos de mujeres portadoras de Staphylococcus aureus que cuidan y alimentan niños.

    Science.gov (United States)

    Guaca-González, Yina Marcela; Flórez-Restrepo, Gladys Fernanda; Moncayo-Ortíz, José Ignacio; Santacruz-Ibarra, Jorge; Álvarez-Aldana, Adalucy

    2018-03-15

    Introducción. Staphylococcus aureus coloniza mucosas y piel, y causa graves infecciones en el hombre y los animales. Es importante establecer el estatus de portadoras de cepas enterotoxigénicas de este microorganismo en manipuladoras de alimentos, con el fin de prevenir intoxicaciones alimentarias.Objetivo. Establecer las correlaciones entre los genes de enterotoxinas clásicas, el gen tsst-1, la producción de toxinas en cultivo y la resistencia antimicrobiana en aislamientos de S. aureus provenientes de manipuladoras de alimentos que cuidan niños en sus comunidades.Materiales y métodos. Se cultivaron muestras de las fosas nasales y las yemas de los dedos de las manos, y se identificó S. aureus empleando las pruebas de rutina y métodos automatizados. La extracción de ADN se hizo mediante el método de bromuro de cetil-trimetil-amonio (Cetyl-Trimethyl-Ammonium Bromide, CTAB) modificado. Para la detección de superantígenos se emplearon pruebas de reacción en cadena de la polimerasa (PCR) simple y múltiple, y para la de toxinas, estuches comerciales.Resultados. Se encontró que el 22,0 % de los aislamientos correspondía a portadoras de S. aureus: 17,0 % en los aislamientos de fosas nasales; 5,0 % en los de las manos y 6,7 % simultáneamente en los dos sitios. La prevalencia de superantígenos fue de 73,7 %. El genotipo más frecuente fue el seatsst-1, con 10,0 %. La resistencia a un solo antibiótico fue de 74,7 % y, a cuatro antibióticos, de 3,2 %; de los aislamientos, el 93,7 % correspondía a cepas productoras de betalactamasas. La detección de genes clásicos y de tsst-1 mediante PCR fue de 48,4 % y la de toxinas en el sobrenadante, de 42,1 %,con una correlación de 95,7 %. Las mayores correlaciones se establecieron entre las toxinas TSST-1 (22/22) y SEA (17/18). La correlación del gen tsst-1 con la proteína y la resistencia fue de 100 %. Todos los aislamientos con el genotipo sea-tsst-1 t fueron resistentes y productores de las toxinas

  3. In vitro antimicrobial susceptibility in clinical isolates of Enterococcus species Susceptibilidad antimicrobiana in vitro en aislamientos clínicos de Enterococcus species

    Directory of Open Access Journals (Sweden)

    Ernesto Calderón-Jaimes

    2003-04-01

    Full Text Available OBJECTIVE: To describe the antimicrobial activity of several antimicrobial agents against 97 clinical significant isolates of Enterococcus spp. MATHERIAL AND METHODS: During a 2-year prospective study at Instituto Nacional de Pediatria (National Institute of Pediatrics in Mexico City. Ninety seven strains of Enterococcus spp. (60 E. faecalis and 37 E. faecium were tested against 11 antibiotics. Susceptibility tests were performed with agar, according to the standards of the sNational Committee for Clinical Laboratory Standards (NCCLS. Isolates were screened for high-level resistance (HLR to beta-lactams, aminoglycosides, glycopeptides and other antibiotics, as well as for vancomycin-phenotypes. Differences between proportions were evaluated with chi2 of Fisher exact fest. RESULTS: Overall resistance rates to the antibiotics tested were: 17/97 (17.5% to penicillin, ampicillin, amoxicillin-clavulanate and imipenem. There was neither HLR nor beta-lactamase production; 74/97 (48.4% were resistant to erythromycin; 60% to ciprofloxacin; 31/97 (32% to gentamicin, and 55/97 (56.7% to streptomycin. Seven strains were vancomycin-resistant enterococci (VRE, all of them identified as E. faecium; 5/7 with Van A and 2/7 with Van B phenotypes. All the isolates were susceptible to linezolid. The difference in susceptibility among species was significant. CONCLUSIONS: Mutidrug-resistant enterococci is a real problem and continuous surveillance is necessary. The microbiology laboratory is the first line of defense against the spread of multiantibiotic-resistan enterococci in the hospital environment . All the strains recovered should be tested for susceptibility to ampicillin, streptomycin, gentamicin and glycopeptides.OBJECTIVO: Describir la actividad antimicrobiana de varios antibióticos, contra 97 cepas de Enterococcus spp., consideradas como aislamientos clínicamente significativos. MATERIAL Y MÉTODOS: En un estudio prospectivo de dos años, (enero de 1998

  4. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  5. Análisis de la diversidad genética de 21 aislamientos del hongo Moniliophthora roreri basado en marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Boris Gutarra Castillo

    2013-12-01

    Full Text Available Objetivos: Estudiar la diversidad genética de 21 aislamientos del hongo que afecta al cultivo del cacao, Moniliophthora roreri, en tres zonas cacaoteras del Perú (Tocache, Mariscal Cáceres y Leoncio Prado. Métodos: Se utilizó 14 iniciadores RAPD (random amplified polymorphic DNA polimórficos y una pareja de oligonucleótidos, los que fueron empleados bajo condiciones de amplificación estandarizadas. Con los datos obtenidos se construyó un dendograma utilizando el coeficiente de Jaccard y el algoritmo UPGMA (Unweighted Pair-Group Method using Arithmetic Average. La estructura genética fue estimada en función del análisis molecular de variancia (AMOVA y la diversidad mediante los índices de Shannon y Nei. Resultados: Fueron conseguidas 59 bandas RAPD con un 73% de polimorfismo. El dendograma obtenido a un índice de similitud de 0,70, claramente dividió los individuos en tres grupos. El análisis de la diversidad genética mostró altos valores en las zonas estudiadas de acuerdo con el índice de Shannon (0,3936 y de Nei (0,2622, con mayor riqueza en Leoncio Prado. Estas zonas presentan alta variabilidad, y según el AMOVA realizado: 88% entre accesiones por zona y solo 12% entre zonas. Conclusiones: Existe más de un grupo genético de Moniliophthora roreri en la Amazonía del Perú. Estos grupos, provenientes del Ecuador, pudieron haber ingresado por el intercambio de semillas y/o de forma natural por medio de los ríos en común y estarían originando nuevos grupos genéticos locales.

  6. DETERMINACIÓN DE Escherichia coli 0157 A PARTIR DE PRODUCTOS CÁRNICOS Y LÁCTEOS ARTESANALES EMPLEANDO DOS SISTEMAS DE AISLAMIENTO

    Directory of Open Access Journals (Sweden)

    Franco U. Lina

    2001-06-01

    Full Text Available Con el objeto de determinar la presencia de E.coli 0157 en alimentos, se analizaron 300 muestras de productos cárnicos y lácteos artesanales. Para su aislamiento e identificación se utilizaron dos técnicas; una tradicional donde después de seis horas de incubación de la muestra en agua peptonada al 1% suplementada con novobiocina (20 mg!L se inocularon placas con agar Mac Conkey Sorbitol. Por medio de esta técnica se identificó Esclzericlzia coli 0157 a partir de una sola muestra (0.33% de las 300 analizadas correspondiente a un derivado cárnico (hamburguesa; también se identificó E.coli en un 1.6%. Simultáneamente se realizó una técnica rápida con Agar Fluorocult, para E.coli 0157: H7, y de las trescientas muestras aisladas se identificaron microorganismos como Esclzericlzia coli 0157 (0.33%, E. coli (25%, Slzigella sonnei (10% , E. aerogenes (9%, P. mirabilis (4% . De las dos técnicas ensayadas estas presentaron el mismo porcentaje de recuperación de Esclzericlzia coli 0157.El método rápido, utilizando Agar Fluorocult, para E. coli O157: H7 permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en 48 horas. En contraste el método tradicional utilizando agar Mac Conkey Sorbitol permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en cinco días. Los métodos y técnicas utilizadas permiten que este estudio pueda reproducirse fácilmente con resultados puntuales.

  7. Evaluación molecular y fenotípica de la sensibilidad al fungicida fenamidone en aislamientos de Peronospora sparsa

    Directory of Open Access Journals (Sweden)

    Argel Luz Edith

    2007-06-01

    Full Text Available

    El Mildeo velloso es uno de los mayores limitantes del cultivo de la rosa en Colombia. Esta enfermedad es causada por el Oomycete holobiótrofo Peronospora sparsa que fue detectado en la década de 1970 en la Sabana de Bogotá. En los últimos años su efecto negativo sobre la floricultura aumentó conduciendo a los cultivadores al empleo excesivo de fungicidas con acción sistémica, muchos de los cuales no cuentan con estudios de líneas base de sensibilidad ni con el diseño de estrategias anti-resistencia apropiadas. A fin de determinar el grado de sensibilidad de diez aislamientos de P. sparsa al fungicida fenamidone, representante del grupo de resistencia cruzada QoI, se realizaron pruebas de sensibilidad in vitro y evaluaciones moleculares. Los resultados muestran que este patógeno presenta un alto grado de sensibilidad a dicha molécula (EC50 promedio: 0,51 mg· L-1 y que no hay evidencia de la presencia de las mutaciones puntuales G143A y F129L asociadas con fenotipos resistentes a QoI. Este estudio aporta las bases para el desarrollo de una metodología de detección molecular de individuos con resistencia a fungicidas QoI que puede ser utilizada para monitorear las poblaciones del patógeno en nuestro medio.

  8. Aislamiento de distintos serotipos de Haemophilus influenzae en muestras profundas de pacientes pediátricos Isolation of Haemophilus influenzae serotypes from sterile sites in sick children

    Directory of Open Access Journals (Sweden)

    B.M. Gatti

    2004-03-01

    Full Text Available Haemophilus influenzae (Hi es responsable de diversas enfermedades humanas como sepsis, meningitis, celulitis y osteoartritis. En este trabajo se investigó la recuperación de distintos serotipos de Hi en muestras profundas de pacientes pediátricos. Se estudiaron 179 aislamientos de 146 niños durante el periodo 1996-2002 en el Laboratorio de Microbiología del Hospital de Niños Superiora Sor María Ludovica, Argentina. La distribución de los serotipos fue la siguiente: 1 a, 112 b, 1 c,1 d, 4 e, 3 f y 24 no tipificables. A partir del establecimiento de la estrategia de vacunación universal anti Hi b en 1998 se observa una disminución notable del serotipo b y un aumento relativo de otros y no tipificables.Haemophilus influenzae (Hi is the causative agent of several human diseases such as sepsis, meningitis, celulitis, and osteoarthritis. We investigated the isolation of Hi serotypes from sterile sites in sick children. One hundred and seventy nine strains from 146 patients were studied, period 1996-2002, at the Microbiology Laboratory, Hospital de Niños Superiora Sor María Ludovica, Argentina. The serotype distribution was:1 a, 112 b,1 c,1 d, 4 e, 3 f y 24 no typable. Since the beginning of universal Hi b vaccination in 1998, we have observed the fast decrease of serotype b and a relative increase of other serotypes.

  9. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  10. Energy saving by means of air conditioning equipment replacement and the household application of thermal insulation; Ahorro de energia electrica por reemplazo de equipos de aire acondicionado y aplicacion de aislamiento termico en viviendas

    Energy Technology Data Exchange (ETDEWEB)

    Peralta Solorio, Jose Luis [Fideicomiso para el Ahorro de la Energia (Mexico)

    2005-07-15

    An extension study of the Financing Program for Energy Saving looked for the evaluation of the electric energy saving potential obtained by the replacement of air conditioning equipment and the application of thermal insulation in 30 houses of two Mexican cities with warmth climate. In a joint effort with Comision Federal de Electricidad the consumption files of the users were analyzed and field measurements of electric demand and of refrigeration were made. As a following step the change of the refrigeration necessities derived from the application of thermal insulation were evaluated as well as the energy efficiency improvement obtained by the substitution of the air conditioning equipment and the favorable results obtained by the implementation of both measures - thermal insulation and change of air conditioning equipment in a joint form. This way, as a conclusion, the optimum sequence of application of these measures is revealed. [Spanish] Un estudio extension del Programa de Financiamiento para el Ahorro de Energia Electrica busco evaluar el potencial de ahorro de energia electrica alcanzado por el reemplazo de equipos de aire acondicionado y la aplicacion de aislamiento termico en 30 viviendas de dos ciudades mexicanas con clima calido. En un esfuerzo conjunto con la Comision Federal de Electricidad se analizaron los historiales de consumo de los usuarios y se efectuaron las mediciones de campo de demanda electrica y de refrigeracion. Como paso siguiente se valoro el cambio en las necesidades de refrigeracion derivado de la aplicacion de aislamiento termico al igual que la mejora en eficiencia energetica obtenida por la sustitucion de aire acondicionado y se identificaron los resultados favorecedores arrojados por la implementacion de ambas medidas -aislamiento termico y cambio de equipo de aire acondicionado- en forma conjunta. De esta manera, como conclusion, se devela la mas optima secuencia de aplicacion de estas medidas.

  11. Correlación entre Actividades de Interacción Social Registradas con Nuevas Tecnologías y el grado de Aislamiento Social en los Adultos Mayores

    OpenAIRE

    Martínez Rebollar, A.; Campos Francisco, W.

    2015-01-01

    El Aislamiento Social es un problema que se acentúa en la etapa de la vejez, poniendo en riesgo la integridad física y mental de los adultos mayores. Para mitigar este problema, se han desarrollado trabajos computacionales que fomentan la socialización a través de actividades de interacción social basadas en la comunicación y movilidad del adulto mayor. Sin embargo, son escasos los trabajos que proveen evidencia estadística acerca del impacto de las actividades de interacción social con el gr...

  12. Aislamiento, identificación y daños asociados al síndrome de la muerte súbita en el cultivo de soja en Argentina

    OpenAIRE

    Scandiani, María Mercedes; Carmona, Marcelo Aníbal; Luque, Alicia Graciela; Matos, Kedma da Silva; Lenzi, Lisandro; Formento, Ángela Norma; Martinez, Cristina Valeria; Ferri, Mónica Raquel; Lo Piccolo, Melina; Tartabini, Mirta; Alvarez, Diego; Sautua, Francisco

    2012-01-01

    Los objetivos de este trabajo fueron aislar e identificar los agentes causales del síndrome de la muerte súbita (SMS) en muestras provenientes de diferentes localidades de Argentina, y cuantificar la incidencia de la enfermedad y los daños causados a campo en el rendimiento. Se analizaron 215 raíces provenientes de plantas con síntoma foliares típicos de SMS para el aislamiento e identificación de los agentes causales. Para realizar las pruebas de patogenicidad se efectuaron dos bioensayos en...

  13. Desarrollo de un proceso a escala de laboratorio para el aislamiento, conservación y producción de cepas nativas de Monascus spp. a partir de la biodiversidad fúngica ecuatoriana

    OpenAIRE

    Ayala Pastaz, Klever Bayardo

    2017-01-01

    Desarrollar un proceso a escala de laboratorio para la conservación y producción de cepas nativas de Monascus purpureus, mediante bioprocesos que permita el máximo aprovechamiento del recurso natural fúngico y el manejo sostenible de la biodiversidad. Se evidencia un limitado conocimiento en el manejo y aprovechamiento sustentable de la especie Monascus spp. nativo ecuatoriano, tanto en su proceso de aislamiento, conservación y producción; así como del ciclo de vida en el medio natural y m...

  14. Resistencia a carbapenemes en aislamientos de Pseudomonas aeruginosa: un ejemplo de interacción entre distintos mecanismos Carbapenem resistance in Pseudomonas aeruginosa isolates: an example of interaction between different mechanisms

    Directory of Open Access Journals (Sweden)

    Gisela Santella

    2011-12-01

    Full Text Available OBJETIVO: Identificar la proteína de membrana externa ausente en los aislamientos resistentes y determinar tanto las causas de su ausencia en la membrana, como la presencia de otros mecanismos de resistencia a carbapenemes en aislamientos clínicos de Pseudomonas aeruginosa. MÉTODOS: Se estudió un brote de 20 aislamientos de P. aeruginosa previamente caracterizados como productores de la metalobetalactamasa IMP-13. Estos aislamientos presentaron igual expresión de la enzima IMP-13, pero solo cinco de ellos fueron resistentes a carbapenemes. En esos cinco aislamientos resistentes se confirmó la ausencia de una proteína de membrana externa. Se secuenciaron oprD y ampC; se identificaron las proteínas de membrana externa por desorción/ionización láser asistida por matriz/espectometría de masa tiempo de vuelo (MALDI-TOF; se determinó el nivel de expresión de oprD, de AmpC y de los sistemas de eflujo tipo Mex, por reacción en cadena de polimerasa en tiempo real, y por último, se determinó la contribución del déficit de oprD a la resistencia a carbapenemes. RESULTADOS: La proteína de la membrana externa ausente en el grupo R (resistentes a ambos carbapenemes fue identificada como OprD-TS, pero no se observaron variaciones en su expresión. El gen oprD presentó mutaciones en los cinco aislamientos resistentes. Se observó la misma producción de la enzima tipo AmpC PDC-5 y del sistema de eflujo Mex AB-OprM entre los aislamientos sensibles y resistentes a carbapenemes. Se analizó cómo la presencia conjunta de IMP-13 y el déficit de oprD contribuyen al aumento de la resistencia. CONCLUSIONES: Distintos mecanismos contribuyen a la resistencia de aislamientos productores de IMP-13 a carbapenemes. La posibilidad de no detectar estos aislamientos productores de IMP-13 representa un riesgo latente de selección de mutantes con mecanismos de resistencia que se suman para aumentar la resistencia a carbapenemes.OBJECTIVE: To identify the

  15. Nuevo dispositivo para el aislamiento de la fracción estromal vascular a partir de lipoaspirados humanos: método de obtención y análisis de calidad celular

    OpenAIRE

    S. Dos-Anjos; J. Mercader; A.J. Katz.; R. Llull

    2013-01-01

    El tejido adiposo obtenido mediante liposucción es una fuente idónea para aislar células con potencial terapéutico, las denominadas células de la fracción estromal vascular (FEV), que incluyen células madre mesenquimales. Estas células se han convertido en una de las principales herramientas de terapia celular autóloga para diversas aplicaciones médicas, y en los últimos años se han ido desarrollando diversas tecnologías para su aislamiento y uso clínico. En este trabajo presentamos un nuevo ...

  16. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DE Phytophthora infestans (Mont de Bary EN SOLANÁCEAS CULTIVADAS EN COLOMBIA GENETIC VARIABILITY OF ISOLATES OF Phytophthora infestans (Mont. de Bary IN SOLANACEOUS CROPS FROM COLOMBIA

    Directory of Open Access Journals (Sweden)

    Natalia Raigosa Gómez

    2009-06-01

    Full Text Available Se estudio el nivel de variabilidad genética de una población de 35 aislamientos de Phytophthora infestans obtenidos en diferentes hospedantes y regiones geográficas de Colombia, mediante las técnicas de haplotipos mitocondriales y RAPD. Los resultados encontrados sugieren la existencia en el país de los haplotipos mitocondriales Ia en los aislamientos que afectan tomate de árbol (Solanum betaceum y IIa en cultivos de papa; dichos haplotipos están asociados a los linajes genéticos EC-3 y EC-1, respectivamente. Sin embargo, tres aislamientos obtenidos en tomate de mesa (S. lycopersicum, pimentón (Capsicum sp. y pepino de agua (S. muricatum requieren de un análisis posterior, debido a la falta de correlación entre los perfiles de restricción generados con los cuatro pares de cebadores utilizados en esta prueba y los haplotipos mitocondriales mencionados en la literatura. De otra parte, mediante cuatro cebadores RAPD, fue posible encontrar variabilidad al interior de los dos linajes genéticos, siendo interesante el hecho que los aislamientos obtenidos en tomate de árbol (EC-3 fueron divididos en dos grupos, relacionados con una distancia genética de 0,17. Estos hallazgos indican que es importante contemplar las fuentes de variación asexual en el análisis de la estructura poblacional de este oomycete y por tanto en el diseño de las estrategias de control de las enfermedades que causa P. infestans en cultivos de solanáceas de importancia económica.The level of genetic variability of 35 isolates of Phytophthora infestans obtained from different hosts and geographical regions of Colombia was studied through mitochondrial haplotypes and RAPD techniques. Results suggested the existence of mitochondrial haplotypes Ia affecting tree tomato (Solanum betaceum and IIa in potato, which are associated with genetic lineages EC-3 and EC-1, respectively. However, three isolates obtained from tomato (S. lycopersicum, capsicum (Capsicum sp. and

  17. Genotipificación y evaluación de la dinámica de infección de un aislamiento colombiano de Leptospira santarosai en el modelo experimental en hámster

    Directory of Open Access Journals (Sweden)

    Piedad Agudelo-Flórez

    2014-09-01

    Conclusión. Se identificó la presencia de la especie L. santarosai con capacidad patógena comparable con la cepa Fiocruz L1-130 de L. interrogans, de reconocida virulencia y tropismo pulmonar, en cuanto a los aspectos histopatológicos de tropismo a pulmón y riñón. Nunca antes se había evaluado en un modelo experimental un aislamiento de origen local bajo estos criterios biológicos.

  18. Utilización del medio Mrs-s en el aislamiento de bacterias lácticas mesofilas en leche de cabra Utilización del medio Mrs-s en el aislamiento de bacterias lacticas mesofilas en leche de cabra

    Directory of Open Access Journals (Sweden)

    Fortes F. Celia L. de Luces

    1990-12-01

    Full Text Available Con el fin de evaluar el MRS-S (Sorbato al 0.10% en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml, N-L (bacterias aromáticas, reducción de la leche tornasolada a 40 y 21oC y crecimiento a 45 y 10oC.Las cepas seleccionadas se sometieron a caracterización fisiológica y Bioquímica. El medio MRS-S mostró ser efectivo con un porcentaje de inhibición de la flora indeseable del 86.56%, y adecuado por el aislamiento de Lactococcus. De acuerdo con los perfiles taxonómicos se consiguió aislar de un total de 156 colonias dos Lactococcus lactis subsp. lactis y un Lactococcus lactis biovar diacetilactis.With the objective of evaluating the MRS-S (0.10% of sorbate in the isolation of lactic bacteria samples of raw goat milk were cultivated in MRS-S and PCA in deep and incubated in aerobic conditions for 48 hours al 32oC. Gram positive coccus, negative catalase which grew in MRS-S were isolated and preliminarly characterized through the growing process in agar MRS-S, MRS-T (O.20ltg/ml tetracycline, N-L (aromatic bacteria, litmus milk reduction at 40 and 210C and growing at 45 and 10oC. Selected strains were subject to the physiological and biochemical characterization. MRS-S media showed to be effective with an 86.56% of inhibition for indesirable bacteria and adequated for Lactococcus isolation. Related to taxonomic profiles from 156 colonies were isolated two lactococcus lactis subsp. lactis and one Lactococcus luctis biovar diacetilactis.

  19. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  20. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  1. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  2. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  3. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  4. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  5. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  6. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  7. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  8. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  9. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  10. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  11. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  12. Tn7::In2-8 dispersion in multidrug resistant isolates of Acinetobacter baumannii from Chile Dispersión de Tn7::In2-8 en aislamientos multirresistentes de Acinetobacter baumannii de Chile

    Directory of Open Access Journals (Sweden)

    M. S. Ramírez

    2010-06-01

    Full Text Available Acinetobacter baumannii is considered an important pathogen in our hospital environment having a well-known capacity to acquire different mechanisms of antibiotic resistance. Previous studies in our laboratory had exposed the high dispersion of class 2 integrons in this species. In the present study, we analyzed 7 multiresistant intI2 positive A. baumannii isolates, 6 of which were found to harbour the Tn7::In2-8 element. Our results demonstrate the unusually high distribution of Tn7::In2-8 among different A. baumannii clones from Chile, suggesting a particular behavior of these elements at geographical level.Acinetobacter baumannii, patógeno de importancia clínica en el ámbito hospitalario, es reconocido como un microorganismo que posee la capacidad de evolucionar rápidamente hacia la multirresistencia. Estudios previos efectuados en nuestro laboratorio han demostrado la alta dispersión de los integrones de clase 2 en aislamientos de esta especie. En el presente trabajo se analizaron 7 aislamientos de Acinetobacter baumannii multirresistentes portadores de la integrasa de clase 2, 6 de los cuales portaban el inusual arreglo Tn7::In2-8. Nuestros resultados muestran una elevada frecuencia de dispersión del elemento Tn7::In2-8 en diferentes clones circulantes en Chile, lo que sugiere un comportamiento geográfico particular.

  13. Nuevo dispositivo para el aislamiento de la fracción estromal vascular a partir de lipoaspirados humanos: método de obtención y análisis de calidad celular

    Directory of Open Access Journals (Sweden)

    S. Dos-Anjos

    2013-12-01

    Full Text Available El tejido adiposo obtenido mediante liposucción es una fuente idónea para aislar células con potencial terapéutico, las denominadas células de la fracción estromal vascular (FEV, que incluyen células madre mesenquimales. Estas células se han convertido en una de las principales herramientas de terapia celular autóloga para diversas aplicaciones médicas, y en los últimos años se han ido desarrollando diversas tecnologías para su aislamiento y uso clínico. En este trabajo presentamos un nuevo método rápido, sencillo y eficiente para el aislamiento de células de la FEV mediante un dispositivo médico cerrado que permite recoger y procesar lipoaspirados humanos en el mismo procedimiento quirúrgico de manera coste-efectiva. Además describimos los métodos llevados a cabo para cuantificar la calidad, seguridad y eficacia del inóculo celular obtenido.

  14. Modelo de estado para el estudio de las descargas parciales en el aislamiento principal de las máquinas eléctricas rotatorias de gran potencia; Big Rotating Machines State Model for Partial Discharges Studies in Main Insulation

    Directory of Open Access Journals (Sweden)

    Santiago A Dorrbercker Drake

    2011-02-01

    Full Text Available Se presenta un modelo de estado que caracteriza la tensión de ignición de las descargas parciales (DP enel aislamiento principal de las máquinas eléctricas rotatorias de gran potencia (MERGP.  Los objetivos delmodelamiento se dirigieron en dos vertientes:  la primera a conocer el comportamiento del menor nivel detensión que produce DP y la segunda destinada al comportamiento del tamaño de las cavidades, en lasque puede aparecer DP, atendiendo al nivel instantáneo de la tensión de corriente alterna (CA aplicada alas mismas. El presente trabajo se propone, proveer de una herramienta capaz de modelar el comportamientode algunos parámetros característicos de las DP en el aislamiento principal de las MERGP, cuando elaislamiento principal es sometido a diferentes condiciones de trabajo.  This paper describes a state model for PD inception voltage in main insulation of big rotating machines(BRM.  Intends of the present paper were:  to show the behaviour of PD inception voltage under differentfactors; and to know the relationships between the size of cavities and the instantaneous value of ACapplied voltage to the insulation. The objective of this paper is offer a computational tool able to model theperformance of some PD characteristic parameters when main insulation is under operation conditions.

  15. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  16. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  17. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  18. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  19. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  20. Factores de riesgo asociados al aislamiento de Escherichia coli o Klebsiella pneumoniae productoras de betalactamasas de espectro extendido en un hospital de cuarto nivel en Colombia

    Directory of Open Access Journals (Sweden)

    Adriana Jiménez

    2014-04-01

    Full Text Available Introducción. Las betalactamasas de espectro extendido (BLEE son un fenómeno de resistencia emergente de particular incidencia en América Latina. En Colombia existe poca información sobre los factores de riesgo asociados con su adquisición. Objetivo. Determinar los factores de riesgo que están asociados a la infección o colonización por Escherichia coli o Klebsiella pneumoniae productoras de BLEE en pacientes mayores de 18 años. Materiales y métodos. Se llevó a cabo un estudio de casos y controles con relación 1:1 en pacientes con aislamientos de E. coli o K. pneumoniae productoras de BLEE en cualquier tipo de muestra durante el periodo de enero de 2009 a noviembre de 2011 en el Hospital Universitario de San José. Resultados. Se estudiaron 110 casos y 110 controles; 62,7 % correspondió a E. coli y 37,3 %, a K. pneumoniae. Como factores de riesgo independiente en el análisis multivariado se encontraron la insuficiencia renal crónica (OR=2,99; IC95%, 1,10-8,11; p=0,031, la cirugía urológica (OR=4,78; IC95%, 1,35-16,87; p=0,015, el antecedente de uso de antibióticos en los tres meses anteriores (OR=2,24; IC95%, 1,09-4,60; p=0,028, el origen hospitalario de la infección (OR=2,92; IC95%, 1,39-6,13; p=0,004 y la hospitalización previa (OR=1,59; IC95%, 1,03-2,46; p=0,036. Conclusión. Anticiparse al patrón de resistencia del microorganismo que infecta a un paciente con base en los factores de riesgo asociados permitiría la elección de un tratamiento antibiótico empírico apropiado, con el fin de lograr la disminución de la morbimortalidad de los pacientes.

  1. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  2. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  3. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  4. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  5. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  7. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  8. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  9. Endocarditis por Brucella canis: primer caso documentado en un paciente adulto en Argentina Brucella canis endocarditis: first documented case in Argentina

    Directory of Open Access Journals (Sweden)

    Valeria Manias

    2013-03-01

    Full Text Available Se describe el primer caso documentado de endocarditis por Brucella canis en Argentina. El paciente fue un varón adulto que consultó por edemas en miembros inferiores, registros febriles aislados de 2 meses de evolución y dolor precordial opresivo que irradiaba a brazo izquierdo. Negaba contacto con animales de cría o consumo de productos sin pasteurización. Estudios cardiológicos constataron endocarditis infecciosa. Se resuelve cirugía de recambio valvular ante fracaso terapéutico empírico con cefalotina, ampicilina y gentamicina. Los hemocultivos fueron positivos (4 de 4 muestras con bacilos gram negativos. Se realizó la identificación con técnica API 20 NE (bioMérieux, el método automatizado Phoenix (BD y las pruebas bioquímicas convencionales, sin concluir género ni especie. Se derivó la cepa al departamento de Bacteriología Especial INEI-ANLIS "Dr. Carlos G. Malbrán" donde se identificó al aislamiento como Brucella canis. Se rotó el esquema terapéutico a doxiciclina, rifampicina y trimetoprima-sulfametoxazol con buena evolución. La importancia del caso radica en la posible falla del tratamiento antimicrobiano empírico administrado para endocarditis, ya que B. canis no responde a los antimicrobianos convencionales para esta patología.We herein present the case of an adult male patient who consulted for lower extremity edema, a 2- month history of fever and oppressive chest pain radiating to the left arm. He referred neither contact with breeding animals nor consumption of unpasteurized dairy products. A diagnosis of endocarditis was confirmed by cardiac studies. Since the empirical treatment with cephalotin, ampicillin and gentamicin failed, the patient underwent aortic valve replacement. A total of four blood cultures were positive with a gram-negative rod. Bacterial identification was performed using the API 20 NE technique (bioMerieux, the Phoenix automated method (BD and conventional biochemical tests which were

  10. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  11. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  12. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  13. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  14. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  15. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  16. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  17. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  18. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  19. Estrategia de PCR múltiple para la caracterización molecular simultánea de Staphylococcus aureus y enterotoxinas estafilocócicas en aislamientos de brotes de origen alimentario

    Directory of Open Access Journals (Sweden)

    Aníbal A. Brizzio

    2013-03-01

    Full Text Available Introducción. La intoxicación alimentaria estafilocócica es la más frecuente de las intoxicaciones alimentarias. La acción de las enterotoxinas de Staphylococcus aureus en la luz intestinal provoca una importante pérdida de agua que origina vómitos y diarrea. Objetivo. Presentar una estrategia rápida, fiable y de bajo costo, basada en una reacción en cadena de la polimerasa (PCR múltiple para, simultáneamente, identificar S. aureus y detectar genes de las cinco enterotoxinas clásicas de S. aureus (sea, seb, sec, sed, see en cepas de Staphylococcus spp. aisladas de alimentos. Materiales y métodos. Se trabajó con aislamientos recuperados de 12 brotes de intoxicación alimentaria estafilocócica ocurridos en la provincia de Santa Fe, Argentina. El aislamiento y la caracterización fenotípica se llevaron a cabo mediante procedimientos estándar. La evaluación genotípica se hizo por una PCR múltiple, utilizando simultáneamente cebadores para los genes nuc, sea-see y 16S rRNA. Resultados. En las cepas analizadas se detectó 58 % de portadoras de genes toxigénicos. Las toxinas sea y seb se encontraron en igual porcentaje (29 %, mientras que las sec, sed y see se encontraron en menor e idéntica proporción (14 %. No encontramos más de un tipo diferente de enterotoxinas de S. aureus en los aislamientos analizados. Conclusiones. La estrategia de PCR múltiple diseñada en este trabajo permitió identificar cepas de S. aureus y confirmar, al mismo tiempo, su enterotoxigenicidad. En estos momentos, nuestros esfuerzos están dirigidos a detectar los genes que codifican enterotoxinas distintas de las clásicas, a fin de conocer su incidencia en las intoxicaciones alimentarias estafilocócicas e investigar su relevancia en la salud pública de nuestro país.   doi: http://dx.doi.org/10.7705/biomedica.v33i1.816

  20. Tipificación capsular mediante PCR de aislamientos de Haemophilus influenzae no tipificables por aglutinación PCR-based capsular typing of Haemophilus influenzae isolates non-typeable by agglutination

    Directory of Open Access Journals (Sweden)

    G. Weltman

    2005-12-01

    Full Text Available Haemophilus influenzae es reconocido como un agente patógeno responsable de infecciones localizadas y sistémicas. Se han descrito 6 tipos de polisacáridos capsulares antigénicamente distintos (a, b, c, d, e, y f que se pueden identificar por aglutinación en lámina con antisueros específicos. También existen cepas no capsuladas (NC fenotípicamente no tipificables (NT. La introducción de la vacuna conjugada produjo una marcada disminución de las enfermedades invasivas causadas por H. influenzae tipo b. En este contexto, la tipificación capsular mediante PCR es el método más apropiado para distinguir las cepas no capsuladas de las mutantes b deficientes en cápsula (b- y detectar la presencia de cepas pertenecientes a otros serotipos que no puedan ser tipificables por aglutinación. Se determinó el genotipo capsular a 38 aislamientos de Haemophilus influenzae no tipificables por aglutinación, derivados al servicio de Bacteriología Clínica del INEI-ANLIS "Dr. Carlos G. Malbrán" en el período 2002-2004. El 78,9% de los aislamientos provenían de hemocultivos y la mayor parte de ellos estaban asociados a foco respiratorio. El 100% de los aislamientos fueron identificados como H. influenzae no capsulados mediante la técnica de PCR.Haemophilus influenzae is recognized as a pathogenic agent responsible of localized and systemic infections. Six antigenically different capsular polysaccharide types have been described (a, b, c, d, e, and f which can be identified by slide agglutination with specific antisera. Besides there are non capsulated strains that cannot be typed by slide agglutination. The introduction of the conjugated vaccine produced an important reduction of invasive diseases caused by H. influenzae type b. Capsular typing by PCR is the most appropriated method for distinguishing non capsulated strains from capsule deficient type b mutants (b- and for detecting strains of other serotypes that cannot be detected by slide

  1. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  2. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  3. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  4. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  5. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  6. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  7. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  8. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  9. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  10. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  11. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  12. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  13. Aislamiento de una cepa de campo de Babesia bigemina (Piroplasma: Babesiidae y establecimiento del cultivo in vitro para la producción de antígenos

    Directory of Open Access Journals (Sweden)

    Roger I Rodríguez-Vivas

    2007-03-01

    Full Text Available La babesiosis bovina ocasionada por Babesia bigemina produce grandes pérdidas a la economía pecuaria Mexicana. Debido a las variaciones antigénicas que presenta B. bigemina es necesario contar con antígenos locales para la realización de estudios epidemiológicos y de inmunización. Se recolectaron 30 garrapatas Boophilus microplus de un bovino adulto clínicamente enfermo de babesiosis (B. bigemina en Yucatán, México. En laboratorio se produjeron larvas, ninfas y una cepa congelada. El aislamiento de la cepa se realizó con éxito y se necesitó 30 días en el cultivo in vitro para obtener un PEI del 1.5 %. La cepa fue congelada en nitrógeno líquido y reactivada en el cultivo celular. La concentración del medio que permitió el mayor PEI (14 %, pIsolation of a field strain of Babesia bigemina (Piroplasma: Babesiidae and establishment of in vitro culture for antigen production. Bovine babesiosis, caused by Babesia bigemina, is a barrier for livestock development; it results in high economic loss to Mexican livestock. Control requires adequate antigens for diagnosis and vaccination programs. However, because of antigenic variation among Babesia strains, it is necessary to use antigens prepared from local strains. The purpose of the present study was to isolate a local field strain and to establish the in vitro culture of B. bigemina by the evaluation of the constituent’s concentration of culture media. Thirty engorged female Boophilus microplus were collected from cattle suffering clinical babesiosis (B. bigemina in Yucatan state, Mexico. These ticks were sent to the laboratory for detection of Babesia sp. vermicules. Eggs were kept at 83-85 % humidity and 27 ºC until hatching. Larvae were transferred to an esplenectomized calf (B-1. The resulting nymphs were transferred to an esplenectomized calf (B-2. Twelve days later, B. bigemina (local strain was detected in calf B-2 and its infected blood was frozen in liquid nitrogen to

  14. Aislamiento y caracterización de cepas nativas de Lactobacillus spp. para su uso como probióticos en la industria láctea

    Directory of Open Access Journals (Sweden)

    Sylvia Vázquez

    2011-05-01

    Full Text Available La utilización de fermentos en la elaboración de productos lácteos es una práctica diaria a nivel industrial. En nuestro país los mismos son comprados a multinacionales extranjeras que se dedican a producir y comercializar fermentos; muchos de los cuales incorporan bacterias probióticas. Los probióticos pueden definirse como microorganismos que luego de ser consumidos en cantidades adecuadas, confieren algún efecto benéfico en el huésped. En el presente trabajo se realizó el aislamiento de una cepa de Lactobacillus de origen humano. Se identificó por tinción gram, prueba catalasa, crecimiento en anaerobiosis y aerobiosis y un test API 50 CH. Con el objetivo de probar propiedades probióticas de la cepa se llevaron a cabo estudios de resistencia al pH, tolerancia a sales biliares y se realizó un Modelo Gástrico in vitro. Los resultados permiten afirmar que estamos en presencia de una cepa nativa de Lactobacillus acidophilus caracterizada fenotípicamente con un 97% de confianza. Presentaría la habilidad de sobrevivir al pasaje a través del tubo digestivo ya que resistió la exposición a un pH similar al estomacal, pudo crecer en un medio con sales biliares y sobrevivió a la acción conjunta de la pepsina y una simulación de jugo gástrico; características que permiten clasificarla como posible cepa probiótica.Abstract  The use of starters to elaborate dairy products is a current practice in the industry. In our Country we import these starters from foreign companies dedicated to make and sale it, and most of them include probiotic bacterias. Probiotics can be defined as microorganisms that after be consumed in adequate amount, can give some advantageous effect to the host. In this study a strain of Lactobacillus was isolated from a human. The identification was done through gram stain, catalase test, aerobic and anaerobic growth, and an API 50 CH test. In order to prove the probiotic properties of the strain, studies of p

  15. Efecto genético del aislamiento geográfico de la liebre negra (Lepus insularis), endémica de Isla Espíritu Santo, Baja California Sur, México

    OpenAIRE

    Cervantes, Fernando A.; Castañeda, Mario

    2012-01-01

    Este estudio evaluó la magnitud de la divergencia genética entre Lepus insularis y L. californicus xanti de la Península de Baja California causada por el aislamiento geográfico de L. insularis efectuando un análisis de aloenzimas. Los resultados se compararon con un sistema biogeográfico similar que se presenta entre L. c. sheldoni de Isla Carmen y L. c. martirensis con distribución de la región norte de la Península. Se examinaron 26 loci con muestras de tejido de corazón y riñón mediante l...

  16. Foamglas D. 1. T. N.° 19 Convalidación del Agrément 1. N. L n.° 1.031. Aislamiento de cubiertas isolation pour toitures roof insulation

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1968-11-01

    Full Text Available Not availableEl Foamglas es un material constituido por vidrio químicamente puro, de tipo boro-silicato, inorgánico, sin adición de aglomerante. Se presenta y utiliza en placas de diferentes dimensiones estandarizadas. Estas placas se colocan en cubiertas planas o con pendiente. Se unen con betún y se recubren con una impermeabilización. Otros empleos no considerados en el presente documento son: en el doblado de muros, en las cámaras frigoríficas, en las fachadas ligeras, falsos techos, en el aislamiento de depósitos de agua y tuberías.

  17. Biofilm formation by Stenotrophomonas maltophilia isolates from device-associated nosocomial infections Formación de biopelículas por aislamientos de Stenotrophomonas maltophilia recuperados de infecciones nosocomiales asociadas al uso de dispositivos médicos

    Directory of Open Access Journals (Sweden)

    B. Passerini De Rossi

    2007-12-01

    Full Text Available Medical devices are often colonized by bacteria which may cause severe infections. The aim of this work was to evaluate biofilm formation by S. maltophilia isolates from device-associated nosocomial infections. The 13 local isolates exhibited different capacities of biofilm formation on hydrophilic and hydrophobic surfaces. All isolates formed strong biofilms in polystyrene microplates, while strong, moderate or weak biofilms were detected in borosilicate (BS or polypropylene (PP tubes. The proficiency of biofilm formation was better evaluated by the level of crystal violet staining expressed relative to the final culture density. The microscopic analysis of biofilms formed on glass coverslips revealed the presence of a matrix of exopolysaccharides and microcolonies typical of biofilm architecture. Isolates with increased adhesion to BS showed larger microcolonies. According to our results, twitching correlated well with attachment to the three abiotic surfaces tested, while swimming only showed a slight correlation with biofilm formation on PP. Poor correlation was observed between cell surface hydrophobicity and biofilm formation. One of the highest biofilm-producing isolates adhered to urethral catheters of different materials, and exhibited an increased resistance to oxidative stress, one of the common stresses encountered by bacteria during the infection process due to the immune response.El objetivo de este trabajo fue evaluar la formación de biopelículas por parte de aislamientos de Stenotrophomonas maltophilia. Los 13 aislamientos locales evaluados mostraron diferente capacidad de formar biopelículas en superficies hidrofílicas e hidrofóbicas. Todos ellos formaron biopelículas fuertes en microplacas de poliestireno (PS, mientras que se observaron biopelículas fuertes, moderadas o débiles en tubos de borosilicato (BS o polipropileno (PP. La medida del cristal violeta unido a la biopelícula expresada en función de la densidad

  18. Polimorfismos genéticos de aislamientos del género Malassezia obtenidos en Colombia de pacientes con lesión dermatológica y sin ella.

    Directory of Open Access Journals (Sweden)

    Adriana M. Celis

    2005-12-01

    Full Text Available Introducción. Las especies del género Malassezia se consideran levaduras oportunistas emergentes de gran importancia. Han sido asociadas a diferentes patologías dermatológicas y sistémicas de las cuales se aislan una o más especies de este género. El papel de estas levaduras en las enfermedades dermatológicas no se ha aclarado completamente, ya que la Malassezia spp. pertenece a la flora normal de la piel. Objetivo. Buscar marcadores genéticos en los aislamientos de Malassezia spp. que permitan correlacionar las lesiones dermatológicas con las especies aisladas. Materiales y métodos. Se obtuvieron 103 aislamientos de Malassezia spp. a partir de muestras de pacientes con pitiriasis versicolor, dermatitis seborreica, dermatitis seborreica en pacientes positivos para VIH, dermatitis atópica, y de individuos sanos. Para los controles se usaron ocho cepas del Centraalbureau voor Schimmelcultures (CBS, Holanda. El perfil genético se realizó utilizando la técnica de ADN polimórfico amplificado aleatorio (RAPD con tres iniciadores (OPA2, OPA4, OPA13. Los datos obtenidos se analizaron con los programas Diversity Database y SYN-TAX-PC. Resultados. Se observó heterogeneidad genética intraespecífica en Malassezia furfur, Malassezia globosa, Malassezia restricta, Malassezia slooffiae y Malassezia obtusa, mientras que Malassezia sympodialis mostró mayor homogeneidad. Conclusión. No se determinó ningún patrón genético específico mediante la técnica de RAPD para las especies de Malassezia que se pudiera relacionar con la entidad dermatológica implicada.

  19. The impact of the use of thermal insulating materials in the global climatic change; El impacto del uso de los aislamientos termicos en el cambio de los climas globales

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)

    1996-12-31

    One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.

  20. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y Testudines de la Estación de Biología Tropical Roberto Franco en Villav icencio, Colombia

    Directory of Open Access Journals (Sweden)

    D. A. Pachón

    2010-01-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos en mamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal. La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programa de recuperación del Caimán Llanero ( Crocodylus intermedius , que se encuentra en inminente peligro de extinción; adicionalmente cuenta con una colección viva de Testudines que comprende más de 20 especies. Con el fin de determinar la presencia de potenciales enteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientales y cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagar Orientación BD® para realizar los aislamientos y la identificación microbiológica. Los resultados muestran una mayor presentación de flora gram negativa predominando microorganismos de los géneros Escherichia coli (28%, Klebsiella sp (26%, Salmonella sp. (6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del género Enterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todas las muestras sin importar el origen de las mismas. Conscientes del riesgo que implica el aislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico, se dio inicio a la implementación de un manual de bioseguridad para la Estación con el fin disminuir el riesgo para la población humana y animal.

  1. The impact of the use of thermal insulating materials in the global climatic change; El impacto del uso de los aislamientos termicos en el cambio de los climas globales

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)

    1997-12-31

    One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.

  2. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  3. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  4. Caracterización morfológica, biológica y genética de un aislamiento Colombiano de granulovirus de Erinnyis ello (L. (Lepidoptera: Sphingidae

    Directory of Open Access Journals (Sweden)

    Gloria Patricia Barrera Cubillos

    2014-07-01

    Full Text Available Título en español: Caracterización morfológica, biológica y genética de un aislamiento Colombiano de granulovirus de Erinnyis ello (L. (Lepidoptera: Sphingidae Título en ingles: Characterization of a Colombian isolate of Erinnyis ello granulovirus (L. (Lepidoptera: Sphingidae Titulo corto: Granulovirus de E. ello Resumen: El gusano cachón Erinnyis ello (L. es una plaga polífaga que puede causar graves pérdidas en cultivos de caucho. El uso de granulovirus representa una alternativa interesante para el control biológico de este insecto. Tres aislamientos colombianos del granulovirus de E. ello (EeGV recuperados en larvas de campo, fueron caracterizados morfológica y molecularmente. Los cuerpos de inclusión de los tres aislamientos presentaron forma ovoide con una única nucleocápside, con tamaño promedio de 302,9 ± 22 x 181,5 ± 16 nm. El análisis de los perfiles de restricción con diferentes endonucleasas no mostró diferencias entre los tres aislamientos, lo cual sugiere que son muestras de la misma cepa viral, denominada VG010, cuyo tamaño del genoma se estimó en 88,7 Kb. El análisis de las relaciones filogenéticas basado en las secuencias de lef-8, lef-9 y gran mostró con alta consistencia la estrecha relación entre VG010 y un aislamiento de EeGV (M34-4 previamente descrito, lo cual sugiere que son variantes genotípicas de la misma especie viral. La eficacia del aislamiento VG010 en condiciones de laboratorio sobre larvas de segundo y cuarto estadio fue de 100 % y 64 % respectivamente, mientras que la concentración letal media (CL50 fue 4,3 x 103 CI/mL. La productividad viral, osciló entre 2,1 x 109 y 3,8 x 109 CI/gramo de larva. Estos resultados representan la base para el desarrollo de un nuevo bioinsecticida para el control de la plaga en campo. Palabras clave: Gusano cachón. Baculovirus. Control biológico. Filogenia.  Abstract: Erinnyis ello (L. is a polyphagous lepidopteran pest that may cause serious

  5. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  6. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  7. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  8. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  9. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  10. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  11. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  12. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  13. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  14. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  15. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  16. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  17. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  18. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  19. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  20. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  1. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  2. Evaluación de los cebadores TS3 e ITS4 para la detección de infecciones por Candida spp. en muestras de flujo vaginal y humor acuoso Evaluation of ITS3 and ITS4 primers for detection of Candida spp. Candida spp. infections from vaginal samples and aqueous humor

    Directory of Open Access Journals (Sweden)

    Juan Felipe Ramirez

    2008-06-01

    Full Text Available Antecedentes. Los métodos convencionales para a identificación de levaduras del género Candida requieren mucho tiempo, necesitan cantidad importante de la muestra y, en muchos casos, es necesario realizar cultivo. Objetivos. Evaluar un par de cebadores para la identificación de levaduras del género Candida y demostrar su potencial aplicación para el diagnóstico de infecciones intraoculares. Materiales y métodos. Se utilizaron 17 cepas de referencia, 29 aislamientos clínicos de flujo vaginal, 7 muestras de humor acuoso y una de humor vítreo. Evaluamos tres métodos para el rompimiento de la pared celular: congelación descongelación, sonicación, y la enzima liticasa. Para la purificación del ácido nucleico, se utilizó en los tres casos el estuche comercial Wizard Genomics; en la reacción de PCR, el estuche comercial Go Taq Green Master Mix y los iniciadores ITS3 e ITS4 a una concentración de 0,5 µM. Resultados. De los tres métodos el que mejor resultados ofreció fue el uso de enzima liticasa más el estuche comercial. Con los iniciadores ITS3 e ITS4 fue posible identificar las levaduras únicamente a nivel de género y no se presentó reacción cruzada con otros microorganismos comúnmente encontrados en diferentes muestras de tejido humano. La sensibilidad fue de 100 fg. Se lograron identificar por PCR todos los aislamientos a partir de flujo vaginal y de una muestra de humor acuso. Para las demás muestras de humor acuoso el diagnóstico fue para otros agentes causales, entre ellos, Toxoplasma sp. Conclusión. Consideramos que ésta es una metodología adecuada, la cual permite identificar levaduras del género Candida con gran sensibilidad y reproducibilidad.Background. Conventional methods for Candida identification are time consuming, require high amounts of the sample and in several cases the culture is mandatory. Aims. To evaluate two primers for the identification of Candida and to demonstrate their application for

  3. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  4. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  5. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  6. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  7. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  8. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  9. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  10. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  11. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  12. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  13. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  14. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  15. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  16. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  17. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  18. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  19. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  20. Aislamiento e identificación de Vibrio parahaemolyticus O3: K6 en pescados y moluscos bivalvos procedentes de un mercado pesquero de Lima, Perú

    Directory of Open Access Journals (Sweden)

    Rocío Aliaga

    2010-07-01

    Full Text Available Objetivo: Determinar la presencia de Vibrio parahaemolyticus serotipo O3:K6 en pescados y moluscos bivalvos procedentes de un mercado pesquero de Lima. Material y Métodos: Se analizaron 254 muestras entre pescados y moluscos bivalvos siguiendo la técnica descrita por Yukiko Harakudo et al, que consta de un paso de enriquecimiento, siembra en medio cromogénico, evaluación de fermentación de glucosa y la prueba de tolerancia a sales. Las cepas identificadas como Vibrio parahaemolyticus fueron serotipificadas usando anticuerpos monoclonales y evaluadas en su potencial patogénico en medio de Wagatsuma. Resultados: Se aislaron 15 cepas de V. parahaemolyticus, 9(7,5% en pescados y 6(4,5% en moluscos bivalvos. Tres (20% presentaron fenómeno de Kanagawa positivo indicando la producción de la hemolisina termoestable directa (TDH. Una cepa TDH-positiva aislada en una muestra pescado fue serotipo O3:K6. Conclusiones: Vibrio parahaemolyticus se encuentra distribuido en los recursos hidrobiológicos estudiados con mayor frecuencia en pescados, a partir de los cuales se encontró el serovar O3:K6. Este es el primer reporte de la cepa pandémica O3:K6 de Vibrio parahaemolyticus aislada de fuente no humana en el Perú. (Rev Med Hered 2010;21:139-145.

  1. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  2. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  3. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia Molecular characterization of 15 isolations of Beauveria bassiana related to Cosmopolites and Metamasius in plantain and banana in three regions of Colombia

    Directory of Open Access Journals (Sweden)

    Diego Fernando Marmolejo

    2008-10-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a -20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.Weevils Cosmopolites and Metamasius in municipalities of the Valle del Cauca, Caldas and Quindío departaments of Colombia were collected. Monosporic cultures were obtained from10-10 and 10-11 dilutions of Beauveria bassiana. Isolates were kept at -80°C with 10% glycerol and DNA stored at -20°C. RAMs molecular markers generated a total of 82 fragments of which 67% were polymorphic. A heterozygosity value of 0.24 indicated a medium - high diversity. Five groups were formed which have a similarity value of 0.84 and one big group with 11 isolates and four groups with only one isolate. In the big group was detected a duplicate and fungi genetic diversity in the sampled places. Neither relationship among isolates of Cosmopolites and Metamasius nor geographical zone related to the formation of genetic groups.

  5. Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

    Directory of Open Access Journals (Sweden)

    A. Corso

    2009-03-01

    Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

  6. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  8. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  9. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  10. Método de difusión con discos para la determinación de sensibilidad a fluconazol en aislamientos de Candida spp Disk diffusion method for fluconazole susceptibility testing of Candida spp. isolates

    Directory of Open Access Journals (Sweden)

    L. Rodero

    2006-09-01

    Full Text Available Se estudiaron 1193 aislamientos clínicos para estandarizar y evaluar un método de difusión con discos de fluconazol de lectura visual, que permita detectar levaduras sensibles al antifúngico. Las especies analizadas fueron: Candida albicans (n=584, Candida parapsilosis (n=196, Candida tropicalis (n=200, Candida glabrata (n=113, Candida krusei (n=50, Candida spp. y otras levaduras oportunistas (n=50. Los discos fueron manufacturados en el INEI-ANLIS "Dr. Carlos G. Malbrán". Se midieron los halos de inhibición del crecimiento producidos por fluconazol y la concentración inhibitoria mínima (CIM por el método de referencia M27-A2 modificado por EUCAST. Se establecieron los valores de corte del método de difusión en: ≥16 mm para levaduras sensibles a fluconazol (CIM ≤ 8 µg/ml, entre 9 y 15 mm para sensibles dependientes de la dosis (CIM = 16-32 mg/ml y ≤ 8 mm para resistentes (CIM ≥ 64 µg/ml. El método de difusión tuvo 94,7% de concordancia con el de referencia, con 0,2% de errores very major y 0,3% de errores major. La reproducibilidad inter e intralaboratorio fue muy buena. Para detectar aislamientos sensibles a fluconazol, este método resulta confiable y de bajo costo; sin embargo, es conveniente que los aislamientos con halos ≤ 15 mm sean reevaluados por el método de referencia.In order to standardize and evaluate a disk diffusion method with visual reading to detect in vitro fluconazole susceptibility of yeast, 1193 clinical isolates were tested. These included 584 Candida albicans, 196 Candida parapsilosis, 200 Candida tropicalis, 113 Candida glabrata, 50 Candida krusei and 50 Candida spp. and other opportunistic yeasts. The disks were manufactured in the INEI-ANLIS "Dr. Carlos G. Malbrán". The disk diffusion method results were compared to MIC results obtained by the reference CLSI M27-A2 broth microdilution method modified by EUCAST. The interpretative breakpoints for in vitro susceptibility testing of fluconazole

  11. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  12. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  13. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  14. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  15. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  16. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  17. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  18. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV Evidence of different phylogenetic origins of two mexican Sugarcane mosaic virus (SCMV isolates

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2012-01-01

    Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.The molecular analysis of the Sugarcane mosaic virus (SCMV for coat protein cistron reported in the public GenBank database, revealed the presence of 45 additional nucleotides coding for 15 amino acids in the N-terminal region of the coat protein sequence of the mexican isolate GU474635. BLAST analysis indicates this particular feature is also present in the coat protein sequence identified with the accession number D00949 reported in the USA in 1991. Phylogenetic analysis of 185 SCMV coat protein sequences reported from Asia, Africa, Brazil and Argentina among others, suggest a putative different phylogeographical origin of the mexican SCMV isolates. Coat protein

  19. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  20. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  1. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  2. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  3. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  4. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  5. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  7. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  8. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  9. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  10. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  11. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  12. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  13. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  14. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  15. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  16. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  17. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  18. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  19. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  20. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  1. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  2. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  3. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  4. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  5. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  6. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  7. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  8. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  9. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  10. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  11. Spoilage yeasts in Patagonian winemaking: molecular and physiological features of Pichia guilliermondii indigenous isolates Levaduras contaminantes en vinos patagónicos: características moleculares y fisiológicas de los aislamientos indígenas de Picchia guilliermondii

    Directory of Open Access Journals (Sweden)

    C. A. Lopes

    2009-09-01

    Full Text Available Yeasts belonging to the genus Dekkera/Brettanomyces, especially the species Dekkera bruxellensis, have long been associated with the production of volatile phenols responsible for off-flavour in wines. According to recent reports, the species Pichia guilliermondii could also produce these compounds at the initial stages of fermentation. Based on the abundance of P. guilliermondii in Patagonian winemaking, we decided to study the relevance of indigenous isolates belonging to this species as wine spoilage yeast. Twenty-three indigenous isolates obtained from grape surfaces and red wine musts were analyzed in their capacity to produce volatile phenols on grape must. The relationship between molecular Random Amplified Polymorphic DNA (RAPD and physiological (killer biotype patterns detected in indigenous populations of P. guilliermondii and volatile phenol production was also evaluated. Different production levels of 4-ethylphenol, 4-vinylguaiacol and 4-ethylguaiacol were detected among the isolates; however, the values were always lower than those produced by the D. bruxellensis reference strain in the same conditions. High levels of 4-vinylphenol were detected among P. guilliermondii indigenous isolates. The combined use of RAPD and killer biotype allowed us to identify the isolates producing the highest volatile phenol levels.Las levaduras del género Dekkera/Brettanomyces, sobre todo la especie Dekkera bruxellensis, siempre han sido asociadas con la producción de fenoles volátiles responsables de aromas desagradables en los vinos. Recientemente, se ha demostrado que la especie Pichia guilliermondii también es capaz de producir estos compuestos, particularmente durante las etapas iniciales de la fermentación. Dada la abundancia de P. guilliermondii en las bodegas de la Patagonia, se decidió evaluar la importancia de algunos aislamientos indígenas de esta especie como levaduras alterantes de vinos regionales. Se evaluó la capacidad de

  12. Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo

    2009-04-01

    Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

  13. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  14. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  15. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  16. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  17. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  18. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  19. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  20. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  1. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  2. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  3. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  4. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  5. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  6. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  7. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  8. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  9. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  10. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  11. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  12. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  13. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  14. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  15. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  16. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  17. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  18. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  19. Energy consumption and the use of thermal insulating materials. A comparative analysis on the tendencies over the time; Consumo de energia y uso de aislamientos termicos - un analisis comparativo de tendencias en el tiempo

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    positivas y son semejantes a las tendencias en el consumo de aislamientos termicos y a cifras semejantes de otros paises. El analisis de estas cifras nos permiten detectar si se pueden correlacionar los esfuerzos de ahorro de energia con el consumo de aislamientos termicos y con el nivel de vida de un pais (determinado por su ingreso per capita), y establecer un indice futuro de efectividad de conservacion de energia por el uso adecuado de materiales de espesor economico. El indice propuesto en esta ponencia sirve este proposito y nos arroja resultados interesantes. A lo largo de los anos recientes y como resultado del cambio en el nivel de industrializacion y de vida en Mexico, el consumo de energeticos ha aumentado en proporcion mayor al crecimiento de poblacion, tomando como base las cifras de 1980. En ese mismo periodo, el producto interno bruto per capita ha aumentado en proporcion tambien ligeramente menor al crecimiento poblacional. Esto significa que la cifra de Intensidad Energetica, definida como la proporcion de consumo de energeticos sobre el producto interno bruto, ha aumentado ligeramente en el mismo periodo en consideracion, significando que el pais se ha vuelto mas ineficiente en anos recientes. Al mismo tiempo, la capacidad de produccion de materiales aislantes termicos ha permanecido constante desde 1980 hasta principios de 1994. Esto compara desfavorablemente con todos los paises desarrollados, en los cuales la intensidad energetica ha disminuido considerablemente en los ultimos anos, al tiempo que la produccion de materiales aislantes termicos ha crecido a un ritmo de proporciones semejantes.

  20. Universal isolation precautions for patients at an academic hospital Precauciones universales en el aislamiento de pacientes en un hospital universitario Precauções universais em isolamentos de pacientes em hospital universitário

    Directory of Open Access Journals (Sweden)

    Vanessa Gomes Maziero

    2012-01-01

    Full Text Available OBJECTIVE: To apply universal isolation precautions for patients at an academic hospital by a nursing team. METHODS: This descriptive and prospective study used data from advice service of quality control and nursing care that were gathered in observational reports of universal isolation precautions for patients admitted in two surgical inpatient units during 2008 and 2010. RESULTS: The mean general classification for both units was between desirable and adequate in the observational analysis of universal precaution. A borderline effect was observed only in November 2008 at the Men's Surgical Unit. The units assessed had compromised biosecurity, however, as time advanced data showed an improvement on their performance. CONCLUSION: The effective involvement of nurses in the unit is critical to prevent and control nosocomial infections.OBJETIVO: Utilización de las precauciones universales por el equipo de Enfermería en el aislamiento de pacientes en un Hospital Universitario. MÉTODOS: Estudio descriptivo, prospectivo. Fueron utilizados datos de la Asesoría de Control de Calidad de la Asistencia de Enfermería, correspondientes a los informes de las observaciones respecto a las precauciones universales en el aislamiento de pacientes en dos unidades de internamiento Médico - Quirúrgico, en el período comprendido entre 2008 y 2010. RESULTADOS: Las dos unidades de la institución presentaron un promedio general de clasificación, del análisis observacional de precaución universal, entre deseable y adecuada, siendo limítrofe apenas en noviembre del 2008 en la unidad Médico-Quirúrgica Masculina. Las unidades evaluadas, respecto a la adhesión a las precauciones universales, presentaron compromiso con la bioseguridad, y los datos exhibidos se mostraron mejores en cada año descrito. CONCLUSIÓN: La participación activa del enfermero responsable por la unidad es importante en la prevención y control de infecciones hospitalarias

  1. Tipificación molecular de aislamientos de Pseudomonas aeruginosa obtenidos de pacientes con fibrosis quística Molecular typification of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis

    Directory of Open Access Journals (Sweden)

    N. G. Iglesias

    2008-03-01

    Full Text Available La fibrosis quística es la enfermedad genética letal de mayor frecuencia en la población caucásica. La infección pulmonar crónica es la principal causa de morbilidad de la enfermedad, siendo la infección por Pseudomonas aeruginosa la más importante, ya que resulta de difícil erradicación. El Centro de Referencia Provincial de Fibrosis Quística que funciona en el Hospital de Niños "Sor María Ludovica" de La Plata asiste a alrededor de 220 pacientes con fibrosis quística cuyas edades oscilan entre los dos meses y los 45 años. La edad de sobrevida depende de una serie de factores entre los que se encuentran el diagnóstico temprano de la enfermedad y la adquisición de la infección pulmonar crónica por P. aeruginosa. La misma puede adquirirse en forma directa, por transmisión persona a persona o de forma indirecta a través del uso de elementos hospitalarios contaminados. El objetivo de este trabajo fue la tipificación molecular de aislamientos de P. aeruginosa obtenidos de pacientes con fibrosis quística, con el fin de evaluar la relación genómica entre los mismos. El estudio se llevó a cabo mediante RAPD-PCR. El análisis demostró que existe gran heterogeneidad genética entre los aislamientos. La separación en cohortes de pacientes de acuerdo con su bacteriología, que implica la asistencia en días diferentes y las hospitalizaciones en habitaciones aisladas ha demostrado, junto a otras estrategias, disminuir las infecciones cruzadas.Cystic fibrosis is the most frequent lethal genetic disease that affects the caucasian population. The main cause of morbidity is the chronic lung infection, being the infection caused by Pseudomonas aeruginosa the most difficult to eradicate. This bacteria can be acquired in direct form, by person-to-person transfer, or indirectly, by hospital acquired infection. The Centro Provincial de Referencia de Fibrosis Quística functioning in the Hospital de Niños "Sor María Ludovica", in La

  2. Aislamiento e identificación de cepas de Azospirillum sp. en pasto guinea (Panicum maximum Jacq. del Valle del Cesar Isolation and identification of Azospirillum sp. in Guinea grass (Panicum maximum Jacq. of the Valle del Cesar

    Directory of Open Access Journals (Sweden)

    Diana M Cárdenas

    2010-09-01

    Full Text Available Se evaluó el efecto de factores ambientales del Valle del Cesar y el manejo agronómico del pasto guinea (Panicum maximum Jacq., sobre la población bacteriana del género Azospirillum en medios de cultivo semisólidos NFb y LGI, para lo cual se utilizó un diseño experimental en parcelas divididas con un arreglo factorial de 2 (épocas climáticas: lluvia y sequía x 2 (manejos agronómicos: agroecólogico y extractivo x 3 (muestras analizadas: suelo rizosférico, raíces y hojas. Los resultados no revelaron diferencias estadísticas significativas, lo que indica que esta bacteria puede mantener su población en condiciones de estrés por diferentes mecanismos fisiológicos. A partir de estas muestras se obtuvieron 16 aislamientos pertenecientes al género Azospirillum, a los cuales se les evaluó su actividad de reducción de acetileno como indicador de la fijación biológica de nitrógeno y su capacidad en la producción de compuestos indólicos como promotores del crecimiento vegetal. Se seleccionaron las cepas SRGM2, SRGM3 y SRGM4 obtenidas de muestras de suelo rizosférico de pasto guinea de la Estación Experimental Motilonia de Corpoica, municipio Agustín Codazzi, departamento del Cesar. Estos aislamientos se caracterizaron molecularmente por el gen 16S rRNA y según el análisis BLAST en la base de datos del GenBank y presentaron 93% de similitud con A. lipoferum (SRGM2 y SRGM3 y 94% con A. brasilense (SRGM4.The effect of environmental factors of the Valle del Cesar and the agronomic management of Guinea grass (Panicum maximum Jacq., on the bacterial population of the Azospirillum genus in semisolid NFb and LGI culture media was evaluated, for which an experimental design was used in divided plots with a 2 (climatic seasons: rainy and dry x 2 (agronomic managements: agroecological and extractive x 3 (analyzed samples: rhizospheric soil, roots and leaves factorial arrangement. The results did not reveal significant statistical

  3. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  4. Fractal analysis of the electrical discharges' surface paths in polymeric insulation considering different pollution levels; Analisis fractal de las trayectorias de descargas electricas superficiales en aislamiento polimerico considerando diferentes niveles de contaminacion

    Energy Technology Data Exchange (ETDEWEB)

    Palacios Lopez, Arturo

    2002-07-01

    In this thesis tree patterns of superficial breakdown in polymeric insulator of Silicon Rubber are generated. Experimental arrangement rod-rod was used on the basis of norm ASTM D 2303-85. Pollution levels on the basis of norm IEC 507 were also used. The experimental values of Fractal Dimension for each case of pollution were reported. A self similar method called Box Counting for the fractal dimension calculus and for the self affine methods an R/S and Variogram were used. According to the results, it was concluded that the tree patterns of superficial electric breakdown in Silicon Rubber is self similar and its value does not depend on the degree of pollution, that is equivalent to the concentration of salt for liter of water or to the Equivalent Salt Deposition (ESDD), in the surface of an insulator. [Spanish] En el presente trabajo se inducen descargas electricas superficiales en un aislamiento polimerico de Hule Silicon, el arreglo experimental que se utilice es punta-punta con base en la norma ASTM D 2303-85 y los niveles de contaminacion con base en la norma IEC 507. Se reportan los valores experimentales de la Dimension Fractal para cada caso de contaminacion, se utilice el metodo auto similar de conteo de cuadros, para el calculo de la Dimension Fractal y para metodos auto afines se utilice analisis R/S y variograma. Con los resultados obtenidos se concluye que la trayectoria de la descarga electrica superficial en un polimero de Hule Silicon es auto similar y su valor no depende del grado de contaminacion, el cual es equivalente a la concentracion de gramos de sal por litro de agua o a la densidad de sal depositada (DESD), en la superficie de un aislador.

  5. El método de cultivo "in vitro" como instrumento práctico en el diagnóstico y el aislamiento primário de Leishmania braziliensis braziliensis I. Observaciones de laboratório

    Directory of Open Access Journals (Sweden)

    Eduardo M. Netto

    1986-06-01

    Full Text Available Comparamos diferentes medios artificiales y procedimientos de cultivo in vitro de Leishmania braziliensis braziliensis (Lbb aislada de lesiones de hamsteres experimentalmente infectados. Observamos que la aspiración de material de la lesión, usando jeringa de 5 mlyaguja 22g(25 x 8mm, mostró resultados satisfactorios siendo un procedimiento conveniente de colecta. El medio de Agar Sangre Difco (DAB es un medio eficiente para el aislamiento de Lbb. El medio de Evans demostro similares resultados al DAB, mientras que el medio líquido de Schneider y el químicamente definido AR-103 fueron nitidamente inferiores. En la propagación in vitro de Lbb, el medio de Schneider permitió un buen crecimiento del flagelado, alcanzando densidades de 0,21 - 2,57 x 10(8 promastigotes por ml ya, en el 5.° dia de cultivo. La adición de 5-fluorocytosine a los tubos de cultivo (150/jg/mlpara evitar la contaminación por hongos, no inhibió el crecimiento de Lbb.We have compared differeni media and isolation procedures to cultivate Leishmania braziliensis braziliensis/rom hamster tissues. Wefmd that aspiration of the lesion using a 22 g needle and a five ml syringegives satisfactorv results, and is a convenient sampling method. Difco Blood agar is an efficient medium for isolation. Evans medium gave equal results while Schneiders and AR-103 medium were inferior. In Schneider's medium flagellate growth achieved 0.21 - 2.57 x 10(8 promastigotes/ml bv the fifth day 5-fluorocytosine added to the cultures to avoid fungal contamination does not inhibit the growth of L. b. brasiliensis.

  6. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y testudines de la Estación de Biología Tropical Roberto Franco en Villavicencio, Colombia

    Directory of Open Access Journals (Sweden)

    C. A. Moreno

    2010-04-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos enmamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal.La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programade recuperación del Caimán Llanero (Crocodylus intermedius, que se encuentra en inminentepeligro de extinción; adicionalmente cuenta con una colección viva de Testudinesque comprende más de 20 especies. Con el fin de determinar la presencia de potencialesenteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientalesy cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagarOrientaciónBD® para realizar los aislamientos y la identificación microbiológica. Los resultadosmuestran una mayor presentación de flora gram negativa predominando microorganismosde los géneros (28%, Klebsiella sp (26%, Salmonella sp.(6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del géneroEnterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todaslas muestras sin importar el origen de las mismas. Conscientes del riesgo que implica elaislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico,se dio inicio a la implementación de un manual de bioseguridad para la Estación con elfin disminuir el riesgo para la población humana y animal.

  7. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  8. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  9. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  10. Campylobacter spp.: prevalencia y caracterización feno-genotípica de aislamientos de pacientes con diarrea y de sus mascotas en la provincia de La Pampa, Argentina Campylobacter spp.: prevalence and pheno-genotypic characterization of isolates recovered from patients suffering from diarrhea and their pets in La Pampa Province, Argentina

    Directory of Open Access Journals (Sweden)

    Ana L Tamborini

    2012-12-01

    Full Text Available Se investigó la prevalencia de Campylobacter spp. en 327 pacientes con diarrea y en 36 animales (perros, gatos y pollos que convivían con pacientes en los que se detectó este patógeno; el estudio se llevó a cabo en Santa Rosa, La Pampa, Argentina. Se aisló Campylobacter spp. en 50/327 pacientes y en 12/36 animales, Campylobacter jejuni fue la especie más frecuente. Se detectó resistencia a ciprofoxacina (65 % y a tetraciclina (32 % en una selección de 35 aislamientos de origen humano. En el análisis por electroforesis de campo pulsado de 13 aislamientos de C. jejuni se identificaron siete subtipos genéticos. Dos subtipos agruparon aislamientos de pacientes y de sus respectivos perros, y un tercer subtipo agrupó 1 aislamiento humano y 2 de pollos de ese paciente. Si bien las aves son reconocidas como el principal reservorio, es importante fortalecer la vigilancia de Campylobacter spp. en mascotas, las cuales pueden ser portadores asintomáticos del patógeno.The prevalence of Campylobacter spp. was investigated in 327 patients suffering from diarrhea and in 36 animals (dogs, cats and chickens owned by the patients that presented infection by Campylobacter in Santa Rosa, La Pampa, Argentina. Campylobacter spp. was isolated in 50/327 patients and in 12/36 animals, being Campylobacter jejuni the most common species. Resistance to ciprofoxacin (65 % and tetracycline (32 % was found among 35 isolates of human origin studied. Seven genetic subtypes were observed among 13 C. jejuni isolates by pulsed feld gel electrophoresis. Two subtypes grouped isolates belonging to patients and their respective dogs whereas another subtype grouped one isolate of human origin and two isolates from the patient´s chickens. The results of this investigation highlight the need to strengthen surveillance of Campylobacter spp. not only in poultry, which is recognized as the main reservoir, but also in pets, which were shown to be asymptomatic carriers of the

  11. Análisis de la eficiencia del sistema de aislamiento de vibraciones de grupos electrógenos MAN 18 V48/60 B // Efficiency analysis of vibration isolation system installed on engine generator sets type MAN 18 V48/60 b

    Directory of Open Access Journals (Sweden)

    Evelio Palomino‐Marín

    2011-01-01

    Full Text Available Todo sistema de aislamiento de vibraciones está encaminado en primera instancia a aislarvibraciones como su propio nombre lo indica. En ocasiones es menester que a la máquina no laperturben vibraciones procedentes del entorno, como lo puede ser por ejemplo, el caso de unarectificadora en un taller de mecanizado. Así mismo, en otras ocasiones resulta necesario aislar lamáquina para evitar que las vibraciones producidas por ella misma afecten al entorno. Tal es el casode los grupos electrógenos MAN 18 V48/60 B, cuyos motores de combustión interna responden a undiseño de 18 cilindros en “V” distribuidos en 13 metros de longitud. El sistema de aislamiento deestos motores consta de 14 paquetes de ocho resortes cada uno, incluyendo un amortiguadorviscoso por cada calzo. Se efectuaron mediciones espectrales de vibraciones en cada uno de estoscalzos antivibratorios, sobre y debajo de estos respectivamente y se evaluó la eficiencia de estoscalzos en todo el espectro, determinándose aquellas frecuencias que por determinadas razones noalcanzan los niveles de eficiencia en el aislamiento establecidos a tales efectos. De esta manera, sepresenta una metodología para conducir este análisis.Palabras claves: calzos antivibratorios, aislamiento de vibraciones, grupos electrógenos.___________________________________________________________________AbstractA vibroisolation system has a priority goal which is isolate vibrations. Such vibrations can come fromthe environment and could affect the machine behavior and could affect its technological functionstoo. That’s the case of a machine tool, for instance. However, it is also possible that vibrations comefrom the own machine and in this case the main goal of vibroisolation system is to avoid thatvibrations go to machine foundations. This is the case on which this paper is focused. Twelvevibration isolators with eight springs each one including a viscous damper are mounted asvibroisolation system on

  12. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  13. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  14. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  15. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  16. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  17. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  19. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  20. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  1. PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA

    OpenAIRE

    BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO

    2004-01-01

    Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

  2. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  3. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

    Science.gov (United States)

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

    2013-01-01

    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

  4. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  5. Demonstration Of A Nanomaterial-Modified Primer For Use In Corrosion-Inhibiting Coating Systems

    Science.gov (United States)

    2011-11-01

    resin packages/binders, can cause a high-build coating thickness that can be prone to chipping and “mud cracking ” if not properly applied. The...for all non-magnetic coatings on a ferrous (magnetic) substrate, e.g. paint, plastic, enamel , powder, rubber, ceramic, galvanising, zinc, sprayed... cracking during the scribing process due to the brittle coating system on the intermediate primer coupons (16 and 22) as well as coupon 11. Mildew

  6. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

    2013-01-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  7. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    OpenAIRE

    Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera

    2010-01-01

    Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...

  8. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  9. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

    Science.gov (United States)

    Carter-Harris, Lisa

    2016-11-01

    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    Science.gov (United States)

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  11. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    D. S. Lucas

    2004-01-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

  12. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  15. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  16. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  17. EFECTO SOBRE LA SARNA POLVOSA DE CUATRO AISLAMIENTOS DEL HONGO Trichoderma asperellum EN TRES TIPOS DE SUELO EFFECT ON THE POWDERY SCAB OF FOUR ISOLATES OF THE FUNGUS Trichoderma asperellum IN THREE TYPES OF SOILS

    Directory of Open Access Journals (Sweden)

    Elizabeth Gilchrist

    2009-06-01

    Full Text Available El protozoario Spongospora subterranea f. sp. subterranea es un parásito obligado que replica en raíces y tubérculos de papa causando la sarna polvosa. Esta enfermedad se ha difundido a escala global debido al comercio de tubérculos-semilla infectados y a la ausencia de tratamientos efectivos. En este trabajo se investigó la influencia sobre la sarna polvosa de cuatro aislamientos de Trichoderma asperellum en tres tipos de suelo: Andisol, Entisol e Inceptisol. Tubérculos de Solanum tuberosum variedad Diacol Capiro fueron plantados en parcelas infectadas con 1942 ± 226 quistosoros por gramo de suelo. No se observaron diferencias entre las plantas tratadas y no tratadas con T. asperellum. La superficie de raíz ocupada por agallas fue en promedio 2,2%, sin encontrarse diferencias significativas (PThe protozoan Spongospora subterranea f. sp. subterranea is an obligate parasite that replicates in roots and tubers of potato causing the powdery scab. This disease has disseminated on a global scale, because the commercial traffic of infected tubers used as seed and the absence of effective treatments. The present work investigated the effects of four isolates of Trichoderma asperellum in three soil types: Andisol, Entisol and Inceptisol. The soils were infected with 1942 ± 226 cystosori per gram of soil. It was used Solanum tuberosum variety Diacol Capiro. No differences were observed between treated and non treated plants with T. asperellum. The root surface affected by galls was an average of 2.2 %, and no significant differences (p<0.05 were observed among the soils. The reduction of plant growth was of 41, 32 and 28 % for the Andisol, Entisol and Inceptisol, respectively. The reduction in tubers production was of 40, 28 and 0,1% for the Andisol, Entisol and Inceptisol, respectively. Similar percent of root surface covered with galls resulted in production reduction of 40%, but also of 0,1%, indicating the necessity of other methods to

  18. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  19. Application of hierarchical oligonucleotide primer extension (HOPE) to assess relative abundances of ammonia- and nitrite-oxidizing bacteria

    KAUST Repository

    Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying

    2017-01-01

    for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study

  20. PLASMA POLYMER FILMS AS ADHESION PROMOTING PRIMERS FOR ALUMINUM. PART II: STRENGTH AND DURABILITY OF LAP JOINTS

    Science.gov (United States)

    Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 A in thickness) were deposited onto 6111-T4 aluminum substrates in radio frequency and microwave powered reactors and used as primers for structural adhesive bonding. Processing variables such as substrate pre-treatment,...