WorldWideScience

Sample records for baba2 primer aislamiento

  1. Primer aislamiento ambiental de Cryptococcus gattii de serotipo B, en Cúcuta, Colombia

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    2011-04-01

    Conclusiones. Éste es el primer reporte de la recuperación ambiental de C. gattii de serotipo B en Cúcuta. Sin embargo, por la baja tasa de recuperación de aislamientos únicamente en suelo, el nicho ambiental de C. gattii no se pudo establecer, por lo que es necesario realizar posteriores estudios ambientales en Cúcuta, debido a que este serotipo, no sólo está causando criptococosis, sino también muestra una gran virulencia después del brote ocurrido en Vancouver.

  2. Primer aislamiento e identificación de Ureaplasma spp y de Mycoplasma lipofaciens de gallinas comerciales en México

    Directory of Open Access Journals (Sweden)

    Ernesto Soto Priante

    2011-01-01

    Full Text Available Durante un estudio realizado en México durante los años 2003 y 2004 se realizó el aislamiento de Ureaplasma spp (U. spp y de Mycoplasma lipofaciens (M. lipofaciens de la porción superior de la tráquea de aves comerciales vivas y sanas tipo White Leghorn (Gallus gallus domesticus. Se identificaron un total de 13 aislamientos de U. spp y 8 aislamientos de M. lipofaciens entre los 223 micoplasmas aislados. El aislamiento de U. spp se realizó en una sola granja avícola localizada en el estado de Jalisco en aves de 50 semanas de edad. El aislamiento de M. lipofaciens se realizó en granjas avícolas localizadas en el mismo estado de Jalisco así como en el estado de Puebla, en aves de 50 a 80 semanas de edad. Este es el primer informe del aislamiento e identificación de U. spp y de M. lipofaciens en México, lo que puede considerarse relevante si se toma en cuenta que los ureaplasmas pueden ser de origen aviar o humano, y por ello será necesario determinar su posible transmisión entre especies. Además M. lipofaciens reacciona positivamente cuando se realizan pruebas serológicas hacia M. synoviae, lo que puede generar errores en diagnóstico y tratamientos innecesarios.

  3. Primer aislamiento de Escherichia coli O157:H7 Enterohemorrágica en el Perú

    Directory of Open Access Journals (Sweden)

    Blanca Huapaya C

    2001-01-01

    Full Text Available En Febrero del año 2001 como parte del "Estudio transversal de los agentes etiológicos de diarrea aguda" en la Macrorregión Sur del país, el Laboratorio Referencial de Tacna aisló una cepa procedente de una muestra de heces de un lactante de 11 meses de edad con un cuadro de diarrea disentérica, identificándola como Escherichia coli O157. Esta cepa fue confirmada y caracterizada en el Instituto Nacional de Salud como E. coli O157:H7 toxina shiga tipo II, siendo el primer aislamiento reportado de Escherichia coli enterohemorrágica en el Perú.

  4. Primer aislamiento de Histoplasma capsulatum de murciélago urbano Eumops bonariensis First isolation of Histoplasma capsulatum from the urban bat Eumops bonariensis

    Directory of Open Access Journals (Sweden)

    C.E. Canteros

    2005-03-01

    Full Text Available Se comunica el primer aislamiento de Histoplasma capsulatum var. capsulatum de un murciélago macho de la especie Eumops bonariensis, capturado en la ciudad de Buenos Aires en 2003. Los aislamientos fueron recuperados de bazo e hígado e identificados fenotípicamente. Se los comparó por PCR, con 17 aislamientos clínicos, 12 de pacientes residentes en la ciudad de Buenos Aires y cinco de otros países de América, usando los iniciadores 1283, (GTG5, (GACA4 y M13. Con los cuatro iniciadores, los perfiles de los aislamientos de murciélago resultaron idénticos entre sí y más relacionados a los de pacientes de Buenos Aires que a los de otros países (porcentaje de similitud: 91-100% y 55-87%, respectivamente. La alta relación genética entre los aislamientos obtenidos del murciélago y de los humanos residentes en Buenos Aires sugiere una fuente común de infección. Este es el primer registro de E. bonariensis infectado con H. capsulatum en el mundo, y el primer aislamiento del hongo en la población de quirópteros de la Argentina. Así como estos mamíferos actúan como reservorio y dispersan el hongo en la naturaleza, la infección en murciélagos urbanos podría asociarse al elevado número de casos de histoplasmosis entre pacientes inmunodeprimidos en la ciudad de Buenos Aires.We report the first isolation of Histoplasma capsulatum var. capsulatum from a male bat Eumops bonariensis captured in Buenos Aires city in 2003. The pathogen was recovered from spleen and liver specimens, and was identified by its phenotypic characteristics. PCR with primers 1283, (GTG5, (GACA4 and M13 was used to compare both bat isolates with 17 human isolates, 12 from patients residing in Buenos Aires city, and 5 from other countries of the Americas. The profiles obtained with the four primers showed that both bat isolates were identical to each other and closer to Buenos Aires patients than to the other isolates (similarity percentage: 91-100% and 55

  5. Primer aislamiento e identificación de Ureaplasma spp y de Mycoplasma lipofaciens de gallinas comerciales en México

    OpenAIRE

    Ernesto Soto Priante; Clemente Lemus Flores; Ariel Ortiz Muñíz

    2011-01-01

    Durante un estudio realizado en México durante los años 2003 y 2004 se realizó el aislamiento de Ureaplasma spp (U. spp) y de Mycoplasma lipofaciens (M. lipofaciens) de la porción superior de la tráquea de aves comerciales vivas y sanas tipo White Leghorn (Gallus gallus domesticus). Se identificaron un total de 13 aislamientos de U. spp y 8 aislamientos de M. lipofaciens entre los 223 micoplasmas aislados. El aislamiento de U. spp se realizó en una sola granja avícola localizada en el estado ...

  6. Primer aislamiento de Encephalitozoon intestinalis a partir de muestra de materia fecal de un paciente colombiano con sida

    Directory of Open Access Journals (Sweden)

    Ana Luz Galván

    2008-09-01

    Full Text Available Introducción. Los microsporidios son agentes de infecciones oportunistas en pacientes con sida y con trasplantes, principalmente. Enterocytozoon bieneusi y Encephalitozoon intestinalis son los más frecuentes, asociados con infecciones entéricas. Los cultivos celulares han contribuido al conocimiento de los microsporidios. En Colombia no se han obtenido aislamientos provenientes de pacientes con microsporidiosis y, por consiguiente, no existen cepas autóctonas de los mismos. Objetivo. Establecer el cultivo celular de microsporidios intestinales a partir de materia fecal de pacientes parasitados. Materiales y métodos. Se realizó concentración agua-éter de la materia fecal positiva para microsporidios y el sedimento resultante se trató con una mezcla de antibióticos y antimicóticos durante 18 horas a 37 oC. Se inocularon células Vero previamente cultivadas en placas de 24 pozos y en medio RPMI con suplemento de suero bovino fetal al 10% y antibióticos, con las esporas concentradas. Los cultivos se mantuvieron a 37 oC al 5% de CO2. Se cambió de medio cada dos días y se evaluó la presencia de esporas en los sobrenadantes mediante Gram-cromótropo rápido en caliente. Resultados. En la segunda semana después de la infección, se encontraron esporas de microsporidios con morfología y coloración características. Mediante PCR se determinó que el microsporidio encontrado correspondía a la especie E. intestinalis. Conclusión. Se estableció el cultivo in vitro de microsporidios de materia fecal. Este protocolo es importante para la obtención y el mantenimiento de cepas autóctonas en Colombia, y contribuirá a las investigaciones de aspectos bioquímicos, inmunológicos y epidemiológicos de dichas cepas.

  7. Prevalence of the Helicobacter pylori babA2 gene and correlation with the degree of gastritis in infected Slovenian children.

    Science.gov (United States)

    Homan, Matjaž; Šterbenc, Anja; Kocjan, Boštjan J; Luzar, Boštjan; Zidar, Nina; Orel, Rok; Poljak, Mario

    2014-10-01

    The aims of our study were to determine the prevalence of the babA2 gene within Helicobacter pylori strains circulating in the Slovenian pediatric population, to further clarify its significance in causing inflammation of gastric mucosa in children and to verify whether cagA, vacA, iceA and babA genes work independently or synergistically in causing gastritis. A total of 163 H. pylori isolates obtained from the same number of children were tested for the presence of cagA, vacA and iceA genes using previously established methods, while the babA2 gene was determined using novel polymerase chain reaction assay targeting a 139-bp fragment of the central region of babA2. The babA2 gene was detected in 47.9% of H. pylori samples. The presence of the babA2 gene was strongly associated with cagA, vacA s1 and vacA m1 genotype. The babA2 status correlated positively with bacterial density score, activity of inflammation and chronic inflammation of gastric mucosa. No significant correlation was found between the babA2 status and the presence of atrophy or intestinal metaplasia. In addition, the activity of gastric inflammation and density score were significantly associated with the coexpression of the cagA, vacA s1, vacA m1 and babA2 genes. The study, which included the largest number of pediatric H. pylori samples to date, confirmed that babA2 gene plays an important role in the pathogenesis of H. pylori gastritis in children. Furthermore, our results suggest that babA2, cagA and vacA s1 and m1 gene products may work synergistically in worsening the inflammation of gastric mucosa.

  8. Primer aislamiento en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina

    OpenAIRE

    Errecalde, Laura; Ceriana, Paola; Gagetti, Paula; Erbín, Mariana; Duarte, Andrea; Rolón, María J.; Cuatz, Daniel; Corso, Alejandra; Kaufman, Sara

    2013-01-01

    Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a l...

  9. Helicobacter pylori strains harboring babA2 from Indian sub population are associated with increased virulence in ex vivo study.

    Science.gov (United States)

    Ghosh, Prachetash; Sarkar, Avijit; Ganguly, Mou; Raghwan; Alam, Jawed; De, Ronita; Mukhopadhyay, Asish K

    2016-01-01

    The babA2 gene along with the cagA and vacA of Helicobacter pylori has been considered as a risk factor for the disease outcome in certain populations. This study was aimed to understand the role of babA2 of H. pylori with the background of cagA and vacA in disease manifestations in Indian sub population. A total of 114 H. pylori strains isolated from duodenal ulcer (DU) (n = 53) and non-ulcer dyspepsia (NUD) patients (n = 61) were screened for the prevalence of these virulence markers by PCR. The comparative study of IL-8 production and apoptosis were done by co-culturing the AGS cell line with H. pylori strains with different genotypes. Adherence assay was performed with babA2 positive and negative strains. Two isogenic mutants of babA2 were constructed and the aforesaid comparative studies were carried out. PCR results indicated that 90.6 % (48/53), 82 % (50/61) and 73.6 % (39/53) strains from DU patients were positive for cagA, vacA, and babA2, respectively. Whereas the prevalence of these genes in NUD subjects were 70.5 % (43/61); 69.8 % (37/53), and 65.6 % (39/61), respectively. Although adherence to AGS cells was comparable among strains with babA2 positive and negative genotypes, but the triple positive strains could induce highest degree of IL-8 production and apoptosis, followed by the cagA (-)/vacA (-)/babA2 (+) strains and triple negative strains, respectively. The wild type strains showed significantly higher IL-8 induction as well as apoptosis in ex vivo than its isogenic mutant of babA2. PCR study demonstrated that there was no significant association between the distribution of babA2 genotype or of triple positive strains and disease outcome in this sub population. The adherence assay showed that there was no significant difference in the extent of adherence to AGS cells among babA2 positive and negative strains. But the ex vivo study indicated that the triple positive or even the babA2 only positive strains are involved in increased virulence. The wild type strains also exhibited increased virulence compared to the babA2 mutant strains. This inconsistency demonstrated that bacterial genotype along with host genetic polymorphisms or other factors play important role in determining the clinical manifestation of H. pylori infections.

  10. Primer aislamiento en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina

    Directory of Open Access Journals (Sweden)

    Laura Errecalde

    Full Text Available Describimos el primer caso en Argentina de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad con sensibilidad intermedia a la vancomicina y no sensibilidad a la daptomicina. Caso clínico: Paciente masculino, con antecedente de insuficiencia renal crónica en hemodiálisis y osteosíntesis de cadera debido a una fractura. Se internó por síndrome febril persistente luego del desplazamiento de la prótesis por un traumatismo. Se aisló de hemocultivos S. aureus resistente a la meticilina adquirido en la comunidad. Durante el tratamiento con vancomicina y daptomicina, se observó un aumento gradual de la CIM de vancomicina de 1 µg/ml (VSSA a 2 µg/ml (h-VISA y a 4 µg/ml (VISA, y la emergencia de no sensibilidad a daptomicina (CIM = 4 µg/ml. Al suspender la vancomicina y la daptomicina, la cepa revirtió al fenotipo de sensibilidad a ambas drogas. Es mandatorio evaluar por CIM la sensibilidad a vancomicina y a daptomicina intratratamiento cuando estas drogas se usan como terapia.

  11. Construction and characterization of recombinant attenuated Salmonella typhimurium expressing the babA2/ureI fusion gene of Helicobacter pylori.

    Science.gov (United States)

    Liu, Dong-sheng; Hu, Si-jun; Zhou, Nan-jin; Xie, Yong; Cao, Jun

    2011-10-01

    This study aimed to construct a live attenuated Salmonella typhimurium strain harbouring the Helicobacter pylori babA2 and ureI fusion gene, and to evaluate its immunogenicity. The babA2 and ureI fusion gene were cloned on an asd+ vector pYA3342 and expressed in attenuated S. typhimurium strain x8501 (Δasd). The level of babA2 and ureI fusion protein expression in S. typhimurium x8501 was examined by RT-PCR and Western blot tests. Stability of the recombinant x8501 (pYA3342/babA2/ureI) was determined after incubation for five days in vitro. The fusion gene, composed of 2860 base pairs, was inserted into the recombinant vector, as indicated by PCR amplification, endonuclease digestion and sequencing. Compared with the GenBank database, homologies of amino-acid sequences of the cloned babA2 and ureI were 100% and 97%, respectively. Recombinant fusion protein was recognized by commercial antibodies for whole-cell lysate of H. pylori. Furthermore, plasmids were able to stably reside in host bacteria. A prokaryotic expression system, recombinant live attenuated S. typhimurium expressing the H. pylori babA2 and ureI fusion gene, was successfully constructed, and the expressed fusion protein showed satisfactory immunoreactivity, thus offering a new candidate for prophylactic and therapeutic vaccines against H. pylori. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  12. Helicobacter pylori strains harboring babA2 from Indian sub population are associated with increased virulence in ex vivo study

    OpenAIRE

    Ghosh, Prachetash; Sarkar, Avijit; Ganguly, Mou; Raghwan,; Alam, Jawed; De, Ronita; Mukhopadhyay, Asish K.

    2016-01-01

    Background The babA2 gene along with the cagA and vacA of Helicobacter pylori has been considered as a risk factor for the disease outcome in certain populations. This study was aimed to understand the role of babA2 of H. pylori with the background of cagA and vacA in disease manifestations in Indian sub population. Methods A total of 114 H. pylori strains isolated from duodenal ulcer (DU) (n?=?53) and non-ulcer dyspepsia (NUD) patients (n?=?61) were screened for the prevalence of these virul...

  13. Aislamiento acústico

    Directory of Open Access Journals (Sweden)

    Tobío, J. M.

    1970-07-01

    Full Text Available This is a very specific subject in the field of architectural acoustics, namely, insulation'. Emphasis is placed on the theoretical foundations of this phenomenon, and the most simple formula are developed to calculate easily the transmission losses of a material or the constructional insulating arrangements. The practical aspect of insulation can be considered by means of several graphs and charts, without the use of mathematics, and utilising common materials, that will not substantially increase the cost of the project. Finally this papers offers a critical discussion of building codes, and their reference to the acoustical insulation of dwellings, and data is included on the new regulations of the Madrid Municipality.Se trata un tema muy concreto de la Acústica Arquitectónica, el aislamiento, haciendo hincapié en los fundamentos teóricos del fenómeno y estableciendo las fórmulas más sencillas que permiten calcular fácilmente las pérdidas de transmisión de un material o disposición constructiva aislante. Varias gráficas y abacos permiten abordar, sin ningún tratamiento matemático, el problema práctico del aislamiento, aprovechando los materiales comunes y sin ocasionar gastos que graven sustancialmente el importe del proyecto. Por último, se hace un estudio crítico de las normas y su incidencia en los problemas del aislamiento de viviendas, incluyendo datos referentes a la nueva Ordenanza del Ayuntamiento de Madrid.

  14. Hombre, calor y aislamiento

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1961-11-01

    Full Text Available Con los nuevos tipos estructurales y con los adelantos de las ciencias biológicas en lo que se refiere a los procesos orgánicos, mis ideas sobre aislamiento, y las de casi todos los demás arquitectos y constructores, han sufrido una evolución interesantísima en los últimos veinticinco años. Y me complace subrayar que los que, como yo, estudiamos el decorado humano, podemos hacer mucho en beneficio de nuestros clientes. No hace aún mucho tiempo toda la protección de una casa contra el peligro de transferencia térmica se confiaba exclusivamente a muros y cubiertas no aislantes. Los propietarios se limitaban a culpar al tiempo de su falta de confort. Pero esta falta de comodidad en cuanto a calefacción no era la única consecuencia; tras ella aparecían daños de efectos duraderos y patológicos.

  15. Reporte de primer caso humano de aislamiento y tipificación de Brucella abortus RB 51: first report in Chile Isolation and identification of Brucella abortus RB 51 in human

    OpenAIRE

    M. Villarroel; M. Grell; R. Saenz

    2000-01-01

    En el Laboratorio de Microbiología del Hospital Base de Osorno, se aisló una cepa de Brucella sp, que posteriormente se tipificó en el Laboratorio Regional de Diagnósticos del Servicio Agrícola y Ganadero, SAG Osorno. Esta cepa fue aislada de un hemocultivo realizado a un paciente con sintomatología clínica compatible con Brucelosis. El resultado de la tipificación fue Brucella abortus RB 51, cepa vaccinal que se presumía apatógena para el hombre. Este es el primer reporte a nivel mundial de ...

  16. Inversores bidireccionales con aislamiento en alta frecuencia para aplicaciones de energías renovables

    OpenAIRE

    Beristáin Jiménez, José Antonio

    2005-01-01

    En esta tesis se realiza el análisis y la síntesis de inversores bidireccionales con aislamiento en alta frecuencia. Entre las aplicaciones que se contemplan podemos destacar: sistemas de alimentación fotovoltaicos, sistemas de alimentación utilizando celdas de combustible, mini-generadores eólicos y compensación armónica. Hay dos grandes requerimientos para varias de estas aplicaciones. En primer lugar, es necesario proporcionar aislamiento eléctrico entre la fuente de corriente continua y l...

  17. Reporte histórico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de cólera en el Perú ‑ 1991 Historical report: first isolation of Vibrio cholera serogroup O1 biovar El Tor serovar Inaba during the cholerae epidemic in Perú ‑ 1991

    Directory of Open Access Journals (Sweden)

    Nora Bravo Cruz

    2011-03-01

    Full Text Available Hace 20 años apareció una enfermedad diarreica nueva en el Perú y el Laboratorio de Referencia de Enteropatógenos del Instituto Nacional de Salud, cumplió una labor destacada en el aislamiento e identificación rápida y oportuna del Vibrio cholerae. La enfermedad del cólera no se había presentado anteriormente, pero en la última semana de enero de 1991 se detectó un brote epidémico de diarrea aguda con deshidratación intensa y algunos casos de fallecidos. La epidemia afectó, al comienzo, varias localidades del litoral peruano. Equipos de trabajo de la Oficina General de Epidemiología y de los laboratorios del Instituto Nacional de Salud obtuvieron muestras fecales de pacientes con diarrea aguda procedentes de las ciudades de Chancay, Chimbote, Piura y algunos hospitales de Lima. Las muestras colectadas en el medio de transporte de Cary y Blair fueron procesadas en el Laboratorio Nacional de Referencia de Enteropatógenos (LANARE del Instituto Nacional de Salud. De todas las muestras se aisló e identificó Vibrio cholerae serogrupo O1 biovar El Tor serovar Inaba que mostró ser sensible a la tetraciclina y a otros antibióticos. Esta investigación confirmó el primer brote epidémico de cólera en el Perú.20 years ago, a new diarrheal disease was introduced in Peru and the Enteropathogens Reference Laboratory of the Instituto Nacional de Salud had an outstanding role in the isolation and rapid and timely identification of Vibrio cholerae. Cholera had not been seen before, but during the last week of January 1991 an outbreak of acute diarrhea was detected, presenting intense dehydration and some deaths. The epidemic affected, in the beginning, many locations of the peruvian coast. Some working teams of the General Office of Epidemiology and of the Instituto Nacional de Salud obtained fecal samples from patients with acute diarrhea coming from the cities of Chancay, Chimbote, Piura and some hospitals in Lima. The collected samples

  18. Mycobacterium bovis in Argentina: isolates from cats typified by spoligotyping Mycobacterium bovis en Argentina: aislamientos de gatos tipificados por spoligotyping

    Directory of Open Access Journals (Sweden)

    M. J. Zumárraga

    2009-12-01

    Full Text Available In the present work, 19 Mycobacterium bovis isolates from different cats were typified by spoligotyping. We detected nine spoligotypes. There was only one cluster, which grouped 11 of the isolates (57.9%, showing the main spoligotype from cattle from Argentina. The rest of the spoligotypes presented only one isolate each. Five of them were not found in cattle, and were unique and exclusive of cats. The isolates studied show that tuberculosis of bovine origin in cats constitutes a potential public health problem in Buenos Aires region. The identification of genotypes from non-natural hosts could contribute to understand the spread of bovine tuberculosis. This is the first report showing genetic profiles of M. bovis isolates in felines from Argentina.En el presente trabajo se tipificaron por spoligotyping 19 aislamientos de M. bovis de diferentes gatos. Se detectaron 9 espoligotipos y un único agrupamiento o cluster integrado por 11 aislamientos (57,9% y relacionado con el principal espoligotipo de bovinos de Argentina. El resto de los espoligotipos detectados presentaron solamente un aislamiento cada uno; 5 de ellos no se encontraron en bovinos y fueron únicos y exclusivos de gatos. La presencia de estos aislamientos indica que la tuberculosis bovina en los gatos constituye un potencial problema de salud pública en la ciudad de Buenos Aires. La identificación de genotipos de aislamientos de M. bovis de hospedadores no convencionales podría contribuir a la mejor comprensión de la diseminación de la tuberculosis bovina. Este es el primer informe en el que se muestran los perfiles genotípicos de aislamientos de M. bovis obtenidos de felinos de Argentina.

  19. Aislamiento de especies termotolerantes de Campylobacter en dos poblaciones de pollos criados con y sin confinamiento

    Directory of Open Access Journals (Sweden)

    Tresierra-Ayala Alvaro

    1995-01-01

    Full Text Available Se estudió la frecuencia del aislamiento de Campylobacter spp. en pollos domésticos y pollos mantenidos en confinamiento permanente, en la ciudad de Iquitos (Perú. Campylobacter spp. fue aislado en 54,0% en el primer grupo y 35,0% en el segundo (p<0,05. De las especies termotolerantes clásicas, las más frecuentes fueron C. jejuni y C. coli. La presencia de C. lari en estas aves, señala la importancia de ellas como reservorio natural de este microorganismo.

  20. AISLAMIENTO Y EVALUACIÓN IN VITRO DE ANTAGONISTAS DE Botrytis cinerea EN MORA

    Directory of Open Access Journals (Sweden)

    Jos\\u00E9 Alonso Calvo-Araya

    2012-01-01

    Full Text Available El objetivo de este estudio fue determinar la capacidad antagónica de hongos a Botrytis cinerea en el cultivo de la mora en Costa Rica. Durante el primer semestre del 2009 se aislaron 35 hongos filamentosos habitantes del carpoplano de frutos de mora, de los cuales seis cepas de Trichoderma fueron seleccionadas para su evaluación in vitro contra B. cinerea por medio de la técnica de cultivos duales. En la evaluación se determinó la competencia por sustrato y el efecto antibiótico. Para evaluar la competencia por sustrato se utilizó la escala de Bell y en el caso del efecto antibiótico se calculó el porcentaje de inhibición del crecimiento. Todas las cepas evaluadas compitieron eficientemente por sustrato contra B. cinerea, destacaron los aislamientos Lu13 y Lu15, que alcanzaron el grado I en la escala usada, donde el antagonista sobrepasó y creció sobre el patógeno cubriendo el 100% del medio de cultivo. Los restantes aislamientos de Trichoderma alcanzaron el grado II de antagonismo. En cuanto al efecto antibiótico, todos los aislamientos inhibieron el crecimiento micelial de B. cinerea, cuatro de ellos alcanzaron un valor mayor al 80% al ser evaluados en condiciones in vitro.

  1. Contención sin aislamiento

    OpenAIRE

    Mario Sánchez Gumiel

    2013-01-01

    En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, c...

  2. Metalo-ß-lactamasas en aislamientos clínicos de pseudomonas aeruginosa en Lima, Perú

    Directory of Open Access Journals (Sweden)

    Edgar Gonzales-Escalante

    2013-06-01

    Full Text Available Con el objetivo de detectar y caracterizar molecularmente las metalo-ß-lactamasas (MßL en aislamientos clínicos de Pseudomonas aeruginosa, se realizó un estudio trasversal en seis hospitales de referencia de Lima (Perú en agosto de 2011. Se evaluó 51 aislamientos de P. aeruginosa, resistentes a ceftazidima y con sensibilidad reducida a carbapenémicos. El ensayo fenotípico se realizó con el método de aproximación de discos con sustratos (ceftazidima, imipenem y meropenem y con ácido etilendiaminotetraacético (EDTA. La detección de genes MßL se realizó mediante la técnica de reacción en cadena de polimerasa multiplex. A través del método fenotípico se detectaron MßL en el 15,7% de los aislamientos, en todos ellos la detección de genes mostró la presencia del gen blaIMP. La descripción del primer reporte de MßL en aislamientos de P. aeruginosa en el Perú debería alertar a los equipos de vigilancia epidemiológica intrahospitalaria para promover su control y prevenir su diseminación.

  3. Contención sin aislamiento

    Directory of Open Access Journals (Sweden)

    Mario Sánchez Gumiel

    2013-02-01

    Full Text Available En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, como el Atlántico después de la Segunda Guerra Mundial, en el nuevo escenario geopolítico del siglo XXI.Palabras Clave: Estados Unidos, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Contención, Aislamiento, Corea, Vietnam, Tian’anmen, URSS, Comunismo, Capitalismo.___________________Abstract:On February 2012 took place the fourtieth anniversary of President Nixon’s visiting to China and, as a consequence, of the resumption of the Sino-American relations which had been interrupted in 1949. Since then, the United States and China have experienced a reciprocal policy of containment without isolation, both being aware of their mutual differences but knowing of the necessity of mutual understanding as well. As a result, the Pacific ocean is making changes, just as the Atlantic after the Second World War, in order to become the new geopolitical place of the Twenty First century.Keywords: United States, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Containment, Isolation, Korea, Vietnam, Tian’anmen, USSR, Communism, Capitalism.

  4. Consideraciones sobre aislamientos térmicos

    Directory of Open Access Journals (Sweden)

    García Arroyo, A.

    1966-06-01

    Full Text Available The yearly change in ambient temperature, and also the daily variations, become notably evident inside buildings. In extreme cases they cause considerable discomfort. This can be avoided by two means: insulation and heating or air conditioning. As each of these factors covers a wide range of possibilities, a detailed study of the physical factors, such as location, cost, climate, etc., makes it possible to find the most suitable materials, with the best overall thermal transmission factor (Ue, and the cheapest thickness (te of the insulating material.La variación anual de la temperatura externa, así como la diaria, se manifiesta de una manera notable en el interior de los edificios creando, en condiciones extremas, un inconfort evitable mediante la combinación apropiada de dos elementos: aislamientos y sistemas de calefacción o aire acondicionado. Dada la extensa gama de variación de cada uno de estos factores, haciendo un estudio detallado de sus propiedades físicas, situación, costes y clima de la región, encontramos el material más idóneo a emplear, coeficiente global de transmisión térmica (Ue del aislamiento y espesor (te más económico del material aislante.

  5. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DEL POTATO MOP-TOP VIRUS (PMTV

    Directory of Open Access Journals (Sweden)

    In\\u00E9s Osorio-Giraldo

    2013-01-01

    Full Text Available El objetivo de este trabajo fue evaluar los niveles de variación de aislamientos de PMTV en cultivos de papa de Colombia durante los años 2010 y 2011. Se obtuvieron secuencias de los genes de la cápside viral (CP, ARN 2 y del Triple Bloque de Genes (TGB2, ARN 3 de cepas de PMTV de los departamentos de Antioquia, Boyacá, Cundinamarca y Nariño. Adicionalmente, dos de los aislamientos fueron secuenciados en >83% de sus ARN 2 y 3. Los análisis filogenéticos basados en CP indicaron la presencia de dos clados. El primero contiene cepas de referencia mundial de PMTV en conjunto con 19 de las cepas de este estudio; mientras que el segundo clado sólo agrupó cepas de Colombia, las que compartieron menos de 76% de identidad con el primer grupo. Esto posiblemente indica la ocurrencia de una nueva especie de pomovirus, aunque se requiere secuenciación de todo el genoma para confirmar dicha hipótesis taxonómica. El análisis del TGB2 generó un solo clado, agrupando indistintamente las cepas colombianas de PMTV con las de otros países. El análisis de los segmentos 2 y 3 del genoma viral, indicó que los dos aislamientos colombianos secuenciados compartían >94% de identidad con las secuencias de cepas de República Checa y Suecia. Estos resultados pueden ser utilizados para el diseño de herramientas de diagnóstico del PMTV en los Andes, que apoyen los programas de certificación de tubérculo-semilla y mejoramiento genético de papa.

  6. Aislamiento de Sporothrix pallida complex en muestras clínicas y ambientales de Chile

    Directory of Open Access Journals (Sweden)

    Rodrigo M Cruz Choappa

    2014-12-01

    Full Text Available Se informa para Chile el aislamiento de S. pallida complex desde muestras médicas y del suelo del hogar de una paciente. Los hongos del complejo Sporothrix schenckii pueden causar distintas infecciones. En Chile, los aislamientos médicos y ambientales de este complejo son poco frecuentes. El objetivo de este trabajo fue identificar un agente atípico en un caso de onicomicosis y detectar su presencia en el suelo del jardín del hogar de la paciente. Para esto, las muestras clínicas se obtuvieron por raspado subungueal del primer dedo del pie derecho, y las muestras de suelo, de diferentes sectores del jardín. La identificación de las especies se realizó por morfofisiología y para la confirmación molecular se envió una de las cepas aisladas de la uña de la paciente al CBS (14.062. Se identificó S. pallida complex tanto de las muestras de uña como de aquellas provenientes del suelo del jardín.

  7. ESCUELAS-ISLA: UN AISLAMIENTO INSTITUCIONAL

    Directory of Open Access Journals (Sweden)

    Claudio Vergara Reyes

    2012-01-01

    Full Text Available Este trabajo trata acerca de un tipo de escuela en la realidad educativa chilena, denominada "escuela-isla", caracterizada por su aislamiento institucional del entorno social, económico, político, religioso y cultural. El concepto nace de una serie de reflexiones bajo el marco formativo de las prácticas pedagógicas tempranas, a partir de un conjunto de experiencias que configuran al centro de enseñanza y que resultan clave para la comprensión de la naturaleza del término. El documento hace una caracterización de este tipo de escuela, reconociendo cualidades que no son propias de una institución social. Asimismo, se propone y justifica la necesidad de un tipo de "alianza simbiótica" entre la organización educativa y el resto de organizaciones de la comunidad (red de enlace para complementar y potenciar su función educativa (formativa. Por último, se destaca la importancia de la interacción de la escuela con otras instituciones de la sociedad, y que tales vínculos constituyen una estrategia educativa para el desarrollo social y comunitario.

  8. Queratitis por Acanthamoeba sp.: primer caso confirmado por aislamiento y tipificación molecular en Bahía Blanca, provincia de Buenos Aires, Argentina Acanthamoeba sp. keratitis: first case confirmed by isolation and molecular typification in Bahía Blanca, Buenos Aires Province, Argentina

    Directory of Open Access Journals (Sweden)

    M. L. Gertiser

    2010-06-01

    Full Text Available Algunas especies del género Acanthamoeba provocan queratitis amebiana (QA, una infección de la córnea muy dolorosa, generalmente unilateral, con compromiso importante de la visión. Se presenta el caso de una mujer de 31 años usuaria de lentes de contacto con hábitos inadecuados de higiene y conservación de las lentes. La paciente consultó por enrojecimiento y dolor intenso en el ojo derecho, de dos meses de evolución. Luego del examen oftalmológico y ante la sospecha de una etiología parasitaria se realizó una biopsia de la zona lesionada, que se destinó al análisis bacteriológico y parasitológico en el laboratorio. También se remitieron los líquidos de lavado y el estuche de las lentes. No se detectó crecimiento bacteriano en las muestras. Los cultivos para la búsqueda de Acanthamoeba resultaron positivos en todos los especímenes analizados. Las amebas aisladas fueron clasificadas morfológica y molecularmente como pertenecientes al género Acanthamoeba. El presente trabajo muestra el primer caso de queratitis por Acanthamoeba de la ciudad de Bahía Blanca identificado por el laboratorio mediante procedimientos de alto valor diagnóstico.Some species of the Acanthamoeba genus cause keratitis, a very painful, most likely unilateral corneal infection , associated with eye and vision impairment. We here present a case of a 31-year-old female patient, a regular user of soft contact lenses without good practices of lens hygiene and handling. The patient attended medical consultation after two months of inflammation and pain in her right eye. After ophthalmological studies, and due to suspicion of a parasitic infection, a biopsy was performed and the sample submitted for bacteriological and parasitological analyses. Moreover, contact lens holders and lens cleaning solutions were studied. The samples yielded negative results for bacterial infection. However, cultivation of all samples showed the presence of amoeboid parasites

  9. Capital social versus aislamiento social: los jornaleros migratorios de Tamaulipas

    OpenAIRE

    Izcara Palacios,Simón Pedro; Andrade Rubio,Karla Lorena

    2012-01-01

    La importancia del capital social en la explicación de los procesos migratorios es un elemento en torno al cual existe un amplio consenso por parte de los teóricos de las migraciones; como contraste, el fenómeno contrario: el aislamiento de los migrantes de las redes sociales, ha recibido una menor atención por parte de la teoría migratoria. Mientras el capital social contribuye a limar las situaciones de pobreza, el aislamiento social deja a los individuos sin ninguna protección de los malos...

  10. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  11. Pathogenic and Genetic Diversity among Iranian Isolates of Macrophomina phaseolina Diversidad Patogénica y Genética entre Aislamientos Iraníes de Macrophomina phaseolina

    Directory of Open Access Journals (Sweden)

    Siavosh Rayatpanah

    2012-03-01

    Full Text Available Charcoal rot, caused by Macrophomina phaseolina (Tassi Goid., is an economically important disease of oilseed plants in Northern Iran. Seventy isolates of M. phaseolina were obtained from different hosts, including soybean (Glycine max L., and sunflower (Helianthus annuus L. in the northern oilseed planting regions of Iran. RAPD-PCR amplification profiles, by using of six random OPA primers (kit A showed polymorphisms among the isolates. The primer OPA-13 (5'_ CAGCACCCAC_3' amplified the genomic DNA of all isolates of M.phaseolina producing 4-12 bands of sizes between 0.25 and 2.3 kb. Unweighted pair-group method with arithmetic mean (UPGMA analysis classified the isolates into the nine major groups with 64% similarity. Pathogenicity of isolates was evaluated at seedling stage of soybean, sunflower, and maize (Zea mays L. plants under in vitro conditions. None of the isolates were pathogenic on corn, while all of the isolates infected soybean and sunflower seedlings. Isolates were more virulent on soybean than sunflower. The disease index on sunflower and soybean varied between 19-24 and 27-30 respectively. These results indicated a significant pathogenic and genetic variability within the Iranian isolates of M. phaseolina. Cultivation with crop rotation was probably tended to induce less diversity of the pathogen isolates.Pudrición carbonosa, causada por Macrophomina phaseolina (Tassi Goid., es una enfermedad de importancia económica de las plantas de semillas oleaginosas en el norte de Irán. Setenta aislamientos de M. phaseolina se obtuvieron de diferentes hospederos, incluyendo soya (Glycine max L. y girasol (Helianthus annuus L. en las regiones de plantación de semillas oleaginosas del norte de Irán. Perfiles RAPD-PCR de amplificación, utilizando primers aleatorios de seis OPA (kit A mostraron polimorfismos entre los aislamientos. El primer OPA-13 (5'-CAGCACCCAC-3' amplificó el ADN genómico de todos los aislamientos de M. phaseolina

  12. Heterocigosis y aislamiento: el caso de las poblaciones andinas

    Directory of Open Access Journals (Sweden)

    Acreche, Noemí

    2003-01-01

    Full Text Available Poblaciones de la Puna y del Valle Calchaquí de la Provincia de Salta, de las que se conoce su condición de aislamiento reproductivo, fueron estudiadas con el objeto de analizar si existe asociación entre los niveles de heterocigosis por individuo para grupos sanguíneos eritrocitarios y STRs y el lugar de origen de sus padres. A tales efectos se considera para acda individuo la proporción de loci heterocigotos y la pertenencia de sus padres a una de las siguientes categorías: ambos no migrantes, no migrante-migrante de corta distancia/migrante de larga distancia, ambos migrantes de larga distancia, migrante de corta distancia-migrante de larga distancia. Los grupos sanguíneos presentan mayor variabilidad en el Valle que en la Puna, de acuerdo a lo esperado por el grado de aislamiento y diferencias significativas en los promedios de heterocigosisi por individuo en ambas zonas. Por el contrario, los STRs mantienen valores constantes por lo que los análisis a partir de grupos sanguíneos reflejarían mejor las condiciones de aislamiento de las diferentes poblaciones. No se observó asociación entre las categorías definidas según la procedencia de los padres y la proporción de loci heterocigotos en los individuos.

  13. Genotipificación de aislamientos clínicos del complejo Cryptococcus neoformans/Cryptococcus gattii obtenidos en el Hospital «Dr. Julio C. Perrando», de la ciudad de Resistencia (Chaco, Argentina

    Directory of Open Access Journals (Sweden)

    Maria E Cattana

    Full Text Available La criptococosis es una infección fúngica causada por levaduras del género Cryptococcus, particularmente las del complejo Cryptococcus neoformans/Cryptococcus gattii. El conocimiento sobre la casuística de la criptococosis en el nordeste argentino es exiguo y no se tiene información sobre los tipos moleculares circulantes. El objetivo de este estudio fue realizar la caracterización genética de los aislamientos pertenecientes al complejo C. neoformans/C. gattii obtenidos en el Hospital «Dr. Julio C. Perrando» de la ciudad de Resistencia (Chaco, Argentina, con el fin de determinar especie, variedad y genotipo. Durante dos años y un mes se estudiaron 26 aislamientos clínicos. Mediante métodos convencionales y moleculares, un aislamiento fue identificado como C. gattii genotipo VGI y los 25 restantes como C. neoformans var.grubii, 23 de los cuales correspondieron al genotipo VNI y dos al genotipo VNII. Estos datos son una contribución al conocimiento de la epidemiología de la criptococosis en la Argentina y el primer informe sobre genotipos del complejo C. neoformans/C. gattii de origen clínico en el nordeste argentino.

  14. Susceptibility trends of Bacteroides fragilis group isolates from Buenos Aires, Argentina Tendencias en el perfil de sensibilidad de aislamientos del grupo Bacteroides fragilis obtenidos en Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    L. Fernández Canigia

    2007-09-01

    Standards Institute (CLSI, anteriormente NCCLS. En los tres períodos considerados, los antibióticos más activos frente a aislamientos de la especie B. fragilis como así también frente a aislamientos pertenecientes a otras especies del grupo B. fragilis fueron imipenem, con 99,1 y 100% de actividad, respectivamente, y metronidazol, con 100% de actividad. Con ampicilina-sulbactama se observó a lo largo del tiempo una disminución de la sensibilidad, desde el 100% en el primer período hasta un 90,3 y 82,4% en el último, para B. fragilis y para especies del grupo distintas de B. fragilis, respectivamente. Cuando se consideraron los tres períodos juntos, se observaron diferencias significativas entre la especie B. fragilis y los restantes aislamientos del grupo para cefoxitina, piperacilina y clindamicina (84,2% vs. 56,5%; 85,9% vs. 66,7% and 88,8% vs. 64,7%, respectivamente, p< 0.05. Cefoxitina fue el antibiótico que mostró mayores variaciones a través del tiempo y entre especies. Las tasas de sensibilidad a clindamicina fueron bajas (alrededor del 60% entre los aislamientos no pertenecientes a la especie B. fragilis durante los últimos dos períodos. Las variaciones observadas en los perfiles de sensibilidad del grupo B. fragilis muestran la necesidad de vigilar periódicamente la emergencia de resistencia a los antimicrobianos, a fin de orientar el tratamiento de las infecciones por bacterias anaerobias.

  15. Aspectos económicos del aislamiento acústico

    Directory of Open Access Journals (Sweden)

    Amarilla, Beatriz C.

    1990-12-01

    Full Text Available The general objective of this study was to analyze the soundproofing/cost ratio with different building alternatives for interior walls and floors. This technical-economic study was divided into three parts: — Dividing walls (environmental noises — Floors (impact noises — Special Solutions (double walls, floating floors, etcetera The results show that in developing countries the most costly solutions are not always the best for housing, as far as soundproofing is concerned. A good knowledge of the economic aspects related to this matter allows obtaining a good quality at a moderate cost, which is a priority in this type of country.

    El objetivo general de este trabajo fue el de analizar el comportamiento de la relación costo-aislamiento acústico en soluciones constructivas alternativas para muros interiores y entrepisos. Este estudio técnico-económico comprende tres partes: * Muros divisorios (ruidos aéreos. * Entrepisos (ruidos de impacto. * Soluciones especiales (muros de doble hoja, pisos flotantes, etc. Se llega a la conclusión que, en los países en desarrollo, no siempre las mejores soluciones para la vivienda, desde el punto de vista acústico, son las de mayor costo. Conocer en profundidad los aspectos económicos de esta cuestión significa poder lograr una buena calidad con costos moderados, lo cual constituye una prioridad en este tipo de países.

  16. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  17. Perfiles de resistencia a fluoroquinolonas en aislamientos clínicos de cocos Gram positivos provenientes de hospitales colombianos, 1994-2004

    Directory of Open Access Journals (Sweden)

    César A. Arias

    2008-06-01

    Conclusión. Los aislamientos colombianos de S. pneumoniae mantienen susceptibilidad a las fluoroquinolonas de última generación. La resistencia a fluoroquinolonas es alta en S. aureus, especialmente en aislamientos resistentes a la meticilina (cercana al 100%.

  18. Aislamiento geográfico y disponibilidad del internet en las escuelas mexicanas

    Directory of Open Access Journals (Sweden)

    Djamel Toudert

    2016-01-01

    Full Text Available El artíulo examina el impacto del aislamiento en la disponibilidad de la Internet en los diferentes ámbitos de sostenimiento, el tipo y el nivel escolar y, la ubicación socioterritorial de las escuelas en México. La investigación se realizó con información del último censo de escuelas y datos que permitieron elaborar un indicador de aislamiento. Los resultados obtenidos con pruebas de independencia y de distribución cuantitativa nos permiten confirmar la importancia de relación entre el aislamiento geográfico y la disponibilidad de la Internet. Además, esta vinculación parece afectar aún más a los centros escolares que desempeñan una misión de integración en entornos marginados.

  19. Necesidad del aislamiento térmico en la edificación actual

    Directory of Open Access Journals (Sweden)

    Alamán, A.

    1972-09-01

    Full Text Available The author attempts to clear up a few ideas on this subject, as not everyone knows enough about its correct use: what is meant by thermal insulation and thermal conductivity, essential requirements with respect to material, lightweight and heavy insulation, justification of insulation for reasons of building evolution, comfort, economy and to avoid condensation, as well as the influence of openings in outside walls.El autor trata de aclarar algunos conceptos sobre esta materia, ya que, en realidad, no todos conocen adecuadamente su correcto empleo: qué se entiende por aislamiento térmico y por conductividad térmica, condiciones que deben exigirse a los materiales, aislamientos ligeros y pesados, justificación del aislamiento por razones de evolución de la construcción, de confort, de economía y para evitar condensaciones, así como la influencia de los huecos en las fachadas.

  20. Aislamiento geográfico y disponibilidad del internet en las escuelas mexicanas

    OpenAIRE

    Djamel Toudert

    2016-01-01

    El artíulo examina el impacto del aislamiento en la disponibilidad de la Internet en los diferentes ámbitos de sostenimiento, el tipo y el nivel escolar y, la ubicación socioterritorial de las escuelas en México. La investigación se realizó con información del último censo de escuelas y datos que permitieron elaborar un indicador de aislamiento. Los resultados obtenidos con pruebas de independencia y de distribución cuantitativa nos permiten confirmar la importancia de relación entre el aisla...

  1. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DEL POTATO MOP-TOP VIRUS (PMTV)

    OpenAIRE

    In\\u00E9s Osorio-Giraldo; Pablo Guti\\u00E9rrez-S\\u00E1nchez; Mauricio Mar\\u00EDn-Montoya

    2013-01-01

    El objetivo de este trabajo fue evaluar los niveles de variación de aislamientos de PMTV en cultivos de papa de Colombia durante los años 2010 y 2011. Se obtuvieron secuencias de los genes de la cápside viral (CP, ARN 2) y del Triple Bloque de Genes (TGB2, ARN 3) de cepas de PMTV de los departamentos de Antioquia, Boyacá, Cundinamarca y Nariño. Adicionalmente, dos de los aislamientos fueron secuenciados en >83% de sus ARN 2 y 3. Los análisis filogenéticos basados en CP indicaron la presencia ...

  2. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  3. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  4. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  5. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  6. OPTIMIZACIÓN DE UN PROTOCOLO DEL AISLAMIENTO DEL ADN Y DE UN SISTEMA DE AMPLIFICACIÓN ISSR-PCR PARA Ceratozamia mexicana Brongn. (Zamiaceae.

    Directory of Open Access Journals (Sweden)

    Nadia Guadalupe Sánchez-Coello

    2012-01-01

    Full Text Available La mayoría de las cícadas contienen altas concentraciones de aceites esenciales, flavonoides, polifenoles y polisacáridos que interfieren en la extracción de ADN, causando productos de amplificación errados o inhibiendo la PCR. La optimización del aislamiento del ADN y el empleo de iniciadores de secuencias intergénicas repetidas simples (ISSRs se investigaron en Ceratozamia mexicana Brongn., una cícada mexicana en peligro de extinción. El ADN obtenido de tejido foliar fresco, con un amortiguador modificado de cetil trimetil amonio, nos permitió obtener un ADN de buena calidad, sin pigmentos coloridos o contaminantes. La modificación al protocolo de extracción de ADN, basado en CTAB, fue un prelavado por 1 h, del tejido foliar, con una solución de 0.7 M de NaCl, para facilitar la lisis celular. El ADN extraído exitosamente se amplificó por PCR, usando seis iniciadores arbitrarios ISSR. Se observaron productos de amplificación reproducibles en todas las reacciones de PCR. Nuestros resultados muestran que la implementación mejora significativamente la calidad del ADN obtenido, usando una concentración baja de iniciadores (25 pM. Se detectaron 23 bandas fuertes, nueve de las cuales fueron polimórficas. Los resultados indican que el protocolo de optimización del aislamiento del ADN y en el sistema de PCR es viable para futuros trabajos en esta especie. Este trabajo es el primer protocolo de extracción de ADN y de ISSR reportado para esta especie ornamental en peligro de extinción.

  7. Migración irregular y aislamiento social. Los jornaleros tamaulipecos indocumentados en los Estados Unidos

    Directory of Open Access Journals (Sweden)

    Izcara-Palacios, Simón Pedro

    2010-08-01

    Full Text Available “Social isolation” is a concept poorly developed in the analysis of poverty. “Social exclusion” and “marginality” are concepts more frequently used. “Social isolation” refers to an erosion of the relational sphere of the individual (i.e.: it is a lack of familial support and/or social networks, and an absence of social activity and recreational interaction. Moreover, “social isolation” is associated with anxiety and depression symptoms. This paper analyses the situation of “social isolation” of Tamaulipas’ undocumented farm workers employed in the United Stated.

    El concepto de “aislamiento social” ha sido insuficientemente utilizado en el análisis de la pobreza. “Exclusión social” y “marginalidad” son dos conceptos más desarrollados. El “aislamiento social” hace referencia a una erosión de las esferas relacionales del individuo (esto es, a una falta de soporte familiar y/o redes sociales, y a una ausencia de actividad social e interacción recreacional. Más aún, el “aislamiento social” está asociado a síntomas de ansiedad y depresión. Este artículo analiza la situación de aislamiento social de los jornaleros indocumentados tamaulipecos empleados en los Estados Unidos.

  8. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  9. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  10. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  11. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5 recuperados entre 1994 y 2004.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    2006-06-01

    Full Text Available Introducción. Streptococcus pneumoniae serotipo 5 es causa importante de enfermedad invasora en Colombia, donde se ha demostrado la circulación del clon 19-Colombia(5 susceptible a penicilina pero resistente a tetraciclina y a cloranfenicol. Objetivo. Establecer las relaciones genéticas de aislamientos invasores colombianos de S. pneumoniae serotipo 5 recuperados entre 1994 y 2004 con el clon 19-Colombia(5. Materiales y métodos. Se estudiaron 83 aislamientos que tenían datos de susceptibilidad a penicilina, vancomicina, ceftriaxona, eritromicina, trimetoprim sulfametoxazol, cloranfenicol y tetraciclina, de los cuales 29 fueron obtenidos de niños menores de cinco años. El patrón de restricción del ADN se determinó por electroforesis en gel de campo pulsado, usando la enzima Sma I. La similitud genética entre los aislamientos y el clon se estableció según los criterios de Tenover y utilizando el programa Fingerprinting II. Resultados. Todos los aislamientos se relacionaron con el clon 19-Colombia5 y se agruparon en el patrón electroforético A con 17 subtipos. El patrón A se estableció en 32 aislamientos (38,6%, el A8 en 18 (21,7% y el A5 en 10 (12%, los 15 patrones restantes agruparon los otros 23 aislamientos. Los 34 aislamientos resistentes a tetraciclina y cloranfenicol mostraron relación con los patrones electroforéticos A (n = 32, A16 (n = 1 y A28 (n = 1, caracterizados, al igual que el clon, por presentar una banda de 340 Kb. Conclusión. Estos resultados muestran la circulación continua en el país de aislamientos de S. pneumoniae serotipo 5 genéticamente relacionados con el clon 19-Colombia(5.

  12. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  13. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  14. Aislamientos de Staphylococcus aureus sensibles a meticilina relacionados genéticamente con el clon USA300, ¿origen de los aislamientos SARM de genotipo comunitario en Colombia?

    Directory of Open Access Journals (Sweden)

    Javier Antonio Escobar-Pérez

    2014-04-01

    Full Text Available Introducción. USA300 es un linaje genético que se encuentra en aislamientos de Staphylococcus aureus sensibles (SASM y resistentes a meticilina (SARM. Actualmente, en Colombia las infecciones por SARM en hospitales y en la comunidad son causadas principalmente por un clon con genotipo comunitario (SARM-GC relacionado genéticamente con el clon USA300. El origen de esta variante es aún desconocido. Objetivo. Identificar y caracterizar aislamientos de S. aureus resistentes y sensibles a meticilina con el fin de aportar información para establecer un posible origen de los aislamientos SARM-GC en Colombia. Materiales y métodos. Se realizó una caracterización de aislamientos SASM relacionados con el clon USA300 detectados a partir de un análisis de 184 aislamientos de S. aureus (90 SARM y 94 SASM causantes de infecciones. La relación genética de los aislamientos se determinó por electroforesis en gel de campo pulsado (PFGE, tipificación de secuencias multilocus (MLST y tipificación del gen de la proteína A (spa. Resultados. De los 184 aislamientos, 27 (14,7 % presentaron características moleculares y relación genética con el clon USA300, y de ellos, 18 fueron SARM y nueve fueron SASM. Todos los aislamientos SARM relacionados con este clon albergaban un casete estafilocócico cromosómico mec (SCCmec IVc (3.1.2. En ningún aislamiento SASM se detectaron secuencias remanentes de SCCmec o una duplicación del sitio attB que evidenciaran la pérdida del casete. Conclusión. El origen de los aislamientos SARM-GC en Colombia probablemente se encuentre en la diseminación de clones SASM relacionados con el clon USA300 que adquirieron el SCCmec IVc posteriormente.

  15. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  16. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos?

    Directory of Open Access Journals (Sweden)

    V. López

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.

  17. Una revisión del fenómeno de aislamiento magnético

    Directory of Open Access Journals (Sweden)

    Zósimo Arévalo Velosa

    2007-09-01

    Full Text Available Los dispositivos de alta energía son diseñados para que funcionen con campos eléctricos y magnéticos extrema-damente altos. Debido a esto, dichos dispositivos presentan fenómenos y comportamientos no lineales, como el aislamiento magnético que altera el transporte de los electrones. La no linealidad ha obligado a analizar y revisar desde el punto de vista matemático las condiciones de frontera y las soluciones del problema. El objetivo de este trabajo es exponer el tema a un nivel que facilite su difusión entre la comunidad académica no familiarizada con el mismo. Para ello, el trabajo presenta una descripción de los fenómenos que se generan cuando hay campos eléctricos y magnéticos muy altos, tomando el caso de un diodo plano al vacío, así como las ecuaciones que modelan el fenómeno de aislamiento magnético; también demuestra la existencia de las soluciones y encuentra las positivas en base a los métodos de solución superior e inferior para problemas de valor de frontera, y pro-porciona algunos ejemplos de aplicación del fenómeno de aislamiento magnético.

  18. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  19. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  20. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  1. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  2. Aislamiento de virus rábico de murciélagos en colombia, s. a.

    OpenAIRE

    Morales Alarcón, A.; Osorno-Mesa, E.; Bernal Cubides, C.; Lleras Pizarro, A.

    2012-01-01

    Se intentó el aislamiento de virus rábico en 919 murciélagos, más 83 sin clasificar que no se incluyen en el cuadro, insectívoros y frugívoros procedentes de 3 zonas de Colombia. Las especies estudiadas fueron las siguientes: Corollia perspicillata, Myotis nigricans, Lasiurus ega, Artibeus Lituratus palmarum, Vampyrops helleri, Trachops cirrhosus cirrhosus, Glossophaga longirostris, Saccopteryx bilineata, Molossus molossus, Peropteryx kappleri, Phyllostomus hastatus.  No se encontró ningún ej...

  3. Aislamiento de Escherichia coli K88 en diarreas de cerdos y niños

    OpenAIRE

    Manzullo, Alfredo; Borsella, Maria Graciela

    1985-01-01

    En los últimos años, en los países menos desarrollados, han aparecido brotes, cada vez con mayor frecuencia, de diarreas infantiles, considerados por algunos autores, como uno de los problemas sanitarios más complejos por su diversidad etiológica, hecho este, que puede provocar repetidos episodios diarreicos en el mismo grupo poblacional sensible, generalmente en los primeros dos años de vida. La presente comunicación, tiene por objeto relatar el aislamiento de Escherichia coli enterotóxica (...

  4. Sensibilidad antimicrobiana in vitro en aislamientos de Enterococcus faecalis y Enterococcus faecium obtenidos de pacientes hospitalizados

    Directory of Open Access Journals (Sweden)

    Manuel Medell

    2014-04-01

    Full Text Available Introducción. Actualmente se considera a Enterococcus spp. como uno de los agentes de infección hospitalaria más importantes, siendo su resistencia a los antibióticos un problema importante en los centros de salud. Objetivos. Caracterizar la resistencia antimicrobiana en 50 cepas de Enterococcus spp. aisladas de muestras clínicas de pacientes hospitalizados. Materiales y métodos. Se llevó a cabo un estudio de tipo descriptivo observacional de corte transversal en 50 aislamientos clínicos de estas especies microbianas. Se trabajó un aislamiento por paciente. La identificación y la sensibilidad a los antibióticos se realizaron por métodos automatizados y convencionales. El análisis fenotípico de los mecanismos de resistencia a glucopéptidos se hizo según las recomendaciones de la Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. Resultados. De 50 aislamientos, 30 (60,0 % y 20 (40,0 % pertenecían a las especies de Enterococcus faecalis y Enterococcus faecium, respectivamente. La resistencia global expresada por este género fue de 38/50 (76,0 % para ampicilina; 33/50 (66,0 % para gentamicina de alto nivel; 34/50 (68,0 % para estreptomicina de alto nivel; 26/50 (52,0 % para ciprofloxacina; 4/50 (8,0 % para linezolid; 17/50 (34,0 % para teicoplanina; 25/50 (50,0 % para vancomicina; 31/50 (62,0 % para minociclina; 34/50 (68,0 % para tetraciclina y 9/50 (18,0 % para nitrofurantoina. Frente a los glucopéptidos, 25/50 (50,0 % y 10/50 (20,0 % de los aislamientos presentaron los mecanismos Van A y Van B, respectivamente. Conclusiones. Podemos concluir que la mayoría de las veces, las cepas aisladas en el Hospital Hermanos Ameijeiras mostraron porcentajes de resistencia por encima de lo reportado en la literatura científica consultada. El alto porcentaje de cepas con resistencia a la vancomicina podría influir en la aparición de otros gérmenes Gram positivos con resistencia a este fármaco. Se reporta por

  5. Cajones con aislamiento térmico para uso de las lanchas de fibra de vidrio del sector artesanal

    OpenAIRE

    Wood, C.D.; Grijalva, M.

    1988-01-01

    Se construyeron tres tipos de cajones de madera en su exterior con aislamiento térmico usando materiales que se encuentran disponibles en el Ecuador. El primero fue hecho de madera y polietileno como aislante; el segundo con acero galvanizado en la parte interna, encima del aislamiento de polietileno, y el tercero con fibra de vidrio y resina en el interior, usando como aislante poliuretano. El cajón con fibra de vidrio fue más costoso pero parecía ser el mejor en términos de su peso y resist...

  6. Aislamiento social y soledad: ¿qué podemos hacer los equipos de atención primaria?

    OpenAIRE

    Joan Gené-Badia; Marina Ruiz-Sánchez; Núria Obiols-Masó; Laura Oliveras Puig; Elena Lagarda Jiménez

    2016-01-01

    La soledad y el aislamiento social son condicionantes de salud emergentes en la población anciana, especialmente en las personas viudas, hiperfrecuentadoras y con problemas crónicos y depresión. La soledad es la sensación subjetiva de tener menor afecto y cercanía de lo deseado en el ámbito íntimo o relacional. El aislamiento social es la situación objetiva de contar con mínimos contactos con otras personas. Su contribución al incremento de la morbimortalidad es comparable al de otros factore...

  7. Caracterización molecular de un aislamiento cubano de parvovirus canino

    Directory of Open Access Journals (Sweden)

    Anniet Fresneda-Disotuar

    2015-12-01

    Full Text Available El parvovirus canino tipo 2 (VPC-2 es el agente causal de una enfermedad infecto-contagiosa que produce gastroenteritis aguda hemorrágica que afecta a caninos jóvenes. El VPC-2 es un virus con genoma ADN, pequeño, desnudo y muy resistente a las condiciones ambientales que emergió y se expandió rápidamente a fines de la década de los años 70. En los años 80 surgieron consecutivamente dos variantes antigénicas, denominadas VPC-2a y VPC-2b. En el 2000 se detectó una nueva variante antigénica llamada VPC-2c, reportándose con frecuencia en comunidades caninas de varios países del mundo. El objetivo de este trabajo consistió en caracterizar un aislamiento cubano de parvovirus canino, atenuado y adaptado a cultivo celular. El material genético fue amplificado por reacción en cadena de la polimerasa y secuenciado posteriormente. Las secuencias obtenidas fueron analizadas y comparadas con secuencias de aislados y cepas conocidas depositadas en las bases de datos, donde se evidenció que el aislamiento cubano era del tipo VPC-2.

  8. Caracterización fenotípica de aislamientos ambientales de Cryptococcus neoformans.

    Directory of Open Access Journals (Sweden)

    Sandra Huérfano

    2003-09-01

    Full Text Available La criptococosis es causada por las tres variedades de Cryptococcus neoformans, las cuales presentan diferencias fisiológicas y de virulencia, algunas de las cuales se han estudiado para reconocer aspectos de su biología. Este trabajo evaluó las características fenotípicas de aislamientos ambientales de las variedades grubii y gattii, con el fin de establecer diferencias asociadas con el ciclo de vida y la virulencia. Se estudiaron 28 aislamientos serotipo A y 31 serotipo C. Se evaluaron la morfología macroscópica y microscópica de blastoconidias cultivadas en agar Sabouraud y suelos, el crecimiento a 37 °C, la producción de 22 enzimas extracelulares, la frecuencia del fenómeno de fructificación haploide, la pareja sexual, el patrón de sensibilidad a toxinas asesinas (killer y la virulencia en ratones Balb/c. No se observaron diferencias entre las dos variedades en la morfología macroscópica, la microscópica, ni en el crecimiento a 37 °C (p>0,05; sin embargo, se observó disminución del tamaño celular y capsular de blastoconidias cultivadas en suelo comparado con el tamaño en Sabouraud (p

  9. Detección y aislamiento de fallas en el sistema térmico IFATIS

    Directory of Open Access Journals (Sweden)

    Salvador Saucedo-Flores

    2012-01-01

    Full Text Available Se resuelve el problema de detección y aislamiento de fallas para una planta piloto no lineal, orientada a desarrollar algoritmos de tolerancia a las fallas, auspiciada por la Unión Europea. Se retoma una forma novedosa de modelar las fallas de los sensores, de manera que cada falla física sea asociada a un conjunto adecuado de fallas matemáticas. Ello permite, mediante geometría diferencial, diseñar un FDI no lineal ligeramente extendido para tomar en cuenta la estructura del sistema. Se describen las técnicas del modelado, el diseño de los generadores de los residuales, la matriz de residuales y se termina con la simulación de sistema térmico de tres tanques del proyecto europeo IFATIS.

  10. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  11. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  12. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  13. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  14. Aislamiento, propagación y crecimiento de hongos comestibles nativos en residuos agroindustriales

    Directory of Open Access Journals (Sweden)

    Winston Franz Ríos - Ruiz

    2017-01-01

    Full Text Available La investigación tuvo como objetivo aislar el micelio secundario de Auricularia spp y Pleurotus spp procedente de tres áreas naturales de la región San Martín, así como evaluar el crecimiento en medio agar papa dextrosa y en sustratos estériles a base de residuos agroindustriales. Se obtuvieron 10 aislamientos de micelios secundarios a través de carpóforos desinfectados d e Pleurotus spp y otros 10 aislamientos de carpóforos desinfectados de Auricularia spp. La mayor velocidad de crecimiento en Auricularia spp fue de 62,5 μm h - 1 (A1 y de 75 μm h - 1 (B10 para Pleurotus spp. En una segunda parte del experimento se produjo se milla de las cepas nativas más veloces en granos de maíz esterilizado durante un periodo de incubación de 40 días. La semilla fue inoculada en sustratos estériles a base de residuos agroindustriales. Las cepas A1 de Auricularia spp y B10 de Pleurotus spp d esarrollaron mejor en sustrato a base de residuos de pulpa de café, logrando una eficiencia biológica de 30,33% y 18,20%, respectivamente. Se concluye que las cepas nativas A1 y B10 de hongos comestibles pueden ser utilizadas en la propagación de semilla y producción de hongos comestibles, brindando al agricultor una alternativa complementaria de alto valor nutritivo.

  15. Genotipificación de aislamientos de Bartonella bacilliformis por amplificación de elementos repetitivos mediante el uso de REP-PCR y ERIC-PCR

    Directory of Open Access Journals (Sweden)

    Carlos Padilla R

    2003-07-01

    Full Text Available Objetivos: Genotipificar los aislamientos de Bartonella bacilliformis a través de la amplificación de elementos repetitivos mediante el uso de ERIC-PCR y REP-PCR, y determinar si existe variabilidad genética entre aislamientos de varias zonas endémicas. Materiales y Métodos: Se evaluaron mediante el uso del ERIC-PCR y REP-PCR 17 aislamientos de B. bacilliformis de Lima, Cusco y Ancash. Los aislamientos fueron realizados durante los años 1998 y 1999. Para el análisis de los patrones de bandas se usó el software GelCompar 4,0. Resultados: Fueron identificados en los 17 aislamientos 10 genotipos. Los genotipos D, E y H fueron detectados en Cusco; mientras que los genotipos B, C, G, J e I en Lima; y el genotipo F en Ancash. Conclusiones: Nuestros resultados sugieren que REP-PCR y ERIC-PCR son métodos útiles para genotipificar aislamientos de B. bacilliformis. La variabilidad genética debe ser tomada en cuenta en estudios epidemiológicos y clínicos de Bartonelosis; así como el desarrollo de nuevas técnicas diagnósticas y de vacunas.

  16. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  17. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  18. La situación sociolaboral de los migrantes internacionales en la agricultura: irregularidad laboral y aislamiento social

    Directory of Open Access Journals (Sweden)

    Simón Pedro Izcara Palacios

    2009-01-01

    Full Text Available Los jornaleros inmigrantes constituyen uno de los grupos sociales más pobres de las comarcas agrarias de Estados Unidos y España. Los trabajadores agrarios migratorios viven en áreas remotas y sufren de malnutrición, salarios bajos, alta movilidad laboral, condiciones laborales precarias y ambientes laborales inadecuados. Por una parte, el sector agrario, que constituye un refugio laboral para los trabajadores ilegales, opera fuera del mercado laboral formal; por otra parte, los jornaleros padecen un grave problema de "aislamiento social", esto ha sido señalado como una de las principales causas de falta de bienestar de éstos. El artículo analiza, de modo comparativo, la situación de irregularidad laboral y aislamiento social de los jornaleros tamaulipecos empleados en la agricultura estadounidense y los trabajadores marroquíes empleados en el sector agrario andaluz.

  19. AISLAMIENTO DE MICROORGANISMOS INOCUOS PRODUCTORES DE SIDERÓFOROS PARA SISTEMAS DE FITORREMEDIACIÓN

    Directory of Open Access Journals (Sweden)

    Guillermo M. Carrillo-Castañeda

    2011-11-01

    Full Text Available La contaminación del suelo reduce la producción y calidad de los alimentos. Para la recuperación de suelos contaminados la fitorremediación compite favorablemente con costosos métodos físicos y químicos. En este trabajo fueron colectadas muestras de suelo y de raíz de plantas silvestres en nueve sitios en el predio del Colegio de Posgraduados, Campus Montecillo. Después de determinar el pH de las muestras de suelo, del sobrenadante se estriaron muestras en medio sólido B de King. Del ápice de raíces se obtuvieron muestras para estriarlas en el mismo medio y las cajas fueron incubadas a 26-28 °C. De 223 aislamientos bacterianos obtenidos, 23 fueron seleccionados por producir pigmentos fluorescentes y ser inocuos. Dos aislamientos de suelo (2S-10, 2S-9 y uno de raíz (2R-2 fueron los de mayor producción de pigmentos fluorescentes. La semilla de alfalfa inoculada con células de los aislamientos 2S-10, 2R-2, y 2S-9 germinó en 78, 56, y 88 %, respectivamente mientras que la semilla sin inocular germinó en 88 %. En una prueba preliminar, resaltó el mayor desarrollo de las plántulas inoculadas con el aislamiento 2S10. Mediante la interacción planta-microorganismo se logra acrecentar la potencialidad de las plantas para acumular metales y hacer más eficiente el proceso de fitorremediación.

  20. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5, recuperados entre 1994 y 2004

    Directory of Open Access Journals (Sweden)

    Sandra Carolina Firacative Ropero

    2006-01-01

    resistentes a tetraciclina y cloranfenicol, estuvieron relacionados con el patrón electroforético A (n=32 y los subtipos A16 (n=1 y A28 (n=1, caracterizados por presentar una banda de 340 Kb, al igual que el clon. Estos resultados muestran la prevalencia y circulación continua de aislamientos de S. pneumoniae serotipo 5, los cuales están genéticamente relacionados con el clon 19-Colombia.

  1. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE HERPESVIRUS BOVINO TIPO 1

    Directory of Open Access Journals (Sweden)

    D. Piedrahita

    2005-01-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  2. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE Herpesvirus bovino TIPO 1

    Directory of Open Access Journals (Sweden)

    Vera V.

    2005-11-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  3. Evaluación de la técnica de MSP-PCR para la caracterización molecular de aislamientos de Rhodotorula mucilaginosa provenientes de la Patagonia noroccidental Assessment of the MSP-PCR technique for the molecular characterization of Rhodotorula mucilaginosa isolates from northwestern Patagonia

    Directory of Open Access Journals (Sweden)

    D. Libkind

    2007-09-01

    Full Text Available La identificación rápida de levaduras de origen ambiental o clínico es de importancia para el estudio de la biodiversidad de estos microorganismos y para la detección de posibles patógenos. Rhodotorula mucilaginosa es una levadura ubicua y pigmentada, capaz de producir infecciones en pacientes inmunocomprometidos. En este trabajo se evaluó la utilidad de la técnica de fingerprinting conocida como MSP-PCR (Micro/Minisatellite-Primed PCR en la caracterización e identificación de aislamientos ambientales de R. mucilaginosa provenientes de la Patagonia noroccidental. Sobre la base de sus caracteres fenotípicos, de un total de 200 levaduras pigmentadas se seleccionaron 110 aislamientos que presuntamente corresponderían a la especie R. mucilaginosa. Se evaluaron los iniciadores (GTG5, (GAC5 y M13 en aislamientos representativos, y se seleccionó el iniciador (GTG5 por ser el que permitió una mejor agrupación de los aislamientos pertenecientes a R. mucilaginosa y una mejor diferenciación de éstos con los de especies filogenéticamente próximas. Utilizando dicho iniciador, el 87% de los aislamientos de R. mucilaginosa presentó un perfil de MSP-PCR similar (> 60% al de la cepa de referencia CBS 316T de R. mucilaginosa. La técnica de MSP-PCR resultó efectiva, tanto para caracterizar e identificar un número elevado de aislamientos ambientales de R. mucilaginosa como para detectar polimorfismos en la especie.The rapid identification of environmental or clinical yeast isolates is important for biodiversity studies and the detection of probable pathogens. Rhodotorula mucilaginosa is a ubiquitous and pigmented yeast capable of infecting immunocompromised patients. In this study, we evaluated the Micro/mini satellite-primed PCR (MSP-PCR fingerprinting method for the characterization and identification of R. mucilaginosa isolates from natural environments in northwestern Patagonia. There were selected 110 putative R. mucilaginosa isolates

  4. Biological characterization of Citrus tristeza virus strains in lemon in Tucumán, Argentina Caracterización biológica de aislamientos del virus de la tristeza de los cítricos de limoneros en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Julia Figueroa

    Full Text Available Tucumán province is the largest lemon producer in the world, with a production of 1.3 million tons. Unfotunality, tristeza disease has been present in Argentina since 1930 and is endemic. Citrus tristeza virus isolates from the main lemon varieties in Tucumán province were biologically characterized on the basis of vein clearing, vein corking, leaf cupping, stunting, stem pitting and other symptoms using standard indicator plants. The lemon varieties were: Frost Eureka, Frost Lisbon, Limoneira 8A and Genoa EEAT. The indicator plants used were Mexican lime, Eureka lemon, Duncan grapefruit, Pineapple sweet orange and sour orange seedlings, plus Ruby Blood sweet orange budded on sour orange rootstock. Symptoms on each of the indicator plants were rated from 0 (no reaction to 5 (most severe. A total rating for each isolate was obtained by summing the ratings on each indicator plant. Differences among lemon isolates were observed. Genoa isolate induced least growth while Limoneira isolate induced the most severe stem pitting. Little difference was observed between Eureka and Lisbon isolate.La Argentina es el primer país productor de limón en el mundo y la provincia de Tucumán lidera esta producción con 1,3 millones de toneladas. Desafortunadamente la tristeza de los cítricos es una enfermedad endémica en la Argentina desde 1930. En el presente trabajo se informa sobre la caracterización biológica realizada a distintos aislamientos del virus de la tristeza de los cítricos de las principales variedades comerciales de limoneros. Las variedades de limoneros estudiadas fueron: Eureka Frost, Lisboa Frost, Lisboa Limoneira 8 A y Génova EEAT. La caracterización se realizó en las plantas indicadoras estándares para este tipo de pruebas y fueron: plantines de lima mexicana, limón Eureka, pomelo Duncan, naranjo dulce Pineapple y naranjo agrio; y plantas injertadas de naranjo dulce Ruby Blood en naranjo agrio. Los principales síntomas evaluados

  5. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  6. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  7. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  8. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  9. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  10. Aislamiento de algas del embalse del Neusa por medio de cultivos In Vitro

    Directory of Open Access Journals (Sweden)

    A. Maldonado

    2000-07-01

    Full Text Available EI cultivo de algas a nivel mundial es un oficio de vieja data, pero en Colombia se encuentra en sus primeras etapas de desarrollo. El presente trabajo desarrollado en el Laboratorio de Bioensayos, Departamento de Biología, Universidad Nacional de Colombia está encaminado a aportar técnicas en el desarrollo del cultivo de algas. En la parte practica del trabajo se utilizaron muestras de agua del embalse del Neusa las cuales se cultivaron en medios líquido y solido. Se observo un mejor crecimiento de cianofíceas filamentosas en medio solido y algas verdes en medio líquido. Las clamidomonas se ven favorecidas en ambos medios, hecho que permitió aislar una sepa pura de este tipo de algas. Las diatorneas por el hecho de crecer en relación con algas verdes generan un problema metodológico para su aislamiento, que aun se encuentra sin resolver.

  11. Estudio sobre las relaciones filogenéticas entre diversos aislamientos del hongo Paracoccidioides brasiliensis

    Directory of Open Access Journals (Sweden)

    Juan McEwen

    2003-01-01

    Full Text Available Aunque es poco lo que se conoce acerca de la biología evolutiva
    del hongo P. brasiliensis, varios estudios moleculares han demostrado que existen variaciones en secuencias de ADN entre sus aislamientos, las que se correlacionan con el origen geográfico de las mismas y con diferencias en su virulencia para modelos murinos (1,2. Se desconoce si estas variaciones son el resultado final de un proceso de especiación alopátrica que daría origen a especies aisladas genéticamente provistas de características fenotípicas (patogenicidad, inmunogenicidad y genotípicas diferentes, las que podrían ser usadas como una alternativa para mejorar e innovar los métodos actuales de diagnóstico. Por lo tanto, proponemos como objetivo general estudiar un aspecto fundamental de la biología evolutiva del hongo patógeno humano P. brasiliensis como es la especiación.

  12. Aislamiento de especies termotolerantes de Campylobacter en dos poblaciones de pollos criados con y sin confinamiento Isolation of thermotolerant Campylobacter species from two populations of chickens bred in confinement and at liberty

    Directory of Open Access Journals (Sweden)

    Alvaro Tresierra-Ayala

    1995-10-01

    Full Text Available Se estudió la frecuencia del aislamiento de Campylobacter spp. en pollos domésticos y pollos mantenidos en confinamiento permanente, en la ciudad de Iquitos (Perú. Campylobacter spp. fue aislado en 54,0% en el primer grupo y 35,0% en el segundo (pEstudou-se a freqüência de isolamento de Campylobacter spp. em frangos domésticos e frangos mantidos em confinamento permanente, na cidade de lquitos (Peru. Campylobacter spp. foi isolado em 54,0% no primeiro grupo e 35,0% no segundo (pThe isolation rates of thermotolerant Campylobacter species in free-ranging domestic chickens and confined chickens from Iquitos city, Peru, were determined. Campylobacter spp. were isolated in 54,0% of the former group of chickens, being less frequent (35,0% in the latter (p<0,05. Of the classical thermotolerant species, C. jejuni and C. coli were the most frequent. However, the presence C. lari suggests that the chickens might be an important reservoir of this bacterium.

  13. Aislamientos de Histoplasma capsulatum con morfología aberrante obtenidos en la República Argentina Histoplasma capsulatum with aberrant morphology isolated in Argentina

    Directory of Open Access Journals (Sweden)

    M.F. Zuiani

    2006-04-01

    Full Text Available Por primera vez en la Argentina se describe una cepa de Histoplasma capsulatum var. capsulatum con morfotipo aberrante, obtenida de un paciente con SIDA. En los primocultivos desarrollados en agar Sabouraud a 25-28 °C, las colonias de la fase micelial fueron blancas, glabras, umbilicadas, centralmente radiadas y de bordes regulares, más semejantes a las de hongos hialinos ambientales que a las de H. capsulatum. Al examen microscópico llamó la atención la ausencia de conidios característicos, la presencia de clamidoconidios solitarios, terminales e intercalares, de 4 µm de diámetro, y el engrosamiento de las hifas. La identificación del hongo se confirmó mediante la detección de exoantígenos específicos (H y M en los sobrenadantes de cultivos de la fase micelial y por la reversión a la fase levaduriforme típica, obtenida al incubar en agar cerebro-corazón adicionado con cisteína a 37 °C. Mediante RAPD-PCR con los iniciadores 1281-1283, el perfil del ADN genómico coincidió con el genotipo de H. capsulatum predominante entre los aislamientos de pacientes argentinos.For the first time in Argentina, we describe a strain of Histoplasma capsulatum var. capsulatum with an aberrant morphology that was isolated from a single patient with AIDS. Mycelial phase cultures on agar Sabouraud at 25-28 °C showed white, glabrous, umbilicated and centrally radiated colonies. Unusual microscopic findings were the absence of typical conidia, the presence of terminal/intercalary chlamydoconidia with a diameter of 4 µm and of thickened hyphae. Fungal identification was confirmed by the detection of bands H and M species specific antigens in mycelial culture supernatants and reversion to the typical yeast phase on agar brain-heart-cysteine at 37 °C. The genomic DNA profile obtained by RAPD-PCR with primers 1281-1283 coincided with the predominant profile of H.capsulatum among isolates from Argentine patients.

  14. Aislamiento de virus rábico de murciélagos en Colombia, S. A. Aislamiento de virus rábico de murciélagos en Colombia, S. A.

    Directory of Open Access Journals (Sweden)

    Morales Alarcón A.

    1968-09-01

    Full Text Available Se intentó el aislamiento de virus rábico en 919 murciélagos, más 83 sin clasificar que no se incluyen en el cuadro, insectívoros y frugívoros procedentes de 3 zonas de Colombia. Las especies estudiadas fueron las siguientes: Corollia perspicillata, Myotis nigricans, Lasiurus ega, Artibeus Lituratus palmarum, Vampyrops helleri, Trachops cirrhosus cirrhosus, Glossophaga longirostris, Saccopteryx bilineata, Molossus molossus, Peropteryx kappleri, Phyllostomus hastatus. No se encontró ningún ejemplar de murciélago hematófago. Virus rábico fue aislado de Myotis nigricans + Lasiurus ega en Pavarandocito, Antioquia, en donde la rabia paresiante estaba activa en el momento de la investigación; en San Vicente de Chucurí, Santander, se aisló virus rábico de un ejemplar, Carollia perspicillata, zona en donde no se ha presentado, hasta ahora, rabia paresiante. Ningún aislamiento de virus rábico se hizo en la Guajira en donde, en años anteriores, ha habido brotes de rabia paresiante. Se intentó el aislamiento de virus rábico en 919 murciélagos, más 83 sin clasificar que no se incluyen en el cuadro, insectívoros y frugívoros procedentes de 3 zonas de Colombia. Las especies estudiadas fueron las siguientes: Corollia perspicillata, Myotis nigricans, Lasiurus ega, Artibeus Lituratus palmarum, Vampyrops helleri, Trachops cirrhosus cirrhosus, Glossophaga longirostris, Saccopteryx bilineata, Molossus molossus, Peropteryx kappleri, Phyllostomus hastatus.  No se encontró ningún ejemplar de murciélago hematófago. Virus rábico fue aislado de Myotis nigricans + Lasiurus ega en Pavarandocito, Antioquia, en donde la rabia paresiante estaba activa en el momento de la investigación; en San Vicente de Chucurí, Santander, se aisló virus rábico de un ejemplar, Carollia perspicillata, zona en donde no se ha presentado, hasta ahora, rabia paresiante. Ningún aislamiento de virus rábico se hizo en la Guajira en donde, en años anteriores, ha

  15. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  16. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  17. Brief exegesis on the existing legislation and the application of thermal insulation in the world - proposal for Mexico; Breve exegesis sobre legislacion existente en la aplicacion de aislamientos termicos en el mundo - propuesta para Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)

    1992-12-31

    -economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.

  18. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  19. Aislamiento acústico a ruido aéreo en acristalamientos de vidrio

    Directory of Open Access Journals (Sweden)

    Escuder Silla, E.

    2007-08-01

    Full Text Available In this paper, the Ookura & Saito model is applied to determine the Airborne Sound Insulation of glazing systems. In particular, the calculations that appear are for monolithic glasses of different thicknesses and laminated glasses from different types. There are different prediction models of the airborne acoustic behaviour of multilayer panels (and the laminated glasses can be considered like such. In all of them, the input data are the elastic constants and the loss factor. The monolithic glasses and the intermediate layer have been characterized according to different Standards. The results are compared with experimental measurements and data of the study of Marsh (1, obtaining a range of acceptable adjustment.

    En este artículo se aplica el modelo de Ookura & Saito para determinar el aislamiento acústico a ruido aéreo de sistemas constructivos basados en vidrios. En concreto, los cálculos que se presentan son para vidrios monolíticos de distintos espesores y para vidrios laminados de diferentes tipos. Existen diferentes modelos de predicción del comportamiento acústico a ruido aéreo de estructuras multicapa (y los vidrios laminados pueden considerarse como tales. En todos ellos, los datos de entrada son las constantes elásticas y el factor de pérdidas. Tanto los vidrios monolíticos como la capa intermedia se han caracterizado siguiendo diferentes normativas. Los resultados se comparan con medidas experimentales y con datos recogidos del estudio de Marsh (1, obteniéndose un grado de ajuste aceptable.

  20. Efectos del aislamiento en la adultez sobre el dolor y la frustración

    Directory of Open Access Journals (Sweden)

    Giselle Kamenetzky

    2011-01-01

    Full Text Available Los animales que viven aislados en la adultez presentan indicadores conductuales de estrés crónico, ansiedad e hipoalgesia. Si bien existe una amplia gama de tratamientos que evidencian las relaciones entre la frustración, el dolor y la ansiedad, pocos trabajos estudiaron el efecto que podría tener el aislamiento en la adultez sobre las respuestas de los animales ante la devaluación de incentivos. Se evaluaron ratas aisladas (Aislados y agrupadas (Agrupados a partir de los 60 días de edad en la sensibilidad al dolor con la prueba de la placa térmica (PT y en el efecto de reforzamiento parcial sobre el contraste sucesivo negativo consumatorio (ERP-CSNc. En el ERP-CSNc dos grupos de animales (Aislados y Agrupados recibieron una fase de precambio con ensayos bajo un Programa de reforzamiento continuo (RC, consumo de 32% de solución azucarada y otros dos grupos (Aislados y Agrupados en uno de reforzamiento parcial (RP, 50% reforzados con 32% de solución azucarada y 50% no reforzados. En la fase de postcambio los cuatro grupos recibieron soluciones de sacarosa al 4%. Se midió el tiempo que el animal permanecía en contacto con el bebedero (TB. Las ratas aisladas mostraron hipoalgesia en la PT. En el ERP-CSNc, tanto las ratas aisladas como las agrupadas entrenadas en RP mostraron el mismo grado de mayor persistencia de TB durante la fase de postcambio, respecto de los entrenados bajo RC. Estos resultados se discuten en función de trabajos previos y de los posibles mecanismos implicados.

  1. Aislamiento de polisacáridos a partir de cordones umbilicales humanos

    Directory of Open Access Journals (Sweden)

    Guillermo Lago

    2002-12-01

    Full Text Available Se realizó el aislamiento y caracterización de polisacáridos obtenidos a partir de cordones umbilicales humanos mediante una modificación a la técnica de Danishevsky y Bella. Se trataron los cordones con solución de cloruro de sodio bajo condiciones de temperatura y agitación controlada y se precipitaron los polisacáridos mediante la adición de una disolución de bromuro de cetiltrimetilamonio al 1 %. Se resuspendió el sedimento obtenido en una solución de cloruro de sodio 0,4 mol/L eliminando algunas impurezas que no se solubilizan a esta fuerza iónica mediante centrifugación y se precipitó el producto de interés mediante la adición de etanol al sobrenadante, caracterizándose por métodos químicos. El producto puede ser empleado como materia prima para obtener un gel cicatrizante en la Industria Médico-Farmacéutica.The polysaccharides obtained from human umbilical cords by a modification of Danishevsky and Bella’s technique were isolated and characterized. The cords were treated with a sodium chloride solution under controlled temperature and agitation conditions. The polysaccharides were precipitated by adding a disolution of cetyltrimethylammonium 1 %. The sediment obtained in a sodium chloride solution 0.4 mol/L was resuspended, eliminating some impurities that were not soluble at this ionic force by centrifugation. The product of interest was precipitated by adding ethanol to the supernadant and it was characterized by chemical methods. This product may be used as a raw material to obtain a healing gel in the Medicopharmaceutical Industry.

  2. Aislamiento y caracterización de micromicetos biodegradadores de polietileno

    Directory of Open Access Journals (Sweden)

    Carmen R. Méndez

    2013-05-01

    Full Text Available La biodegradación del polietileno por microorganismos es una solución para la reducción de la contaminación por plásticos. En el presente trabajo se muestran los resultados del aislamiento y caracterización de cepas de hongos capaces de degradar el polietileno, así como la determinación de las condiciones de pH y temperatura en las que se logran la mayor actividad. Los hongos fueron aislados de productos elaborados con polietileno obtenidos de relleno sanitario, la identificación taxonómica en base a características macroscópicas del crecimiento en placa petri y el estudio microscópico empleando la técnica de microcultivo en lámina. La actividad biodegradadora se determinó con la técnica de Kavelman y Kendrick, a temperaturas entre 20 y 30 °C y a pH 4,5 – 8,0. Veinte cepas de micromicetos fueron aisladas e identificadas, en 5 (25% se evidencio la capacidad de biodegradar el polietileno a 20 °C, siendo el pH 6,5 el óptimo, la cepa de mayor rendimiento pertenece a la especie de Aspergillus flavus. A temperatura de 30 °C, 6 (30% cepas evidenciaron actividad degradadora, siendo pH 6,5 el óptimo, la cepa de mayor rendimiento fue la misma del caso anterior.

  3. Aislamiento y serotipificación de Salmonella sp. en estanques con Crocodylus intermedius y testudines cautivos en Villavicencio - Colombia

    Directory of Open Access Journals (Sweden)

    Diana Pachón C.

    2011-05-01

    Full Text Available Objetivo. Determinar la presencia de microorganismos del género Salmonella sp. en el ambiente acuático de los ejemplares Crocodylus intermedius y testudines en la Estación de Biología Tropical Roberto Franco (EBTRF. Materiales y métodos. En este estudio se utilizó la metodología estándar para aislar e identificar microorganismos del género Salmonella sp., a partir de muestras de agua y sedimento de 52 estanques (nEstanques Crocodylus=25; nEstanques testudines=27; se procedió a serotipificar los aislamientos por el método convencional de Kaufmann-White y se realizaron pruebas de sensibilidad a antimicrobianos por la técnica de Kirby Bauer. Resultados. Se determinó la presencia de Salmonella sp., en un 33% del total de estanques muestreados. El 29% de los aislamientos de Salmonella sp. serotipificados, correspondió al serogrupo B; los serogrupos C, C1, C2 y D1 presentaron menores porcentajes. Con las pruebas de sensibilidad a antimicrobianos se determinó que el 100% de los aislamientos fueron sensibles a norfloxacina. Conclusiones. La ocurrencia de Salmonella sp., en los estanques de la EBTRF fue del 33%, con la mayor presencia del serogrupo B, donde se encuentran especies con características ampliamente zoonóticas. Con los resultados obtenidos es necesario el seguimiento de las normas de bioseguridad establecidas en la estación para el manejo de las poblaciones allí mantenidas y evitar de esa manera la ocurrencia de cuadros zoonóticos.

  4. Evaluación de aislamientos nativos de Beauveria Spp. sobre Tecia solanivora (Lepidoptera: Gelechiidae in vitro

    Directory of Open Access Journals (Sweden)

    Jorge Enrique Villamil

    2014-06-01

    Full Text Available Se evaluó la eficacia de hongos entomopatógenos nativos en el biocontrol de Tecia solanivora (Lepidoptera: Gelechiidae in vitro. Los aislamientos fueron obtenidos de larvas y adultos de gusano blanco Premmotrypes vorax, barrenador del curubo Aepytus sp, picudo de la palma Rinchophorus palmarum, broca del café Hypothenemus hampei, polilla guatemalteca Tecia solanivora y palomilla de la papa Phthorimaea operculella infectados, de los municipios de Ventaquemada, Umbita, Coper (Boyacá y San gil (Santander. El trabajo se realizó en el laboratorio de control biológico del Grupo Manejo Biológico de Cultivos en Tunja, Colombia. Se seleccionaron in vitro, de forma preliminar cinco de los siete aislamientos de hongos obtenidos: Bv01, Bv03, Bv04, Bv05 y Bv07, los cuales ocasionaron mortalidades superiores al 10%. De acuerdo con la caracterización morfológica realizada, los hongos encontrados pertenecen al género Beauveria. La evaluación de su eficacia se realizó con 10 larvas de T. solanivora desinfectadas y sumergidas en suspensión de 1x107esporas.mL-1, las cuales se observaron durante 32 días, registrando cada 8 días la mortalidad. Se empleó un diseño completamente al azar, con 6 tratamientos, 4 repeticiones y una prueba de separación de medias de Tukey. Los resultados mostraron que 32 días después de la inoculación los aislamientos Bv03 y Bv05 fueron los que produjeron la mayor mortalidad acumulada (7,4 y 8,5%, respectivamente. Se confirma el bajo potencial de los hongos entomopatógenos nativos para el control de larvas de T. solanivora.

  5. Nuevo método para el aislamiento y la cuantificación de insectos del orden Collembola

    OpenAIRE

    Kalyanne Fernández; F. Fernández; E. Pérez

    2000-01-01

    Recientemente, se ha informado que algunos integrantes del orden Collembola se alimentan de las hifas externas y de los cuerpos de fructificación de los HMA, originando principalmente efectos negativos sobre el desarrollo de la simbiosis. Con el objetivo de obtener un método optimizado y eficiente que posibilite el aislamiento de colémbolos en suelos, se diseñaron dos experimentos: el primero estableció una comparación entre la metodología comúnmente empleada para aislar los animales (embudos...

  6. Respuesta fisiológica y capacidad antagonista de aislamientos filosféricos de levaduras obtenidos en cultivos

    Directory of Open Access Journals (Sweden)

    Cluadia Milena Medina

    2009-09-01

    Full Text Available La filósfera es un ecosistema complejo que a pesar de contar con un gran número de microorganismos asociados, presenta pocos estudios diseñados para entender las características eco-fisiológicas de los microorganismos que lo habitan.  Las levaduras, como elemento importante de este hábitat, están expuestas a un ambiente variable afectado por la planta hospedera, edad y posición de la hoja, disponibilidad y calidad de nutrientes, temperatura, pH, radiación y actividad del agua.  Estos factores producen una presión de selección para el establecimiento de poblaciones naturales o introducidas de levaduras que puedan desplazar otras poblaciones de hongos fitopatógenos.  En este estudio se obtuvieron 80 aislamientos de levaduras filosféricas de dos cultivos de mora (Rubus glaucus, a las que se les determinó su nicho potencial en términos de su capacidad para crecer a diferentes condiciones de temperatura, pH, estrés osmótico y tolerancia a radiación UV.  El estrés osmótico fue la condición evaluada más restrictiva para las levaduras obtenidas, ya que únicamente seis aislamientos presentaron un crecimiento superior a 0.3 unidades de DO a 405nm, cuando fueron crecidas a 50% y 60% de glucosa.  Este estudio permitió seleccionar diez aislamientos filosféricos de levaduras, destacados por su capacidad para crecer en un amplio rango de condiciones.  De estos, cuatro aislamientos LvF 34, LvF 43, LvF 44 y  LvF 50 se destacaron por su capacidad de antagonismo contra el hongo fitopatogeno Botritys cinérea. Su determinación taxonómica permitió reportar por primera vez las especies Candida kunwinensis y Rhodotorula colostri con potencial biocontrolador.

  7. El aislamiento social de los trabajadores con visas H-2A. El ejemplo de los jornaleros tamaulipecos

    OpenAIRE

    Simón Pedro Izcara Palacios

    2012-01-01

    La proximidad de Tamaulipas a la frontera estadounidense abarata los costos de transporte, y esto hace que en el estado se otorgue un número elevado de visas H-2A a trabajadores agrarios temporales. Sin embargo, los programas de trabajadores huéspedes empujan a la mano de obra al abuso y la explotación. El aislamiento social, que hace referencia a una erosión de la esfera relacional del individuo, constituye uno de los principales problemas sufridos por los trabajadores tamaulipecos con visa ...

  8. Coordinación de aislamiento en subestaciones a nivel de 500 Kv. (Artículo)

    OpenAIRE

    Morales Mariño, Náthali Elizabeth

    2009-01-01

    En base a normas IEC, se establece los procedimientos para la selección de pararrayos para la protección contra sobretensiones y de la coordinación de aislamiento en subestaciones de extra alta tensión (EHV). Dichos procedimientos se aplican al caso particular de la S/E Pifo. Se determina las posibles sobretensiones que aparecen sobre la subestación, para luego seleccionar el pararrayos que mejor se ajuste a los requerimientos del sistema, comparando los requerimientos eléctricos y mecánicos ...

  9. Aislamiento y caracterización de Mycoplasma sp.de pulmones de cerdos provenientes de mataderos

    OpenAIRE

    Copes, Julio; Nievas, Fabián; Cerdá, Raúl Oscar; Perfumo, Carlos J.

    1995-01-01

    Se realizó un estudio microbiológico de 100 pulmones obtenidos al azar provenientes de capones y hembras sin servicio faenados en diferentes mataderos. Estos fueron clasificados macroscópicamente en pulmones con lesiones neumónicas (CLN) (43) y sin lesiones neumónicas (SLN) (57). Las muestras fueron procesadas para realizar el aislamiento y caracterización de microorganismos perteneciente al género Mycoplasma, en particular Mycoplasma hyorhinis y Mycoplasma hyosynoviae. De casos seleccionados...

  10. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  11. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  12. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  13. Diseño de un sistema de tamizado semicontinuo para el aislamiento de almidón de plátano macho (musa paradisiaca l.)

    OpenAIRE

    Ramírez Cortes, Roberto

    2016-01-01

    El plátano macho (Musa paradisiaca L.) es un fruto climatérico que se recolecta en un estado de madurez fisiológica. En esta etapa posee un alto contenido de almidón, por lo cual es una importante fuente alterna para el aislamiento del polisacárido. Hasta ahora, los procesos reportados para su aislamiento, son llevados a cabo en lotes, y durante la operación de tamizado, se emplean grandes cantidades de agua para producir la liberación de los gránulos de almidón. El objetivo de este trabajo f...

  14. Personas mayores en situación de aislamiento social: diseño y efectividad de un servicio de apoyo psicológico

    OpenAIRE

    Santos-Olmo Sánchez, Ana Belén

    2016-01-01

    La exclusión y el aislamiento social son fenómenos complejos y multidimensionales que afectan a la vida de las personas, excluyéndolas de la sociedad en la que viven, privándoles de sus derechos sociales, fomentando la desigualdad y, finalmente, afectando a su dignidad e identidad personal y social. La población mayor de 65 años es un grupo especialmente vulnerable puesto que se añaden factores de fragilidad y dependencia funcional. El aislamiento social en las personas mayores es un problema...

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  16. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  17. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  18. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  19. ESCUELAS-ISLA: UN AISLAMIENTO INSTITUCIONAL (SCHOOLS- ISLAND: AN INSTITUTIONAL ISOLATION

    Directory of Open Access Journals (Sweden)

    Vergara Reyes, Claudio

    2012-05-01

    Full Text Available Resumen: Este trabajo trata acerca de un tipo de escuela en la realidad educativa chilena, denominada “escuela-isla”, caracterizada por su aislamiento institucional del entorno social, económico, político, religioso y cultural. El concepto nace de una serie de reflexiones bajo el marco formativo de las prácticas pedagógicas tempranas, a partir de un conjunto de experiencias que configuran al centro de enseñanza y que resultan clave para la comprensión de la naturaleza del término. El documento hace una caracterización de este tipo de escuela, reconociendo cualidades que no son propias de una institución social. Asimismo, se propone y justifica la necesidad de un tipo de “alianza simbiótica” entre la organización educativa y el resto de organizaciones de la comunidad (red de enlace para complementar y potenciar su función educativa (formativa. Por último, se destaca la importancia de la interacción de la escuela con otras instituciones de la sociedad, y que tales vínculos constituyen una estrategia educativa para el desarrollo social y comunitario.Abstract: This work is about a type of school the Chilean educational reality, to known as school-island, mainly by institutional isolation from the social, economic, political, religious and cultural. The concept stems from a series of reflections within the framework formative early teaching practices, based on a set of experiences that shape the educational unit and are keys to understanding the nature of the term. The document provides a characterization of this type of school, recognizing qualities that are not characteristic of a social institution. It also proposes and justifies the need for a kind of "symbiotic partnership" between the educational organization and other community organizations (network link to complement and enhance its educational. Finally, it highlights the importance of interaction between the school and other institutions of society and that such links

  20. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  1. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  2. Caracterización fenotípica y genotípica de aislamientos de Neisseria meningitidis, serogrupo B, procedentes de Cartagena, Colombia, 2012-2014

    Directory of Open Access Journals (Sweden)

    Jaime Moreno

    2015-03-01

    Conclusión. La caracterización clínica, epidemiológica y molecular de los aislamientos causantes de enfermedad meningocócica es necesaria para el conocimiento de la propagación de clones virulentos y facilita la detección temprana de casos, lo que reduce los riesgos de epidemia.

  3. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia

    Directory of Open Access Journals (Sweden)

    Muñoz Flórez Jaime Eduardo

    2008-09-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a –20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.

  4. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  5. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  6. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  7. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  8. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  9. SUSCEPTIBILIDAD ANTIMICROBIANA DE AISLAMIENTOS DE Salmonella enterica PROVENIENTES DE PISOS, EQUIPOS, UTENSILIOS Y PRODUCTO TERMINADO EN PLANTAS DE BENEFICIO PORCINO EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    P. M. Bermúdez

    2016-01-01

    Full Text Available La diseminación de Salmonella spp. resistente a antimicrobianos en las cadenas productivas de alimentos de origen animal es una preocupación de salud pública de carácter mundial. Este estudio describe los patrones de resistencia antimicrobiana de 283 aislamientos de Salmonella enterica procedentes de plantas de beneficio porcino en Colombia. Se evaluó la susceptibilidad antimicrobiana frente a diez antimicrobianos mediante el método de difusión en disco: amoxacilina-ácido clavulánico (30 ug, ampicilina (10 ug, ceftiofur (30 ug, ciprofloxacina (5 ug, cloranfenicol (30 ug, florfenicol (30 ug, gentamicina (10 ug, sulfadiazina/trimetroprim (25 ug, tetraciclina (30 ug y tilmicosina (15 ug. Los resultados evidenciaron la presencia de 279 aislamientos multirresistentes de Salmonella enterica de origen porcino provenientes del ambiente y del producto terminado en las plantas de beneficio evaluadas (46,64% n: 132. Se detectaron 52 patrones de multiresistencia: el más común fue ceftiofur-tetraciclina-tilmicosina en el 9,89% (n: 28 de los aislamientos. Con referencia a estos antimicrobianos, 96,82% (n: 274 de los aislamientos fueron resistentes a tetraciclina, 73,14% (n: 207 a tilmicosina y 28,27% (n: 80 a ceftiofur. De especial interés fue la alta proporción de aislamientos resistentes a ceftiofur, debido a una posible resistencia cruzada con ceftriaxona. Los resultados obtenidos demuestran la necesidad de promover el diseño e implementación de un Programa oficial Integrado de Vigilancia de la Resistencia Antimicrobiana, además de sistemas de monitoreo voluntario en cada eslabón de la cadena productiva porcina, para contribuir a la prevención y control de la transmisión de microorganismos resistentes de origen alimentario en el marco del sistema de gestión de inocuidad alimentaria en Colombia.

  10. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  11. Evaluación de aislamientos nativos de Beauveria bassiana y Metarhizium anisopliae para el control del gusano del fruto Heliothis virescens (Fabricius 1771) en el cultivo de tomate Solanum lycopersicum (Mill) en Guasave, Sinaloa

    OpenAIRE

    Gaxiola Castro, Luis Alberto

    2014-01-01

    En el presente trabajo se evaluaron en laboratorio 10 aislamientos nativos de hongos entomopatógenos, tres de M. anisopliae y siete de B. bassiana sobre larvas de segundo y tercer estadío de gusano del fruto (Heliothis virescens) provenientes de una cría axénica; los dos aislamientos más patogénicos fueron B. bassiana con clave B1 y B2, por presentar mortalidad de larvas superior a 55%. Con estos mismos aislamientos se realizó un bioensayo para determinar la DL50 y la TL50. También se evaluó ...

  12. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  13. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2005-07-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  14. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  15. The thermal insulating materials and its coatings for underground piping; Los aislamientos termicos y sus recubrimientos para tuberias subterraneos

    Energy Technology Data Exchange (ETDEWEB)

    Salcido Lopez, Salvador [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    Energy Saving through the adequate selection and application of the thermal insulating materials, as well as its coatings for underground piping conducting fluids, both at high and at low temperature. The benefits are outlined at economical level for the investor as well as at ecological level (of vital importance today) and are observed as practical examples in industrial and commercial processes. [Espanol] Ahorro de energeticos mediante la adecuada seleccion y aplicacion de los aislamientos termicos, asi como de sus recubrimientos para tuberias subterraneas que conducen fluidos tanto en alta como en baja temperatura. Los beneficios son destacados tanto a nivel economico para el inversionista, como a nivel ecologico (de vital importancia en la actualidad), y son observados con ejemplos practicos en procesos industriales y comerciales.

  16. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  17. Ensayo de aislamiento acústico a ruido aéreo de los cerramientos exteriores y particiones realizados con paneles de madera

    Directory of Open Access Journals (Sweden)

    Pacios Álvarez, Antonia

    2007-06-01

    Full Text Available The house prototype of the Provisional Emergency House System uses wood and its derivatives for the facades, floor structure, roofing and partitions.  The extensive use of wooden panels for the construction and the lack of data, in Spain, about their acoustic behavior bring up the necessity to make in situ measurements of the acoustic isolation to airborne sound. Panels used for facades and partitions are built with a wooden framework and membrane of oriented strand board in both sides, for the facades, and of laminated plaster boards for the inner partitions. With the objective of verifying the sound insulation of the facades according to Spanish Standard UNE EN ISO 140-5, in situ measurements of airborne sound insulation of facade elements and facades have been made; according to Spanish Standard UNE EN ISO 140-4, in situ measurements of airborne sound insulation between rooms for internal walls have also been made. The procedure of the global insulation has been followed to measure the acoustic insulation of complete facades without making distinction between the elements that form it.El prototipo de vivienda del Sistema de Vivienda Provisional de Emergencia utiliza principalmente la madera y sus derivados tanto en los cerramientos y particiones como en el forjado y la cubierta. El empleo de soluciones constructivas ligeras y la falta de datos en España acerca del comportamiento acústico de los mismos plantea la necesidad de realizar mediciones in situ del aislamiento acústico a ruido aéreo. El panel base de cerramiento y particiones se construye partiendo de un entramado de montantes de madera con membrana en ambas caras de tableros de virutas de madera orientadas, para el caso de los cerramientos exteriores, y de tableros laminados de yeso para las particiones interiores. Con el objeto de comprobar el aislamiento acústico de dichos cerramiento se han realizado ensayos siguiendo la Norma UNE EN ISO 140-5 para la medición in situ del

  18. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  19. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  20. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. PCR múltiple para la detección de los genes sea, seb, sec, sed y see de Staphylococcus aureus: Caracterización de aislamientos de origen alimentario Multiplex PCR for the detection of sea, seb, sec, sed and see genes of Staphylococcus aureus: Characterization of isolates from food

    Directory of Open Access Journals (Sweden)

    E. A. Manfredi

    2010-09-01

    Full Text Available La presencia de Staphylococcus aureus en los alimentos representa un riesgo potencial para la salud pública; sus enterotoxinas son el principal factor de virulencia. La detección de las enterotoxinas de S. aureus puede realizarse por ELISA, aunque sólo es posible detectar el pool de enterotoxinas SEA, SEB, SEC, SED y SEE. Los objetivos del presente trabajo fueron optimizar dos técnicas de PCR múltiple para la detección de los genes sea, seb, sec, sed y see de S. aureus y caracterizar un conjunto de 115 aislamientos de Staphylococcus spp. asociados a intoxicaciones alimentarias provenientes de diferentes provincias de Argentina. La caracterización se realizó por pruebas bioquímicas, ELISA y PCR. Sesenta y ocho aislamientos (59,1% fueron positivos por ELISA, mientras que 61 (53% fueron positivos por PCR. De los aislamientos positivos por PCR, 34 (55,7% portaron el gen sea, 9 (14,8% el gen seb, 5 (8,1% el gen see, 4 (6,5% el gen sec, 6 (9,9% los genes sea y seb, 2 (3,3% los genes sea y sec, y 1 (1,7% los genes sea y sed. Este es el primer estudio de caracterización genotípica de aislamientos de S. aureus asociados con brotes de intoxicación alimentaria registrados en distintas provincias argentinas.The presence of Staphylococcus aureus in food represents a potential risk to public health, being its enterotoxins the major virulence factor. Enterotoxin detection can be determined by ELISA, but only for the pool of enterotoxins SEA, SEB, SEC, SED and SEE. The main aims of this study were to optimize two PCR techniques for detection of S. aureus sea, seb, sec, sed and see, and to characterize Staphylococcus spp. isolates associated with food intoxication. Two PCR techniques were optimized and 115 Staphylococcus spp. isolates from Ciudad Autónoma de Buenos Aires, and Buenos Aires, Córdoba, and Neuquén provinces were characterized. The characterization was performed by biochemical tests, ELISA and PCR. Sixty-eight isolates (59.1% were

  2. Caracterización molecular de aislamientos de enterobacter cloacae multirresistentes, productores ß-Lactamasas provenientes de pacientes de un hospital de tercer nivel de Bogotá

    Directory of Open Access Journals (Sweden)

    Ibonne Aydee García Romero

    2005-07-01

    Full Text Available Antecedentes. Las enterobacterias, antaño flora normal del tracto gastrointestinal, han cambiado su biología y emergido como agentes patógenos nosocomiales que se tornan resistentes los antibióticos conocidos. Objetivo. Realizar la caracterización epidemiológico-molecular de 20 aislamientos de Enterobacter cloacae resistentes a cefalosporinas de tercera generación; provenientes de un hospital de tercer nivel de Bogotá-Colombia. Material y métodos. Los aislamientos fueron identificados mediante sistemas automatizados Microscan y VITEK, se utilizó el Enterobacter asbureae como control externo inter-especie. La confirmación de resistencia se hizo por técnica de difusión en agar, y una vez establecida se realizó BLEE para comprobación. La determinación de puntos isoeléctricos se hizo, mediante lisis por ultrasonido y la genotipificación mediante la metodología para bacterias Gramnegativas propuesta por Versalovic. Resultados: Los aislamientos colectados durante un año fueron causantes de 15 casos de infección Intrahospitalaria y dos colonizaciones. Todos los aislamientos presentaron resistencia a cefotaxima, ceftazidima, ceftriaxona, aztreonam y ciprofloxacina, 95% a amikacina, gentamicina y cloranfenicol, 75% a trimetoprim/sulfametoxazol, 20% a cefepime y todos fueron sensibles a imipenem. Dos aislamientos fueron confirmados como productores de â-lactamasas de espectro extendido (BLEE por la técnica microbiológica de disco combinado. Por isoelectroenfoque presentaron dos â-lactamasas con puntos isoeléctricos (pI de 5,4 y 8,2. En los 18 aislamientos no inhibidos por ácido clavulánico, se detectaron entre 2 y 4 â-lactamasas con pI de 5,4; 6,0; 7,0; 8,2 y mayor que 8,2; la resistencia a cefalosporinas de tercera generación podría ser atribuida a la hiperproducción de AmpC; los valores de pI sugieren la producción simultánea de â-lactamasas tipo SHV y TEM. La genotipificación mediante tres metodologías de rep

  3. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  4. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  5. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  6. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  7. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  8. Haemophilus influenzae : Caracterización de aislamientos recuperados de enfermedades invasivas en Cuba durante el período 2008-2011

    Directory of Open Access Journals (Sweden)

    Gilda Toraño

    2012-12-01

    Full Text Available Con el objetivo de caracterizar los aislamientos de Haemophilus influenzae, responsables de enfermedades invasivas en Cuba, en la etapa posterior a la vacunación se estudió el total de los recuperados durante el período 2008-2011, remitidos al Instituto "Pedro Kourí" desde diferentes provincias del país. La confirmación de especie y determinación de serotipos se realizó atendiendo al requerimiento de los factores V y X y empleando el método de aglutinación en lámina, respectivamente. Se definieron los biotipos a través de las pruebas de indol, urea y ornitina; se determinó la concentración mínima inhibitoria (CMI mediante la prueba del elipsómetro para la ampicilina, la ceftriaxona, el cloranfenicol y la rifampicina. Para 23 aislamientos se corroboró la identificación como H. influenzae : 21 fueron serotipables y 2 no tipables (HNT. El 90,4% de los serotipables fueron serotipo b y se detectaron dos serotipos a. Nueve aislamientos de H. influenzae b pertenecieron al biotipo I y los aislamientos, serotipo a y HNT, al biotipo II. En una cepa se demostró producción de la enzima ß-lactamasa y resistencia para la ampicilina y el cloranfenicol, con valores de CMI= 8 y 12 µg/mL, respectivamente. Se puso en evidencia que a pesar de la disminución de la incidencia de la enfermedad invasiva por Hib, este serotipo aún constituye el más frecuente y se alerta sobre la necesidad de una vigilancia sostenida que permita detectar fallos vacunales. La susceptibilidad antimicrobiana demostrada para este período pudiera considerarse como un beneficio adicional de la introducción de la vacunación en Cuba.

  9. Detección de un complejo clonal con el genotipo de Brucella abortus biovariedad 2 como fundador en aislamientos de B. abortus de Argentina

    Directory of Open Access Journals (Sweden)

    Daiana Hollender

    Full Text Available Brucella abortus es el agente causal de la brucelosis bovina, enfermedad zoonótica que se encuentra ampliamente distribuida en el mundo. Actualmente existen ocho biovariedades de B. abortus. En Argentina se encuentra con mayor frecuencia la biovariedad 1, pero también se suele aislar la biovariedad 2, que es más patogénica que la anterior. Resulta necesario contar con métodos de tipificación que tengan la resolución suficiente para permitir el seguimiento epidemiológico de los brotes de brucelosis y de los programas de control de la enfermedad. Debido a la gran homogeneidad genética que existe entre las distintas especies del género Brucella, ha sido dificultoso el desarrollo de herramientas moleculares para realizar el análisis epidemiológico de los aislamientos. La publicación del genoma de varias especies de Brucella facilitó el diseño de estas herramientas. El objetivo del presente trabajo fue emplear un esquema de análisis multilocus de VNTR en aislamientos de Argentina obtenidos en nuestro laboratorio. De los 56 aislamientos analizados se obtuvieron 47 perfiles genotípicos diferentes. El empleo de este esquema permitió asignarles a dichos aislamientos la biovariedad correspondiente. A través del análisis goeBURST se pudo relacionar a todos los genotipos entre sí, y además, proponer al genotipo de la biovariedad 2 como fundador.

  10. Voltage pre-regulator without insulation with high efficiency; Pre-regulador de tension sin aislamiento con alta eficiencia

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ramos, Octaviano

    2003-04-15

    esta tesis se propone una nueva topologia de pre-regulador para fuentes de alimentacion con una alta eficiencia ({eta}), debido a una estrategia novedosa de manejo de la energia; asimismo corrige el FP. Esto representa un avance en lo que respecta a la investigacion sobre fuentes de alimentacion, debido a que normalmente dos parametros estan en oposicion: cuando se mejora la eficiencia ({eta}) se descuida el factor de potencia (FP), asimismo cuando se corrige el FP se descuida la {eta}, sin embargo es posible mejorar estos dos parametros al mismo tiempo aprovechando el concepto de pasar parte de la energia de entrada directo a la salida. El nuevo pre-regulador puede combinarse con reguladores tradicionales con aislamiento como el convertidor CD/CD flyback, o bien combinarse con reguladores de alta eficiencia como el llamado reductor de dos entradas. El regulador es necesario para obtener una fuente de alimentacion regulada con un alto factor de potencia y buena eficiencia. El documento de tesis esta organizado en cuatro capitulos. En el primer capitulo se examinan las propuestas de diversos autores, y finaliza con el planteamiento de la topologia propuesta para este trabajo de investigacion. El capitulo dos, titulado Teoria de operacion, analisis y diseno de la solucion propuesta, muestra las ecuaciones de diseno y formas de onda del convertidor propuesto que ayudan a entender su funcionamiento. En el capitulo tres, titulado Estrategia de control, se justifica el uso de un control no lineal debido a las caracteristicas de la topologia y el por que la utilizacion de modos deslizantes (SMC), se plantea el analisis y diseno de la etapa de control del convertidor propuesto por modos deslizantes. Ademas se presenta la forma en que se implemento fisicamente dicho control. El capitulo cuatro, titulado Analisis de resultados, se divide en dos partes: simulaciones y resultados experimentales. Adicionalmente se presenta un analisis comparativo entre la topologia propuesta y el

  11. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  12. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  13. Técnica para aislamiento de bacteriófagos específicos para E.coli DH5α a partir de aguas residuales

    Directory of Open Access Journals (Sweden)

    Gabriel Gaviria A.

    2012-04-01

    Full Text Available Objetivo. Establecer una técnica para el aislamiento de bacteriófagos a partir de aguas residuales específicos para E. coli DH5α. Materiales y métodos. Se tomó como base el método 1601 de la Agencia de Protección Ambiental de los Estados Unidos de América y un método de obtención de enterovirus a partir de aguas residuales. En el desarrollo del protocolo se realizaron múltiples pruebas utilizando como control positivo el bacteriófago T4 y los aislamientos de bacteriófagos obtenidos a partir de aguas residuales. Resultados. Se observó la formación de unidades formadoras de placa (UFP, se obtuvó la titulación de los bacteriófagos presentes en cada uno de los cultivos de E.coli DH5α, se determinaron las relaciones que existen entre la cuantificación de la formación de unidades formadoras de placa (UFP del tratamiento control y el tratamiento experimental y las respectivas características de las (UFP en cada uno de los experimentos realizados. Conclusiones. Se logró establecer un protocolo microbiológico para el aislamiento de bacteriófagos específicos para E. coli DH5α.

  14. Diseño de dos metodologías moleculares para la rápida identificación de aislamientos de Staphylococcus aureus resistente a meticilina asociados a la comunidad en Colombia

    Directory of Open Access Journals (Sweden)

    Javier Antonio Escobar

    2012-06-01

    Full Text Available Introducción. Los aislamientos de Staphylococcus aureus resistente a la meticilina asociado a la comunidad (SARM-AC, están aumentando la frecuencia de infecciones en personas sanas de la comunidad y en pacientes hospitalizados. En Colombia y en la región andina estos aislamientos tienen un componente genético relacionado con el clon pandémico USA300. Objetivo. Diseñar y estandarizar dos metodologías para la diferenciación rápida de aislamientos colombianos de S. aureus resistente a la meticilina asociado a la comunidad de los asociados al hospital (SARM-AH. Materiales y métodos. Se estandarizaron dos metodologías moleculares para la identificación de aislamientos de S. aureus resistente a la meticilina asociado a la comunidad. La primera se basa en la digestión diferencial con tres enzimas de restricción de los genes cinasa de carbamato (arcC y cinasa de guanilato (gmk para los tipos de secuencia 5 (ST5 y 8 (ST8, correspondientes a aislamientos de S. aureus resistente a la meticilina asociado al hospital y asociado a la comunidad, respectivamente. La segunda se basa en la amplificación por reacción en cadena de la polimerasa de cinco factores de virulencia que se encuentran de manera diferencial en estos aislamientos. Las dos metodologías fueron validadas en 237 aislamientos clínicos de S. aureus resistente a la meticilina. Resultados. Con la primera metodología se identificaron el 100 % y 93,2 % de los aislamientos de S. aureus resistente a la meticilina asociado a la comunidad y asociado al hospital, respectivamente. Con la segunda metodología se identificaron correctamente los dos tipos de aislamientos. Conclusiones. Estas dos metodologías son una buena alternativa en términos de ahorro en tiempo y dinero comparadas con otras técnicas, como la electroforesis en campo pulsado y la tipificación de secuencias multilocus para la rápida identificación de aislamientos de S. aureus resistente a la meticilina asociado a la

  15. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  16. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  17. Characterization of some psorosis and concave gum isolates from northwestern Argentina Caracterización de aislamientos de psorosis y concave gum del noroeste argentino

    Directory of Open Access Journals (Sweden)

    Julia Figueroa

    Full Text Available The Citrus Sanitation Center of the Estación Experimental Agroindustrial Obispo Colombres in Tucumán, Argentina, has developed a virus bank of various graft-transmissible citrus pathogens found in northwestern Argentina. In this bank, several psorosis and concave gum isolates are maintained in Pineapple sweet orange seedlings. In order to characterize these pathogens, 11 isolates were indexed to seedlings of Pineapple sweet orange, Dweet tangor, Eureka lemon plus Etrog citron budded on rough lemon seedlings. Cross protection was applied for identifying psorosis-A. Symptoms obtained were variable and ranged from mild to very severe. A clear effect of temperature on symptom expression, and distinct differences in the reactions between psorosis-A and concave gum viruses were detected.El Centro de Saneamiento de Citrus de la Estación Experimental Agroindustrial Obispo Colombres, de Tucumán, Argentina, ha constituido un banco de virus de cítricos con material recolectado en la región noroeste del país. El mismo cuenta con varios aislamientos de psorosis y concave gum que se mantienen en plantas de naranjo dulce Pineapple. Con el objetivo de caracterizar biológicamente 11 de estos aislamientos, se inocularon plantines de naranjo dulce Pineapple, Dweet tangor, limonero Eureka y plantas injertadas de cidro Etrog en limoneros rugoso. Las pruebas con Pineapple se realizaron por duplicado bajo dos condiciones de temperatura: frías y calientes. La confirmación de psorosis A se realizó mediante prueba de protección cruzada con un aislamiento de psorosis B. Los resultados obtenidos muestran una amplia diversidad biológica entre los aislamientos, con expresión de síntomas que variaron desde suaves a muy severos. Se confirmó la presencia de psorosis A y se encontró que los aislamientos de "concave gum" del banco de virus no estaban en mezcla con psorosis. El efecto de la temperatura en la manifestación de los síntomas fue significativo y se

  18. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2012-01-01

    Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.

  19. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Ortiz Rojas Luz Yineth

    2012-03-01

    Full Text Available

    El análisis molecular del cistron, (ue codica para la proteina de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la pre- sencia de 65 nucleotidos adicionales (ue codican para (uince aminoãcidos, en la region amino de la secuencia de la proteina de la cubierta del aislamiento mexicano identicado con el nümero de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento DDDF6F, reportado en 1FF1 en Estados Unidos. El anãlisis logenHtico de 1I5  secuen- cias de la proteína de la cubierta de SCMV reportadas de Asia, África, Brasil y Argentina, entro otros, sugiere diJerentes origenes logeogrãcos de los aislamientos mexicanos. El aislamiento mexicano GU6N6OP5 es filogeneticamente mãs cercano a aislamientos de QCWV de Brasil X de EE.UU., mien- tras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son

    logenHticamente mãs cercanas al aislamiento mexicano EUDF1DN5. Las caracteristicas particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México X Brasil, sugieren un baYo control tosanitario en el intercambio de material vegetal.

  20. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  1. AISLAMIENTO DE CEPAS NATIVAS DE TRICHODERMA SPP DE SUELOS HORTICOLAS DEL VALLE DE TOLUCA, COMO BIOCONTROL POTENCIAL DE SCLEROTINIA

    Directory of Open Access Journals (Sweden)

    Hilda G. García-Nuñez

    2012-08-01

    Full Text Available Se evaluó la presencia de Trichoderma en siete localidades en la zona sur del Valle de Toluca, Estado de México. Esta es un área con un alto potencial en la producción de hortalizas. El estudio se dirigió al aislamiento de cepas nativas de Trichoderma a partir de muestras de suelo, identificación de factores fisiográficos, así como las propiedades físicas y químicas del suelo que determinan la ocurrencia de Trichoderma. Se evaluó el potencial de las cepas de Trichoderma para el control de Sclerotinia spp., hongo patógeno causante de la pudrición blanda en lechuga. Se aislaron once cepas, el mayor número de ellas asociadas al tipo de suelo se encontró en las localidades de San Francisco Putla y San Francisco Tetetla. El análisis de regresión logística mostró que no hay una relación entre las propiedades del suelo (materia orgánica y pH y la presencia de Trichoderma. La prueba de Tukey (p

  2. CARACTERIZACIÓN DE AISLAMIENTOS DE Colletotrichum lindemuthianum DE ECUADOR Y GUATEMALA PARA IDENTIFICAR GENES DE RESISTENCIA

    Directory of Open Access Journals (Sweden)

    Halima Awale

    2008-01-01

    Full Text Available El objetivo de esta investigación fue determinar la variabilidad patogénica de C. lindemuthianum en zonas productoras de frijol común en Ecuador y Guatemala para identificar las combinaciones de genes de resistencia más efectivas para las condiciones locales. Aislamientos de antracnosis recolectados fueron caracterizados para la identifi cación de las razas presentes en estos países empleando el juego estándar de 12 cultivares diferenciales. De acuerdo a la evaluación, solamente dos razas (5, 9 mostraron estar presentes en los dos países. En Guatemala se registró una mayor diversidad patogénica (mayor número de razas que en Ecuador. Basados en esta información y en otros datos de estudios realizados anteriormente, sugerimos como la combinación genética más efectiva la piramidación de los genes Co-12 y Co-42. Esta combinación conferiría resistencia completa a casi todas las razas de C. lindemuthianum identifi cadas hasta el momento en los dos países.

  3. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  4. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  5. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  6. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

  7. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  8. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  9. Revisión sistemática de la farmacorresistencia en enterobacterias de aislamientos hospitalarios en Colombia

    Directory of Open Access Journals (Sweden)

    Leidy González

    2014-06-01

    Full Text Available Introducción. La resistencia bacteriana es un problema de salud pública a nivel mundial que compromete seriamente la capacidad de tratar las infecciones. Objetivo. Describir el perfil de resistencia a los antimicrobianos marcadores en enterobacterias identificadas en hospitales colombianos. Materiales y métodos. Se hizo una revisión bibliográfica sistemática de las publicaciones indexadas en Medline, Embase y Lilacs, además de la búsqueda manual de todos los números de revistas colombianas reconocidas en el campo de la infectología y otros afines para identificar referencias no disponibles electrónicamente. Resultados. Se identificaron 43 estudios y reportes de vigilancia epidemiológica con información sobre la resistencia de las enterobacterias en hospitales, principalmente de Bogotá, Cali y Medellín. La tasa de resistencia en Escherchia coli oscila entre 3 y 11 %, 5 y 20 % y 0,2 a 0,8 % para piperacilina-tazobactam, cefalosporinas de tercera generación y carbapenémicos, respectivamente. En aislamientos de Klebsiella pneumoniae, la resistencia oscila entre 21,8 y 48,1 % frente a piperacilina-tazobactam, 20 y 35 % frente a cefalosporinas de amplio espectro y 3 y 8 % frente a carbapenémicos, con variaciones importantes por ciudades, niveles de atención y circunstancias clínicas. Conclusiones. La diseminación de la resistencia bacteriana en enterobacterias aisladas en hospitales colombianos es un problema creciente que requiere medidas prontas para cortar las cadenas de transmisión.

  10. Inoculación experimental de Terminalia catappa con un aislamiento ambiental de Cryptococcus neoformans var. gattii serotipo C.

    Directory of Open Access Journals (Sweden)

    Patricia Escandón

    2002-12-01

    Full Text Available En 1997, nuestro laboratorio informó por primera vez el aislamiento de Cryptococcus neoformans var. gattii serotipo C asociado con detritus del árbol de almendro, Terminalia catappa. Este hallazgo ha llevado a realizar un seguimiento más detallado de la asociación plantahongo. Datos preliminares habían revelado que la supervivencia del hongo en plántulas de almendro ocurría hasta por 100 días. El propósito de este estudio fue establecer si bajo las mismas condiciones, C. neoformans var. gattii podría permanecer viable por un mayor período de tiempo. Se emplearon 83 plántulas de almendro, de 20 a 40 cm de altura, inoculados con C. neoformans var. gattii, serotipo C (INS-755. Se realizaron ensayos inoculando el tallo o el suelo en el que serían sembradas las plántulas. Las observaciones se realizaron por un período de hasta 12 meses. Como técnicas de procesamiento del material vegetal se emplearon las técnicas de hongos endófitos (tallos, maceración (raíz, hojas y el estándar de suspensión (suelos. Adicionalmente, el hongo fue visualizado microscópicamente en el tejido vegetal con el empleo de azul de tripán y lactofenol. Se observó que C. neoformans var. gattii permanecía viable en la planta hasta por 12 meses posinoculación y que podía migrar desde el suelo hacía el tallo y viceversa, sin causar alteraciones macroscópicas ni microscópicas en la planta. Lo anterior sugiere una posible asociación ambiental entre el hospedero T. catappa y C. neoformans var. gattii.

  11. AISLAMIENTO DE ADN GENÓMICO DE Myrciaria dubia (HBK “CAMU CAMU” APROPIADO PARA ANÁLISIS MOLECULARES

    Directory of Open Access Journals (Sweden)

    Juan Carlos Castro Gómez

    2012-06-01

    Full Text Available Myrciaria dubia “camu-camu”, una especie nativa de la Amazonía que produce frutos con alto contenido de vitamina C y otras sustancias importantes. Sin embargo, los estudios moleculares de esta planta son escasos, por falta de un protocolo reproducible para purificar sus ácidos nucléicos. El objetivo de este trabajo fue establecer un protocolo para aislar el ADN genómico a partir de hojas de M. dubia, apropiado para análisis moleculares. El ADN se purificó con un protocolo modificado, la calidad y cantidad se estimó por espectrofotometría y electroforesis en gel de agarosa. Adicionalmente, la calidad se evaluó mediante RAPD. El ratio de calidad (A260/A280 promedio del ADN fue 1.9±0.1 y el espectro de absorción UV/Vis presentó un único pico de máxima absorbancia a 260nm. Mediante electroforesis el ADN fue íntegro y sin ARN. También, la síntesis de amplicones RAPD nos sugiere ausencia de inhibidores para polimerasas. La concentración promedio del ADN fue 99±33 ng/ml y el rendimiento promedio fue 237±80 mg ADN/g hoja. En conclusión, se ha establecido un protocolo de aislamiento de ADN genómico a partir de hojas de Myrciaria dubia “camu camu”, caracterizado por permitirnos obtener ADN de alta calidad y cantidad suficiente para análisis moleculares como el RAPD.

  12. Aislamiento e identificación de patógenos de la estirpe silvestre del ajo (Allium sativum L.

    Directory of Open Access Journals (Sweden)

    Karina Astorga-Quirós

    2014-02-01

    Full Text Available El cultivo del ajo (Allium sativum L. en Costa Rica se podría convertir en una alternativa rentable para la producción y diversificación de los agricultores de hortalizas. Sin embargo, el tipo de reproducción vegetativa que presenta facilita la transmisión y diseminación de enfermedades, lo que provoca un debilitamiento progresivo de los bulbos. Actualmente, se buscan alternativas de manejo diferentes al control químico, para disminuir el impacto ecológico y ambiental de los patógenos que lo afectan. El control biológico es una de ellas, pero presenta dificultades para el aislamiento y la identificación certera de patógenos asociados a pudriciones que se dan en el suelo. Por lo anterior, el objetivo general de esta investigación consistió en aislar e identificar a nivel de especie cepas de Pseudomonas marginalis, Penicillium sp. y Sclerotium cepivorum a partir de material vegetativo de ajo en campo, para su utilización en futuros trabajos de control biológico de estas enfermedades. La metodología seguida permitió aislar e identificar con un alto porcentaje de certeza a P. marginalis, así como obtener cultivos monospóricos de Penicillium sp. y cultivos puros de S. cepivorum. Las técnicas descritas constituyen la base para futuros trabajos relacionados con las fitopatologías en el cultivo del ajo.

  13. Susceptibilidad de Delia platura a siete aislamientos de nematodos entomopatógenos de la zona Central Andina de Colombia

    Directory of Open Access Journals (Sweden)

    Carolina Jaramillo Contreras

    2013-07-01

    Full Text Available La mosca de la semilla, Delia platura, es una de las principales plagas en los cultivos de espinaca en la sabana de Bogotá. En Colombia la plaga es controlada mediante la aplicación de insecticidas y la información sobre su control sigue siendo limitada. Por ello el objetivo de este trabajo fue evaluar la susceptibilidad de D. platura a siete aislamientos de nematodos entomopatógenos de la zona Central Andina de Colombia. Además de evaluar diferentes dosis y producción de juveniles infectivos (JIs de la especie más virulenta, bajo condiciones de laboratorio. En el laboratorio se estableció la cría en papa amarilla (Solanum phureja para obtener larvas de tercer instar, las cuales se expusieron a 2500 JIs/especie NEPS. Seleccionada la especie más virulenta, se expuso D. platura a 500, 1000, 2000, 4000 y 8000 JIs/larva. Los mejores resultados obtenidos se encontraron con Steinernema sp3 con una mortalidad entre el 75 a 88% en las dosis de 4000 y 8000 JIs encontrando que la DL50 es de 1314JIs/larva y 15259 JIs/larva la DL95. Así mismo, se estableció que Steinernema sp3 se reproduce exitosamente en D. platura, encontrando un promedio de producción 670 ± 7.67 JIs/larva durante un periodo de dieciocho días. La mosca de la semilla es altamente susceptible a Steinernema sp3, el cual puede ser un agente potencial para el control de esta plaga.

  14. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  15. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  16. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  17. Comportamiento de la infección experimental por aislamientos colombianos de Giardia duodenalis en el modelo animal del gerbo (Meriones unguiculatus.

    Directory of Open Access Journals (Sweden)

    Adriana Arévalo

    2005-09-01

    Full Text Available Introducción. Se han informado infecciones naturales y experimentales con Giardia sp. en bovinos, equinos, caprinos, caninos, felinos y roedores como ratones, ratas y gerbos; estos últimos son el modelo más adecuado para estudios de la infección por Giardia duodenalis y Giardia muris. Objetivo. Establecer el comportamiento de la infección con aislamientos colombianos de Giardia duodenalis en el modelo animal del gerbo. Materiales y métodos. Se purificaron mediante gradientes de sacarosa y percoll quistes del parásito obtenidos a partir de heces de pacientes sintomáticos infectados. La inoculación a los animales se realizó mediante sonda gástrica con 5x103 quistes. El curso de la infección se estableció mediante recuento diario de quistes y semanal de trofozoítos durante treinta días. Resultados. La eliminación de quistes presentó un patrón intermitente de excreción, con ausencia en la primera y cuarta semanas de infección, y presencia constante durante la segunda y tercera semanas, en número variable con promedio mínimo de 79 y máximo de 17.943 quistes liberados en heces recolectadas en un período de dos horas. Se observó colonización de los trofozoítos en el intestino delgado, en número que osciló entre 15.000 y 6'577.778 trofozoítos por ml. Conclusiones. En gerbos infectados con aislamientos de Giardia duodenalis circulantes en otras regiones geográficas, la resolución natural de la infección oscila entre 86 y 114 días mientras que los gerbos infectados con aislamientos colombianos del parásito la resuelven al día 30. El gerbo constituye un modelo animal adecuado para la infección con aislamientos colombianos de G. duodenalis. La infección experimental por Giardia en gerbo permite obtener quistes y trofozoítos del parásito en cantidades suficientes con la finalidad de ser utilizados como antígenos para la inmunización de animales y para la obtención de anticuerpos que puedan utilizarse para la detecci

  18. Caracterización fenotípica de aislamientos de Acinetobacter baumannii en una institución de salud de alta complejidad de Cali

    Directory of Open Access Journals (Sweden)

    Alfredo Prado

    2014-04-01

    Full Text Available Introducción. La caracterización fenotípica de las bacterias del género Acinetobacter mediante pruebas bioquímicas y microscópicas es posible. Varios estudios han demostrado que los aislamientos provenientes de infecciones asociadas a la atención en salud presentan una elevada resistencia a los antibióticos de primera elección. Objetivo. Describir los patrones de resistencia de los aislamientos de Acinetobacter baumannii obtenidos en una institución de salud, así como sus características fenotípicas y los posibles mecanismos de resistencia. Materiales y métodos. Se realizó un estudio descriptivo de corte transversal con 28 informes de muestras tomadas a pacientes hospitalizados con infección por A. baumannii. Las pruebas de sensibilidad para ceftazidime, cefepime, meropenem, amikacina y ciprofloxacina se realizaron con el sistema automatizado Vitek® y la clasificación de sensible, intermedia y resistente se hizo con base en el protocolo establecido por el Clinical and Laboratory Standards Institute para el año 2007. Resultados. El mayor porcentaje de aislamientos correspondió al sexo masculino (53,6 %, a la sala de infectología (28,5 % y al mes de septiembre (21,4 %; el tipo de muestra más frecuente fue el de secreción endotraqueal (53,6 %. A partir de los patrones de los perfiles de sensibilidad a los antibióticos empleados se obtuvieron 13 filotipos. Conclusión. Acinetobacter baumannii es un agente patógeno resistente a múltiples antimicrobianos, involucrado en brotes de infecciones asociadas a la atención en salud. Los patrones de los perfiles de resistencia permiten inferir que los posibles mecanismos de resistencia presentes en la mayoría de los aislamientos son la producción de betalactamasas de espectro extendido, las enzimas modificadoras del antibiótico y la modificación del sitio diana.

  19. Evaluación del comportamiento de aislamientos térmicos elaborados con médula de maíz en un sistema SATE

    OpenAIRE

    Remesal Ciudad, Angel

    2015-01-01

    El presente TFG parte de una tesis doctoral inédita y un TFG previos. Los profesores y doctorados que conforman el grupo de investigación GICITED (Grup Interdisciplinar de Ciència i Tecnologia a l’Edificació) de la UPC, están trabajando conjuntamente para elaborar un aislamiento térmico de origen vegetal, aprovechando subproductos agrícolas y aglomerantes orgánicos de origen natural. El panel está formado por la fibra extraída del tallo del maíz (médula) aglutinada con alginato, una goma natu...

  20. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  1. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  2. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  3. Variabilidad genética de aislamientos de Salmonella typhimurium (grupo B obtenidos de hígados de pollo destinados para consumo humano

    Directory of Open Access Journals (Sweden)

    Martín Talavera Rojas

    2011-01-01

    Full Text Available Se determinó la frecuencia de aislamientos de Salmonella spp en hígados de pollo para venta, en cuatro mercados del área metropolitana de la ciudad de Toluca, México. El aislamiento bacteriológico se realizó de acuerdo a la norma NOM-114-SSA1- 1994 para la determinación de Salmonella en alimentos. Se realizó la prueba de ERIC-PCR para determinar la variedad genética de las cepas de Salmonella aisladas. De un total de 520 muestras incluidas en el estudio, 7 (1.34 % resultaron positivas a Salmonella serogrupo B (typhimurim. En el ERIC-PCR se observaron cuatro perfiles, encontrando similitud entre cepas de diferentes mercados, lo cual podría indicar que el manejo que se les da a las canales y vísceras es de suma importancia, además que la presencia en hígados de pollo para consumo humano debe ser considerado como una fuente importante de infección, ya que cualquier serovariedad de esta bacteria representa un potencial de infección para el humano.

  4. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  6. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  7. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  8. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  9. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  10. Caracterización de vidrios para la evaluación del aislamiento acústico a ruido aéreo

    Directory of Open Access Journals (Sweden)

    Alba Fernández, J.

    2012-08-01

    Full Text Available The main contribution of this paper is the formulation of an alternative to experimental determination of loss factor and, consequently, to improve the predictions of airborne sound insulation for any type of monolithic or laminated glass. In addition, a review of the standards related to measurement of mechanical parameters of glass is carried out, with particular interest in laminated glass. Indeed, one of the problems that arise in the current context of building acoustics is to meet the requirements of facades airborne sound insulation of existing Building Technical Code (BTC. It is known that the blind and the hollow part of the facade should be distinguished. The weakest part regarding to airborne sound insulation is the empty one (consisting of glass, woodwork and other elements. Choosing an adequate woodwork makes the glass surface become the limiting factor. The Constructive Elements Catalog (CEC of the BTC, the UNE-EN 12758:2011 standard, as well as some, increasingly, data vendors provide information about airborne sound insulation for monolithic glass, laminated glass and double glazing. In the case of laminated glass, these data are limited only to those with a single intermediate layer, and also nonacoustic. Can therefore be said that there is a gap of knowledge in this regard. To obtain reliable predictions of airborne sound insulation of multilayer partitions, such as laminated glass, mechanical characteristics must be known, being loss factor one of the most important.

    La principal aportación del trabajo es la formulación de una alternativa que facilita la determinación experimental del factor de pérdidas y, en consecuencia, mejorar las predicciones de aislamiento a ruido aéreo para vidrios con una o más capas intermedias sea cual fuere su naturaleza. Además, se realiza una revisión de las normativas relacionadas con los ensayos de los parámetros mecánicos necesarios para la caracterizar los vidrios, centr

  11. AISLAMIENTO, IDENTIFICACIÓN Y CARACTERIZACIÓN DE NUCLEOPOLIEDROVIRUS NATIVOS DE SPODOPTERA FRUGIPERDA EN COLOMBIA ISOLATION, IDENTIFICATION AND CHARACTERIZATION OF NATIVE NUCLEOPOLYHEDROVIRUS OF SPODOPTERA FRUGIPERDA IN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Juliana Andrea Gómez Valderrama

    2010-12-01

    Full Text Available El gusano cogollero del maíz Spodoptera frugiperda (J.E. Smith es considerado la plaga más importante del cultivo en el mundo. En varios países se han empleado exitosamente los nucleopoliedrovirus de la familia Baculoviridae para su control. Sin embargo, en Colombia, no se cuenta ningún bioplaguicida viral registrado para el control de la plaga. En el presente trabajo, se realizó la búsqueda de aislamientos nativos de nucleopoliedrovirus en los departamentos de Tolima, Meta y Córdoba, mediante la recolección de larvas en diferentes cultivos. Las muestras fueron analizadas por microscopía para la búsqueda de partículas virales y los aislamientos encontrados se caracterizaron física y biológicamente. Se recolectaron 2.140 larvas de S. frugiperda en los tres departamentos muestreados. Sin embargo, sólo en un lugar (Cereté, Córdoba, se encontraron larvas con síntomas de infección viral en campo. El 2% de las muestras colectadas mostraron síntomas típicos de infección y en total se identificaron 3 aislamientos codificados como NPV003 (Córdoba, NPV009 (Tolima y NPV011 (Meta. Los aislamientos presentaron un tamaño de partícula entre 1,93 µm y 2,14 µm. Las concentraciones letales medias (CL50 sobre larvas neonatas oscilaron entre 2,2 x 105 CI/mL y 7,0 x 105 CI/mL y no se registraron estadísticas entre los aislamientos, sugiriendo que todos tienen la misma patogenicidad sobre larvas neonatas del insecto. Estos virus nativos representan la base para el desarrollo de una nueva alternativa biológica para el control de la plaga, siendo necesario iniciar los estudios para su formulación.Worldwide, the fall armyworm Spodoptera frugiperda (J.E. Smith is considered the most important pest of maize crop. Nucleopolyhedrovirus of Baculoviridae family have been successfully used in several countries for its control. However, in Colombia there are not any biopesticide registered for the control of this pest. In the present work, native

  12. Aislamiento de microorganismos productores de biosurfactantes y lipasas a partir de efluentes residuales de camales y suelos contaminados con hidrocarburos

    Directory of Open Access Journals (Sweden)

    Lizzie Karen Becerra Gutiérrez

    2016-01-01

    Full Text Available Los biosurfactantes son moléculas anfipáticas que reducen la tensión en la interfase, incrementando así la solubilidad en agua y disponibilidad de compuestos orgánicos, son producidos por bacterias, hongos, y levaduras. Para el aislamiento de bacterias productoras de biosurfactante y lipasas, se sembró en medios inductores 10% de efluentes residuales procedentes de camales y suelos de grifos contaminados con hidrocarburos de la Provincia de Trujillo - Perú. Los cultivos aislados se sembraron en agar lecitina y agar rodamina para la determinación de productores de lipasas. Los microorganismos seleccionados se sembraron en agar sangre y agar Siegmund y Wagner (SW para la selección preliminar de bacterias biosurfactantes. Posteriormente se determinó a aquellos microorganismos productores de surfactantes mediante Índice de Emulsificación (IE y Medición de la Tensión superficial. Los cultivos positivos a estas pruebas fueron seleccionados e identificados mediante galerías API e identificación molecular por secuenciamiento de ADN. Los cultivos que redujeron en mayor medida la tensión superficial fueron P. aeruginosa y B. amyloliquefaciens, llegando a reducir la tensión superficial a 27,2 ± 0,4 y 31,03 ± 0,4 mN/m respectivamente, mientras que P. stutzeri y Pseudomonas sp. redujeron la tensión superficial a 48,3 y 52,6 ± 0,4 mN/m respectivamente. Se concluye, por tanto, que se obtuvo 49 cultivos productores de lipasas de la provincia de Trujillo, de los cuales se determinó que Pseudomonas stutzeri, Pseudomonas sp, Pseudomonas aeruginosa y Bacillus amyloliquefaciens son productores de biosurfactantes y pueden aplicarse en el área de la biotecnología ambiental para la remoción y biodegradación de contaminantes.

  13. Dinámica poblacional y aislamiento de bacterias ácido lácticas en lactosuero fermentado

    Directory of Open Access Journals (Sweden)

    Valeria Martínez-López

    2016-01-01

    Full Text Available Introducción: El consumo de queso producido con leche cruda puede causar daños a la salud debido a la carga microbiana presente en la leche bronca, que puede incluir microorganismos patógenos. Los cultivos iniciadores endémicos de los quesos artesanales podrían mejorar el sabor de quesos fabricados con leche pasteurizada. El objetivo de este trabajo fue estudiar la dinámica poblacional de bacterias ácido lácticas (BAL del suero fermentado de queso de hebra (SFQH y su aislamiento. Método: El suero de queso fue obtenido del proceso artesanal para la elaboración de queso de hebra usando leche cruda (Tuxtepec, Oaxaca, México. Durante 120 h, muestras de SFQH, que fueron obtenidas en diferentes tiempos, se utilizaron para determinar el pH del medio e inocular cajas con medios selectivos MRS, M17, APT y Elliker. Los aislados obtenidos se caracterizaron morfológica y molecularmente. Resultados: La población de BAL se modificó en función del tiempo de fermentación y del pH (4.05 a 3.4 del suero. Se aislaron 22 cepas catalasa negativas y Gram-positivo. El análisis filogenético (ADNr 16S indicó la presencia de cuatro cepas del género Enterococcus (VD, VH, VL, VB y una de Lactobacillus (VK. La cepa VH predominó sobre el resto de los aislados y junto con la cepa VK permanecieron durante todo el bioproceso. Discusión o Conclusión: El cambio en el pH del SFQH permitió aislar cepas de BAL, que podrían utilizarse como cultivos iniciadores para obtener queso de acuerdo a las especificaciones de la NOM-243-SSA1-2010, sin comprometer su calidad sensorial.

  14. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  15. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  16. MATRICES DE RIGIDEZ Y DE CARGA DE PRIMER Y SEGUNDO ORDEN DE UNA VIGA-COLUMNA ORTOTRÓPICA CON CONEXIONES SEMIRRÍGIDAS: I TEORIA

    Directory of Open Access Journals (Sweden)

    J. DARIO ARISTIZABAL-OCHOA

    2010-01-01

    Full Text Available Las matrices de rigidez y de carga de primer y segundo orden de una vigacolumna de Timoshenko ortotrópica de sección transversal simétrica con conexiones semirrígidas incluyendo los efectos de la carga axial en los extremos (tracción o compresión y de las fuerzas cortantes a lo largo del elemento son deducidas de una manera clásica. El modelo de Haringx descrito por Timoshenko y Gere (1961 es adoptado en la formulación de las matrices. Ambas matrices pueden ser utilizadas en los análisis elásticos de estabilidad, de primer y de segundo orden de estructuras aporticadas con elementos vigacolumna de Timoshenko de sección transversal simétrica con conexiones rígidas, semirrígidas y simples. Las matrices de rigidez propuestas pueden también ser usadas en el análisis inelástico de pórticos cuyos elementos sufren de degradación por flexión o, en caso contrario, rigidización de las conexiones. Las expresiones cerradas de las matrices de rigidez y de carga desarrolladas y presentadas en este artículo encuentran grandes aplicaciones en los análisis de estabilidad y de segundo orden de estructuras aporticadas compuestas de elementos vigacolumna con rigidez a cortante relativamente baja tales como polímeros compuestos ortotrópicos (FRP o "composites" y elementos cortos elastoméricos de múltiples capas comúnmente usados como aislamiento sísmico en edificios. Los efectos del alabeo torsional a lo largo del elemento no son incluidos.

  17. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  18. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  19. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  20. Streptococcus pneumoniae: evolución de los serotipos y los patrones de susceptibilidad antimicrobiana en aislamientos invasores en 11 años de vigilancia en colombia (1994 -2004.

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo

    2006-06-01

    Full Text Available Introducción. Streptococcus pneumoniae es una las principales causas de morbilidad y mortalidad en niños y adultos en el mundo. Objetivo. Realizar un análisis de los datos de la vigilancia por el laboratorio de los aislamientos invasores de S. pneumoniae recuperados entre 1994 y 2004. Materiales y métodos. Se empleó la información de los aislamientos invasores de S. pneumoniae recibidos en el Grupo de Microbiología del Instituto Nacional de Salud durante la vigilancia de meningitis bacteriana aguda e infección respiratoria aguda entre 1994 y 2004. Los aislamientos contaban con datos epidemiológicos, serotipo, patrones de susceptibilidad antimicrobiana y algunos con tipificación molecular. Resultados. Se analizaron los datos de 2.022 aislamientos procedentes de 120 hospitales de diferentes regiones del país, recuperados principalmente de hemocultivos (50,7% y líquido cefalorraquídeo (42%. Los serotipos más importantes fueron el 14, 6B, 23F, 1, 5, 6A, 19F, 18C y 9V, los cuales corresponden al 83,6% en niños menores de 6 años, al 74,0% en el grupo de 6 a 14 años y al 61,4% en mayores de 14 años. El 29,8% de los aislamientos presentó susceptibilidad disminuida a la penicilina (SDP, 44,3% a trimetoprim-sulfametoxazol, 32,4% a tetraciclina, 8,2% a cloranfenicol, 3,8% a eritromicina; todos fueron sensibles a vancomicina y el 13% fue multirresistente. Se tipificaron 602 aislamientos con SDP, de los cuales 27 (4,5% se relacionaron con el clon 1-España23F, 38 (6,3% con el clon 2-España6B, 301 (50% con el 3- España9V y 75 (12,5% con el clon 26-Colombia23F, además, los 138 aislamientos con tipo capsular 5 se relacionaron con el clon 19-Colombia5. Conclusiones. Los resultados proporcionan información básica necesaria para el diseño e implementación de estrategias para la prevención de la enfermedad neumocócica en nuestro país.

  1. Actividades enzimáticas en aislamientos bacterianos de tractos digestivos de larvas y del contenido de pupas de Automeris zugana y Rothschildia lebeau (Lepidoptera: Saturniidae

    Directory of Open Access Journals (Sweden)

    Adrián Pinto-Tomás

    2007-06-01

    Full Text Available El tracto digestivo de orugas constituye un microambiente extremo, debido a su elevado pH y presencia de sustancias antimicrobianas secretadas por el insecto o derivadas del tejido vegetal ingerido. Al mismo tiempo, el intestino alberga gran cantidad de alimento, por el cual los microorganismos presentes podrían competir entre sí y con su hospedero. Existe poca información sobre la microbiota asociada con el intestino de orugas tropicales, aunque se ha demostrado la presencia de bacterias de diversos géneros tanto en el intestino como en el interior de pupas. El estudio de las actividades enzimáticas de estos microorganismos constituye un punto de partida en la comprensión de la posible relación metabólica y fisiológica que establecen con sus hospederos, a la vez que permite investigar enzimas con potenciales aplicaciones biotecnológicas. En este trabajo se evaluó la presencia de actividades gelatinolítica, caseinolítica, esterásica, lipolítica, quitinolítica, amilásica, celulolítica y xilanolítica en dos colecciones de aislamientos bacterianos provenientes de tractos digestivos de orugas y de pupas de los lepidópteros Automeris zugana y Rothschildia lebeau. Se utilizaron ensayos bioquímicos tradicionales para detectar enzimas secretadas en condiciones aerobias, en las que ambas colecciones exhibieron un comportamiento enzimático similar. Ningún aislamiento produjo un resultado positivo en todas las pruebas, pero como conjunto ambas colecciones fueron capaces de utilizar todos los sustratos evaluados. Los aislamientos obtenidos de pupas presentaron prácticamente las mismas actividades que sus homólogos provenientes de intestinos. En ambas colecciones fue posible agrupar los aislamientos de acuerdo con su patrón de producción de enzimas. Además de un conjunto heterogéneo de aislamientos poco activos (dos o menos actividades, se destacan dos grupos muy activos (al menos cinco actividades, que manifiestan una aparente

  2. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  3. AISLAMIENTO Y CARACTERIZACIÓN MORFOLÓGICA DE Rosellinia pepo Pat. EN PLANTAS DE MACADAMIA ISOLATION AND MORPHOLOGICAL CHARACTERIZATION OF Rosellinia pepo Pat. IN MACADAMIA PLANTS

    Directory of Open Access Journals (Sweden)

    Carmen Eliana Realpe Ortiz

    2006-12-01

    Full Text Available El hongo Rosellinia pepo Pat., causante de la llaga estrellada, se considera uno de los principales problemas fitosanitarios de la macadamia por ocasionar la muerte de la planta en su etapa productiva. Debido a que no existe una metodología de aislamiento confiable que asegure la recuperación del hongo con un porcentaje mínimo de contaminación y los estudios relacionados con este patógeno son escasos se planteó una investigación con el fin de perfeccionar una metodología de aislamiento y realizar algunas caracterizaciones morfológicas de este patógeno. La nueva metodología permitió obtener aislamientos con un 91,26% de pureza del hongo. La tasa de crecimiento fue de 4,68 mm día-1. Las colonias son de color blanco y apariencia algodonosa en su inicio, pero a medida que envejece el micelio toma un color café o negro y su apariencia se torna quebradiza. La observación de micelio blanco en forma de estrella en el lado interior del medio sintético permite diferenciarlo de otras especies como R. bunodes. Las mediciones microscópicas de los hinchamientos piriformes presentaron en promedio 106,4mm de largo y 75,3mm de ancho. Este trabajo también permitió determinar el nivel de inóculo infectivo.The fungus Rosellinia pepo Pat, the causal agent of star gall, is considered to be a main phytosanitary problem to the Macademia tree by causing the death of the tree while in its productive stage. Because no reliable isolation method exists that assures recovery of the mushroom with a minimum percentage of contamination and studies of this pathogen are scarce. This study was conducted to perfect an isolation methodology and permit some morphological characterizations of this pathogen. The new methodology allowed isolations with 91,26% purity of mushroom to be obtained. The rate of growth was 4,68 mm day-1. The colonies were of white color and cottony appearance in the beginning, but as the micelio aged it assumed a brown or black color and a

  4. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López

    2006-12-01

    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  5. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  6. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  7. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  8. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  9. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  10. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  11. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  12. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  13. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  14. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  15. Identificación de antígenos de aislamientos colombianos de Giardia duodenalis reconocidos por IgG total y subclases.

    Directory of Open Access Journals (Sweden)

    Jenny Fabiola Hernández

    2003-09-01

    Full Text Available Se conocen investigaciones realizadas sobre la respuesta inmune humoral en giardiosis. Sin embargo, estudios sobre perfiles de antígenos de quistes y de trofozoítos de Giardia duodenalis reconocidos por IgG y subclases (IgG1, IgG2, IgG3, IgG4 anti-G. duodenalis no se han realizado en la misma magnitud. Con el fin de determinar los antígenos de los aislamientos colombianos de G. duodenalis reconocidos por IgG y sus subclases anti-G. duodenalis, se utilizó la metodología de Western blot. Quistes y trofozoítos del parásito, independientemente, se sometieron a separación de proteínas mediante SDS-PAGE. Las proteínas separadas fueron transferidas a membrana de nitrocelulosa mediante inmunoelectrotransferencia y su antigenicidad determinada confrontando éstas con IgG y sus subclases anti-G. duodenalis presentes en el suero de pacientes con giardiosis comprobada parasitológicamente. La unión antígeno-anticuerpo se detectó con conjugados anti-inmunoglobulina específicos unidos a fosfatasa alcalina, la cual permitió evidenciar los polipéptidos antigénicos cuando se adicionó el sustrato 5-bromo-4-cloro-3-indolil-fosfato/azul de nitrotetrazolio. Se leyeron y analizaron las bandas mediante análisis de regresión lineal, utilizando el programa Quantity One®. Se reconocieron 32 antígenos, simultáneamente en quistes y trofozoítos de aislamientos colombianos del parásito por IgG total anti-G. duodenalis, que oscilaron entre 22-185 kDa y 19 en un rango de 42 a 180 kDa, reconocidos tanto por IgG1 como por IgG3 anti-G. duodenalis. Las IgG2 e IgG4 anti-parásito no reconocieron antígenos en ninguno de los dos estadios. Los antígenos de 27, 30, 31, 33, 45, 49, 57, 78, 89 y 170 kDa son compartidos con aislamientos de G. duodenalis circulantes en otras regiones geográficas. El reconocimiento de antígenos de quistes y trofozoítos de los aislamientos colombianos de G. duodenalis por IgG, IgG1 e IgG3 anti-G. duodenalis de pacientes

  16. Aislamiento y caracterización de Escherichia coliO157:H7 a partir de carne molida de bovino en Lima-Perú

    Directory of Open Access Journals (Sweden)

    Carmen R. Méndez

    2013-12-01

    Full Text Available El objetivo del estudio fue aislar y caracterizar E. coliO157:H7 a partir de carne molida fresca de bovino obtenida en diferentes mercados de abastos. Se analizaron 195 muestras; para el aislamiento y enumeración de E. coli se utilizó la técnica del Numero Más probable mediante tubos múltiples; para el aislamiento y caracterización de E. coliO157:H7 el enriquecimiento selectivo y el análisis bioquímico, las colonias características se confirmaron mediante pruebas serológicas. Para determinar la presencia de shigatoxina (stx1, stx2 e intimina (eae A se empleó la técnica de PCR multiplex en tiempo real y para enterohemolisina la prueba de hemólisis. El 87.18% de la muestras fue positivo para E. coliy el 77.95% presentó un recuento igual o superior a 50 NMP/g. Se obtuvieron 3 (1.54% cepas de E. coliO157:H7, una stx1 +/ stx2 +/ eaeA – y enterohemolisina -, una stx1 +/ stx2 -/ eaeA + y enterohemolisina – y la otra stx1 -/ stx2 -/ eaeA – y enterohemolisina +. También se obtuvieron 4 cepas (2.05% de E. coli O157 no H7, ninguna presentó factores de virulencia. El estudio reveló el riesgo potencial de que E. coliO157:H7 afecte a la población de Lima.

  17. Aislamiento de Cándida sp. en cultivos de catéteres intravasculares en un hospital de alta complejidad.: 2008 y 2009, Lima-Perú.

    Directory of Open Access Journals (Sweden)

    Katherine Sedano-Rojas

    2011-10-01

    Full Text Available Objetivo: Determinar la frecuencia de aislamiento de Cándida en cultivos de CIV en un hospital de alta complejidad entre los años 2008 y 2009 y describir las características clínicas de los pacientes. Material y métodos: Estudio descriptivo retrospectivo. Se revisaron 783 registros de cultivos de catéter intravascular (CIV de la sección microbiología del Laboratorio Central del Hospital Nacional Cayetano Heredia, desde enero de 2008 a diciembre de 2009, así como la historia clínica de los pacientes con cultivo positivo a Cándida sp. Para la estadística se utilizó la hoja de cálculo de Microsoft Excel 2007, así como el programa estadístico Epi Info versión 3.4.3. Resultados: Se encontraron 467 (59,6% cultivos positivos; 425 (91% fueron bacterias. S. epidermidis se aisló en 215/467 (46%, siendo predominante en la Unidad de Cuidados Intensivos de Recién Nacidos (UCI-RN. Cándida se aisló en 42 (9%; 43,8% Cándida sp, 25% C. albicans y 31,3% C. krusei. Conclusiones: La frecuencia de aislamiento de cándida en cultivos de CIV fue 9%, siendo la especie más frecuente C. krusei. El 18,7% fallecieron. (Rev Med Hered 2011;22:176-181..

  18. Resistencia a los antimicrobianos de aislamientos de Escherichia coli obtenidos de cerdos de la República Argentina Antimicrobial resistance of Escherichia coli isolated from pigs in Argentina

    Directory of Open Access Journals (Sweden)

    F.A. Moredo

    2007-12-01

    Full Text Available Se estudiaron 69 aislamientos de Escherichia coli provenientes de cerdos clínicamente sanos o con signología clínica no compatible con diarreas causadas por este microorganismo, con el objetivo de determinar el patrón de resistencia a los antimicrobianos frecuentemente utilizados en medicina veterinaria y humana. Se empleó el método de difusión en agar. Se observaron elevados porcentajes de resistencia frente a ampicilina, estreptomicina y tetraciclina, antimicrobianos utilizados en las explotaciones porcinas, y frente a trimetoprima-sulfametoxazol y cloranfenicol, compuestos que han dejado de utilizarse hace varios años. El 62% de los aislamientos mostró multirresistencia. Los resultados obtenidos en el presente trabajo corroboran la hipótesis de que la distribución fenotípica de la resistencia y, posiblemente, la de sus determinantes genéticos están directamente influenciadas por los tratamientos antimicrobianos utilizados.Sixty-nine Escherichia coli isolates from healthy pigs or with clinical signs non-compatible with diarrhea caused by this microorganism, were studied. The purpose was to determine the resistance profile against antimicrobials frequently used in veterinary and human medicine. The agar diffusion method was used. High resistance percentages against antimicrobials used in swine farms such as ampicillin, streptomycin and tetracycline were observed, as well as against trimetoprim-sulfametoxazole and chloramphenicol, compounds that were stopped being used several years ago. Sixty two percent of isolates showed multidrug-resistance. The results obtained in this work corroborate the hypothesis that the phenotypic distribution of resistance and possibly that of its genetic determinants, are directly influenced by the antimicrobial treatments used.

  19. Caracterización morfológica y molecular de una colección de aislamientos de Phomopsis longicolla(teleomorfo desconocido: Diaporthalesde la región templada y subtropical de Argentina

    Directory of Open Access Journals (Sweden)

    Facundo E. Hernández

    2015-09-01

    Full Text Available Diaporthe(telomorfo - Phomopsis(anamorfo (DP constituye un grupo fúngico de amplia diversidad genética con más de 900 especies distribuidas en un amplio rango de hospedantes que incluye especies cultivadas y no cultivadas, forestales, frutales y malezas. Los aislamientos de DP son hemi-biótrofos y disponen de diferentes fuentes de inóculo primario, como el rastrojo y las semillas, para reiniciar sus ciclos de parasitismo-saprofitismo. Ellos colonizan los tejidos del hospedante desde los estadios tempranos del desarrollo y establecen relaciones nutricionales de endofitia y necrotrofia fúngica. La plasticidad del género Phomopsisha favorecido su expansión a diferentes agro-ecosistemas y hospedantes constituyendo un importante riesgo epidemiológico. El objetivo fue validar la identidad y evaluar las relaciones biológicas de 12 aislamientos de P. longicollay D. phaseolorumvar. sojaeobtenidos en distintos agro-ambientes templados y subtropicales de Argentina, para analizar la variabilidad y estrategias de conservación de la bio-diversidad fúngica. Las cualidades macro-morfo-lógicas(textura y color de colonias, forma y distribución de estromas, desarrollo, forma y distribución de cuerpos fructíferos, y los caracteres micro-morfológicos(tamaño y forma de conidios, ascos y ascosporas permitieron identificar a tres nuevos aislamientos de P. longicollaincluidos en el complejo D/P. El análisis molecular complementario corrigió las limitaciones derivadas de la caracterización basada sólo en marcadores morfológicos y logró reubicar al aislamiento AFP.8413 de identidad dudosa, en el nodo correspondiente a P. longicolla.De esta manera, la caracterización molecular definió la identidad de los aislamientos y los ubicó en los 4 taxones del complejo DP: diez aislamientos fueron incluidos en Plo(AFP.Gpo 4.4, AFP.Gpo 3.5, AFP.Gpo 4.3, AFP.Gpo 3.4, AFP.CaA, AFP. CaB, AFP.B5L16, AFP.B4L17, AFP.227B2, AFP.8413, un aislamiento incluido en Dps

  20. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  1. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  2. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  3. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  4. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  5. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  6. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  7. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  8. Características clínico-epidemiológicas de 14 casos con aislamiento clínico de enterococo resistente a Vancomicina en el Hospital Nacional Edgardo Rebagliati Martins

    Directory of Open Access Journals (Sweden)

    Wilfredo Hernán Flores Paredes

    2007-04-01

    Full Text Available Objetivo: Describir las características clínico-epidemiológicas de los casos con aislamiento clínico de enterococo resistente a la vancomicina (ERV. Material y métodos: Estudio descriptivo y retrospectivo que analiza todos los casos de ERV en un periodo de dos años (Set-2000 a Agost-2002. Se recolectó información de las historias clínicas de los pacientes y del sistema estadístico hospitalario. En la identificación y susceptibilidad antimicrobiana de las cepas ERV se utilizó el sistema MicroScan (Dade Behring. Resultados: El primer aislado ERV del hospital Rebagliati fue en setiembre-2000. En el periodo de dos años fueron 14 los pacientes a quienes se les aisló Enterococcus faecium resistente a la vancomicina. Los especímenes positivos fueron: sangre (7 aislados, orina (6 aislados, punta de catéter central (1 aislado y líquido ascítico (1 aislado. Las características clínicas de los pacientes fueron: edad avanzada, hemodiálisis, cirugía abdominal complicada, postración crónica, y alta mortalidad intrahospitalaria (50%. La estancia hospitalaria fue prolongada (media 41 [1-90] días. Ocho (57% pacientes se expusieron a una UCI y aquí su estancia también fue prolongada (media 34 [8-55] días. Nueve (64% pacientes recibieron vancomicina, pero fueron 13 (93% los pacientes que se expusieron a antibióticos relacionados a ERV (vancomicina, cefalosporinas de tercera generación y agentes antianaeróbicos. Se estableció alguna relación epidemiológica entre las cepas ERV con el seguimiento intrahospitalario de los pacientes y el fenotipo microbiológico de los aislados, se encontró al menos dos cadenas de transmisión que posiblemente tenían diseminación clonal. Se demuestra que hubo un brote nosocomial de ERV en una UCI entre Dic-2001 y Ene-2002. En el periodo de estudio no se realizaron estudio de tamizaje de colonización intestinal con ERV para conocer la verdadera magnitud del ERV en el hospital. Este estudio deja la

  9. Caracterización genotipica de aislamientos de Escherichia coli obtenidos de cerdos con diarrea posdestete y enfermedad de los edemas Genotypic characterization of toxigenic Escherichia coli isolated from pigs with postweaning diarrhea (PWD and edema disease (ED

    Directory of Open Access Journals (Sweden)

    Fabiana A Moredo

    2012-06-01

    Full Text Available El objetivo del trabajo fue caracterizar mediante PCR 47 aislamientos de Escheríchia coli recuperados de 32 cerdos con diagnóstico clínico de diarrea posdestete (DPD y de 3 cerdos con enfermedad de los edemas (ED. Sobre 44 aislamientos provenientes de cerdos con DPD, 42 (95,5 % fueron caracterizados como E. coli enterotoxigénicos (ETEC y 2 (4,5 % como E. coli productores de toxina Shiga (STEC. Catorce aislamientos de ETEC (33,3 % fueron positivos para los genes estl/estlI/fedA. El genotipo más complejo fue eltA/estll/east1/faeG/aidA. Los aislamientos provenientes de cerdos con ED se clasificaron como STEC porcinos y fueron portadores de stxJaidA. Once aislamientos (25 % fueron portadores del gen que codifica la expresión de la adhesina AIDA-I. Sin embargo, en ningún aislamiento se detectaron los genes que codifican la expresión de las adhesinas F5, F6, F41, de intimina y de "Paa". La prevención de la DPD y de la ED podría realizarse mediante el desarrollo de vacunas que generen anticuerpos contra las adhesinas de las cepas de E. coli prevalentes en la Argentina.The purpose of this work was to characterize 47 Escherichia coli strains isolated from 32 pigs diagnosed with postweaning diarrhea and tree pigs with edema disease by PCR. Forty two (95.5 % of the strains isolated from diarrheic pigs were characterized as enterotoxigenic E. coli (ETEC and 2 (4.5 % as Shiga toxin-producing E. coli (STEC. Fourteen (33.3 % ETEC strains were positive for est/estll/fedA genes. The most complex genotype was eltA/estl/faeG/aidA. Strains isolated from pigs with ED were classified as porcine STEC and were stxjaidA carriers. Eleven (25 % strains carried the gene encoding adhesln protein AIDA-I. However, genes coding for F5, F6, F41, intimin and Paa were not detected. The development of vaccines generating antibodies against prevalent E. coli adhesins in Argentina could be useful for the prevention of PWD and ED.

  10. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  11. Control biológico de la pudrición basal del tallo en Crisantemo (Dendranthema grandiflorum ocasionada por Sclerotinia sclerotiorum con algunos aislamientos de Trichoderma sp. y Gliocladium sp.

    Directory of Open Access Journals (Sweden)

    Valencia Jenny

    1999-12-01

    Full Text Available

    EI hongo Sclerotinia sclerotiorum ocasiona perdidas apreciables en diversos cultivos de flores y hortalizas. La investigación consistió en evaluar la capacidad antagónica de algunos aislamientos de Trichoderma sp. Y Gliocladium sp. Sobre Sclerotinia sclerotiorum, tanto in vitro, como en plantas de crisantemo. Los mejores antagonistas del patógeno in vitro fueron los aislamientos G-8B y G-98 de Gliocladium sp. y los aislamientos T-2IB y T-34B de Trichoderma sp. Los dos aislamientos de Gliocladium sp. Formaron un halo de inhibición alrededor de la colonia del patógeno, mientras que los aislamientos de Trichoderma sp. Produjeron esporulación abundante sobre las colonias del patógeno. Los mejores tratamientos en el control de la enfermedad en plantas de crisantemo fueron los aislamientos T-2IB y T-34B de Trichoderma sp. y el aislamiento G-8B de Gliocladium sp., con un menor índice y una menor severidad de la enfermedad. La metodología de evaluación in vitro utilizada en la investigación fue confiable, ya que los resultados encontrados en el laboratorio fueron bastante similares a los obtenidos en el ensayo de invernadero. Además, los aislamientos de Trichoderma y de Gliocladium utilizados ocasionaron un estimulo apreciable en el crecimiento de las plantas y un adelanto en la floración.

  12. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  13. El medio de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y otros hongos patógenos Modified Kaminski agar for the isolation of dermatophytes and some other pathogenic fungi

    Directory of Open Access Journals (Sweden)

    Fernando Montoya

    1989-01-01

    Full Text Available

    Se evaluaron 3 medios de cultivo de composición diferente (Mycobiotic agar, agar de Kaminski y agar de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y el reaislamiento de S. schenckii y hongos negros, agentes de cromomicosis. Con el objeto de puntualizar diferencias entre dichos medios se determinaron, para cada uno, la frecuencia de aislamiento de los hongos, sus características morfológicas y su tiempo de crecimiento, así como la rapidez e Intensidad de la contaminación bacteriana y/o micótica. Se estudiaron 150 muestras de pacientes con sospecha clínica de dermatofitosis y se hicieron 30 reaislamientos de S. schenckiiy 10 de agentes de cromomicosis. Se demostró la utilidad del agar de Kaminski modificado, tanto para el aislamiento como para el reaislamiento de los agentes señalados, a pesar de su mayor índice de contaminación microbiana. Fue, además, útil para el aislamiento de levaduras del género Candida.

    Three culture media with different composition (Mycobiotic agar, Kaminski agarand Kaminski agar modified with nystatin were evaluated for isolation of dermatophytes and reisolation of S. schenckiiand dematiaceous fungi. One hundred and fifty specimens of cases suspicious of dermatophytosis, as well as 30 strains of S. schenckiiand 10 of chromoblatomycosis agents were studied. The modified Kaminski agar was efficient for the isolation and reisolation of the tested agents, in spite of Its greater contamination rate; It was equally adequate for isolation of Candida species.

  14. Valoración de enfermería: detección de la soledad y del aislamiento social en los ancianos de riesgo Nursing assessment: detection of loneliness and social isolation in old people in risk

    Directory of Open Access Journals (Sweden)

    Montserrat Puig Llobet

    2009-03-01

    Full Text Available Objetivo: Identificar los instrumentos de valoración que pueden ser de utilidad en la profesión enfermera para detectar la soledad y el aislamiento social en los ancianos de riesgo. Metodología: Se ha realizado una revisión de los instrumentos multidisciplinares que valoran la soledad y el aislamiento social, a partir de bases de datos y búsqueda manual de diagnósticos y escalas que determinen la soledad y el aislamiento social en la Taxonomía NANDA y la Taxonomía Nursing Outcomes Classification (NOC. Resultados: De los once instrumentos analizados, siete de ellos estiman la soledad tanto de forma subjetiva como objetiva. Sin embargo, existen diferencias en la forma de valoración. Conclusión: Las escalas de valoración social y de soledad son un elemento útil en la detección de ancianos con riesgo de percibir y sufrir la soledad. Los resultados corroboran que los profesionales de enfermería tienen herramientas adecuadas en la detección de los factores de riesgo de la soledad y del aislamiento social.Objectives: Identify the valuation instruments that can be useful in the nursing profession to detect loneliness and social isolation in the elderly at risk. Methodology: The review of multidisciplinary instruments that value the loneliness and social isolation from databases and search manual diagnostic and scales to determine the loneliness and social isolation in the NANDA Taxonomy and Taxonomy Nursing Outcomes Classification (NOC. Results: Of the eleven instruments analyzed, seven of them feel the loneliness of both subjective and objective manner. However, differences exist in the form of valuation. Conclusions: The scales of social value and loneliness are a useful element in the detection of elderly at risk of perceiving and suffer loneliness. The results confirm that nursing professionals have adequate instruments to detect the risk factors of loneliness and social isolation.

  15. Aislamiento y caracterización de Escherichia coli O157 en productos cárnicos bovinos y medias reses en la provincia de Tucumán

    Directory of Open Access Journals (Sweden)

    María A Jure

    2015-06-01

    Full Text Available Escherichia coli O157 es un patógeno emergente asociado a diarrea, colitis hemorrágica y síndrome urémico hemolítico. Los productos cárnicos constituyen una importante fuente de contaminación con este microorganismo. Los objetivos de este estudio fueron establecer la frecuencia de detección de E. coli O157 en productos cárnicos y media res en la provincia de Tucumán, caracterizar los factores de virulencia de los aislamientos obtenidos, establecer la relación clonal entre cepas regionales mediante electroforesis de campo pulsado y comparar con lo consignado en la base de datos nacional. Desde 2004 hasta 2013 se analizaron 169 muestras de carne picada, 35 embutidos y 216 esponjados de media res. Se identificaron 13 aislamientos de E. coli O157; 6 de ellos fueron O157:H7 productores de toxina Shiga y se caracterizaron como stx2c(vh-a/eae/ehxA (n = 5 y stx2/eae/ehxA (n = 1; los 7 aislamientos de E. coli O157 no toxigénicos fueron O157:NT(n = 4,O157:NM (n = 1,O157:ND (n = 1 y O157:H16 (n = 1. Los patrones de PFGE fueron diferentes entre sí y de los registrados en la base de datos nacional. Se concluye que existe gran diversidad genética en los aislamientos de E. coli O157 circulantes en nuestra región.

  16. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  17. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  18. Características de aislamientos de Rhizoctonia solani Huhn y su importancia como patógenos de Stylosanthes guianensis (Aubl. Sw.

    Directory of Open Access Journals (Sweden)

    Lenne Jilliam M.

    1986-06-01

    Full Text Available Se encontró considerable variación en el crecimiento, color, zonificación, esclerocios, textura del micelio y en la virulencia de siete aislamientos de R. solani. Como seis aislamientos fueron multinucleados y uno binucleado, se demostró que es indispensable determinar ésta característica en ensayos con R. solani. Los aislamientos se ubicaron en los grupos de anastomosis AG -1, AG-2, AG-4; pero en los ensayos con electroforesis de isoenzirnas los modelos de bandas para los a islamientos probadores de los AG y los probados en éste estudio fueron diferentes, lo que llevó a cuestionar la importancia de los AG. Los ecotípos de Centrosema spp y P. phaseoloides fueron más afectados que los de S. guianensis, D. ovalifolium y S. capitata. La reacción al daño de R. solani fue diferencial en los ecotipos CIAT 1283 (tardío y 184 (común y tuvo mucha relación con la edad; en general, la enfermedad se incrementó con la edad en el eco tipo tardío y disminuyó con ésta o fue independiente en el ecotipo común; el ecotipo más fectado fue el tardío; las pérdidas de forraje no fueron considerables, pero el efecto en la digestibilidad fue notorio; la capacidad de rebrote fue buena en 184. Se observó un estímulo en el crecimiento de las plantas de S.guianensis y D. ovalifolium.Considerable variation was found in the growth, color, zonation, sclerotia, mycelial texture and virulence of seven isolates of R. solani. Six multinuclease and one binuclease isolates were determined, demonstrating that it is indispensable to determine this characteristic in trials with this pathogen. The isolates were placed in three anastomosis group AG -1, AG -2 and AG -4; but with electrophoresis of isoenzymes it was found that the band models were different for the known rest AG iso lates and those isolates proven in this study which questions the importance of anastomosis qroups. Ecotypes of Centrosema spp. and P. phaseoloides were more affected than those of S

  19. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  20. Aislamiento reproductivo asimétrico entre Lutzomyia pseudolongipalpis y Lutzomyia longipalpis (especie C2, vectores neotropicales de leishmaniasis visceral (Diptera: Pshychodidae

    Directory of Open Access Journals (Sweden)

    Jazzmin Arrivillaga

    2009-06-01

    Full Text Available Lutzomyia pseudolongipalpis y Lutzomyia longipalpis (especie C2, L. n. sp son dos especies de flebotominos vectores endémicos de Venezuela, simpátricas, monofiléticas, con profundas divergencias, morfológicamente diferentes y pertenecientes al complejo de especies L. longipalpis. El estudio de su aislamiento reproductivo es clave para entender el proceso de especiación y el mantenimiento de estas dos especies hermanas como entidades taxonómicas y biológicas discretas. Por tal motivo, se realizaron ensayos de entrecruzamiento homo y heteroespecíficos, los cuales fueron monitoreados por dos criterios: biológico (presencia de cópula y progenie y genético (utilizando dos marcadores isoenzimáticos diagnósticos para el complejo L. longipalpis, las enzimas AK y HK. Los resultados indican aislamiento reproductivo, con un intercambio genético asimétrico hacia la hibridización en condiciones experimentales, y producción de un bajo número de heterocigotos, lo que apoya la existencia de selección negativa sobre los híbridos y explica su ausencia en condiciones naturales en la localidad simpátrica.Asymmetric reproductive isolation between Lutzomyia pseudolongipalpis and Lutzomyia longipalpis (species C2, Neotropical vectors of visceral leishmaniasis (Diptera: Pshychodidae. Lutzomyia pseudolongipalpis and Lutzomyia longipalpis (species C2, L. sp n. are two endemic species of Phlebotominae sand fly vectors from Venezuela. The two insects are sympatric and monophyletic but have deeply diverging, morphological differences. They belong to the L. longipalpis complex. A study of their reproductive isolation is necessary to understand the process of speciation and maintenance of the two sister species as two discrete taxonomic and biological entities. Cross-mating tests were conducted (homo and hetero-specific and monitored under two criteria: biological (presence of copulation and offspring and genetic (using two isozymic markers diagnostic for

  1. Análisis de Vías Libres para mantenimiento partiendo de las Configuraciones de Aislamiento. // Analysis of free access for maintenance starting from isolation configurations.

    Directory of Open Access Journals (Sweden)

    A. Torres Valle

    2005-01-01

    Full Text Available La seguridad durante las intervenciones de mantenimiento se trata de manera limitada y en general independiente de lossistemas de gestión del mantenimiento. Esta variable está afectada por múltiples factores de tipo técnico o humano, muchasveces subjetivos y difíciles de cuantificar, lo que limita el diseño de planes preventivos. Sin embargo, algunos factoresconstituyen puntos comunes: las configuraciones de aislamiento durante las vías libres y los errores humanos asociados a suviolación. Esta característica permitió desarrollar el análisis de tales situaciones a través de la metodología de árboles defallos que vincula coherentemente fallos de equipos y errores humanos. La metodología ha sido automatizada dentro delcódigo MOSEG Win Ver 1.0 y la misma puede abarcar desde el análisis de una situación particular de vía libre hasta el deuna estrategia completa de mantenimiento desde el punto de vista de la seguridad del personal mantenedor.Palabras Claves: Vía libre, configuración de aislamiento, árbol de fallos, errores humanos, estrategias demantenimiento._____________________________________________________________________________Abstract.Safety during maintenance operations have been studied in a limited way and generally isolated from the maintenancemanagement system. Safety is affected by multiple both technical and human factors, of a subjective nature and difficult toquantify, this limits its value for designing preventive plans. However, some factors constitute common points namely:isolating configurations during the work protection code and human errors associated with its violation. Such situationswere able to be analyzed by following this feature through the fault tree methodology that matches equipment failures andhuman errors coherently. The methodology is automated as part of MOSEG Win Ver 1.0 code. It ranges from the analysisof particular situations up to complete maintenance strategy from the point of view of

  2. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  3. Perfiles genéticos (RFLP-IS6110 y resistencia a drogas en aislamientos de M. tuberculosis de pacientes internados en un hospital referencial del Callao, Perú

    Directory of Open Access Journals (Sweden)

    Christian Baldeviano V

    2003-04-01

    Full Text Available Objetivo: evaluar la frecuencia y el agrupamiento de los perfiles genéticos (RFLP-IS6110 y los niveles de resistencia a drogas en aislamientos de M. tuberculosis de pacientes hospitalizados con tuberculosis pulmonar frotis positivo (TBP-FP en un hospital general de la provincia del Callao, Lima, Perú. Materiales y métodos: se incluyeron pacientes con TBP-FP hospitalizados en el Hospital Nacional Daniel A. Carrión entre agosto de 2000 y febrero de 2001. Se realizó la prueba de sensibilidad a las cuatro drogas de primera linea (INH, RIF, SM, EMB por el método de las proporciones y la genotipificación mediante el método estándar de RFLP-IS6110. Se recolectó la información de los pacientes de los registros de laboratorio e historias clínicas. Resultados: en 74 aislamientos, el número de bandas en los perfiles genéticos variaron entre 2 y 16, 4 perfiles (5,5% mostraron menos de 5 bandas. En total 50 perfiles genéticos fueron obtenidos de 70 pacientes. 34 aislamientos (48,6 % se agruparon en 14 "clusters" y 36 tuvieron ocurrencia única. La resistencia a drogas en pacientes nunca y antes tratados fue 45,2% y 71,1%, respectivamente. La multidrogorresistencia fue 16,1% y 36,8%, respectivamente. 10 de los 14 "clusters" incluyeron por lo menos un aislamiento resistente y un cluster agrupó 6 aislamientos resistentes. Conclusiones: No se encontró evidencia de algún genotipo predominante en la población estudiada. Sin embargo, se observaron «clusters» agrupando pacientes con TB sensible y resistente. Nuestros resultados sugieren que existen genotipos asociados a resistencia lo cual indicaría transmisión activa de cepas resistentes en la provincia del Callao. Es necesario llevar a cabo un estudio poblacional para confirmar nuestros resultados.

  4. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  5. Isolation and Characterization of Potential Phytase-Producing Fungi from Environmental Samples of Antioquia (Colombia Aislamiento y Caracterización de Hongos Productores de Fitasa a partir de Muestras Ambientales de Antioquia (Colombia

    Directory of Open Access Journals (Sweden)

    Maritza Ocampo Betancur

    2012-06-01

    Full Text Available Abstract. Phytases are enzymes used as feed additive that enhance the phosphorus and mineral uptake in monogastric animals and reduce the level of phosphate excretion in their manure. Due to their easy cultivation and high production of extracellular enzymes, filamentous fungi are one of best sources of phytase for use in the feed industry. Phytase has been found principally in the genera Aspergillus, Penicillium, Mucor and Rhizopus. In this work, we report the isolation and characterization of environmental fungi producers of phytase with potential use as feed additives. Samples were collected from soils, fruits and cereals in Antioquia (Colombia. A total of 26 fungal strains were isolated and identified using ITS sequencing and morphological analysis. Strains belonged to the following genera: Penicillium, Aspergillus, Fusarium, Mortierella, Pestalotiopsis, Phoma, Paecilomyces and Rigidoporus. Fifty percent of isolates exhibited halos in phytase screening agar indicating that acidic phytases are common enzymes secreted by environmental fungi. Ten isolates were also able to grow in liquid phytase screening medium revealing their potential use for enzyme production in submerged fermentations. Molecular detection of the PhyA gene from Aspergillus was achieved. Partial sequence of the phyA gene from one A. niger isolate was obtained and analyzed.Resumen. Las fitasas son enzimas utilizadas como aditivo en productos de alimentación animal, con el fin de mejorar la asimilación de fósforo y minerales en animales monogástricos y disminuir la excreción de fósforo al ambiente. Los hongos filamentosos son una de las mejores fuentes de fitasas debido a su facilidad de cultivo y altos niveles de producción de enzimas extracelulares. Los principales productores de fitasas corresponden a miembros de los géneros Aspergillus, Penicillium, Mucor y Rhizopus. En este trabajo se reporta el aislamiento y caracterización de hongos ambientales productores de

  6. Caracterización de aislamientos de Vibrio cholerae no-O1, no-O139 asociados a cuadros de diarrea Characterization of Vibrio cholerae non-O1 and non-O139 isolates associated with diarrhea

    Directory of Open Access Journals (Sweden)

    S. González Fraga

    2009-03-01

    Full Text Available La infección por Vibrio cholerae, el agente causal del cólera, se trasmite al hombre por ingestión de agua y alimentos contaminados. Aunque son los serogrupos O1 y O139 los que habitualmente se asocian al cólera epidémico, los aislamientos de otros serogrupos también son causales de gastroenteritis e infecciones extra-intestinales. Durante el período 2003-2005, se investigó la presencia de V. cholerae en la materia fecal de niños con diarrea atendidos en el Hospital del Niño Jesús, Tucumán. Se recuperaron 34 aislamientos de V. cholerae no-O1, no-O139. Se determinaron sus perfiles de virulencia por PCR, la sensibilidad a los antimicrobianos y la diversidad genética por electroforesis en campo pulsado. Se obtuvieron ocho perfiles de virulencia, aunque ningún aislamiento fue positivo para la toxina colérica ni para la toxina termoestable. Cuatro aislamientos fueron positivos para el sistema de secreción de tipo tres. El 17,6% de los aislamientos fueron resistentes o de sensibilidad intermedia a ampicilina y el 5,9% fueron resistentes a trimetoprima-sulfametoxazol. Los aislamientos resultaron muy diversos: se hallaron 27 patrones distintos en 29 aislamientos tipificables por electroforesis en campo pulsado. A pesar de su baja incidencia, V. cholerae continúa siendo un agente causal de diarrea en niños, los que se ven afectados por una amplia variedad de cepas circulantes.Vibrio cholerae, etiologic agent of cholera, is transmitted to humans by ingestion of contaminated food or water. Even though serogroups O1 and O139 are the ones usually associated to epidemic cholera, isolates from other serogroups also cause gastroenteritis and extraintestinal infections. During the period 2003-2005, presence of V. cholerae in stools was investigated in children with diarrhea that seaked assistance at the Niño Jesús Hospital in Tucumán. Thirty four isolates of V. cholerae non-O1, non-O139 were recovered. We characterized the isolates studying

  7. Distribución de patrones PRA en aislamientos clínicos del complejo Mycobacterium avium procedentes de España y Suramérica.

    Directory of Open Access Journals (Sweden)

    Martha Isabel Murcia

    2004-06-01

    Full Text Available La infección por el complejo Mycobacterium avium (MAC es la infección sistémica más frecuente en la fase terminal del SIDA. Las sondas de ADN disponibles en el mercado para la identificación de micobacterias son muy precisas pero extremadamente costosas. Por eso, la mayoría de los laboratorios clínicos de Latinoamérica aún tipifican micobacterias mediante pruebas fenotípicas que son lentas, laboriosas y poco precisas. En este trabajo se aplicó el análisis del polimorfismo de los fragmentos de restricción del gen hsp65 (PRA a la identificación de MAC en 163 aislamientos clínicos procedentes de España y Suramérica. El genotipo PRA predominante en cada país fue: M. avium tipo I en Argentina (23/42, 55% y Brasil (48/72, 67%, M. avium tipo II en España (18/26, 69% y M. avium tipo III en Colombia (10/23, 43%. Este último genotipo, que aún no fue descrito fuera del continente americano, resultó muy infrecuente en los otros tres países del estudio. Se discuten ventajas e inconvenientes de la aplicación del PRA al diagnóstico micobacteriológico.

  8. The insulation condition diagnosis of high tension generator stators; Diagnostico del estado de aislamiento de estatores de generadores de alta tension

    Energy Technology Data Exchange (ETDEWEB)

    Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1989-12-31

    The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.

  9. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  11. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  12. Onchocercal DNA amplification using beta actin gene primers ...

    African Journals Online (AJOL)

    Onchocercal DNA amplification using beta actin gene primers compared with first internal transcribed spacer sequences for monitoring onchocerciasis eradication strategy. ... Out of the 12 amplicons in agarose gel, there were 6 sharp and 6 faint bands of 100bp molecular weight as documented. The sharp bands included 3 ...

  13. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  14. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  15. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545–549. Table 1.

  16. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  17. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... 500. Figure 1. PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using RAPD primer GLC-07. M = Molecular size marker (100 bp DNA ladder, Gene Link, USA). important crops species including wheat (T. aestivum L.). Among the DNA markers, randomly amplified.

  18. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  19. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  20. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  1. In vitro antimicrobial susceptibility in clinical isolates of Enterococcus species Susceptibilidad antimicrobiana in vitro en aislamientos clínicos de Enterococcus species

    Directory of Open Access Journals (Sweden)

    Ernesto Calderón-Jaimes

    2003-04-01

    Full Text Available OBJECTIVE: To describe the antimicrobial activity of several antimicrobial agents against 97 clinical significant isolates of Enterococcus spp. MATHERIAL AND METHODS: During a 2-year prospective study at Instituto Nacional de Pediatria (National Institute of Pediatrics in Mexico City. Ninety seven strains of Enterococcus spp. (60 E. faecalis and 37 E. faecium were tested against 11 antibiotics. Susceptibility tests were performed with agar, according to the standards of the sNational Committee for Clinical Laboratory Standards (NCCLS. Isolates were screened for high-level resistance (HLR to beta-lactams, aminoglycosides, glycopeptides and other antibiotics, as well as for vancomycin-phenotypes. Differences between proportions were evaluated with chi2 of Fisher exact fest. RESULTS: Overall resistance rates to the antibiotics tested were: 17/97 (17.5% to penicillin, ampicillin, amoxicillin-clavulanate and imipenem. There was neither HLR nor beta-lactamase production; 74/97 (48.4% were resistant to erythromycin; 60% to ciprofloxacin; 31/97 (32% to gentamicin, and 55/97 (56.7% to streptomycin. Seven strains were vancomycin-resistant enterococci (VRE, all of them identified as E. faecium; 5/7 with Van A and 2/7 with Van B phenotypes. All the isolates were susceptible to linezolid. The difference in susceptibility among species was significant. CONCLUSIONS: Mutidrug-resistant enterococci is a real problem and continuous surveillance is necessary. The microbiology laboratory is the first line of defense against the spread of multiantibiotic-resistan enterococci in the hospital environment . All the strains recovered should be tested for susceptibility to ampicillin, streptomycin, gentamicin and glycopeptides.OBJECTIVO: Describir la actividad antimicrobiana de varios antibióticos, contra 97 cepas de Enterococcus spp., consideradas como aislamientos clínicamente significativos. MATERIAL Y MÉTODOS: En un estudio prospectivo de dos años, (enero de 1998

  2. Detección y expresión de superantígenos y de resistencia antimicrobiana en aislamientos obtenidos de mujeres portadoras de Staphylococcus aureus que cuidan y alimentan niños.

    Science.gov (United States)

    Guaca-González, Yina Marcela; Flórez-Restrepo, Gladys Fernanda; Moncayo-Ortíz, José Ignacio; Santacruz-Ibarra, Jorge; Álvarez-Aldana, Adalucy

    2018-03-15

    Introducción. Staphylococcus aureus coloniza mucosas y piel, y causa graves infecciones en el hombre y los animales. Es importante establecer el estatus de portadoras de cepas enterotoxigénicas de este microorganismo en manipuladoras de alimentos, con el fin de prevenir intoxicaciones alimentarias.Objetivo. Establecer las correlaciones entre los genes de enterotoxinas clásicas, el gen tsst-1, la producción de toxinas en cultivo y la resistencia antimicrobiana en aislamientos de S. aureus provenientes de manipuladoras de alimentos que cuidan niños en sus comunidades.Materiales y métodos. Se cultivaron muestras de las fosas nasales y las yemas de los dedos de las manos, y se identificó S. aureus empleando las pruebas de rutina y métodos automatizados. La extracción de ADN se hizo mediante el método de bromuro de cetil-trimetil-amonio (Cetyl-Trimethyl-Ammonium Bromide, CTAB) modificado. Para la detección de superantígenos se emplearon pruebas de reacción en cadena de la polimerasa (PCR) simple y múltiple, y para la de toxinas, estuches comerciales.Resultados. Se encontró que el 22,0 % de los aislamientos correspondía a portadoras de S. aureus: 17,0 % en los aislamientos de fosas nasales; 5,0 % en los de las manos y 6,7 % simultáneamente en los dos sitios. La prevalencia de superantígenos fue de 73,7 %. El genotipo más frecuente fue el seatsst-1, con 10,0 %. La resistencia a un solo antibiótico fue de 74,7 % y, a cuatro antibióticos, de 3,2 %; de los aislamientos, el 93,7 % correspondía a cepas productoras de betalactamasas. La detección de genes clásicos y de tsst-1 mediante PCR fue de 48,4 % y la de toxinas en el sobrenadante, de 42,1 %,con una correlación de 95,7 %. Las mayores correlaciones se establecieron entre las toxinas TSST-1 (22/22) y SEA (17/18). La correlación del gen tsst-1 con la proteína y la resistencia fue de 100 %. Todos los aislamientos con el genotipo sea-tsst-1 t fueron resistentes y productores de las toxinas

  3. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Science.gov (United States)

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  4. Aislamiento de distintos serotipos de Haemophilus influenzae en muestras profundas de pacientes pediátricos Isolation of Haemophilus influenzae serotypes from sterile sites in sick children

    Directory of Open Access Journals (Sweden)

    B.M. Gatti

    2004-03-01

    Full Text Available Haemophilus influenzae (Hi es responsable de diversas enfermedades humanas como sepsis, meningitis, celulitis y osteoartritis. En este trabajo se investigó la recuperación de distintos serotipos de Hi en muestras profundas de pacientes pediátricos. Se estudiaron 179 aislamientos de 146 niños durante el periodo 1996-2002 en el Laboratorio de Microbiología del Hospital de Niños Superiora Sor María Ludovica, Argentina. La distribución de los serotipos fue la siguiente: 1 a, 112 b, 1 c,1 d, 4 e, 3 f y 24 no tipificables. A partir del establecimiento de la estrategia de vacunación universal anti Hi b en 1998 se observa una disminución notable del serotipo b y un aumento relativo de otros y no tipificables.Haemophilus influenzae (Hi is the causative agent of several human diseases such as sepsis, meningitis, celulitis, and osteoarthritis. We investigated the isolation of Hi serotypes from sterile sites in sick children. One hundred and seventy nine strains from 146 patients were studied, period 1996-2002, at the Microbiology Laboratory, Hospital de Niños Superiora Sor María Ludovica, Argentina. The serotype distribution was:1 a, 112 b,1 c,1 d, 4 e, 3 f y 24 no typable. Since the beginning of universal Hi b vaccination in 1998, we have observed the fast decrease of serotype b and a relative increase of other serotypes.

  5. Evaluación molecular y fenotípica de la sensibilidad al fungicida fenamidone en aislamientos de Peronospora sparsa

    Directory of Open Access Journals (Sweden)

    Argel Luz Edith

    2007-06-01

    Full Text Available

    El Mildeo velloso es uno de los mayores limitantes del cultivo de la rosa en Colombia. Esta enfermedad es causada por el Oomycete holobiótrofo Peronospora sparsa que fue detectado en la década de 1970 en la Sabana de Bogotá. En los últimos años su efecto negativo sobre la floricultura aumentó conduciendo a los cultivadores al empleo excesivo de fungicidas con acción sistémica, muchos de los cuales no cuentan con estudios de líneas base de sensibilidad ni con el diseño de estrategias anti-resistencia apropiadas. A fin de determinar el grado de sensibilidad de diez aislamientos de P. sparsa al fungicida fenamidone, representante del grupo de resistencia cruzada QoI, se realizaron pruebas de sensibilidad in vitro y evaluaciones moleculares. Los resultados muestran que este patógeno presenta un alto grado de sensibilidad a dicha molécula (EC50 promedio: 0,51 mg· L-1 y que no hay evidencia de la presencia de las mutaciones puntuales G143A y F129L asociadas con fenotipos resistentes a QoI. Este estudio aporta las bases para el desarrollo de una metodología de detección molecular de individuos con resistencia a fungicidas QoI que puede ser utilizada para monitorear las poblaciones del patógeno en nuestro medio.

  6. Aislamiento, selección y caracterización de bacterias ácido lácticas en ensilajes de soya

    Directory of Open Access Journals (Sweden)

    Carlos Tobía

    2003-01-01

    Full Text Available Plantas enteras de soya (Glycine max L. Merr., cosechadas en el estado R6 (semillas completamente llenas y seccionadas en trozos de aproximadamente 2 cm. fueron ensiladas en microsilos de 1 kg, con y sin deshidratación parcial (DP; a los silos se les añadió 0, 4, y 8% de melaza de caña azúcar. Se observó una respuesta lineal (P≤ 0,0001 en la disminución del pH concomitantemente con el incremento en la concentración de melaza. Del mismo modo, los contenidos de materia seca (MS se incrementaron al aumentar la concentración de melaza en los ensilajes. La DP concentró en 10 unidades porcentuales el contenido de MS. No se observó interacciones entre la DP y la concentración de melaza. Los aislamientos bacterianos fueron realizados en los microsilos con 4 y 8% de melaza y sin DP, debido a que éstos presentaron las mejores características sensoriales, los menores valores de pH y la menor diversidad de morfotipos bacterianos. Los cultivos se hicieron en agar Rogosa y a las colonias seleccionadas se les efectuó las pruebas de Gram y catalasa; las que correspondieron a bacilos Gram positivos y catalasa negativos, fueron inoculadas en galerias Api 50 CHL®, para su identificación como bacterias ácido lácticas (BAL. Las cepas aisladas correspondieron a Lactobacillus brevis 3.

  7. DETERMINACIÓN DE Escherichia coli 0157 A PARTIR DE PRODUCTOS CÁRNICOS Y LÁCTEOS ARTESANALES EMPLEANDO DOS SISTEMAS DE AISLAMIENTO

    Directory of Open Access Journals (Sweden)

    Franco U. Lina

    2001-06-01

    Full Text Available Con el objeto de determinar la presencia de E.coli 0157 en alimentos, se analizaron 300 muestras de productos cárnicos y lácteos artesanales. Para su aislamiento e identificación se utilizaron dos técnicas; una tradicional donde después de seis horas de incubación de la muestra en agua peptonada al 1% suplementada con novobiocina (20 mg!L se inocularon placas con agar Mac Conkey Sorbitol. Por medio de esta técnica se identificó Esclzericlzia coli 0157 a partir de una sola muestra (0.33% de las 300 analizadas correspondiente a un derivado cárnico (hamburguesa; también se identificó E.coli en un 1.6%. Simultáneamente se realizó una técnica rápida con Agar Fluorocult, para E.coli 0157: H7, y de las trescientas muestras aisladas se identificaron microorganismos como Esclzericlzia coli 0157 (0.33%, E. coli (25%, Slzigella sonnei (10% , E. aerogenes (9%, P. mirabilis (4% . De las dos técnicas ensayadas estas presentaron el mismo porcentaje de recuperación de Esclzericlzia coli 0157.El método rápido, utilizando Agar Fluorocult, para E. coli O157: H7 permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en 48 horas. En contraste el método tradicional utilizando agar Mac Conkey Sorbitol permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en cinco días. Los métodos y técnicas utilizadas permiten que este estudio pueda reproducirse fácilmente con resultados puntuales.

  8. Análisis de la diversidad genética de 21 aislamientos del hongo Moniliophthora roreri basado en marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Boris Gutarra Castillo

    2013-12-01

    Full Text Available Objetivos: Estudiar la diversidad genética de 21 aislamientos del hongo que afecta al cultivo del cacao, Moniliophthora roreri, en tres zonas cacaoteras del Perú (Tocache, Mariscal Cáceres y Leoncio Prado. Métodos: Se utilizó 14 iniciadores RAPD (random amplified polymorphic DNA polimórficos y una pareja de oligonucleótidos, los que fueron empleados bajo condiciones de amplificación estandarizadas. Con los datos obtenidos se construyó un dendograma utilizando el coeficiente de Jaccard y el algoritmo UPGMA (Unweighted Pair-Group Method using Arithmetic Average. La estructura genética fue estimada en función del análisis molecular de variancia (AMOVA y la diversidad mediante los índices de Shannon y Nei. Resultados: Fueron conseguidas 59 bandas RAPD con un 73% de polimorfismo. El dendograma obtenido a un índice de similitud de 0,70, claramente dividió los individuos en tres grupos. El análisis de la diversidad genética mostró altos valores en las zonas estudiadas de acuerdo con el índice de Shannon (0,3936 y de Nei (0,2622, con mayor riqueza en Leoncio Prado. Estas zonas presentan alta variabilidad, y según el AMOVA realizado: 88% entre accesiones por zona y solo 12% entre zonas. Conclusiones: Existe más de un grupo genético de Moniliophthora roreri en la Amazonía del Perú. Estos grupos, provenientes del Ecuador, pudieron haber ingresado por el intercambio de semillas y/o de forma natural por medio de los ríos en común y estarían originando nuevos grupos genéticos locales.

  9. Energy saving by means of air conditioning equipment replacement and the household application of thermal insulation; Ahorro de energia electrica por reemplazo de equipos de aire acondicionado y aplicacion de aislamiento termico en viviendas

    Energy Technology Data Exchange (ETDEWEB)

    Peralta Solorio, Jose Luis [Fideicomiso para el Ahorro de la Energia (Mexico)

    2005-07-15

    An extension study of the Financing Program for Energy Saving looked for the evaluation of the electric energy saving potential obtained by the replacement of air conditioning equipment and the application of thermal insulation in 30 houses of two Mexican cities with warmth climate. In a joint effort with Comision Federal de Electricidad the consumption files of the users were analyzed and field measurements of electric demand and of refrigeration were made. As a following step the change of the refrigeration necessities derived from the application of thermal insulation were evaluated as well as the energy efficiency improvement obtained by the substitution of the air conditioning equipment and the favorable results obtained by the implementation of both measures - thermal insulation and change of air conditioning equipment in a joint form. This way, as a conclusion, the optimum sequence of application of these measures is revealed. [Spanish] Un estudio extension del Programa de Financiamiento para el Ahorro de Energia Electrica busco evaluar el potencial de ahorro de energia electrica alcanzado por el reemplazo de equipos de aire acondicionado y la aplicacion de aislamiento termico en 30 viviendas de dos ciudades mexicanas con clima calido. En un esfuerzo conjunto con la Comision Federal de Electricidad se analizaron los historiales de consumo de los usuarios y se efectuaron las mediciones de campo de demanda electrica y de refrigeracion. Como paso siguiente se valoro el cambio en las necesidades de refrigeracion derivado de la aplicacion de aislamiento termico al igual que la mejora en eficiencia energetica obtenida por la sustitucion de aire acondicionado y se identificaron los resultados favorecedores arrojados por la implementacion de ambas medidas -aislamiento termico y cambio de equipo de aire acondicionado- en forma conjunta. De esta manera, como conclusion, se devela la mas optima secuencia de aplicacion de estas medidas.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  13. Identidad genética del hongo causante del primer caso de coccidioidomicosis descripto por Alejandro Posadas en 1892 Genetic characterization of the fungus involved in the first case of coccidioidomycosis described by Alejandro Posadas in 1892

    Directory of Open Access Journals (Sweden)

    Cristina E Canteros

    2009-04-01

    Full Text Available En 1892, Alejandro Posadas documentó el primer caso mundial de coccidioidomicosis en un paciente argentino de nombre Domingo Escurra. Con el objetivo de identificar la especie de Coccidioides involucrado en ese caso, analizamos una pieza de necropsia del paciente, conservada en el Museo de Patología de la Facultad de Medicina de la Universidad de Buenos Aires, Argentina. La porción del tejido con mayor número de endosporas del hongo libres e integras fue elegida utilizando una coloración inmunohistoquímica específica. El ADN fúngico fue amplificado usando una PCR anidada que reconoce un fragmento del gen Ag2/PRA cuyo polimorfismo diferencia Coccidioides immitis y C. posadasii. Se amplificó además, el ADN de dos cepas de referencia: C. immitis (M38-05 y C. posadasii (1-NL y de cuatro aislamientos de Coccidioides de pacientes argentinos. Los fragmentos amplificados fueron secuenciados en ambas hebras. Las secuencias fueron editadas, alineadas y comparadas con las depositadas en GenBank C. posadasii (Acceso N° AY536446, cepa Silveira y C. immitis (Acceso N° AY536445. Las secuencias del Coccidioides del caso Escurra, de los aislamientos argentinos y de la cepa 1-NL fueron idénticos entre sí y mostraron una mutación puntual de C→G en la posición 1228 en comparación con la secuencia de C. posadasii, cepa Silveira. Este es el primer trabajo donde se busca ADN de Coccidioides en una pieza anatómica de museo con más de 100 años de antigüedad. Los resultados confirman que el primer caso de coccidioidomicosis o enfermedad de Posadas documentado mundialmente fue producido por el recientemente descripto C. posadasii.In 1892 Alejandro Posadas described the first worldwide case of coccidioidomycosis in a patient named Domingo Escurra. A preserved necropsy piece from the patient's remains is conserved in the Museum of Pathology of the Medical School, Buenos Aires University. Paraffin-embedded specimens obtained from this piece served to

  14. Desarrollo de un proceso a escala de laboratorio para el aislamiento, conservación y producción de cepas nativas de Monascus spp. a partir de la biodiversidad fúngica ecuatoriana

    OpenAIRE

    Ayala Pastaz, Klever Bayardo

    2017-01-01

    Desarrollar un proceso a escala de laboratorio para la conservación y producción de cepas nativas de Monascus purpureus, mediante bioprocesos que permita el máximo aprovechamiento del recurso natural fúngico y el manejo sostenible de la biodiversidad. Se evidencia un limitado conocimiento en el manejo y aprovechamiento sustentable de la especie Monascus spp. nativo ecuatoriano, tanto en su proceso de aislamiento, conservación y producción; así como del ciclo de vida en el medio natural y m...

  15. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DE Phytophthora infestans (Mont de Bary EN SOLANÁCEAS CULTIVADAS EN COLOMBIA GENETIC VARIABILITY OF ISOLATES OF Phytophthora infestans (Mont. de Bary IN SOLANACEOUS CROPS FROM COLOMBIA

    Directory of Open Access Journals (Sweden)

    Natalia Raigosa Gómez

    2009-06-01

    Full Text Available Se estudio el nivel de variabilidad genética de una población de 35 aislamientos de Phytophthora infestans obtenidos en diferentes hospedantes y regiones geográficas de Colombia, mediante las técnicas de haplotipos mitocondriales y RAPD. Los resultados encontrados sugieren la existencia en el país de los haplotipos mitocondriales Ia en los aislamientos que afectan tomate de árbol (Solanum betaceum y IIa en cultivos de papa; dichos haplotipos están asociados a los linajes genéticos EC-3 y EC-1, respectivamente. Sin embargo, tres aislamientos obtenidos en tomate de mesa (S. lycopersicum, pimentón (Capsicum sp. y pepino de agua (S. muricatum requieren de un análisis posterior, debido a la falta de correlación entre los perfiles de restricción generados con los cuatro pares de cebadores utilizados en esta prueba y los haplotipos mitocondriales mencionados en la literatura. De otra parte, mediante cuatro cebadores RAPD, fue posible encontrar variabilidad al interior de los dos linajes genéticos, siendo interesante el hecho que los aislamientos obtenidos en tomate de árbol (EC-3 fueron divididos en dos grupos, relacionados con una distancia genética de 0,17. Estos hallazgos indican que es importante contemplar las fuentes de variación asexual en el análisis de la estructura poblacional de este oomycete y por tanto en el diseño de las estrategias de control de las enfermedades que causa P. infestans en cultivos de solanáceas de importancia económica.The level of genetic variability of 35 isolates of Phytophthora infestans obtained from different hosts and geographical regions of Colombia was studied through mitochondrial haplotypes and RAPD techniques. Results suggested the existence of mitochondrial haplotypes Ia affecting tree tomato (Solanum betaceum and IIa in potato, which are associated with genetic lineages EC-3 and EC-1, respectively. However, three isolates obtained from tomato (S. lycopersicum, capsicum (Capsicum sp. and

  16. Aislamiento, identificación y daños asociados al síndrome de la muerte súbita en el cultivo de soja en Argentina

    OpenAIRE

    Scandiani, María Mercedes; Carmona, Marcelo Aníbal; Luque, Alicia Graciela; Matos, Kedma da Silva; Lenzi, Lisandro; Formento, Ángela Norma; Martinez, Cristina Valeria; Ferri, Mónica Raquel; Lo Piccolo, Melina; Tartabini, Mirta; Alvarez, Diego; Sautua, Francisco

    2012-01-01

    Los objetivos de este trabajo fueron aislar e identificar los agentes causales del síndrome de la muerte súbita (SMS) en muestras provenientes de diferentes localidades de Argentina, y cuantificar la incidencia de la enfermedad y los daños causados a campo en el rendimiento. Se analizaron 215 raíces provenientes de plantas con síntoma foliares típicos de SMS para el aislamiento e identificación de los agentes causales. Para realizar las pruebas de patogenicidad se efectuaron dos bioensayos en...

  17. Genotipificación y evaluación de la dinámica de infección de un aislamiento colombiano de Leptospira santarosai en el modelo experimental en hámster

    Directory of Open Access Journals (Sweden)

    Piedad Agudelo-Flórez

    2014-09-01

    Conclusión. Se identificó la presencia de la especie L. santarosai con capacidad patógena comparable con la cepa Fiocruz L1-130 de L. interrogans, de reconocida virulencia y tropismo pulmonar, en cuanto a los aspectos histopatológicos de tropismo a pulmón y riñón. Nunca antes se había evaluado en un modelo experimental un aislamiento de origen local bajo estos criterios biológicos.

  18. Resistencia a carbapenemes en aislamientos de Pseudomonas aeruginosa: un ejemplo de interacción entre distintos mecanismos Carbapenem resistance in Pseudomonas aeruginosa isolates: an example of interaction between different mechanisms

    Directory of Open Access Journals (Sweden)

    Gisela Santella

    2011-12-01

    Full Text Available OBJETIVO: Identificar la proteína de membrana externa ausente en los aislamientos resistentes y determinar tanto las causas de su ausencia en la membrana, como la presencia de otros mecanismos de resistencia a carbapenemes en aislamientos clínicos de Pseudomonas aeruginosa. MÉTODOS: Se estudió un brote de 20 aislamientos de P. aeruginosa previamente caracterizados como productores de la metalobetalactamasa IMP-13. Estos aislamientos presentaron igual expresión de la enzima IMP-13, pero solo cinco de ellos fueron resistentes a carbapenemes. En esos cinco aislamientos resistentes se confirmó la ausencia de una proteína de membrana externa. Se secuenciaron oprD y ampC; se identificaron las proteínas de membrana externa por desorción/ionización láser asistida por matriz/espectometría de masa tiempo de vuelo (MALDI-TOF; se determinó el nivel de expresión de oprD, de AmpC y de los sistemas de eflujo tipo Mex, por reacción en cadena de polimerasa en tiempo real, y por último, se determinó la contribución del déficit de oprD a la resistencia a carbapenemes. RESULTADOS: La proteína de la membrana externa ausente en el grupo R (resistentes a ambos carbapenemes fue identificada como OprD-TS, pero no se observaron variaciones en su expresión. El gen oprD presentó mutaciones en los cinco aislamientos resistentes. Se observó la misma producción de la enzima tipo AmpC PDC-5 y del sistema de eflujo Mex AB-OprM entre los aislamientos sensibles y resistentes a carbapenemes. Se analizó cómo la presencia conjunta de IMP-13 y el déficit de oprD contribuyen al aumento de la resistencia. CONCLUSIONES: Distintos mecanismos contribuyen a la resistencia de aislamientos productores de IMP-13 a carbapenemes. La posibilidad de no detectar estos aislamientos productores de IMP-13 representa un riesgo latente de selección de mutantes con mecanismos de resistencia que se suman para aumentar la resistencia a carbapenemes.OBJECTIVE: To identify the

  19. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  20. Detection of mutated primers and impact on targeted metagenomics results

    OpenAIRE

    Antoine-Lorquin, Aymeric; Mahé, Frédéric; Dunthorn, Micah; Belleannée, Catherine

    2016-01-01

    International audience; High-throughout sequencing platforms are widely used in metabarcoding studies of environmental microbial diversity as they can quickly produce millions of reads. Resulting reads in these studies are clustered into molecular operational taxonomic units (OTUs) and compared statistically. In order to limit the number of spurious OTUs retrieved from samples, eliminating the reads with mutated primers has become the norm. This process has the advantage of not requiring the ...

  1. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  2. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  3. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    provides a framework for examining spending patterns of the federal government by category of activity, rather than by agency or type of financing ...federal spending. Since federal agencies often have diverse, overlapping responsibilities , it is not uncommon for them to be associated with multiple...agency responsible for approximately 96% of spending within the National Defense Budget (050). Defense Primer: The National Defense Budget Function

  4. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  5. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino

    2006-01-01

    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  6. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  7. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  8. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  9. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  10. Utilización del medio Mrs-s en el aislamiento de bacterias lácticas mesofilas en leche de cabra Utilización del medio Mrs-s en el aislamiento de bacterias lacticas mesofilas en leche de cabra

    Directory of Open Access Journals (Sweden)

    Fortes F. Celia L. de Luces

    1990-12-01

    Full Text Available Con el fin de evaluar el MRS-S (Sorbato al 0.10% en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml, N-L (bacterias aromáticas, reducción de la leche tornasolada a 40 y 21oC y crecimiento a 45 y 10oC.Las cepas seleccionadas se sometieron a caracterización fisiológica y Bioquímica. El medio MRS-S mostró ser efectivo con un porcentaje de inhibición de la flora indeseable del 86.56%, y adecuado por el aislamiento de Lactococcus. De acuerdo con los perfiles taxonómicos se consiguió aislar de un total de 156 colonias dos Lactococcus lactis subsp. lactis y un Lactococcus lactis biovar diacetilactis.With the objective of evaluating the MRS-S (0.10% of sorbate in the isolation of lactic bacteria samples of raw goat milk were cultivated in MRS-S and PCA in deep and incubated in aerobic conditions for 48 hours al 32oC. Gram positive coccus, negative catalase which grew in MRS-S were isolated and preliminarly characterized through the growing process in agar MRS-S, MRS-T (O.20ltg/ml tetracycline, N-L (aromatic bacteria, litmus milk reduction at 40 and 210C and growing at 45 and 10oC. Selected strains were subject to the physiological and biochemical characterization. MRS-S media showed to be effective with an 86.56% of inhibition for indesirable bacteria and adequated for Lactococcus isolation. Related to taxonomic profiles from 156 colonies were isolated two lactococcus lactis subsp. lactis and one Lactococcus luctis biovar diacetilactis.

  11. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  12. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    Directory of Open Access Journals (Sweden)

    Caty Martínez B

    2009-04-01

    Full Text Available Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC y primer intervalo de parto (PIDP en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de variación. En el análisis se consideraron los efectos de año de parto, época de parto, edad al primer parto (no se consideró para EPP, sexo de la cría, grupo racial y peso a los 24 meses. Resultados. La media para la EPP y PIDP fue de 38.9 ± 3.9 meses y 469.2 ± 9 días, respectivamente, donde el efecto época de parto, fue significativo para la duración del PIDP. Los efectos sexo de la cría, peso a los 24 meses y época, no fueron significativos sobre la EPP. Los efectos año de parto, edad al primer parto, sexo de la cría, peso a los 24 meses no fueron significativos sobre el PIDP. Conclusiones. La EPP y PIDP fueron afectados por el año y la época de parto, respectivamente.

  13. Tn7::In2-8 dispersion in multidrug resistant isolates of Acinetobacter baumannii from Chile Dispersión de Tn7::In2-8 en aislamientos multirresistentes de Acinetobacter baumannii de Chile

    Directory of Open Access Journals (Sweden)

    M. S. Ramírez

    2010-06-01

    Full Text Available Acinetobacter baumannii is considered an important pathogen in our hospital environment having a well-known capacity to acquire different mechanisms of antibiotic resistance. Previous studies in our laboratory had exposed the high dispersion of class 2 integrons in this species. In the present study, we analyzed 7 multiresistant intI2 positive A. baumannii isolates, 6 of which were found to harbour the Tn7::In2-8 element. Our results demonstrate the unusually high distribution of Tn7::In2-8 among different A. baumannii clones from Chile, suggesting a particular behavior of these elements at geographical level.Acinetobacter baumannii, patógeno de importancia clínica en el ámbito hospitalario, es reconocido como un microorganismo que posee la capacidad de evolucionar rápidamente hacia la multirresistencia. Estudios previos efectuados en nuestro laboratorio han demostrado la alta dispersión de los integrones de clase 2 en aislamientos de esta especie. En el presente trabajo se analizaron 7 aislamientos de Acinetobacter baumannii multirresistentes portadores de la integrasa de clase 2, 6 de los cuales portaban el inusual arreglo Tn7::In2-8. Nuestros resultados muestran una elevada frecuencia de dispersión del elemento Tn7::In2-8 en diferentes clones circulantes en Chile, lo que sugiere un comportamiento geográfico particular.

  14. Modelo de estado para el estudio de las descargas parciales en el aislamiento principal de las máquinas eléctricas rotatorias de gran potencia; Big Rotating Machines State Model for Partial Discharges Studies in Main Insulation

    Directory of Open Access Journals (Sweden)

    Santiago A Dorrbercker Drake

    2011-02-01

    Full Text Available Se presenta un modelo de estado que caracteriza la tensión de ignición de las descargas parciales (DP enel aislamiento principal de las máquinas eléctricas rotatorias de gran potencia (MERGP.  Los objetivos delmodelamiento se dirigieron en dos vertientes:  la primera a conocer el comportamiento del menor nivel detensión que produce DP y la segunda destinada al comportamiento del tamaño de las cavidades, en lasque puede aparecer DP, atendiendo al nivel instantáneo de la tensión de corriente alterna (CA aplicada alas mismas. El presente trabajo se propone, proveer de una herramienta capaz de modelar el comportamientode algunos parámetros característicos de las DP en el aislamiento principal de las MERGP, cuando elaislamiento principal es sometido a diferentes condiciones de trabajo.  This paper describes a state model for PD inception voltage in main insulation of big rotating machines(BRM.  Intends of the present paper were:  to show the behaviour of PD inception voltage under differentfactors; and to know the relationships between the size of cavities and the instantaneous value of ACapplied voltage to the insulation. The objective of this paper is offer a computational tool able to model theperformance of some PD characteristic parameters when main insulation is under operation conditions.

  15. Factores de riesgo asociados al aislamiento de Escherichia coli o Klebsiella pneumoniae productoras de betalactamasas de espectro extendido en un hospital de cuarto nivel en Colombia

    Directory of Open Access Journals (Sweden)

    Adriana Jiménez

    2014-04-01

    Full Text Available Introducción. Las betalactamasas de espectro extendido (BLEE son un fenómeno de resistencia emergente de particular incidencia en América Latina. En Colombia existe poca información sobre los factores de riesgo asociados con su adquisición. Objetivo. Determinar los factores de riesgo que están asociados a la infección o colonización por Escherichia coli o Klebsiella pneumoniae productoras de BLEE en pacientes mayores de 18 años. Materiales y métodos. Se llevó a cabo un estudio de casos y controles con relación 1:1 en pacientes con aislamientos de E. coli o K. pneumoniae productoras de BLEE en cualquier tipo de muestra durante el periodo de enero de 2009 a noviembre de 2011 en el Hospital Universitario de San José. Resultados. Se estudiaron 110 casos y 110 controles; 62,7 % correspondió a E. coli y 37,3 %, a K. pneumoniae. Como factores de riesgo independiente en el análisis multivariado se encontraron la insuficiencia renal crónica (OR=2,99; IC95%, 1,10-8,11; p=0,031, la cirugía urológica (OR=4,78; IC95%, 1,35-16,87; p=0,015, el antecedente de uso de antibióticos en los tres meses anteriores (OR=2,24; IC95%, 1,09-4,60; p=0,028, el origen hospitalario de la infección (OR=2,92; IC95%, 1,39-6,13; p=0,004 y la hospitalización previa (OR=1,59; IC95%, 1,03-2,46; p=0,036. Conclusión. Anticiparse al patrón de resistencia del microorganismo que infecta a un paciente con base en los factores de riesgo asociados permitiría la elección de un tratamiento antibiótico empírico apropiado, con el fin de lograr la disminución de la morbimortalidad de los pacientes.

  16. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Status of corrosions protection primers for the automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann-Loeser, P. [Adam Opel AG, Ruesselsheim (Germany); Schnell, A. [DaimlerChrysler, Werk Sindelfingen (Germany); Stellnberger, K.H.; Androsch, F.M. [voestalpine Stahl, Linz (Austria); Reier, T. [SZMF, Salzgitter (Germany); Lewandowski, J. [ThyssenKrupp Stahl, Duisburg (Germany); Filthaut, C. [DOC Dortmunder OberflaechenCentrum, Dortmund (Germany); Besseyrias, A. [Arcelor / R and D LEDEPP, Florange (France); Dane, C. [Corus, Ijmuiden (Netherlands); Steinbeck, G. [Steel Institute VDEh, Duesseldorf (Germany)

    2005-07-01

    In Europe, 2.5 - 4 {mu}m Zn-pigmented corrosion protection primers (CPP) are being used by the automotive industry. A short introduction describing the development steps leading up to the state of the art will be given and also the reasons for using it in practice. For some applications it became necessary to try to achieve a significantly higher level of corrosion resistance than this ''first generation'' type coating can offer. It was also important to lower the curing temperature of the paint considerably in order to be able to supply bake-hardening grade steels. This type of corrosion protection primer is now called the ''second generation''. The Opel-production of the Astra-family started using 2{sup nd} generation CPP (4-6 {mu}m) on chromate-free pre-treatment and EG for hood and crash box in 2004. The newest developments show a high potential to lower the coating thickness even further and thus make cost savings possible. The development process is still ongoing and for effective progress, a good mutual basis for laboratory evaluation of properties is of valuable support. In a Steel Institute VDEh working group (Arcelor, Corus, Salzgitter, ThyssenKrupp, voestalpine), test procedures are being generated in order to be able to correctly assess properties such as corrosion resistance, adhesion, peeling-off behavior, etc. An overview of the procedures will be given together with correlations between laboratory results and reality. To round up the paper, corrosion protection primers have a number of potentials which can be utilized by the automotive industry to justify the additional cost. Examples highlighted with results giving evidence of these potentials will be shown. (orig.)

  18. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  19. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  20. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  1. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. [eds.; Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  2. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  3. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  4. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  5. Primer reporte de la familia Cheiridiidae (Arachnida: Pseudoscorpionida en Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alexander Quirós-Rodríguez

    2015-09-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  6. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  7. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  8. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  10. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  11. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  12. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  13. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  14. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  15. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  16. Effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers.

    Science.gov (United States)

    Chen, Liang; Shen, Hong; Suh, Byoung In

    2013-11-01

    Some silane primers and some zirconia primers contain extra resins such as bisphenol A glycol dimethacrylate (BisGMA) in their formulations for better wetting. No studies exist on the bonding properties of zirconia and silane primers, which contain extra resins. The purpose of this study was to investigate the effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers. Silica-base lithium disilicate was etched and treated with BisGMA-incorporated Porcelain Primer, unmodified Porcelain Primer, or resin-containing Kerr Silane. Zirconia ceramic was airborne-particle abraded and treated with BisGMA-incorporated Monobond Plus, unmodified Monobond Plus, or BisGMA-containing ZPrime Plus. After primer treatment and cleaning with ethanol, the contact angles were measured to determine surface change (n=10). Shear bond strength tests were also performed to measure the adhesion strength between resin cements and ceramic surfaces (n=10). Data were statistically analyzed by 1-way ANOVA followed by the Tukey multiple comparison as a post hoc test (significance level .05). The incorporation of BisGMA resin did not significantly influence the bond strength or contact angle of the zirconia primer (P>.05), but it did significantly reduce those of the silane primer (PSilane (22 degrees, 23 MPa) had a similar contact angle and higher bond strength than the control (21 degrees, 18 MPa), but lower than Porcelain Primer (88 degrees, 34 MPa). Resin-containing ZPrime Plus (75 degrees, 29 MPa) had a similar contact angle and higher bond strength than both Monobond Plus (74 degrees, 18 MPa) and the control (15 degrees, 4 MPa). The addition of BisGMA resin significantly inhibited the efficacy of silane-containing porcelain primers but did not affect that of phosphate-containing zirconia primers. Copyright © 2013 Editorial Council for the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  17. Studi Operasi Resin Penukar Ion Dalam Sistem Purifikasi Air Primer Pwr

    OpenAIRE

    Biyantoro, Dwi; Basuki, Kris Tri; Subagiono, Subagiono

    2006-01-01

    STUDI OPERASI RESIN PENUKAR ION DALAM SISTEM PURIFIKASI AIR PRIMER PWR. Telah dilakukan studioperasi resin penukar ion dalam sistem purifikasi air primer PWR. Air pendingin reaktor yang pada awalnya sesuaidengan persyaratan setelah pengoperasian reaktor sering kualitasnya berubah, sehingga harus dimurnikan. Unsurunsurpengotor dalam air primer PWR diidentifikasi sebagai penyebab pengotor seperti korosi, pelepasan produk fisi(Cs137, Sr90, Co60,C14, Tc99), dan pelepasan kembali unsur oleh resin ...

  18. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    -chain, the immunoglobulin kappa light chain, and the c-myc locus. Whereas none of the mutants were found to revert to tRNAPro primer utilization, in two tumors resulting from the injection of the SL3-3 Lys3 mutant the primer binding site was altered to match that of a new primer species, tRNA1,2Lys. In addition...

  19. Endocarditis por Brucella canis: primer caso documentado en un paciente adulto en Argentina Brucella canis endocarditis: first documented case in Argentina

    Directory of Open Access Journals (Sweden)

    Valeria Manias

    2013-03-01

    Full Text Available Se describe el primer caso documentado de endocarditis por Brucella canis en Argentina. El paciente fue un varón adulto que consultó por edemas en miembros inferiores, registros febriles aislados de 2 meses de evolución y dolor precordial opresivo que irradiaba a brazo izquierdo. Negaba contacto con animales de cría o consumo de productos sin pasteurización. Estudios cardiológicos constataron endocarditis infecciosa. Se resuelve cirugía de recambio valvular ante fracaso terapéutico empírico con cefalotina, ampicilina y gentamicina. Los hemocultivos fueron positivos (4 de 4 muestras con bacilos gram negativos. Se realizó la identificación con técnica API 20 NE (bioMérieux, el método automatizado Phoenix (BD y las pruebas bioquímicas convencionales, sin concluir género ni especie. Se derivó la cepa al departamento de Bacteriología Especial INEI-ANLIS "Dr. Carlos G. Malbrán" donde se identificó al aislamiento como Brucella canis. Se rotó el esquema terapéutico a doxiciclina, rifampicina y trimetoprima-sulfametoxazol con buena evolución. La importancia del caso radica en la posible falla del tratamiento antimicrobiano empírico administrado para endocarditis, ya que B. canis no responde a los antimicrobianos convencionales para esta patología.We herein present the case of an adult male patient who consulted for lower extremity edema, a 2- month history of fever and oppressive chest pain radiating to the left arm. He referred neither contact with breeding animals nor consumption of unpasteurized dairy products. A diagnosis of endocarditis was confirmed by cardiac studies. Since the empirical treatment with cephalotin, ampicillin and gentamicin failed, the patient underwent aortic valve replacement. A total of four blood cultures were positive with a gram-negative rod. Bacterial identification was performed using the API 20 NE technique (bioMerieux, the Phoenix automated method (BD and conventional biochemical tests which were

  20. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  1. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  2. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  3. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Estrategia de PCR múltiple para la caracterización molecular simultánea de Staphylococcus aureus y enterotoxinas estafilocócicas en aislamientos de brotes de origen alimentario

    Directory of Open Access Journals (Sweden)

    Aníbal A. Brizzio

    2013-03-01

    Full Text Available Introducción. La intoxicación alimentaria estafilocócica es la más frecuente de las intoxicaciones alimentarias. La acción de las enterotoxinas de Staphylococcus aureus en la luz intestinal provoca una importante pérdida de agua que origina vómitos y diarrea. Objetivo. Presentar una estrategia rápida, fiable y de bajo costo, basada en una reacción en cadena de la polimerasa (PCR múltiple para, simultáneamente, identificar S. aureus y detectar genes de las cinco enterotoxinas clásicas de S. aureus (sea, seb, sec, sed, see en cepas de Staphylococcus spp. aisladas de alimentos. Materiales y métodos. Se trabajó con aislamientos recuperados de 12 brotes de intoxicación alimentaria estafilocócica ocurridos en la provincia de Santa Fe, Argentina. El aislamiento y la caracterización fenotípica se llevaron a cabo mediante procedimientos estándar. La evaluación genotípica se hizo por una PCR múltiple, utilizando simultáneamente cebadores para los genes nuc, sea-see y 16S rRNA. Resultados. En las cepas analizadas se detectó 58 % de portadoras de genes toxigénicos. Las toxinas sea y seb se encontraron en igual porcentaje (29 %, mientras que las sec, sed y see se encontraron en menor e idéntica proporción (14 %. No encontramos más de un tipo diferente de enterotoxinas de S. aureus en los aislamientos analizados. Conclusiones. La estrategia de PCR múltiple diseñada en este trabajo permitió identificar cepas de S. aureus y confirmar, al mismo tiempo, su enterotoxigenicidad. En estos momentos, nuestros esfuerzos están dirigidos a detectar los genes que codifican enterotoxinas distintas de las clásicas, a fin de conocer su incidencia en las intoxicaciones alimentarias estafilocócicas e investigar su relevancia en la salud pública de nuestro país.   doi: http://dx.doi.org/10.7705/biomedica.v33i1.816

  5. Isolation of Leptospira interrogans from suburban rats in Tandil, Buenos Aires, Argentina Aislamiento de Leptospira interrogans de ratas suburbanas de Tandil, Buenos Aires, Argentina

    Directory of Open Access Journals (Sweden)

    E. Scialfa

    2010-06-01

    arroyo durante dos noches, con una alta tasa de captura (70%. En las 42 ratas atrapadas se examinó la serología por el test de microaglutinación (TMA; 22 de ellas (52,3% reaccionaron con los serovares castellonis, canicola, grippotyphosa, icterohaemorrhagiae y hebdomadis, a títulos de 1:50. El cultivo de tejido renal de 25 animales permitió obtener 24 aislamientos de L. interrogans (96%. Las cepas aisladas fueron identificadas como serogrupo Icterohaemorrhagiae mediante TMA utilizando suero hiperinmune de conejo. Estos hallazgos muestran una elevada densidad de roedores infectados con leptospiras patógenas en el área suburbana de la ciudad de Tandil, en estrecho contacto con población humana con evidencia de leptospirosis.

  6. Aislamiento y caracterización de cepas nativas de Lactobacillus spp. para su uso como probióticos en la industria láctea

    Directory of Open Access Journals (Sweden)

    Sylvia Vázquez

    2011-05-01

    Full Text Available La utilización de fermentos en la elaboración de productos lácteos es una práctica diaria a nivel industrial. En nuestro país los mismos son comprados a multinacionales extranjeras que se dedican a producir y comercializar fermentos; muchos de los cuales incorporan bacterias probióticas. Los probióticos pueden definirse como microorganismos que luego de ser consumidos en cantidades adecuadas, confieren algún efecto benéfico en el huésped. En el presente trabajo se realizó el aislamiento de una cepa de Lactobacillus de origen humano. Se identificó por tinción gram, prueba catalasa, crecimiento en anaerobiosis y aerobiosis y un test API 50 CH. Con el objetivo de probar propiedades probióticas de la cepa se llevaron a cabo estudios de resistencia al pH, tolerancia a sales biliares y se realizó un Modelo Gástrico in vitro. Los resultados permiten afirmar que estamos en presencia de una cepa nativa de Lactobacillus acidophilus caracterizada fenotípicamente con un 97% de confianza. Presentaría la habilidad de sobrevivir al pasaje a través del tubo digestivo ya que resistió la exposición a un pH similar al estomacal, pudo crecer en un medio con sales biliares y sobrevivió a la acción conjunta de la pepsina y una simulación de jugo gástrico; características que permiten clasificarla como posible cepa probiótica.Abstract  The use of starters to elaborate dairy products is a current practice in the industry. In our Country we import these starters from foreign companies dedicated to make and sale it, and most of them include probiotic bacterias. Probiotics can be defined as microorganisms that after be consumed in adequate amount, can give some advantageous effect to the host. In this study a strain of Lactobacillus was isolated from a human. The identification was done through gram stain, catalase test, aerobic and anaerobic growth, and an API 50 CH test. In order to prove the probiotic properties of the strain, studies of p

  7. Aislamiento de una cepa de campo de Babesia bigemina (Piroplasma: Babesiidae y establecimiento del cultivo in vitro para la producción de antígenos

    Directory of Open Access Journals (Sweden)

    Roger I Rodríguez-Vivas

    2007-03-01

    Full Text Available La babesiosis bovina ocasionada por Babesia bigemina produce grandes pérdidas a la economía pecuaria Mexicana. Debido a las variaciones antigénicas que presenta B. bigemina es necesario contar con antígenos locales para la realización de estudios epidemiológicos y de inmunización. Se recolectaron 30 garrapatas Boophilus microplus de un bovino adulto clínicamente enfermo de babesiosis (B. bigemina en Yucatán, México. En laboratorio se produjeron larvas, ninfas y una cepa congelada. El aislamiento de la cepa se realizó con éxito y se necesitó 30 días en el cultivo in vitro para obtener un PEI del 1.5 %. La cepa fue congelada en nitrógeno líquido y reactivada en el cultivo celular. La concentración del medio que permitió el mayor PEI (14 %, pIsolation of a field strain of Babesia bigemina (Piroplasma: Babesiidae and establishment of in vitro culture for antigen production. Bovine babesiosis, caused by Babesia bigemina, is a barrier for livestock development; it results in high economic loss to Mexican livestock. Control requires adequate antigens for diagnosis and vaccination programs. However, because of antigenic variation among Babesia strains, it is necessary to use antigens prepared from local strains. The purpose of the present study was to isolate a local field strain and to establish the in vitro culture of B. bigemina by the evaluation of the constituent’s concentration of culture media. Thirty engorged female Boophilus microplus were collected from cattle suffering clinical babesiosis (B. bigemina in Yucatan state, Mexico. These ticks were sent to the laboratory for detection of Babesia sp. vermicules. Eggs were kept at 83-85 % humidity and 27 ºC until hatching. Larvae were transferred to an esplenectomized calf (B-1. The resulting nymphs were transferred to an esplenectomized calf (B-2. Twelve days later, B. bigemina (local strain was detected in calf B-2 and its infected blood was frozen in liquid nitrogen to

  8. A Primer on Concepts and Applications of Proteomics in Neuroscience.

    Science.gov (United States)

    Hosp, Fabian; Mann, Matthias

    2017-11-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS)-based proteomics, focusing on the analysis of whole proteomes, protein-based interactions, and post-translational modifications. We also discuss how advanced workflows help to unravel spatial, regulatory, and temporal aspects of neuronal systems. These tools and approaches have already led to detailed and quantitative proteomic maps of the brain and its signaling architecture, generating new insights into health and disease. We predict that these new approaches will also accelerate biomarker discovery and contribute to novel therapeutics for neurodegenerative and other brain-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  10. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  11. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, L.S.; Garcia, G. [UASLP, San Luis Potosi (Mexico). Inst. of Metallurgy]|[UNLP, La Plata (Argentina); Lopez, C. [Univ. Autonoma de Campeche (Mexico)

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  12. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  13. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  14. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  15. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  16. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  17. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic].

    Science.gov (United States)

    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata

    2014-01-01

    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  18. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  19. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  20. Biofilm formation by Stenotrophomonas maltophilia isolates from device-associated nosocomial infections Formación de biopelículas por aislamientos de Stenotrophomonas maltophilia recuperados de infecciones nosocomiales asociadas al uso de dispositivos médicos

    Directory of Open Access Journals (Sweden)

    B. Passerini De Rossi

    2007-12-01

    Full Text Available Medical devices are often colonized by bacteria which may cause severe infections. The aim of this work was to evaluate biofilm formation by S. maltophilia isolates from device-associated nosocomial infections. The 13 local isolates exhibited different capacities of biofilm formation on hydrophilic and hydrophobic surfaces. All isolates formed strong biofilms in polystyrene microplates, while strong, moderate or weak biofilms were detected in borosilicate (BS or polypropylene (PP tubes. The proficiency of biofilm formation was better evaluated by the level of crystal violet staining expressed relative to the final culture density. The microscopic analysis of biofilms formed on glass coverslips revealed the presence of a matrix of exopolysaccharides and microcolonies typical of biofilm architecture. Isolates with increased adhesion to BS showed larger microcolonies. According to our results, twitching correlated well with attachment to the three abiotic surfaces tested, while swimming only showed a slight correlation with biofilm formation on PP. Poor correlation was observed between cell surface hydrophobicity and biofilm formation. One of the highest biofilm-producing isolates adhered to urethral catheters of different materials, and exhibited an increased resistance to oxidative stress, one of the common stresses encountered by bacteria during the infection process due to the immune response.El objetivo de este trabajo fue evaluar la formación de biopelículas por parte de aislamientos de Stenotrophomonas maltophilia. Los 13 aislamientos locales evaluados mostraron diferente capacidad de formar biopelículas en superficies hidrofílicas e hidrofóbicas. Todos ellos formaron biopelículas fuertes en microplacas de poliestireno (PS, mientras que se observaron biopelículas fuertes, moderadas o débiles en tubos de borosilicato (BS o polipropileno (PP. La medida del cristal violeta unido a la biopelícula expresada en función de la densidad

  1. Foamglas D. 1. T. N.° 19 Convalidación del Agrément 1. N. L n.° 1.031. Aislamiento de cubiertas isolation pour toitures roof insulation

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1968-11-01

    Full Text Available Not availableEl Foamglas es un material constituido por vidrio químicamente puro, de tipo boro-silicato, inorgánico, sin adición de aglomerante. Se presenta y utiliza en placas de diferentes dimensiones estandarizadas. Estas placas se colocan en cubiertas planas o con pendiente. Se unen con betún y se recubren con una impermeabilización. Otros empleos no considerados en el presente documento son: en el doblado de muros, en las cámaras frigoríficas, en las fachadas ligeras, falsos techos, en el aislamiento de depósitos de agua y tuberías.

  2. Aislamiento y caracterización de las células madre de la membrana amniótica: una nueva fuente para terapia celular e inmuno-modulación

    OpenAIRE

    García de Insausti, Carmen L

    2012-01-01

    Se realizó el aislamiento y caracterización de las células de 20 membranas amnióticas. De cada MA se obtuvo un promedio de 123±12x106 células epiteliales (hAEC) y 5.3x106 células mesenquimales (hAMSC). Las hEAC expresaron SSEA (1, 3 y 4), y TRA (1-60 y 1-81). Las hAMSC expresaron CD73, CD90, CD105 y no CD34, CD45, CD14 ni CD19. Ambas fueron negativas para HLA DR y positivas para transcriptos de Nanog, Oct-4 y Sox-2. En los cultivos primarios las hAEC mostraron menor capacidad de auto-renova...

  3. Addition of Na2CO3 Improves the Shelf Life of Experimental 4-META Self-etch Primer.

    Science.gov (United States)

    Matsumoto, Hiro; Yamamoto, Takatsugu; Hanabusa, Masao; Momoi, Yasuko; Hayakawa, Tohru

    2017-01-01

    The objective of this study was to assess the influence of the addition of Na2CO3 on the shelf life and bond strength of 4-META self-etch primer. Two 4-META self-etch primers were experimentally formulated with and without the addition of Na2CO3 (primer A and primer B, respectively). The primers were stored at 37°C for several periods of time after formulation. Clearfil SE Bond Primer (Kuraray Noritake Dental) was used as a control. A composite was bonded to bovine dentin using a combination of the primer and a bonding agent (Clearfil SE Bond), and the shear bond strengths were measured. Changes in the pH of the experimental primers were monitored and macroscopic observations were made as a function of the storage periods. With 0-day storage, the bond strength of primer A was equivalent to that of primer B and significantly lower than that of Clearfil SE Primer. The bond strengths of primer A were stable during 90-day storage; by contrast, the bond strengths of primer B significantly decreased during 7-day storage. primer A exhibited stable pH values during 180-day storage; primer B exhibited significantly lower pH than primer A with 0-day storage and discolored gelation during 7-day storage. By adding Na2CO3, the shelf life of the 4-META self-etch primer was obviously improved without significant deterioration in dentin bond strength. Adjusting the pH to around 4.5 was effective for obtaining sufficient bond strength and hydrolytic stability of the primer.

  4. The impact of the use of thermal insulating materials in the global climatic change; El impacto del uso de los aislamientos termicos en el cambio de los climas globales

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)

    1996-12-31

    One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.

  5. A model for the A(H1N1 epidemic in Mexico, including social isolation Un modelo para la epidemia de A(H1N1 en México incorporando aislamiento social

    Directory of Open Access Journals (Sweden)

    Jorge X Velasco-Hernández

    2011-02-01

    Full Text Available OBJECTIVE: We present a model for the 2009 influenza epidemic in Mexico to describe the observed pattern of the epidemic from March through the end of August (before the onset of the expected winter epidemic in terms of the reproduction number and social isolation measures. MATERIAL AND METHODS: The model uses a system of ordinary differential equations. Computer simulations are performed to optimize trajectories as a function of parameters. RESULTS: We report on the theoretical consequences of social isolation using published estimates of the basic reproduction number. The comparison with actual data provides a reasonable good fit. CONCLUSIONS: The pattern of the epidemic outbreak in Mexico is characterized by two peaks resulting from the application of very drastic social isolation measures and other prophylactic measures that lasted for about two weeks. Our model is capable of reproducing the observed pattern.OBJETIVO: Se presenta un modelo de la epidemia de influenza en México en 2009 para describir el patrón observado desde marzo hasta finales de agosto (antes del inicio de la epidemia invernal, en términos del número reproductivo y las medidas de aislamiento social. MATERIAL Y MÉTODOS: El modelo es un sistema de ecuaciones diferenciales ordinarias. Se realizaron simulaciones computacionales para la optimización de trayectorias como función de los parámetros. RESULTADOS: Se exploran las consecuencias de esta última medida combinada con los valores estimados en la literatura médica del número reproductivo básico. CONCLUSIONES: El patrón de la epidemia mexicana de influenza es bimodal debido a la aplicación del aislamiento social y otras medidas profilácticas que duró aproximadamente dos semanas. Este modelo es capaz de reproducir el patrón observado.

  6. Polimorfismos genéticos de aislamientos del género Malassezia obtenidos en Colombia de pacientes con lesión dermatológica y sin ella.

    Directory of Open Access Journals (Sweden)

    Adriana M. Celis

    2005-12-01

    Full Text Available Introducción. Las especies del género Malassezia se consideran levaduras oportunistas emergentes de gran importancia. Han sido asociadas a diferentes patologías dermatológicas y sistémicas de las cuales se aislan una o más especies de este género. El papel de estas levaduras en las enfermedades dermatológicas no se ha aclarado completamente, ya que la Malassezia spp. pertenece a la flora normal de la piel. Objetivo. Buscar marcadores genéticos en los aislamientos de Malassezia spp. que permitan correlacionar las lesiones dermatológicas con las especies aisladas. Materiales y métodos. Se obtuvieron 103 aislamientos de Malassezia spp. a partir de muestras de pacientes con pitiriasis versicolor, dermatitis seborreica, dermatitis seborreica en pacientes positivos para VIH, dermatitis atópica, y de individuos sanos. Para los controles se usaron ocho cepas del Centraalbureau voor Schimmelcultures (CBS, Holanda. El perfil genético se realizó utilizando la técnica de ADN polimórfico amplificado aleatorio (RAPD con tres iniciadores (OPA2, OPA4, OPA13. Los datos obtenidos se analizaron con los programas Diversity Database y SYN-TAX-PC. Resultados. Se observó heterogeneidad genética intraespecífica en Malassezia furfur, Malassezia globosa, Malassezia restricta, Malassezia slooffiae y Malassezia obtusa, mientras que Malassezia sympodialis mostró mayor homogeneidad. Conclusión. No se determinó ningún patrón genético específico mediante la técnica de RAPD para las especies de Malassezia que se pudiera relacionar con la entidad dermatológica implicada.

  7. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y Testudines de la Estación de Biología Tropical Roberto Franco en Villav icencio, Colombia

    Directory of Open Access Journals (Sweden)

    D. A. Pachón

    2010-01-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos en mamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal. La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programa de recuperación del Caimán Llanero ( Crocodylus intermedius , que se encuentra en inminente peligro de extinción; adicionalmente cuenta con una colección viva de Testudines que comprende más de 20 especies. Con el fin de determinar la presencia de potenciales enteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientales y cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagar Orientación BD® para realizar los aislamientos y la identificación microbiológica. Los resultados muestran una mayor presentación de flora gram negativa predominando microorganismos de los géneros Escherichia coli (28%, Klebsiella sp (26%, Salmonella sp. (6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del género Enterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todas las muestras sin importar el origen de las mismas. Conscientes del riesgo que implica el aislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico, se dio inicio a la implementación de un manual de bioseguridad para la Estación con el fin disminuir el riesgo para la población humana y animal.

  8. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Science.gov (United States)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  9. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  10. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  11. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  12. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  13. Supplementary table 6. Primers used in real-time PCR for relative ...

    Indian Academy of Sciences (India)

    pushpa

    Supplementary table 6. Primers used in real-time PCR for relative expression analysis of osa-miR399i and osa-miR530 and their predicted target genes. Gene Locus. Primer sequence. TTGTTGGACATGCTCGTGACA. LOC_Os05g48390. TGGTGACAAGCTTCGGCAA. CGTGTGGAGGATTGTATGCATG. LOC_Os01g54480.

  14. Comparing the Accuracy Rate of Two Different Universal Primers in Enteric Pathogen Diagnosis From Blood

    Directory of Open Access Journals (Sweden)

    Esmaeil Soleimani

    2014-02-01

    Full Text Available Background: Detecting enteric bacteria in blood by culture is a slow assay with low accuracy rate. PCR might be a suitable alternative assay but as several species can cause bacteremia, it is necessary to use universal primers. Objectives: In this study we evaluated and compared two pairs of universal primers in detecting four enteric bacteria in blood, which are common causes of bacteremia in human. Materials and Methods: Standard strains of E. faecalis, S. typhi, E. coli, and S. Aeruginosa, were used in this study. A serially diluted bacterial suspension of all strains was made for inoculation to four sets of defibrinated sheep blood which were used to prepare blood specimens with different bacterial contents for performing routine assay and PCR. PCR was performed using two different universal primers designed from two ribosomal genes, 16sr RNA and 23sr RNA. Results: PCR with 16sr RNA universal primer showed more accuracy rate than both blood culture and PCR with 23sr RNA universal primer. Mean time for performing PCR assay and blood culture was eight and 48 hours, respectively. Conclusions: Both PCR with 16sr RNA and 23sr RNA universal primers have more accuracy rate than blood culture and are faster in detection of bacteremia. PCR with 16sr RNA universal primer is more accurate than both PCR with 16sr RNA universal primer and blood culture for diagnosis of bacteremia.

  15. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... were used, for the screening of the transformed plants (Pietsch et al., 1997). To verify the amplification of extracted DNAs, a pair of primers CDC(a).F/CDC(a).R targeting the cell division control gene was used (Gimenez et al., 2011). The primers were synthetized using Polyplex machine (Gene machine, ...

  16. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang

    2012-03-01

    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  17. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    Science.gov (United States)

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  18. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  19. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... RNA, no direct evidence of interactions with the U-rich anticodon loop of tRNALys3 has been described to date. Here we address the question of the potential role of the interactions between these highly structured regions in the initiation of viral DNA synthesis. To evaluate this we used an antisense...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...

  20. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  1. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    Science.gov (United States)

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  2. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  3. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    Biofilm production contributes to several human diseases, including oral candidiasis. Among the Candida species, Candida albicans is the most prevalent. The expression of virulence genes is implicated in the pathogenic potential of Candida biofilms. However, the evaluation of microbial gene expression from in vivo biofilm samples is not trivial, specifically, assessment via quantitative PCR (qPCR) can be a challenge because of several species present in clinical samples. Hence, the necessity of primers specificity. The aim of this study was to evaluate through in silico and in vitro analyses the specificity of published primers and newly designed primers for C. albicans virulence genes: ALS1, CAP1, CAT1, EFG1, HWP1, LIP3, PLB1, SAP1, SAP4, SOD1, SOD5 and ACT1 (normalizing gene). In silico analysis was performed through a PubMed search of articles with primer sequences that evaluated gene expression of C. albicans. Then, the sequence similarity of twenty-eight primers was checked through BLASTn and ClustalW2. The analysis of secondary structures was performed using mfold. When the primers did not present satisfactory characteristics (absence of secondary structures, not discrepant Tm of forward and reverse sequences and specificity) following in vitro analysis (i.e., end point PCR), new primers were designed using Beacon Designer™ and sequences obtained from the "Candida Genome Database". The selected primers were tested in vitro by end point PCR using a panel of genomic DNA from five different Candida species (C. albicans, Candida glabrata, Candida dubliniensis, Candida krusei, and Candida tropicalis). The resulting PCR products were visualized on agarose gel. qPCR reactions were performed to determine primers' optimal concentration and PCR efficiency. End point PCR demonstrated that published primers for the SAP1 and HWP1 were specific for C. albicans and the one for SOD1 reacted with C. albicans and C. dubliniensis. The sequence of primers designed for ACT1

  4. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    Science.gov (United States)

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  5. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  6. Elektronsko izobraževanje v praksi. Primer programa LOLA

    Directory of Open Access Journals (Sweden)

    Lea Bregar

    2003-12-01

    Full Text Available Slovenija je bila vkljucena v program Phare za studij na da!javo v obdobju od I995 do konca I999 kot ena izmed 11 srednje- in vzhodnoevropskih drzav. Eden od najpomembnejsih cil jev programa Phare je bit razviti človeške vire na podrocju studija na dal javo in odprtega ucenja. v okviru podprojekta Phare Train the Trainers so na Harriot Watt University iz Velike Britanije razvili izobrazevalni program LOLA (ucenje o odprtem ucenju. Leta I999 je bilo organizirano usposab!janje za 400 udeležencev iz 11 drzav Phare. Program LOLAje bit uspdna novost v evropskem izobrazevalnem prostoru ne le zaradi svojih vsebin, temvee tudi zaradi inovativne didaktike, sa} je bit celoten program oblikovan in izvajan kot 'on-line' program. V Clanku je na kratko predstavljen izobrazevalni program LOLA in izkusnje z njegovim izvajanjem kot primer e-izobrazevanja v praksi. Clanek avtorici zakljucujeta s predstavitvijo svojih pogledov na nadaljnje izvajanje programa LOLA in razvoj e-izobrazevanja v Sloveniji ter poudarjata potrebo po kakovostno doloceni in jasni strategiji na podrocju studija na daljavo, odprtega ucenja in e-izobrazevanja v Sloveniji.

  7. Review of Attachment, play, and authenticity: A Winnicott primer.

    Science.gov (United States)

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  8. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  9. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  10. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  11. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  12. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  13. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  14. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  15. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  16. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  17. RNA Primer Extension Hinders DNA Synthesis byEscherichia coliMutagenic DNA Polymerase IV.

    Science.gov (United States)

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  18. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  19. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  20. Effects of primers containing thiouracil and phosphate monomers on bonding of resin to Ag-Pd-Au alloy.

    Science.gov (United States)

    Taira, Yohsuke; Kamada, Kohji; Atsuta, Mitsuru

    2008-01-01

    The purpose of the present study was to evaluate the effects of four experimental primers on bond strength between a self-curing luting agent and silver-palladium-gold alloy. The experimental primers were in mixed solutions of a thiouracil primer (Metaltite) and a phosphate primer (Epricord, PM, PE, or PP), which were designated as Metaltite/Epricord, Metaltite/PM, Metaltite/PE, and Metaltite/PP respectively. Three primers (Metal Primer II, V-Primer, and Alloy Primer) were also prepared as controls. Alumina-blasted metal alloys were bonded with acrylic rods. After 5,000 thermocycles, the maximum shear bond strength was obtained with Metaltite/PE (27.8+/-2.4 MPa) and Metaltite/Epricord (27.6+/-5.9 MPa), followed by Metaltite/PP, Alloy Primer, Metaltite, Metaltite/PM, Metal Primer II, V-Primer, and Epricord. PE, PM, and PP showed the lowest bond strength. Results of this study revealed that the combined use of a thiouracil monomer and a phosphate monomer improved adhesive bonding. In this light, clinicians should pay attention to the types of functional monomers dissolved in a primer when fabricating resin-bonded prostheses.

  1. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  2. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus.

    Science.gov (United States)

    Komorowska, B; Malinowski, T; Michalczuk, L

    2010-09-01

    Detection of Apple stem pitting virus (ASPV) using RT-PCR based methods was studied in infected apple and pear trees. Three virus-specific primers (ASPF1CP, ASPF2CP, ASPR3CP) were designed to target the most conservative regions of the coat protein gene of 10 virus isolates in Poland and 7 other ASPV sequences available in GenBank. The suitability of the primer pairs ASPF1CP-ASPR3CP and ASPF2CP-ASPR3CP for detection of 19 virus isolates was checked. Both new primer pairs initiated amplification of a specific product from all sources tested. From 1 to 11 isolates were not detected with the primer sets published previously. Detection of the virus in the samples collected in March, using ASPF1CP-ASPR3CP primer pair, was possible up to 512 times dilution. For the samples collected in July, virus was detected in the extracts from infected plants diluted eight times. More than 100-fold increase of sensitivity could be obtained by semi-nested PCR with primers ASPF2CP-ASPR3CP following the first round with ASPF1CP-ASPR3CP. Identification of virus isolates with different number of deletions in the coat protein gene was possible using RT-PCR with newly designed reverse primer ASPDEL in combination with the published primer ASPV7956. Besides, the comparative analysis of silicacapture-RT-PCR (SC-RT-PCR) versus immunocapture-RT-PCR (IC-RT-PCR) assays was carried out. Few ASPV isolates escaped detection by IC-RT-PCR, while all isolates tested were detected using the SC-RT-PCR with the new primers. Copyright 2010 Elsevier B.V. All rights reserved.

  3. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  4. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  5. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  6. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia Molecular characterization of 15 isolations of Beauveria bassiana related to Cosmopolites and Metamasius in plantain and banana in three regions of Colombia

    Directory of Open Access Journals (Sweden)

    Diego Fernando Marmolejo

    2008-10-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a -20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.Weevils Cosmopolites and Metamasius in municipalities of the Valle del Cauca, Caldas and Quindío departaments of Colombia were collected. Monosporic cultures were obtained from10-10 and 10-11 dilutions of Beauveria bassiana. Isolates were kept at -80°C with 10% glycerol and DNA stored at -20°C. RAMs molecular markers generated a total of 82 fragments of which 67% were polymorphic. A heterozygosity value of 0.24 indicated a medium - high diversity. Five groups were formed which have a similarity value of 0.84 and one big group with 11 isolates and four groups with only one isolate. In the big group was detected a duplicate and fungi genetic diversity in the sampled places. Neither relationship among isolates of Cosmopolites and Metamasius nor geographical zone related to the formation of genetic groups.

  7. Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

    Directory of Open Access Journals (Sweden)

    A. Corso

    2009-03-01

    Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

  8. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  9. A primer on trace metal-sediment chemistry

    Science.gov (United States)

    Horowitz, Arthur J.

    1985-01-01

    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  10. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  11. Método de difusión con discos para la determinación de sensibilidad a fluconazol en aislamientos de Candida spp Disk diffusion method for fluconazole susceptibility testing of Candida spp. isolates

    Directory of Open Access Journals (Sweden)

    L. Rodero

    2006-09-01

    Full Text Available Se estudiaron 1193 aislamientos clínicos para estandarizar y evaluar un método de difusión con discos de fluconazol de lectura visual, que permita detectar levaduras sensibles al antifúngico. Las especies analizadas fueron: Candida albicans (n=584, Candida parapsilosis (n=196, Candida tropicalis (n=200, Candida glabrata (n=113, Candida krusei (n=50, Candida spp. y otras levaduras oportunistas (n=50. Los discos fueron manufacturados en el INEI-ANLIS "Dr. Carlos G. Malbrán". Se midieron los halos de inhibición del crecimiento producidos por fluconazol y la concentración inhibitoria mínima (CIM por el método de referencia M27-A2 modificado por EUCAST. Se establecieron los valores de corte del método de difusión en: ≥16 mm para levaduras sensibles a fluconazol (CIM ≤ 8 µg/ml, entre 9 y 15 mm para sensibles dependientes de la dosis (CIM = 16-32 mg/ml y ≤ 8 mm para resistentes (CIM ≥ 64 µg/ml. El método de difusión tuvo 94,7% de concordancia con el de referencia, con 0,2% de errores very major y 0,3% de errores major. La reproducibilidad inter e intralaboratorio fue muy buena. Para detectar aislamientos sensibles a fluconazol, este método resulta confiable y de bajo costo; sin embargo, es conveniente que los aislamientos con halos ≤ 15 mm sean reevaluados por el método de referencia.In order to standardize and evaluate a disk diffusion method with visual reading to detect in vitro fluconazole susceptibility of yeast, 1193 clinical isolates were tested. These included 584 Candida albicans, 196 Candida parapsilosis, 200 Candida tropicalis, 113 Candida glabrata, 50 Candida krusei and 50 Candida spp. and other opportunistic yeasts. The disks were manufactured in the INEI-ANLIS "Dr. Carlos G. Malbrán". The disk diffusion method results were compared to MIC results obtained by the reference CLSI M27-A2 broth microdilution method modified by EUCAST. The interpretative breakpoints for in vitro susceptibility testing of fluconazole

  12. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    OpenAIRE

    Mario Antolinez

    2013-01-01

    El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al m...

  13. Oligonucleotide primers for specific detection of actinobacterial laccases from superfamilies I and K.

    Science.gov (United States)

    Fernandes, Tatiana Alves Rigamonte; da Silveira, Wendel Batista; Passos, Flávia Maria Lopes; Zucchi, Tiago Domingues

    2014-08-01

    Although many putative laccase-like genes have been assigned to members of the phylum Actinobacteria, few of the related enzymes have been characterized so far. It is noteworthy, however, that this small number of enzymes has presented properties with industrial relevance. This observation, combined with the recognized biotechnological potential and the capability of this phylum to degrade recalcitrant soil polymers, has attracted attention for bioprospective approaches. In the present work, we have designed and tested primers that were specific for detection of sub-groups of laccase-like genes within actinomycetes, which corresponded to the superfamilies I and K from the classification presented by the laccase and multicopper oxidase engineering database. The designed primers have amplified laccase-like gene fragments from actinomycete isolates that were undetectable by primers available from the literature. Furthermore, phylogenetic alignments suggest that some of these fragments may belong to new laccases-like proteins, and thus emphasize the benefits of designing subgroup-specific primers.

  14. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  15. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  16. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  17. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Directory of Open Access Journals (Sweden)

    Fernando Bastida-González

    2016-01-01

    Full Text Available Nucleoprotein (N gene from rabies virus (RABV is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs via indirect fluorescent antibody (IFA test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers, for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  18. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  19. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  20. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  1. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  2. Self-Etch Environmentally Acceptable Primer Testing (SEEAPT) Deliver Order 0001

    National Research Council Canada - National Science Library

    Joseph, Christopher

    2001-01-01

    .... The focus of the testing was on primer properties. Filiform corrosion, salt fog exposure, pencil hardness, crosshatch adhesion, impact testing, and wet tape adhesion testing were conducted on the 12 candidate systems, along with 4 control systems...

  3. Ceramic bond durability and degradation mechanism of commercial gamma-methacryloxypropyl trimethoxysilane-based ceramic primers.

    Science.gov (United States)

    Aida, Masahiro; Tabei, Naoko; Kimoto, Suguru; Tanimura, Hideki; Takahashi, Haruyoshi; Yaguchi, Takehiro; Nishiyama, Norihiro

    2012-08-01

    To investigate the bond durability and degradation mechanism of various commercial ceramic primers that are based on gamma-methacryloxypropyl trimethoxysilane (gamma-MPTS) and contain various organic additives. The null hypotheses tested were that (1) the type of ceramic primer had no effect on the bond strength after thermocycling and (2) the type of ceramic primer had no effect on the water contact angle after rinsing with THF. The adherent was a silica-based ceramic block used for computer-aided design/computer-aided manufacturing (CAD-CAM). Four commercial ceramic primers, Clearfil Mega Bond Porcelain Bonding kit (CM), Tokuso ceramic primer (TC), GC ceramic primer (CP), and Porcelain Liner M (PL), were compared with a simplified experimental ceramic primer (EP) that comprised gamma-MPTS and an inorganic acid (hydrochloric acid) but no other organic additives. The specimens for the adhesion test were prepared after a dual-curing type resin cement (Link Max) had adhered to the ceramic surfaces treated with each ceramic primer. The bonded specimens were then stored in water at 37 degrees C for 1 day. Then, the bonded specimens were thermocycled between 5 degrees C and 55 degrees C in water baths for 5000 or 10,000 cycles. The dwell time in each water bath and the transfer time were 60 and 7 seconds, respectively. The shear bond strength of resin to the ceramic surface was measured under a crosshead speed of 1.0 mm/minute by a conventional testing machine. Thereafter, the fracture mode for each specimen was determined. In addition, the water contact angle on the treated ceramic surfaces was measured before and after THF using a cotton pellet. As a control, the contact angle on the ground ceramic surface was measured without any ceramic primer. For all samples, thermocycling led to an increase in the frequency of interfacial failure, reflecting reduced mean bond strength of the resin to the treated ceramic surfaces. However, the bond degradation behavior differed

  4. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  5. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...primer alone launches the bullet with a shower of hot particles and gases. Similar attempts with a rifled barrel resulted in just enough force being...performance with novel measurement techniques. Journal of Energetic Materials and Chemical Propulsion. 2013;12(4):361–370. 4. Cup, primer (No. 34

  6. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  8. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  9. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  10. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  11. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  12. GSP: a web-based platform for designing genome-specific primers in polyploids.

    Science.gov (United States)

    Wang, Yi; Tiwari, Vijay K; Rawat, Nidhi; Gill, Bikram S; Huo, Naxin; You, Frank M; Coleman-Derr, Devin; Gu, Yong Q

    2016-08-01

    The sequences among subgenomes in a polyploid species have high similarity, making it difficult to design genome-specific primers for sequence analysis. We present GSP, a web-based platform to design genome-specific primers that distinguish subgenome sequences in a polyploid genome. GSP uses BLAST to extract homeologous sequences of the subgenomes in existing databases, performs a multiple sequence alignment, and design primers based on sequence variants in the alignment. An interactive primers diagram, a sequence alignment viewer and a virtual electrophoresis are displayed as parts of the primer design result. GSP also designs specific primers from multiple sequences uploaded by users. GSP is a user-friendly and efficient web platform freely accessible at http://probes.pw.usda.gov/GSP Source code and command-line application are available at https://github.com/bioinfogenome/GSP CONTACTS: yong.gu@ars.usda.gov or devin.coleman-derr@ars.usda.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  14. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    Science.gov (United States)

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique

    2013-01-01

    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  15. Association of different primers and resin cements for adhesive bonding to zirconia ceramics.

    Science.gov (United States)

    Maeda, Fernando Akio; Bello-Silva, Marina Stella; de Paula Eduardo, Carlos; Miranda Junior, Walter Gomes; Cesar, Paulo Francisco

    2014-06-01

    To evaluate the shear bond strength (SBS) to zirconia ceramics using different associations of primers and resin cements. Two blocks of LAVA zirconia (3Y-TZP) were randomly submitted to an application of three different commercially available primers: Alloy Primer (AP), Z-Prime Plus (ZP), and Signum Zirconia Bond (SZB). Nonprimed specimens were considered controls. After treatment, the 80 specimens (5 mm × 5 mm × 2 mm) were randomly cemented with one of the resin cements: Panavia F, Multilink, seT, and NX3. For cementation, cylinders of resin cement were built on the ceramic surfaces using the SDI SBS apparatus. The specimens were submitted to the SBS test. Fractured surfaces were observed under stereomicroscopy to determine the failure mode, and mean bond strength values were analyzed using the Kruskal-Wallis and Mann-Whitney tests (α = 0.05). Signum Zirconia Bond had the highest SBS compared to all other primers and the control group, regardless of the resin cement used. The highest values were obtained when associating Panavia F with Signum Zirconia Bond. Alloy Primer increased bonding values when associated with seT cement only. When no primer was used, no statistical difference was observed among resin cements. All specimens fractured due to adhesive failure. Signum Zirconia Bond is capable of increasing bonding values of resin cements to zirconia ceramics. Its association with Panavia F shows enhanced results when considering short-term adhesion to zirconia.

  16. Effects of primer containing silane and thiophosphate monomers on bonding resin to a leucite-reinforced ceramic.

    Science.gov (United States)

    Taira, Yohsuke; Sakai, Miyuki; Sawase, Takashi

    2012-05-01

    Silane primers are commonly used for bonding between resin-based luting agents and ceramic restorations. The purpose of the present study was to evaluate the effects of nine silane primers on the bond strength of resin to a leucite-reinforced ceramic. The commercially available dental primers used were five silane primers (GC Ceramic Primer, GP; Clearfil Ceramic Primer, CP; Tokuso Ceramic Primer, TP; Porcelain Liner M, PM; and Monobond Plus, MB). Four experimental primers (MDS, MTS, MDS/MPII, and MTS/MPII) and two control primers (MMA and MMA/MPII) were also prepared. The ceramic specimen was ground with silicon carbide paper, primed, and then bonded to a resin composite disc using a dual-curing luting agent. After a 24-h immersion in water, the shear bond strengths were determined. Shear bond testing revealed that the bond strength was significantly improved with the use of a MTS/MPII primer when compared to MDS, MTS, MMA, MDS/MPII and MMA/MPII. Although no significant differences were detected between GP, CP, PM, and MB, the primers CP, TP, PM, and MTS/MPII exhibited the highest bond strengths, followed by GP and MB, whilst the no-primer control resulted in the lowest values. The maximum bond strengths were obtained with CP, TP, PM, and MTS/MPII. It was suggested that the thiophosphate monomer accelerated the role of the silane monomer. When selecting a primer to bond ceramic restorations, clinicians should be aware that not only the silane monomer but also additional components of the primer considerably affect the bond strength. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  18. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV Evidence of different phylogenetic origins of two mexican Sugarcane mosaic virus (SCMV isolates

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2012-01-01

    Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.The molecular analysis of the Sugarcane mosaic virus (SCMV for coat protein cistron reported in the public GenBank database, revealed the presence of 45 additional nucleotides coding for 15 amino acids in the N-terminal region of the coat protein sequence of the mexican isolate GU474635. BLAST analysis indicates this particular feature is also present in the coat protein sequence identified with the accession number D00949 reported in the USA in 1991. Phylogenetic analysis of 185 SCMV coat protein sequences reported from Asia, Africa, Brazil and Argentina among others, suggest a putative different phylogeographical origin of the mexican SCMV isolates. Coat protein

  19. Sensibilidad de Acinetobacter a la colistina evaluada mediante los métodos de predifusión y de concentración inhibitoria mínima: Detección de aislamientos heterorresistentes Comparative evaluation of the sensitivity of Acinetobacter to colistin, using the prediffusion and minimum inhibitory concentration methods: Detection of heteroresistant isolates

    Directory of Open Access Journals (Sweden)

    Melina E. Herrera

    2011-06-01

    Full Text Available El objetivo de este estudio fue evaluar comparativamente los métodos de predifusión y de concentración inhibitoria mínima para establecer la sensibilidad de aislamientos del complejo Acinetobacter calcoaceticus-baumannii (ABC a la colistina y detectar a aquellos que presenten heterorresistencia a dicho antibiótico. Se estudiaron 75 aislamientos de ABC recuperados de materiales clínicamente significativos. Se determinó su sensibilidad a la colistina por el método de predifusión y de concentración inhibitoria mínima. Todos los aislamientos resultaron sensibles, con CIM = 2 µg/ml y halos de inhibición en el ensayo de la predifusión = 20 mm. Mediante el método de eficiencia de plaqueo se evaluó la presencia de heterorresistencia a la colistina. Se encontraron 14 aislamientos que originaron colonias heterorresistentes; sus CIM aumentaron en algunos casos en más de 8 veces. Con estas colonias seleccionadas se repitió el ensayo de predifusión. Finalmente se confeccionaron los gráficos de dispersión y se realizaron los análisis de regresión lineal, tanto para el conjunto inicial de todos los aislamientos clínicos como para el subgrupo de los aislamientos resistentes generados durante la evaluación de la heterorresistencia. Se obtuvieron coeficientes de determinación (r² de 0,2017 y 0,604, respectivamente, lo que indica correlación entre los métodos sólo al evaluar aislamientos preseleccionados por su resistencia a este agente.The objective of this study is to perform a comparative evaluation of the prediffusion and minimum inhibitory concentration (MIC methods for the detection of sensitivity to colistin, and to detect Acinetobacter baumanii-calcoaceticus complex (ABC heteroresistant isolates to colistin. We studied 75 isolates of ABC recovered from clinically significant samples obtained from various centers. Sensitivity to colistin was determined by prediffusion as well as by MIC. All the isolates were sensitive to

  20. Contenido de proteínas solubles, caracterización de isoenzimas, respuesta al Benomil y crecimiento Micelial de diversos aislamientos de Fusarium oxysporum f.sp. dianthi

    Directory of Open Access Journals (Sweden)

    Garcés de Granada Emira

    1993-06-01

    Full Text Available Fusarium oxysporum es un hongo cosmopolita que existe en muchas formas patogénicas, parasitando más de 100 especies de plantas Gimnospermas y Angiospermas. El gran número de plantas hospedantes que pueden ser atacadas por esa especie de hongo indica los diversos mecanismos
    que tiene el hongo para vencer las defensas de muchas plantas (Bosland, 1988. La variabilidad cultural y patogénica de Fusarium oxysporum ha interesado a micólogos, patólogos, biólogos y mejoradores de plantas para entender las bases de la evolución de su patogenicidad (Awak y
    Lorbeer, 1988. El estudio taxonómico de Fusarium oxysporum se basa en la morfologla y en el desarrollo de las estructuras reproductivas y en la manera como éstas se forman, y el taxon forma especial se tia empleado para categorizar aislamientos que causan enfermedades en una especie, género o familia de plantas en particular (Bosland y Williams, 1987; Bosland, 1988.

  1. A randomised trial comparing the antibacterial effects of dentine primers against bacteria in natural root caries.

    Science.gov (United States)

    Rolland, S L; McCabe, J F; Imazato, S; Walls, A W G

    2011-01-01

    As people are living longer and retaining their teeth into old age, root caries is an increasingly significant problem. A minimally invasive treatment strategy, involving sealing the root caries lesion with an antibacterial resin sealant, could be highly beneficial. The aim of this study was to compare the antibacterial properties of the primers of two proprietary dentine bonding agents, Clearfil SE Bond (SE; Kuraray Medical, Japan) and Clearfil Protect Bond (PB; Kuraray Medical), which contains the antibacterial monomer methacryloyloxydodecylpyridinium bromide. Fifty-two root caries lesions were identified and randomly assigned to a primer. The lesion was cleaned, isolated, sampled with a sharp spoon excavator, a primer applied and a second sample taken. Samples were transported in fastidious anaerobe broth, vortex-dispersed and serial dilutions inoculated onto selective agars. Reduction in colony-forming units (CFU, %) after primer application was calculated for both primers for bacterial growth on each selective agar and compared to a hypothesised mean of 100% (one-sample t test, p < 0.05). No significant differences between primers were seen, indicating efficient bacterial elimination by both materials. Comparing percent reduction between SE and PB for each agar (Mann-Whitney test, p < 0.05), a significantly greater CFU reduction by PB was seen for streptococci but not other bacteria. More lesions exhibited bacterial growth and several lesions demonstrated marked bacterial growth after treatment with SE compared with PB. Therefore, PB appears to exhibit superior antimicrobial properties, particularly against streptococci. Both primers are highly antibacterial towards root caries bacteria and may therefore be suitable for minimally invasive treatment. Copyright © 2011 S. Karger AG, Basel.

  2. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  3. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  4. Cloning flanking sequence by single-primer PCR in transgenic plants.

    Science.gov (United States)

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  5. Microleakage under metallic and ceramic brackets bonded with orthodontic self-etching primer systems.

    Science.gov (United States)

    Uysal, Tancan; Ulker, Mustafa; Ramoglu, Sabri Ilhan; Ertas, Huseyin

    2008-11-01

    To compare the in vitro microleakage of orthodontic brackets (metal and ceramic) between enamel-adhesive and adhesive-bracket interfaces at the occlusal and gingival sides produced by self-etching primer system with that of conventional acid etching and bonding. Sixty freshly extracted human mandibular premolar teeth were used in this study. The teeth were separated into four groups of 15 teeth each and received the following treatments: Group 1, 37% phosphoric acid gel + Transbond XT liquid primer + stainless steel bracket; Group 2, Transbond Plus Self-Etching Primer (TSEP) + stainless steel bracket; Group 3, 37% phosphoric acid gel + Transbond XT liquid primer + ceramic bracket; Group 4, TSEP + ceramic bracket. After curing, specimens were further sealed with nail varnish, stained with 0.5% basic fuchsine for 24 hours, sectioned and examined under a stereomicroscope, and scored for microleakage for the enamel-adhesive and bracket-adhesive interfaces from both occlusal and gingival margins. Statistical analyses were performed using Kruskal-Wallis and Mann-Whitney U tests. The gingival sides in all groups exhibited higher microleakage scores compared with those observed in occlusal sides for both adhesive interfaces. Enamel-adhesive interfaces exhibited more microleakage than did the adhesive-bracket interfaces. Brackets bonded with self-etching primer system showed significantly higher microleakage at the enamel-adhesive interface of the gingival side. TSEP causes more microleakage between enamel-adhesive interfaces, which may lead to lower bond strength and/or white-spot lesions.

  6. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2017-12-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  7. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  8. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    Science.gov (United States)

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (pzirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  9. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  10. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  11. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin.

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-10-01

    The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (PAg-Pd alloy surfaces presented significantly decreased shear bond strength. Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys.

  12. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  13. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  14. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  15. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  16. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    Science.gov (United States)

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (pcontrol. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  17. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  18. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  19. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  20. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  1. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species

    OpenAIRE

    Sánchez Robles, José Manuel; Talavera Lozano, Salvador; García Castaño, Juan Luis; Terrab Benjelloun, Anass; Navarro Sampedro, Laura; Balao Robles, Francisco J.

    2012-01-01

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other ...

  2. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  3. Primer fármaco antiepiléptico : patrón de uso y efectividad

    OpenAIRE

    Martínez Domeño, Alejandro

    2013-01-01

    Estudiem el primer fàrmac antiepileptic utlitzat en 430 pacients amb epilèpsia, per valorar la seva taxa de retenció, efectivitat i tolerabilitat en el primer any de tractament. El 81% van rebre àcid valproic, carbamazepina o feintoina com primer tractament, tot i que l'ús de la fenitoina ha disminuit significativamen en els últims anys. La taxa de retenció annual és del 87%, sent més altes amb levetiracetam i lamotrigina. Un 40% van presentar recurrències en el primer any, sent major el risc...

  4. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  5. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples.

    Science.gov (United States)

    Maheux, Andrée F; Picard, François J; Boissinot, Maurice; Bissonnette, Luc; Paradis, Sonia; Bergeron, Michel G

    2009-07-01

    The analytical performance of 9 different PCR primer sets designed to detect Escherichia coli and Shigella in water has been evaluated in terms of ubiquity, specificity, and analytical detection limit. Of the 9 PCR primer sets tested, only 3 of the 5 primer sets targeting uidA gene and the primer set targeting tuf gene amplified DNA from all E. coli strains tested. However, of those 4 primer sets, only the primer set targeting the tuf gene also amplified DNA from all Shigella strains tested. For the specificity, only the primer sets targeting the uidA gene were 100% specific although the primer sets targeting 16S rRNA, phoE, and tuf genes only amplified Escherichia fergusonii as non-specific target. Finally, the primer set targeting the 16S-ITS-23S gene region, was not specific as it amplified DNA from many other Enterobacteriaceae species. In summary, only the assay targeting the tuf gene detected all E. coli/Shigella strains tested in this study. However, if it becomes important to discriminate between E. coli and E. fergusonii, assays targeting the uidA gene would represent a good choice although none of them were totally ubiquitous to detect of the presence of Shigella strains.

  6. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  7. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  8. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  9. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  10. [Aging effect of one bottle-type ceramic primer on bonding efficacy of resin cement].

    Science.gov (United States)

    Goto, Haruhiko

    2008-04-01

    To understand the degradation mechanisms of commercially available one bottle-type ceramic primer, we prepared one bottle-type experimental ceramic primer consisting of gamma-methacryloxy-propyl-trimethoxysilane, gamma-MPTS, and 90% ethanol solution. The effects of aging of the experimental primer on the hydrolysis and condensation behavior of gamma -MPTS and on the bonding efficacy of gamma-MPTS at the interface between cement and ceramic were studied. We used two lamina bond porcelain primers (LB), that had been aged for 20 months and newly purchased. Experimental primer was aged at 20 degrees C. After aging, we measured 29Si NMR spectrum of the gamma-MPTS and the shear bond strength of the cement to silane-treated ceramic by varying aging periods. When the LB was aged for 20 months, the mean bond strength decreased from 26 to 11 MPa. To understand the degradation mechanism in the bond strength, the effects of aging of experimental primer on molecular species of gamma-MPTS were examined. With prolonging its aging period, the methoxy group of the silicone functional portion in the gamma-MPTS hydrolyzed and the hydrolyzed gamma-MPTS species condensed together. The molecular weight of condensed gamma-MPTS species increased. On the other hand, when the dimer species of gamma-MPTS were produced, a maximum mean bond strength of 28 MPa was observed. Thereafter, the bond strength dropped down and leveled off at 16 MPa. When the LB was aged for 20 months, the bond strength dramatically decreased. This decrease in the mean bond strength was probably attributed to ester exchange reaction of the methoxyl group in the gamma-MPTS by the ethanol used as diluent solvent.

  11. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  12. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...

  13. Aislamiento e identificación de cepas de Azospirillum sp. en pasto guinea (Panicum maximum Jacq. del Valle del Cesar Isolation and identification of Azospirillum sp. in Guinea grass (Panicum maximum Jacq. of the Valle del Cesar

    Directory of Open Access Journals (Sweden)

    Diana M Cárdenas

    2010-09-01

    Full Text Available Se evaluó el efecto de factores ambientales del Valle del Cesar y el manejo agronómico del pasto guinea (Panicum maximum Jacq., sobre la población bacteriana del género Azospirillum en medios de cultivo semisólidos NFb y LGI, para lo cual se utilizó un diseño experimental en parcelas divididas con un arreglo factorial de 2 (épocas climáticas: lluvia y sequía x 2 (manejos agronómicos: agroecólogico y extractivo x 3 (muestras analizadas: suelo rizosférico, raíces y hojas. Los resultados no revelaron diferencias estadísticas significativas, lo que indica que esta bacteria puede mantener su población en condiciones de estrés por diferentes mecanismos fisiológicos. A partir de estas muestras se obtuvieron 16 aislamientos pertenecientes al género Azospirillum, a los cuales se les evaluó su actividad de reducción de acetileno como indicador de la fijación biológica de nitrógeno y su capacidad en la producción de compuestos indólicos como promotores del crecimiento vegetal. Se seleccionaron las cepas SRGM2, SRGM3 y SRGM4 obtenidas de muestras de suelo rizosférico de pasto guinea de la Estación Experimental Motilonia de Corpoica, municipio Agustín Codazzi, departamento del Cesar. Estos aislamientos se caracterizaron molecularmente por el gen 16S rRNA y según el análisis BLAST en la base de datos del GenBank y presentaron 93% de similitud con A. lipoferum (SRGM2 y SRGM3 y 94% con A. brasilense (SRGM4.The effect of environmental factors of the Valle del Cesar and the agronomic management of Guinea grass (Panicum maximum Jacq., on the bacterial population of the Azospirillum genus in semisolid NFb and LGI culture media was evaluated, for which an experimental design was used in divided plots with a 2 (climatic seasons: rainy and dry x 2 (agronomic managements: agroecological and extractive x 3 (analyzed samples: rhizospheric soil, roots and leaves factorial arrangement. The results did not reveal significant statistical

  14. Energy consumption and the use of thermal insulating materials. A comparative analysis on the tendencies over the time; Consumo de energia y uso de aislamientos termicos - un analisis comparativo de tendencias en el tiempo

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    positivas y son semejantes a las tendencias en el consumo de aislamientos termicos y a cifras semejantes de otros paises. El analisis de estas cifras nos permiten detectar si se pueden correlacionar los esfuerzos de ahorro de energia con el consumo de aislamientos termicos y con el nivel de vida de un pais (determinado por su ingreso per capita), y establecer un indice futuro de efectividad de conservacion de energia por el uso adecuado de materiales de espesor economico. El indice propuesto en esta ponencia sirve este proposito y nos arroja resultados interesantes. A lo largo de los anos recientes y como resultado del cambio en el nivel de industrializacion y de vida en Mexico, el consumo de energeticos ha aumentado en proporcion mayor al crecimiento de poblacion, tomando como base las cifras de 1980. En ese mismo periodo, el producto interno bruto per capita ha aumentado en proporcion tambien ligeramente menor al crecimiento poblacional. Esto significa que la cifra de Intensidad Energetica, definida como la proporcion de consumo de energeticos sobre el producto interno bruto, ha aumentado ligeramente en el mismo periodo en consideracion, significando que el pais se ha vuelto mas ineficiente en anos recientes. Al mismo tiempo, la capacidad de produccion de materiales aislantes termicos ha permanecido constante desde 1980 hasta principios de 1994. Esto compara desfavorablemente con todos los paises desarrollados, en los cuales la intensidad energetica ha disminuido considerablemente en los ultimos anos, al tiempo que la produccion de materiales aislantes termicos ha crecido a un ritmo de proporciones semejantes.

  15. Tipificación molecular de aislamientos de Pseudomonas aeruginosa obtenidos de pacientes con fibrosis quística Molecular typification of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis

    Directory of Open Access Journals (Sweden)

    N. G. Iglesias

    2008-03-01

    Full Text Available La fibrosis quística es la enfermedad genética letal de mayor frecuencia en la población caucásica. La infección pulmonar crónica es la principal causa de morbilidad de la enfermedad, siendo la infección por Pseudomonas aeruginosa la más importante, ya que resulta de difícil erradicación. El Centro de Referencia Provincial de Fibrosis Quística que funciona en el Hospital de Niños "Sor María Ludovica" de La Plata asiste a alrededor de 220 pacientes con fibrosis quística cuyas edades oscilan entre los dos meses y los 45 años. La edad de sobrevida depende de una serie de factores entre los que se encuentran el diagnóstico temprano de la enfermedad y la adquisición de la infección pulmonar crónica por P. aeruginosa. La misma puede adquirirse en forma directa, por transmisión persona a persona o de forma indirecta a través del uso de elementos hospitalarios contaminados. El objetivo de este trabajo fue la tipificación molecular de aislamientos de P. aeruginosa obtenidos de pacientes con fibrosis quística, con el fin de evaluar la relación genómica entre los mismos. El estudio se llevó a cabo mediante RAPD-PCR. El análisis demostró que existe gran heterogeneidad genética entre los aislamientos. La separación en cohortes de pacientes de acuerdo con su bacteriología, que implica la asistencia en días diferentes y las hospitalizaciones en habitaciones aisladas ha demostrado, junto a otras estrategias, disminuir las infecciones cruzadas.Cystic fibrosis is the most frequent lethal genetic disease that affects the caucasian population. The main cause of morbidity is the chronic lung infection, being the infection caused by Pseudomonas aeruginosa the most difficult to eradicate. This bacteria can be acquired in direct form, by person-to-person transfer, or indirectly, by hospital acquired infection. The Centro Provincial de Referencia de Fibrosis Quística functioning in the Hospital de Niños "Sor María Ludovica", in La

  16. Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo

    2009-04-01

    Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

  17. Spoilage yeasts in Patagonian winemaking: molecular and physiological features of Pichia guilliermondii indigenous isolates Levaduras contaminantes en vinos patagónicos: características moleculares y fisiológicas de los aislamientos indígenas de Picchia guilliermondii

    Directory of Open Access Journals (Sweden)

    C. A. Lopes

    2009-09-01

    Full Text Available Yeasts belonging to the genus Dekkera/Brettanomyces, especially the species Dekkera bruxellensis, have long been associated with the production of volatile phenols responsible for off-flavour in wines. According to recent reports, the species Pichia guilliermondii could also produce these compounds at the initial stages of fermentation. Based on the abundance of P. guilliermondii in Patagonian winemaking, we decided to study the relevance of indigenous isolates belonging to this species as wine spoilage yeast. Twenty-three indigenous isolates obtained from grape surfaces and red wine musts were analyzed in their capacity to produce volatile phenols on grape must. The relationship between molecular Random Amplified Polymorphic DNA (RAPD and physiological (killer biotype patterns detected in indigenous populations of P. guilliermondii and volatile phenol production was also evaluated. Different production levels of 4-ethylphenol, 4-vinylguaiacol and 4-ethylguaiacol were detected among the isolates; however, the values were always lower than those produced by the D. bruxellensis reference strain in the same conditions. High levels of 4-vinylphenol were detected among P. guilliermondii indigenous isolates. The combined use of RAPD and killer biotype allowed us to identify the isolates producing the highest volatile phenol levels.Las levaduras del género Dekkera/Brettanomyces, sobre todo la especie Dekkera bruxellensis, siempre han sido asociadas con la producción de fenoles volátiles responsables de aromas desagradables en los vinos. Recientemente, se ha demostrado que la especie Pichia guilliermondii también es capaz de producir estos compuestos, particularmente durante las etapas iniciales de la fermentación. Dada la abundancia de P. guilliermondii en las bodegas de la Patagonia, se decidió evaluar la importancia de algunos aislamientos indígenas de esta especie como levaduras alterantes de vinos regionales. Se evaluó la capacidad de

  18. Aislamiento y caracterización de macrófagos-células espumosas a partir de aorta de un modelo deateroesclerosis en conejo hipercolesterolémico.

    Directory of Open Access Journals (Sweden)

    Juan Carlos Porras

    2003-12-01

    Full Text Available Actualmente existe suficiente evidencia que sustenta que la ateroesclerosis es una patología en la cual están involucrados no sólo procesos de desequilibrio y aumento de lípidos, sino también procesos inflamatorios mediados por macrófagos-células espumosas. Estos hallazgos han sido encontrados en estudios llevados a cabo con animales de experimentación. Con el propósito de racionalizar la utilización de animales y de proponer un modelo biológico alterno en el que se puedan estudiar los mecanismos de patogenicidad que involucren tipos celulares relacionados con la ateroesclerosis, en el presente trabajo se estandarizó una técnica de aislamiento y cultivo de macrófagos-células espumosas, así como, los procedimientos para caracterizar los cultivos establecidos mediante la detección de esterasas no específicas. Para el análisis de la expresión de estas enzimas, se utilizó una técnica histoquímica y electroforesis en gel de poliacrilamida en condiciones no denaturantes. En la literatura revisada, este último método no ha sido empleado para evidenciar expresión de esterasas no específicas en leucocitos. El modelo biológico aportado por este trabajo puede ser usado para estudiar respuestas de los macrófagos activados y células espumosas relacionadas con la ateroesclerosis.

  19. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y testudines de la Estación de Biología Tropical Roberto Franco en Villavicencio, Colombia

    Directory of Open Access Journals (Sweden)

    C. A. Moreno

    2010-04-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos enmamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal.La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programade recuperación del Caimán Llanero (Crocodylus intermedius, que se encuentra en inminentepeligro de extinción; adicionalmente cuenta con una colección viva de Testudinesque comprende más de 20 especies. Con el fin de determinar la presencia de potencialesenteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientalesy cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagarOrientaciónBD® para realizar los aislamientos y la identificación microbiológica. Los resultadosmuestran una mayor presentación de flora gram negativa predominando microorganismosde los géneros (28%, Klebsiella sp (26%, Salmonella sp.(6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del géneroEnterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todaslas muestras sin importar el origen de las mismas. Conscientes del riesgo que implica elaislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico,se dio inicio a la implementación de un manual de bioseguridad para la Estación con elfin disminuir el riesgo para la población humana y animal.

  20. Fractal analysis of the electrical discharges' surface paths in polymeric insulation considering different pollution levels; Analisis fractal de las trayectorias de descargas electricas superficiales en aislamiento polimerico considerando diferentes niveles de contaminacion

    Energy Technology Data Exchange (ETDEWEB)

    Palacios Lopez, Arturo

    2002-07-01

    In this thesis tree patterns of superficial breakdown in polymeric insulator of Silicon Rubber are generated. Experimental arrangement rod-rod was used on the basis of norm ASTM D 2303-85. Pollution levels on the basis of norm IEC 507 were also used. The experimental values of Fractal Dimension for each case of pollution were reported. A self similar method called Box Counting for the fractal dimension calculus and for the self affine methods an R/S and Variogram were used. According to the results, it was concluded that the tree patterns of superficial electric breakdown in Silicon Rubber is self similar and its value does not depend on the degree of pollution, that is equivalent to the concentration of salt for liter of water or to the Equivalent Salt Deposition (ESDD), in the surface of an insulator. [Spanish] En el presente trabajo se inducen descargas electricas superficiales en un aislamiento polimerico de Hule Silicon, el arreglo experimental que se utilice es punta-punta con base en la norma ASTM D 2303-85 y los niveles de contaminacion con base en la norma IEC 507. Se reportan los valores experimentales de la Dimension Fractal para cada caso de contaminacion, se utilice el metodo auto similar de conteo de cuadros, para el calculo de la Dimension Fractal y para metodos auto afines se utilice analisis R/S y variograma. Con los resultados obtenidos se concluye que la trayectoria de la descarga electrica superficial en un polimero de Hule Silicon es auto similar y su valor no depende del grado de contaminacion, el cual es equivalente a la concentracion de gramos de sal por litro de agua o a la densidad de sal depositada (DESD), en la superficie de un aislador.

  1. Variación de la autonomía en el aprendizaje, en función de la gestión del conocimiento, para disminuir en los alumnos los efectos del aislamiento

    Directory of Open Access Journals (Sweden)

    Luis Danilo Flores Rivera

    2017-01-01

    Full Text Available El aprendizaje autónomo en la formación universitaria es un elemento clave que permite gestionar el conocimiento , así como también, reforzar y retro alimentar contenidos , es en ese sentido que , l os recursos tecnológicos en línea s on con sidera dos como el aliado ideal en el fortalec imiento d el aprendizaje autónomo , puesto que , facilita los procesos de aprendizaje y disminuye efectos producidos por el aislamiento. Hoy en día e l uso y aplicación de un sin número de herramientas tecnológicas virtuales se adaptan a las necesidades especí ficas del educando . La presente investigaci ón se desarrolló e n una población de 58 estudiantes y 26 docentes de una universidad privada del Ecuado r que contaba con equipamiento tecnológico y herramientas en lín ea adecuadas para efectuar la mis m a . S e aplicó una encuesta estructurada que permitió identificar y conocer sobre las herramientas en línea en función de las actividades de aprendizaje autónomo , e l rendimiento académico , el empleo de los recursos tecnológi cos entre otros, de los cuales se pudo determinar la importancia de los recursos en línea en la gestión académica del aprendizaje autónomo del estudiante.

  2. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  3. Detección del gen codificante de la metalo-ß-lactamasa VIM-2 en un integrón de clase 1 asociado con el gen blaCTX-M-2 en un aislamiento clínico de Pseudomonas aeruginosa en el Uruguay: primera comunicación

    Directory of Open Access Journals (Sweden)

    Ana J Ingold

    2011-09-01

    Full Text Available Con el fin de analizar la presencia de metalo-ß-lactamasas en nuestro medio, se incluyeron en este estudio aislamientos de Pseudomonas aeruginosa causantes de infecciones nosocomiales en un centro hospitalario del Uruguay, en el período comprendido entre abril y setiembre de 2008. En un aislamiento se detectó la presencia del gen codificante de la metalo-ß-lactamasa VIM-2 asociado a un integrón de clase 1 y del gen codificante de una ß-lactamasa de espectro extendido CTX-M-2. Esta es la primera comunicación de la presencia de los genes blaCTX-M-2 y blaVIM-2 en un mismo aislamiento de P. aeruginosa. A pesar de que las carbapenemasas ya han sido ampliamente documentadas en varias partes del mundo, esta es la primera comunicación de una metalo-ß-lactamasa adquirida con actividad carbapenemasa en bacterias patógenas encontradas en el Uruguay.VIM-2 metallo-ß-lactamase gen detection in a class 1 integron associated to blaCTX-M-2 in a Pseudomonas aeruginosa clinical isolate in Uruguay: first communication. In order to analyze the presence of metallo-ß-lactamase in our country, we included in this study Pseudomonas aeruginosa isolates causing nosocomial infections in a hospital from Uruguay. The presence of a metallo-ß-lactamase VIM-2 in a class 1 integron and of an extended spectrum -lactamase CTX-M-2 was detected in one isolate. This is the first report of both genes, blaCTX-M-2 and blaVIM-2,in the same P. aeruginosa isolate. Although carbapenemases have been extensively documented in the world, this is the first report of an acquired metallo-ß-lactamase with carbapenemase activity in pathogenic bacteria in Uruguay.

  4. Campylobacter spp.: prevalencia y caracterización feno-genotípica de aislamientos de pacientes con diarrea y de sus mascotas en la provincia de La Pampa, Argentina Campylobacter spp.: prevalence and pheno-genotypic characterization of isolates recovered from patients suffering from diarrhea and their pets in La Pampa Province, Argentina

    Directory of Open Access Journals (Sweden)

    Ana L Tamborini

    2012-12-01

    Full Text Available Se investigó la prevalencia de Campylobacter spp. en 327 pacientes con diarrea y en 36 animales (perros, gatos y pollos que convivían con pacientes en los que se detectó este patógeno; el estudio se llevó a cabo en Santa Rosa, La Pampa, Argentina. Se aisló Campylobacter spp. en 50/327 pacientes y en 12/36 animales, Campylobacter jejuni fue la especie más frecuente. Se detectó resistencia a ciprofoxacina (65 % y a tetraciclina (32 % en una selección de 35 aislamientos de origen humano. En el análisis por electroforesis de campo pulsado de 13 aislamientos de C. jejuni se identificaron siete subtipos genéticos. Dos subtipos agruparon aislamientos de pacientes y de sus respectivos perros, y un tercer subtipo agrupó 1 aislamiento humano y 2 de pollos de ese paciente. Si bien las aves son reconocidas como el principal reservorio, es importante fortalecer la vigilancia de Campylobacter spp. en mascotas, las cuales pueden ser portadores asintomáticos del patógeno.The prevalence of Campylobacter spp. was investigated in 327 patients suffering from diarrhea and in 36 animals (dogs, cats and chickens owned by the patients that presented infection by Campylobacter in Santa Rosa, La Pampa, Argentina. Campylobacter spp. was isolated in 50/327 patients and in 12/36 animals, being Campylobacter jejuni the most common species. Resistance to ciprofoxacin (65 % and tetracycline (32 % was found among 35 isolates of human origin studied. Seven genetic subtypes were observed among 13 C. jejuni isolates by pulsed feld gel electrophoresis. Two subtypes grouped isolates belonging to patients and their respective dogs whereas another subtype grouped one isolate of human origin and two isolates from the patient´s chickens. The results of this investigation highlight the need to strengthen surveillance of Campylobacter spp. not only in poultry, which is recognized as the main reservoir, but also in pets, which were shown to be asymptomatic carriers of the

  5. Aislamiento, caracterización y conservación de bacterias no entéricas con capacidad de adaptación en altas concentraciones de plata, presentes en una laguna de sedimentación de la planta minera del sector el Pache - Portovelo - el Oro.

    OpenAIRE

    Ramírez Cando, Lenin

    2012-01-01

    La biotecnología ambiental y la microbiología son los campos científicos donde se desarrolló la presente investigación planteándose el aislamiento de bacterias nativas de un sector minero ubicado en El Pache cantón Portovelo en la provincia El Oro, partiendo de sedimentos, residuos del proceso de extracción de oro por flotación. Donde 25 cepas sin identificar se lograron aislar, las mismas se sometieron a un proceso de selección en agar selectivo modificado adicionado sales del metal, resulta...

  6. Análisis de la eficiencia del sistema de aislamiento de vibraciones de grupos electrógenos MAN 18 V48/60 B // Efficiency analysis of vibration isolation system installed on engine generator sets type MAN 18 V48/60 b

    Directory of Open Access Journals (Sweden)

    Evelio Palomino‐Marín

    2011-01-01

    Full Text Available Todo sistema de aislamiento de vibraciones está encaminado en primera instancia a aislarvibraciones como su propio nombre lo indica. En ocasiones es menester que a la máquina no laperturben vibraciones procedentes del entorno, como lo puede ser por ejemplo, el caso de unarectificadora en un taller de mecanizado. Así mismo, en otras ocasiones resulta necesario aislar lamáquina para evitar que las vibraciones producidas por ella misma afecten al entorno. Tal es el casode los grupos electrógenos MAN 18 V48/60 B, cuyos motores de combustión interna responden a undiseño de 18 cilindros en “V” distribuidos en 13 metros de longitud. El sistema de aislamiento deestos motores consta de 14 paquetes de ocho resortes cada uno, incluyendo un amortiguadorviscoso por cada calzo. Se efectuaron mediciones espectrales de vibraciones en cada uno de estoscalzos antivibratorios, sobre y debajo de estos respectivamente y se evaluó la eficiencia de estoscalzos en todo el espectro, determinándose aquellas frecuencias que por determinadas razones noalcanzan los niveles de eficiencia en el aislamiento establecidos a tales efectos. De esta manera, sepresenta una metodología para conducir este análisis.Palabras claves: calzos antivibratorios, aislamiento de vibraciones, grupos electrógenos.___________________________________________________________________AbstractA vibroisolation system has a priority goal which is isolate vibrations. Such vibrations can come fromthe environment and could affect the machine behavior and could affect its technological functionstoo. That’s the case of a machine tool, for instance. However, it is also possible that vibrations comefrom the own machine and in this case the main goal of vibroisolation system is to avoid thatvibrations go to machine foundations. This is the case on which this paper is focused. Twelvevibration isolators with eight springs each one including a viscous damper are mounted asvibroisolation system on

  7. Evaluación de aislamientos de baculovirus para el control de Spodoptera frugiperda (Smith, 1797 (LEP.: NOCTUIDAE, plaga clave del maíz en el noroeste argentino Evaluation of baculovirus strains to control the fall armyworm, Spodoptera frugiperda (Smith, 1797 (LEP.: NOCTUIDAE, a key corn pest in North Western Argentina

    Directory of Open Access Journals (Sweden)

    Marta G. Yasem de Romero

    Full Text Available Para el control de Spodoptera frugiperda (Smith, plaga clave del maíz en el noroeste argentino (NOA, se utilizan insecticidas químicos que muestran en muchas ocasiones, una baja efectividad. Los baculovirus constituyen una alternativa biológica para el manejo del gusano cogollero. El propósito de este trabajo fue evaluar la susceptibilidad de estadios larvales de S. frugiperda a distintas concentraciones de tres aislamientos del Nucleopolyhedrovirus de diferentes procedencias. Los resultados obtenidos permitieron constatar que la mortalidad de las orugas de S. frugiperda aumentó con el incremento de la concentración viral y que la susceptibilidad larval al virus decreció con el aumento de la edad del insecto. Se determinó una concentración letal media (CL50 de 7,6 x 10(4 y 4,5 x 10(5 poliedros/ml en larvas de tres y cinco días respectivamente, para el VPN aislamiento Leales (Tucumán, Argentina. Con niveles similares se ubicó el aislamiento Oliveros (Santa Fe, Argentina, cuya CL50 fue de 8,6 x 10(4 poliedros/ml y 4 x 10(5 poliedros/ml, respectivamente. Por último, el aislamiento oriundo de Brasil presentó CL50 igual a 5,9 x 105 poliedros/ml para larvas de tres días, y 1,5 x 106 poliedros/ml para orugas de cinco días. El aislamiento local demostró la mayor virulencia en la población nativa de larvas de S. frugiperda, registrando para larvas jóvenes (tres y cinco días de edad y a los valores de concentración letal media, un tiempo medio de mortalidad de seis días, resultando siete días para el aislamiento Oliveros y nueve días para el aislamiento Brasil. Considerando los resultados obtenidos, el VPNSf aislamiento Leales tuvo el mejor desempeño y sería conveniente continuar los estudios destinados a desarrollar un bioinsecticida para uso local, ya que evidencia una adecuada virulencia. Además, al ser un aislamiento nativo, su empleo sería el más apropiado en términos de impacto ambiental.Chemical insecticides are used

  8. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  9. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... A set of ten diverse mulberry accessions was used for screening the primers and standardizing PCR conditions. The PCR amplifications were carried out in 10 µl reaction volume, containing 10 ng template DNA, 1X DreamTaqTM Green Buffer (ThermoFisher. Scientific, Lithuania), 0.1 mM of each dNTPs, ...

  10. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  11. Universal primers for plasmid detection and method for their relative quantification in phytoplasma-infected plants

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Sarkisova, Tatiana; Čurnová, L.

    2011-01-01

    Roč. 64, Suppl. (2011), s. 25-26 ISSN 1721-8861 R&D Projects: GA MZe QH91224 Institutional research plan: CEZ:AV0Z50510513 Keywords : Plasmid * universal primers * rep gene Subject RIV: EE - Microbiology, Virology Impact factor: 0.592, year: 2011

  12. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  13. A Primer on Polymer Nomenclature: Structure-Based, Sourced- Based, and Trade Names

    Science.gov (United States)

    Cheng, H. N.; Howell, Bob A.

    2017-01-01

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structurebased and source-based nomenclatures, together with trivial and trade…

  14. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  15. Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers.

    Science.gov (United States)

    Marincevic-Zuniga, Yanara; Gustavsson, Inger; Gyllensten, Ulf

    2012-10-10

    Multiply-primed rolling circle amplification (RCA) is a suitable technique for amplification of circular templates and has been used to identify novel human papillomaviruses (HPV). In this study we develop an efficient RCA for whole genome amplification of HPV using HPV-specific primers in clinical samples and establish a protocol for whole genome sequencing using the Sanger method. Amplification of cloned HPV-genomes by RCA was compared using specific primers against random hexamers. Using HPV-specific primers increased the effectiveness on average 15.2 times and the enrichment of HPV relative to human gDNA on average 62.2 times, as compared to using random hexamer. RCA products were sequenced without need for cloning, even when using low-input amounts. The technique was successfully used on 4 patient samples from FTA cards, to generate whole HPV-genome sequences. Degenerated HPV-specific primers for RCA produce DNA of sufficient quality and quantity suitable for sequencing and other potential downstream analyses. Copyright © 2012. Published by Elsevier Inc.

  16. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  17. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  18. ANALISIS PRODUCT MAPPING DAYA SAING EKSPOR PRODUK PRIMER INDONESIA DAN CHINA

    Directory of Open Access Journals (Sweden)

    Sulthon Sjahril Sabaruddin

    2015-11-01

    Full Text Available This research attempts to analyze the mapping competition of the Indonesian and Chinese primary products in order to identify and map the strengths and weaknesses of Indonesian products vis-à-vis China. To examine this, the study uses tools such as the SMART Model (Software for Market Analysis and Restrictions on Trade, Social Accounting Matrix 2008 (SAM 2008, Normalized Revealed Comparative Advantage (NRCA and the Product Mapping. The results of the competition analysis found that Indonesia which rely on the export of primary products, in overall it is predicted to win the competition against China as the Indonesian primary products have better competitiveness than China. However, in the future, the competition will be fiercer, therefore, Indonesia should make efforts to improve further the competitiveness of Indonesian exports. Penelitian ini dimaksudkan untuk mengevaluasi peta persaingan produk primer Indonesia dan China guna mengidentifikasi dan memetakan kekuatan dan kelemahan produk Indonesia dalam persaingan dengan produk-produk primer asal China. Guna menelaah studi ini, beberapa perangkat dimanfaatkan yakni SMART Model (Software for Market Analysis and Restrictions on Trade, Sistem Neraca Sosial Ekonomi 2008 (SNSE 2008, Normalized Revealed Comparative Advantage (NRCA dan Product Mapping. Hasil analisis peta persaingan kedua negara, Indonesia yang mengandalkan ekspor produk primer diperkirakan secara keseluruhan unggul dibandingkan produk primer dari China karena Indonesia memiliki daya saing yang lebih baik dibandingkan China. Namun demikian, perlu diperhatikan bahwa persaingan ke depan akan berlangsung semakin ketat, oleh karena itu Indonesia perlu melakukan upaya untuk meningkatkan daya saing ekspor Indonesia.

  19. Book review: Estimation of parameters for animal populations: A primer for the rest of us

    Science.gov (United States)

    Post van der Burg, Max

    2016-01-01

    No abstract available.Estimation of Parameters for Animal Populations: A Primer for the Rest of Us. Larkin A. Powell and George A. Gale. 2015. Caught Napping Publications, Lincoln, Nebraska, USA. 239 pages. (http://larkinpowell.wixsite.com/larkinpowell/estimationof-parameters-for-animal-pop). ISBN: 978-329-06151-4.

  20. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  1. Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries.

    Science.gov (United States)

    Shagin, Dmitriy A; Turchaninova, Maria A; Shagina, Irina A; Shugay, Mikhail; Zaretsky, Andrew R; Zueva, Olga I; Bolotin, Dmitriy A; Lukyanov, Sergey; Chudakov, Dmitriy M

    2017-06-05

    Recently we proposed efficient method to exclude undesirable primers at any stage of amplification reaction, here termed NOPE (NOnsense-mediated Primer Exclusion). According to this method, added oligonucleotide overlapping with the 3'-end of unwanted amplification primer (NOPE oligo) simultaneously provides a template for its elongation. This elongation disrupts specificity of unwanted primer, preventing its further participation in PCR. The suggested approach allows to rationally manage the course of PCR reactions in order to facilitate analysis of complex DNA mixtures as well as to perform multistage PCR bypassing intermediate purification steps. Here we apply NOPE method to DNA library preparation for the high-throughput sequencing (HTS) with the PCR-based introduction of unique molecular identifiers (UMI). We show that NOPE oligo efficiently neutralizes UMI-containing oligonucleotides after introduction of UMI into sample DNA molecules, thus allowing to proceed with further amplification steps without purification and associated loss of starting material. At the same time, NOPE oligo does not affect the efficiency of target PCR amplification. We describe a simple, robust and cheap modification of UMI-labeled HTS libraries preparation procedure, that allows to bypass purification step and thus to preserve starting material which may be limited, e.g. circulating tumor DNA, circulating fetal DNA, or small amounts of isolated cells of interest. Furthermore, demonstrated simplicity and robustness of NOPE method should make it popular in various PCR protocols.

  2. [Respiratory symptoms after the use of a painting primer product spray].

    Science.gov (United States)

    Ebbehøj, Niels E; Bang, John

    2008-09-22

    The use of waterproofing spray has been associated with the development of respiratory symptoms, but the pathogenetic mechanisms are unclear. We describe a case of acute respiratory disease with impaired diffusion developed after the use of a painting primer product spray (stain stop). Further investigation in aerosol-toxicology is needed.

  3. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  4. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  5. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  6. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  7. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    ) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... delayed relative to that of the wild-type virus, molecular tumor analysis indicated that all the primer binding site-modified viruses induce T-cell lymphomas similar to those induced by the wild-type virus in terms of frequencies of genomic rearrangements within the T-cell receptor beta......, recombination with endogenous viruses resulting in the generation of recombinant viruses carrying a glutamine primer binding site was detected in the majority of the tumors induced by the SL3-3 Lys3 mutant as well as in two tumors induced by wild-type SL3-3 and the SL3-3 Arg1,2 mutant....

  8. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  9. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  10. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  11. Ronda: nuevas noticias sobre el primer y antiguo puente del Tajo

    Directory of Open Access Journals (Sweden)

    Inocencio Cadiñanos Bardeci

    2014-01-01

    Full Text Available Sobre este bello y famoso puente ya se ha escrito su proceso de construcción. Sin embargo, al hablar del primer intento de levantarlo, se exponen unas muy breves noticias que pretendo completar con otras halladas recientemente...

  12. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  13. Comparison of primers for the detection of pathogenic Escherichia coli using real-time PCR.

    Science.gov (United States)

    Barak, J D; Sananikone, K; Delwiche, M J

    2005-01-01

    To evaluate PCR primers for the detection of pathogenic Escherichia coli in a real-time PCR assay and determine their utility in produce irrigation water testing. Three previously published PCR primer sets and one set designed for this study were tested for their ability to produce amplification products for several pathogenic E. coli serotypes from whole cells as template. Two of the previously published primer sets were chosen for real-time PCR detection limit determination. The coneaeA and PEH detection limit of E. coli O157:H7 was 10(0) and 10(1) CFU rxn(-1) in sterile water respectively. To detect E. coli O157:H7 in sprout irrigation water, the water required dilution due to PCR inhibitors. The detection limit of the coneaeA and PEH was 10(1) and between 10(2) and 10(3) CFU rxn(-1) in diluted sprout irrigation water respectively. The primer set coneaeA was able to produce an amplification product from each E. coli serotype, except O128:H7 and most sensitive for real-time PCR detection of pathogenic E. coli in diluted sprout irrigation water. The necessity of a dissociation analysis to distinguish positive samples from those with fluorescence of random dsDNA generation for real-time PCR in a complex background was established.

  14. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    Science.gov (United States)

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  15. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  16. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  17. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2017-06-01

    Full Text Available Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata that are processed into one of the most valued traditional Chinese medicines (TCM. The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  18. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  19. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  20. Initiation of HIV-1 reverse transcription is regulated by a primer activation signal

    NARCIS (Netherlands)

    Beerens, N.; Groot, F.; Berkhout, B.

    2001-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome appears to be strictly regulated at the level of initiation. The primer binding site (PBS), at which the tRNA(3)(Lys) molecule anneals and reverse transcription is initiated, is present in a highly structured region