WorldWideScience

Sample records for baba2 primer aislamiento

  1. Prevalence of vacA, cagA and babA2 genes in Cuban Helicobacter pylori isolates

    Institute of Scientific and Technical Information of China (English)

    Lino E Torres; Karelia Melián; Arlenis Moreno; Jordis Alonso; Carlos A Sabatier; Mayrín Hernández; Ludisleydis Bermúdez; Boris L Rodríguez

    2009-01-01

    AIM: To investigate the prevalence of vacuolating cytotoxin ( vacA), cytotoxin associated gene A ( cagA) and blood adhesion binding antigen ( babA2) genotypes of Helicobacter pylori ( H pylori) isolates from Cuban dyspeptic patients. METHODS: DNA was extracted from H pylori-positive cultures taken from 130 dyspeptic patients. Genotyping was performed by PCR, using specific primers for vacA ( s1, s2, m1, m2), cagA and babA2 genes. Endoscopic observations and histological examinations were used to determine patient pathologies. RESULTS: vacA alleles s1, s2, m1 and m2 were detected in 96 (73.8%), 34 (26.2%), 75 (57.7%) and 52 isolates (40%), respectively, while the cagA gene was detected in 95 isolates (73.2%). One hundred and seven isolates (82.3%) were babA2-positive. A significant correlation was observed between vacAs1m1 and cagA and between vacAs1m1 and babA2 genotypes ( P < 0.001 and P < 0.05, respectively) and between babA2 genotype and cagA status ( P < 0.05); but, no correlation was observed between vacAs1 and babA2 genotypes. Eighty five (65.4%) and 73 (56.2%) strains were type 1 ( vacAs1- cagA-positive) and "triplepositive" ( vacAs1- cagA- babA2-positive), respectively, and their presence was significantly associated with duodenal ulcer ( P < 0.01 and P < 0.001, respectively). CONCLUSION: The distribution of the main virulence factors in the Cuban strains in this study resembled that of the Western-type strains, and the more virulent H pylori isolates were significantly associated with duodenal ulcer, ulcer disease being the worst pathology observed in the group studied.

  2. Clinical relevance of Helicobacter pylori babA2 and babA2/B in Costa Rica and Japan

    Institute of Scientific and Technical Information of China (English)

    Sergio; A; Con; Hiroaki; Takeuchi; Mitsuaki; Nishioka; Norihito; Morimoto; Tetsuro; Sugiura; Nobufumi; Yasuda; Reinaldo; Con-Wong

    2010-01-01

    AIM:To evaluate the prevalence of Helicobacter pylori(H.pylori ) babA2 ,babB and a recombinant gene between babA2 and babB(babA2/B ),and their role in the development of atrophic gastritis in Costa Rican and Japanese clinical isolates.METHODS:A total of 95 continuous H.pylori-positive Costa Rican(41 males and 54 females;mean age,50.65 years;SD,± 13.04 years) and 95 continuous H.pylori-positive Japanese(50 males and 45 females;mean age,63.43;SD,± 13.21 years) patients underwent upper endoscopy from October 2...

  3. Primer informe sobre el aislamiento de Helicobacter pylori asociado a enfermedades digestivas en Ciudad de La Habana

    Directory of Open Access Journals (Sweden)

    Beatriz Gutiérrez

    2001-03-01

    Full Text Available La infección por Helicobacter pylori desempeña un papel fundamental en el desarrollo de diversas enfermedades digestivas. Actualmente se acepta que este microorganismo está relacionado con la gastritis crónica activa, la úlcera péptica (tanto gástrica como duodenal, el adenocarcinoma gástrico y el linfoma gástrico de células B del tejido linfoide asociado a mucosa (Linfoma MALT. Se estudiaron 121 pacientes, 53 con diagnóstico endoscópico de gastritis, 21 con úlcera péptica, 20 úlceras duodenales, 3 adenocarcinomas del antro gástrico, 5 neoplasias de esófago y 19 panendoscopias normales (dispépticos. A todos los pacientes se les practicó una gastroscopia y se tomaron cuatro fragmentos de biopsias distribuidas entre las regiones de antro y cuerpo gástrico. Para el diagnóstico y aislamiento de H. pylori se empleó la prueba de la ureasa rápida, la tinción de gram, y el cultivo en agar cerebro corazón con suero de caballo 10%, extracto de levadura 0,25% más suplemento Dent (OXOID SR 147 durante 7 días a 37 ºC en jarra en atmósfera de microaerofilia. También se evaluó la presencia de catalasa y oxidasa. Se observó una prevalencia de la infección del 79,2% en la gastritis crónica, un 100% en los pacientes con úlcera duodenal y un 90,4% en relación con la úlcera gástrica, lo que coincide con lo reportado por otros autores. En el 100% de los casos de adenocarcinoma gástrico y en el 60% de los casos de neoplasias de esófago se aisló el microorganismo. El aislamiento de H. pylori en el 78,9% de endoscopias realizadas e informadas como normales es una alerta de la prevalencia en pacientes dispépticos.

  4. Cloning and expression and immunogenicity of Helicobacter pylori BabA2 gene

    Institute of Scientific and Technical Information of China (English)

    Yang Bai; Ya-Li Zhang; Ye Chen; Jian-Feng Jin; Zhao-Shan Zhang; Dian-Yuan Zhou

    2004-01-01

    AIM: To construct a recombinant strain which expresses BabA of Helicobacter pylori(H pylori) and to study the immunogenicity of BabA.METHODS: BabA2 DNA was amplified by PCR and inserted into the prokaryotie expression vector pET-22b (+) and expressed in the BL21 (DE3) E. coli strain. Furthermore,BabA immunogenicity was studied by animal test.RESULTS: DNA sequence analysis showed the sequence of BabA2 DNA was the same as the one published by GenBank.The BabA recombinant protein accounted for 34.8% of the total bacterial protein. The serum from H pylori infected patients and Balb/c miced immunized with BabA itself could recognize rBabA.CONCLUSION: BabA recombinant protein may be an potential vaccine for control and treatment of H pylori infection.

  5. Reporte de primer caso humano de aislamiento y tipificación de Brucella abortus RB 51: first report in Chile Isolation and identification of Brucella abortus RB 51 in human

    Directory of Open Access Journals (Sweden)

    M. Villarroel

    2000-01-01

    Full Text Available En el Laboratorio de Microbiología del Hospital Base de Osorno, se aisló una cepa de Brucella sp, que posteriormente se tipificó en el Laboratorio Regional de Diagnósticos del Servicio Agrícola y Ganadero, SAG Osorno. Esta cepa fue aislada de un hemocultivo realizado a un paciente con sintomatología clínica compatible con Brucelosis. El resultado de la tipificación fue Brucella abortus RB 51, cepa vaccinal que se presumía apatógena para el hombre. Este es el primer reporte a nivel mundial de un aislamiento de B. abortus RB 51 en humanosA Brucella strain was isolated from a haemoculture of a clinically ill veterinarian practitioner, at the Laboratory of Microbiology, Hospital Base Osorno, Chile. This strain was identified as Brucella abortus RB 51 at Laboratorio de Diagnósticos from the Servicio Agrícola y Ganadero (SAG, Osorno, based mainly in the following characteristics: resistence to Rifampicin, aerobic growth and the production of only rough colonies. The strain RB 51 was confirmed by PCR analysis

  6. Prevalence of the Helicobacter pylori babA2 gene and correlation with the degree of gastritis in infected Slovenian children.

    Science.gov (United States)

    Homan, Matjaž; Šterbenc, Anja; Kocjan, Boštjan J; Luzar, Boštjan; Zidar, Nina; Orel, Rok; Poljak, Mario

    2014-10-01

    The aims of our study were to determine the prevalence of the babA2 gene within Helicobacter pylori strains circulating in the Slovenian pediatric population, to further clarify its significance in causing inflammation of gastric mucosa in children and to verify whether cagA, vacA, iceA and babA genes work independently or synergistically in causing gastritis. A total of 163 H. pylori isolates obtained from the same number of children were tested for the presence of cagA, vacA and iceA genes using previously established methods, while the babA2 gene was determined using novel polymerase chain reaction assay targeting a 139-bp fragment of the central region of babA2. The babA2 gene was detected in 47.9% of H. pylori samples. The presence of the babA2 gene was strongly associated with cagA, vacA s1 and vacA m1 genotype. The babA2 status correlated positively with bacterial density score, activity of inflammation and chronic inflammation of gastric mucosa. No significant correlation was found between the babA2 status and the presence of atrophy or intestinal metaplasia. In addition, the activity of gastric inflammation and density score were significantly associated with the coexpression of the cagA, vacA s1, vacA m1 and babA2 genes. The study, which included the largest number of pediatric H. pylori samples to date, confirmed that babA2 gene plays an important role in the pathogenesis of H. pylori gastritis in children. Furthermore, our results suggest that babA2, cagA and vacA s1 and m1 gene products may work synergistically in worsening the inflammation of gastric mucosa.

  7. Aislamiento acústico

    Directory of Open Access Journals (Sweden)

    Tobío, J. M.

    1970-07-01

    Full Text Available This is a very specific subject in the field of architectural acoustics, namely, insulation'. Emphasis is placed on the theoretical foundations of this phenomenon, and the most simple formula are developed to calculate easily the transmission losses of a material or the constructional insulating arrangements. The practical aspect of insulation can be considered by means of several graphs and charts, without the use of mathematics, and utilising common materials, that will not substantially increase the cost of the project. Finally this papers offers a critical discussion of building codes, and their reference to the acoustical insulation of dwellings, and data is included on the new regulations of the Madrid Municipality.Se trata un tema muy concreto de la Acústica Arquitectónica, el aislamiento, haciendo hincapié en los fundamentos teóricos del fenómeno y estableciendo las fórmulas más sencillas que permiten calcular fácilmente las pérdidas de transmisión de un material o disposición constructiva aislante. Varias gráficas y abacos permiten abordar, sin ningún tratamiento matemático, el problema práctico del aislamiento, aprovechando los materiales comunes y sin ocasionar gastos que graven sustancialmente el importe del proyecto. Por último, se hace un estudio crítico de las normas y su incidencia en los problemas del aislamiento de viviendas, incluyendo datos referentes a la nueva Ordenanza del Ayuntamiento de Madrid.

  8. Hombre, calor y aislamiento

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1961-11-01

    Full Text Available Con los nuevos tipos estructurales y con los adelantos de las ciencias biológicas en lo que se refiere a los procesos orgánicos, mis ideas sobre aislamiento, y las de casi todos los demás arquitectos y constructores, han sufrido una evolución interesantísima en los últimos veinticinco años. Y me complace subrayar que los que, como yo, estudiamos el decorado humano, podemos hacer mucho en beneficio de nuestros clientes. No hace aún mucho tiempo toda la protección de una casa contra el peligro de transferencia térmica se confiaba exclusivamente a muros y cubiertas no aislantes. Los propietarios se limitaban a culpar al tiempo de su falta de confort. Pero esta falta de comodidad en cuanto a calefacción no era la única consecuencia; tras ella aparecían daños de efectos duraderos y patológicos.

  9. Helicobacter pylori vacA i region polymorphism but not babA2 status associated to gastric cancer risk in northwestern Iran.

    Science.gov (United States)

    Mottaghi, Batool; Safaralizadeh, Reza; Bonyadi, Morteza; Latifi-Navid, Saeid; Somi, Mohammad Hossein

    2016-02-01

    Helicobacter pylori-specific genotypes have been strongly associated with an increased risk of gastric cancer (GC). The aim of the present work was to study the associations of H. pylori virulence factors, vacA i region polymorphisms and babA2 status with GC risk in Azerbaijan patients. The DNA extracted from gastric biopsy specimens was used to access the babA2 and vacA genotypes. Overall, babA2 was present in 85.39 % (76/89) of H. pylori strains: 19 out of 24 (79.16 %) strains from GC, 16 out of 17 (94.14 %) strains from peptic ulcer disease (PUD) and 41 out of 48 (85.14 %) strains from chronic gastritis. No significant association was found between babA2 genotype and clinical outcomes (P > 0.05). i1 vacA polymorphism was detected in 46/89 (51.68 %) strains: in 21/24 (87.5 %), 6/17 (35.29 %) and 19/48 (39.58 %) patients with GC, PUD and chronic gastritis, respectively. i2 allele was detected in 43 (48.31 %) out of all 89 strains examined: 3 (14.28 %) of 24 strains from GC, 11 (64.71 %) of 17 from PUD, and 29 (60.42 %) of 48 strains from chronic gastritis. In this study, multiple linear regression analysis confirmed the strong association of i1 allele with GC (partial regression correlation 0.455 ± 0.101; P = 0). Results of multiple logistic regression analysis showed that vacA i1 genotype was significantly associated with GC compared with a control group (gastritis) (odds ratio 13.142, 95 % CI 3.116-55.430; P = 0). Findings from the measurement of H. pylori babA2 and vacA genotypes indicate a strong correlation between the vacA i1 allele and GC risk in the Azerbaijan area of Iran.

  10. Primer reporte de aislamiento de Staphylococcus schleiferi subespecie coagulans en perros con pioderma y otitis externa en Chile First report of isolation of Staphylococcus schleiferi subspecies coagulans from dogs with pyoderma and external otitis in Chile

    Directory of Open Access Journals (Sweden)

    L Muñoz

    2012-01-01

    Full Text Available Staphylococcus schleiferi subesp. coagulans fue identificado y descrito por primera vez por Igimi y col (1990 en perros con otitis. El objetivo de este reporte fue determinar la frecuencia de aislamiento de S. schleiferi subesp. coagulans en muestras de perros con pioderma y/u otitis externa en Chile y establecer los perfiles de resistencia frente a antimicrobianos de uso habitual y caracterizar molecularmente la resistencia a quinolonas. Se obtuvieron muestras de 237 caninos adultos diagnosticados con pioderma y/u otitis externa, en el Hospital Veterinario de la Universidad de Chile. La identificación de Staphylococcus schleiferi subesp. coagulans se realizó con BBL™ Crystal GP. La concentración mínima inhibitoria se determinó mediante el método de dilución en agar. El panel de antimicrobianos utilizado fue oxacilina, amoxicilina, cefradina, mupirocina, clindamicina, enrofloxacino, doxiciclina, tetraciclina, kanamicina y sulfametoxazol / trimetoprim. De 237 muestras analizadas, 135 fueron aisladas de pioderma y 102 de otitis. Staphylococcus spp. se identificó en 117 y 52 de las muestras respectivamente. S. schleiferi subesp. coagulans se identificó en 8 cepas aisladas desde pioderma (6,8% y en 11 cepas de otitis (21,2%. Todas las cepas de S. schleiferi subesp. coagulans de pioderma y el 54,5% de otitis resultaron sensibles a todos los antimicrobianos. La susceptibilidad fue de un 90,9% mupirocina, enrofloxacino y sulfametoxazol/trimetoprim; 81,8% a amoxicilina y kanamicina y el 72,7% a clindamicina. Solo una cepa aislada de otitis presentó multirresistencia. La cepa de Staphylococcus schleiferi subesp. coagulans que evidenció resistencia fenotípica a quinolonas presentó mutación en los genes gyrA y grlA.Staphylococcus schleiferi subsp. coagulans was identified and described for the first time in 1990 by Igimi et al (1990 in dogs with otitis. The objective of this report was to determine the frequency of isolation of S

  11. Inversores bidireccionales con aislamiento en alta frecuencia para aplicaciones de energías renovables

    OpenAIRE

    Beristáin Jiménez, José Antonio

    2005-01-01

    En esta tesis se realiza el análisis y la síntesis de inversores bidireccionales con aislamiento en alta frecuencia. Entre las aplicaciones que se contemplan podemos destacar: sistemas de alimentación fotovoltaicos, sistemas de alimentación utilizando celdas de combustible, mini-generadores eólicos y compensación armónica. Hay dos grandes requerimientos para varias de estas aplicaciones. En primer lugar, es necesario proporcionar aislamiento eléctrico entre la fuente de corriente continua y l...

  12. de diversas fuentes de aislamiento

    Directory of Open Access Journals (Sweden)

    María Guadalupe Morales Meza

    2006-01-01

    Full Text Available En este estudio se determinó la resistencia antimicrobiana de cepas de Staphylococcus aureus obtenidas de diversas fuentes de aislamiento para comparar los patrones de resistencia alcanzados de acuerdo con su origen y así establecer si la resistencia a los antibióticos está asociada al origen de aislamiento. Para esto se aislaron 187 cepas a partir de 483 muestras que incluyeron alimentos, ambiente, portadores sanos y portadores enfermos; se realizó la identificación de las cepas por métodos bioquímicos y aquéllas confirmadas como S.aureus se conservaron a –20°C. Con las cepas obtenidas se realizaron pruebas de susceptibilidad antimicrobiana por el método de Bauer-Kirby a los antibióticos comúnmente utilizados para Gram (+. Después de interpretar la prueba se realizó un análisis estadístico de los resultados mediante la prueba c2 de Pearson. La frecuencia de aislamiento fue de 38.7% de S.aureus de todas las muestras manejadas, lo que confirma el hecho de que esta bacteria se encuentra ampliamente distribuida. De los antibióticos probados, en la dicloxacilina, tetraciclina y eritromicina, según el análisis estadístico, se encontró que la resistencia es dependiente del origen de aislamiento. En el caso de la dicloxacilina, este es un antibiótico muy usado en animales, lo que selecciona cepas resistentes que se mantienen en productos de origen animal como los cárnicos y lácteos. El origen de las cepas resistentes a la tetraciclina y eritromicina se considera humano, ya que éstas se encontraron en los alimentos que tienen mucha manipulación durante su proceso y comercialización (jamón, tocino. Para otros antibióticos como lo fueron la penicilina, pefloxacina, cefuroxima, gentamicina, cefotaxima, ampicilina, ceftazidima y cefalotina se encontró que la resistencia es independiente del origen, lo que implica que los genes de resistencia en las cepas de S. aureus para estos antibióticos están ampliamente distribuidos

  13. Association Between Helicobacter pylori cagA, babA2 Virulence Factors and Gastric Mucosal Interleukin-33 mRNA Expression and Clinical Outcomes in Dyspeptic Patients.

    Science.gov (United States)

    Shahi, Heshmat; Reiisi, Somayeh; Bahreini, Rasol; Bagheri, Nader; Salimzadeh, Loghman; Shirzad, Hedayatollah

    2015-01-01

    Helicobacter pylori (H. pylori) infection has been reported in more than half of the world human population. It is associated with gastric inflammation and noticeable infiltration of the immune cells to the stomach mucosa by several cytokines secretion. IL-1β, IL-18 have been shown to contribute to H. pylori induced gastritis, but the details of inflammation and association of virulence factors remain unclear. IL-1 cytokine family has a new additional cytokine, Interleukin-33 (IL-33), which is contemplated to have an important role for host defense against microorganisms. H. pylori virulence factors important in gastritis risk are the cag pathogenicity island (cag-PAI) and babA. This study evaluated IL-33 mucosal mRNA expression levels in infected and uninfected patients and its relationship with bacterial virulence factors cagA, babA2 and type of gastritis. Total RNA was extracted from gastric biopsies of 79 H. pylori-infected patients and 51 H. pylori-negative patients. Mucosal IL-33 mRNA expression levels in gastric biopsies were assessed using real-time PCR. Existence of virulence factors were detected by PCR. IL-33 mRNA expression was significantly higher in biopsies of H. pylori-infected patients compared to H. pylori-uninfected patients (P<0.0001). Also there was a direct relationship between virulence factor bab-A2 and enhancement in IL-33 mRNA expression. Furthermore, IL-33 mRNA expression level was significantly lower in chronic gastritis patients compared with patients with active gastritis (P<0.001). IL-33 may play a crucial role in the inflammatory response and induction of the chronic gastritis and severity of inflammatory changes in the gastric mucosa.

  14. Reporte histórico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de cólera en el Perú ‑ 1991 Historical report: first isolation of Vibrio cholera serogroup O1 biovar El Tor serovar Inaba during the cholerae epidemic in Perú ‑ 1991

    Directory of Open Access Journals (Sweden)

    Nora Bravo Cruz

    2011-03-01

    Full Text Available Hace 20 años apareció una enfermedad diarreica nueva en el Perú y el Laboratorio de Referencia de Enteropatógenos del Instituto Nacional de Salud, cumplió una labor destacada en el aislamiento e identificación rápida y oportuna del Vibrio cholerae. La enfermedad del cólera no se había presentado anteriormente, pero en la última semana de enero de 1991 se detectó un brote epidémico de diarrea aguda con deshidratación intensa y algunos casos de fallecidos. La epidemia afectó, al comienzo, varias localidades del litoral peruano. Equipos de trabajo de la Oficina General de Epidemiología y de los laboratorios del Instituto Nacional de Salud obtuvieron muestras fecales de pacientes con diarrea aguda procedentes de las ciudades de Chancay, Chimbote, Piura y algunos hospitales de Lima. Las muestras colectadas en el medio de transporte de Cary y Blair fueron procesadas en el Laboratorio Nacional de Referencia de Enteropatógenos (LANARE del Instituto Nacional de Salud. De todas las muestras se aisló e identificó Vibrio cholerae serogrupo O1 biovar El Tor serovar Inaba que mostró ser sensible a la tetraciclina y a otros antibióticos. Esta investigación confirmó el primer brote epidémico de cólera en el Perú.20 years ago, a new diarrheal disease was introduced in Peru and the Enteropathogens Reference Laboratory of the Instituto Nacional de Salud had an outstanding role in the isolation and rapid and timely identification of Vibrio cholerae. Cholera had not been seen before, but during the last week of January 1991 an outbreak of acute diarrhea was detected, presenting intense dehydration and some deaths. The epidemic affected, in the beginning, many locations of the peruvian coast. Some working teams of the General Office of Epidemiology and of the Instituto Nacional de Salud obtained fecal samples from patients with acute diarrhea coming from the cities of Chancay, Chimbote, Piura and some hospitals in Lima. The collected samples

  15. Reporte histórico: Primer Aislamiento de Vibrio cholera serogrupo O1 biovar El Tor serovar Inaba durante la epidemia de cólera en el Perú ‑ 1991 Historical report: first isolation of Vibrio cholera serogroup O1 biovar El Tor serovar Inaba during the cholerae epidemic in Perú ‑ 1991

    OpenAIRE

    Nora Bravo Cruz; Alfredo Guillén

    2011-01-01

    Hace 20 años apareció una enfermedad diarreica nueva en el Perú y el Laboratorio de Referencia de Enteropatógenos del Instituto Nacional de Salud, cumplió una labor destacada en el aislamiento e identificación rápida y oportuna del Vibrio cholerae. La enfermedad del cólera no se había presentado anteriormente, pero en la última semana de enero de 1991 se detectó un brote epidémico de diarrea aguda con deshidratación intensa y algunos casos de fallecidos. La epidemia afectó, al comienzo, varia...

  16. AISLAMIENTO Y EVALUACIÓN IN VITRO DE ANTAGONISTAS DE Botrytis cinerea EN MORA

    Directory of Open Access Journals (Sweden)

    Jos\\u00E9 Alonso Calvo-Araya

    2012-01-01

    Full Text Available El objetivo de este estudio fue determinar la capacidad antagónica de hongos a Botrytis cinerea en el cultivo de la mora en Costa Rica. Durante el primer semestre del 2009 se aislaron 35 hongos filamentosos habitantes del carpoplano de frutos de mora, de los cuales seis cepas de Trichoderma fueron seleccionadas para su evaluación in vitro contra B. cinerea por medio de la técnica de cultivos duales. En la evaluación se determinó la competencia por sustrato y el efecto antibiótico. Para evaluar la competencia por sustrato se utilizó la escala de Bell y en el caso del efecto antibiótico se calculó el porcentaje de inhibición del crecimiento. Todas las cepas evaluadas compitieron eficientemente por sustrato contra B. cinerea, destacaron los aislamientos Lu13 y Lu15, que alcanzaron el grado I en la escala usada, donde el antagonista sobrepasó y creció sobre el patógeno cubriendo el 100% del medio de cultivo. Los restantes aislamientos de Trichoderma alcanzaron el grado II de antagonismo. En cuanto al efecto antibiótico, todos los aislamientos inhibieron el crecimiento micelial de B. cinerea, cuatro de ellos alcanzaron un valor mayor al 80% al ser evaluados en condiciones in vitro.

  17. Metalo-ß-lactamasas en aislamientos clínicos de pseudomonas aeruginosa en Lima, Perú

    Directory of Open Access Journals (Sweden)

    Edgar Gonzales-Escalante

    2013-06-01

    Full Text Available Con el objetivo de detectar y caracterizar molecularmente las metalo-ß-lactamasas (MßL en aislamientos clínicos de Pseudomonas aeruginosa, se realizó un estudio trasversal en seis hospitales de referencia de Lima (Perú en agosto de 2011. Se evaluó 51 aislamientos de P. aeruginosa, resistentes a ceftazidima y con sensibilidad reducida a carbapenémicos. El ensayo fenotípico se realizó con el método de aproximación de discos con sustratos (ceftazidima, imipenem y meropenem y con ácido etilendiaminotetraacético (EDTA. La detección de genes MßL se realizó mediante la técnica de reacción en cadena de polimerasa multiplex. A través del método fenotípico se detectaron MßL en el 15,7% de los aislamientos, en todos ellos la detección de genes mostró la presencia del gen blaIMP. La descripción del primer reporte de MßL en aislamientos de P. aeruginosa en el Perú debería alertar a los equipos de vigilancia epidemiológica intrahospitalaria para promover su control y prevenir su diseminación.

  18. Contención sin aislamiento

    Directory of Open Access Journals (Sweden)

    Mario Sánchez Gumiel

    2013-02-01

    Full Text Available En febrero de 2012 se cumplieron cuarenta años de la visita de Richard Nixon a China y, por tanto, de la reanudación de las relaciones sino-americanas que habían sido interrumpidas en 1949. Desde entonces, Estados Unidos y China han mantenido una recíproca política de contención y aislamiento, conscientes de sus diferencias, pero sabedores también de la necesidad de un entendimiento mutuo. Como consecuencia dicha política de contención y aislamiento, el océano Pacífico está transformándose, como el Atlántico después de la Segunda Guerra Mundial, en el nuevo escenario geopolítico del siglo XXI.Palabras Clave: Estados Unidos, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Contención, Aislamiento, Corea, Vietnam, Tian’anmen, URSS, Comunismo, Capitalismo.___________________Abstract:On February 2012 took place the fourtieth anniversary of President Nixon’s visiting to China and, as a consequence, of the resumption of the Sino-American relations which had been interrupted in 1949. Since then, the United States and China have experienced a reciprocal policy of containment without isolation, both being aware of their mutual differences but knowing of the necessity of mutual understanding as well. As a result, the Pacific ocean is making changes, just as the Atlantic after the Second World War, in order to become the new geopolitical place of the Twenty First century.Keywords: United States, China, Nixon, Mao, Deng Xiaoping, Taiwán, Chiang Kai-Shek, Containment, Isolation, Korea, Vietnam, Tian’anmen, USSR, Communism, Capitalism.

  19. Consideraciones sobre aislamientos térmicos

    Directory of Open Access Journals (Sweden)

    García Arroyo, A.

    1966-06-01

    Full Text Available The yearly change in ambient temperature, and also the daily variations, become notably evident inside buildings. In extreme cases they cause considerable discomfort. This can be avoided by two means: insulation and heating or air conditioning. As each of these factors covers a wide range of possibilities, a detailed study of the physical factors, such as location, cost, climate, etc., makes it possible to find the most suitable materials, with the best overall thermal transmission factor (Ue, and the cheapest thickness (te of the insulating material.La variación anual de la temperatura externa, así como la diaria, se manifiesta de una manera notable en el interior de los edificios creando, en condiciones extremas, un inconfort evitable mediante la combinación apropiada de dos elementos: aislamientos y sistemas de calefacción o aire acondicionado. Dada la extensa gama de variación de cada uno de estos factores, haciendo un estudio detallado de sus propiedades físicas, situación, costes y clima de la región, encontramos el material más idóneo a emplear, coeficiente global de transmisión térmica (Ue del aislamiento y espesor (te más económico del material aislante.

  20. 慢性胃炎和消化性溃疡中幽门螺杆菌babA2和cagA及vacA基因型分析%Analysis of babA2,cagA and vacA genotypes of Helicobacter pylori in chronic gastritis and peptic ulcer

    Institute of Scientific and Technical Information of China (English)

    茅海燕; 方平楚; 叶少菁; 尤建飞; 朱永良; 俞建国

    2003-01-01

    目的:研究慢性胃炎和消化性溃疡中幽门螺杆菌(Hp)babA2、cagA、vacA基因型的分布,探讨Hp babA2、cagA、vacA基因型与慢性胃炎和消化性溃疡的关系.方法:用聚合酶链反应测定58株从浙江省慢性胃炎和消化性溃疡患者中分离的Hp babA2基因、cagA基因和vacA基因亚型.结果:58株Hp中babA2、cagA、vacA s1a、vacA m1、vacA m2基因的阳性率分别为87.9%、100%、93.1%、1.7%、65.5%.慢性胃炎和消化性溃疡患者感染的Hp babA2、vacA s1a、vacA m2基因阳性率差异无显著性(P>0.05).结论:从浙江地区慢性胃炎和消化性溃疡患者中分离的Hp babA2、cagA、vacA基因型均以babA2阳性、cagA阳性和vacA s1a/m2型为主,未发现Hp babA2、cagA和vacA基因型与慢性胃炎和消化性溃疡的关系.

  1. ESCUELAS-ISLA: UN AISLAMIENTO INSTITUCIONAL

    Directory of Open Access Journals (Sweden)

    Claudio Vergara Reyes

    2012-01-01

    Full Text Available Este trabajo trata acerca de un tipo de escuela en la realidad educativa chilena, denominada "escuela-isla", caracterizada por su aislamiento institucional del entorno social, económico, político, religioso y cultural. El concepto nace de una serie de reflexiones bajo el marco formativo de las prácticas pedagógicas tempranas, a partir de un conjunto de experiencias que configuran al centro de enseñanza y que resultan clave para la comprensión de la naturaleza del término. El documento hace una caracterización de este tipo de escuela, reconociendo cualidades que no son propias de una institución social. Asimismo, se propone y justifica la necesidad de un tipo de "alianza simbiótica" entre la organización educativa y el resto de organizaciones de la comunidad (red de enlace para complementar y potenciar su función educativa (formativa. Por último, se destaca la importancia de la interacción de la escuela con otras instituciones de la sociedad, y que tales vínculos constituyen una estrategia educativa para el desarrollo social y comunitario.

  2. Sensibilidad al fluconazol de aislamientos de Trichophyton rubrum

    Directory of Open Access Journals (Sweden)

    Norma T Gross-Martínez

    2014-03-01

    Full Text Available Antecedentes: Trichophyton rubrum es el dermatofito más frecuentemente aislado a nivel mundial y afecta principalmente: piel glabra, uñas de las manos y de los pies. El fluconazol es utilizado con frecuencia para el tratamiento de las onicomicosis en nuestra población, por lo que el objetivo de la presente investigación fue estudiar la sensibilidad a este antifúngico, de aislamientos costarricenses de T. rubrum. Métodos: se investigó la sensibilidad in vitro al fluconazol de 80 aislamientos de T. rubrum, obtenidos de muestras de piel y sus anexos. El método utilizado fue el de microdilución M-38A, descrito por el “National Committee for Clinical Laboratory Standards”. Las diluciones finales del fluconazol fueron de 0,25 a 128 μg/ml. Resultados: la mayoría de los aislamientos fueron obtenidos de uñas de los pies (68,75%. El 86,25% de los aislamientos analizados presentaron una concentración mínima inhibitoria entre 0,25-8 μg/ml, el 8,75% entre 16-32 μg/ml y un 5% > 64 μg/ml. De estos aislamientos resistentes, dos fueron de uñas de los pies y dos de plantas de pie. Conclusión: debido a que la mayoría de los aislamientos de T. rubrum demostraron ser sensibles al fluconazol, solo se recomienda realizar la prueba de sensibilidad a este antifúngico en casos de falla terapéutica, especialmente en pacientes con onicomicosis en la cual el tratamiento es prolongado.

  3. Helicobacter pylori isolated from Iranian drinking water: vacA, cagA, iceA, oipA and babA2 genotype status and antimicrobial resistance properties.

    Science.gov (United States)

    Ranjbar, Reza; Khamesipour, Faham; Jonaidi-Jafari, Nematollah; Rahimi, Ebrahim

    2016-05-01

    Despite the clinical importance of Helicobacter pylori in human gastric disorders, its exact route of transmission is still uncertain. Based on the contentious hypothesis and findings of previous investigations, water may play an important role in the transmission of H. pylori to humans. This study was carried out to investigate the vacA, cagA, oipA, iceA and babA2 genotype status and antimicrobial resistance properties of H. pylori strains isolated from the drinking water samples of four major provinces in Iran. A total of 400 drinking water samples were cultured and tested. H. pylori-positive strains were analyzed for the presence of various genotypes and antimicrobial resistance. Twelve of 400 (3%) water samples were positive for H. pylori. Samples from Isfahan province had the highest, while those from Shiraz had the lowest prevalence of H. pylori. The seasonal distribution was also determined, with the highest prevalence of bacteria in the summer season (7.36%). H. pylori strains harbored the highest levels of resistance against ampicillin (100%), erythromycin (75%), clarithromycin (75%), and trimethoprim (58.3%). The most commonly detected genotypes were vacAs1a (83.3%), vacAm1a (66.6%), vacAs2 (50%) and cagA (50%). The presence of similar genotypes in the H. pylori strains of drinking water and those of human clinical samples suggest that contaminated water maybe the sources of bacteria. Spiramycin and furazolidone are suggested for the treatment of cases of H. pylori infection.

  4. RATMAC PRIMER

    Energy Technology Data Exchange (ETDEWEB)

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine

    1980-10-01

    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  5. Pathogenic and Genetic Diversity among Iranian Isolates of Macrophomina phaseolina Diversidad Patogénica y Genética entre Aislamientos Iraníes de Macrophomina phaseolina

    Directory of Open Access Journals (Sweden)

    Siavosh Rayatpanah

    2012-03-01

    Full Text Available Charcoal rot, caused by Macrophomina phaseolina (Tassi Goid., is an economically important disease of oilseed plants in Northern Iran. Seventy isolates of M. phaseolina were obtained from different hosts, including soybean (Glycine max L., and sunflower (Helianthus annuus L. in the northern oilseed planting regions of Iran. RAPD-PCR amplification profiles, by using of six random OPA primers (kit A showed polymorphisms among the isolates. The primer OPA-13 (5'_ CAGCACCCAC_3' amplified the genomic DNA of all isolates of M.phaseolina producing 4-12 bands of sizes between 0.25 and 2.3 kb. Unweighted pair-group method with arithmetic mean (UPGMA analysis classified the isolates into the nine major groups with 64% similarity. Pathogenicity of isolates was evaluated at seedling stage of soybean, sunflower, and maize (Zea mays L. plants under in vitro conditions. None of the isolates were pathogenic on corn, while all of the isolates infected soybean and sunflower seedlings. Isolates were more virulent on soybean than sunflower. The disease index on sunflower and soybean varied between 19-24 and 27-30 respectively. These results indicated a significant pathogenic and genetic variability within the Iranian isolates of M. phaseolina. Cultivation with crop rotation was probably tended to induce less diversity of the pathogen isolates.Pudrición carbonosa, causada por Macrophomina phaseolina (Tassi Goid., es una enfermedad de importancia económica de las plantas de semillas oleaginosas en el norte de Irán. Setenta aislamientos de M. phaseolina se obtuvieron de diferentes hospederos, incluyendo soya (Glycine max L. y girasol (Helianthus annuus L. en las regiones de plantación de semillas oleaginosas del norte de Irán. Perfiles RAPD-PCR de amplificación, utilizando primers aleatorios de seis OPA (kit A mostraron polimorfismos entre los aislamientos. El primer OPA-13 (5'-CAGCACCCAC-3' amplificó el ADN genómico de todos los aislamientos de M. phaseolina

  6. Primer aislamiento de Clostridium tetani a partir de suelos de la Meseta Central de Costa Rica

    OpenAIRE

    Rodríguez, Evelyn; Gamboa, María del Mar; Fernández, Bernal

    2016-01-01

    Clínical evidence has long pointed to the existence of Clostridium tetani in Costa Rica. Thirty soil samples were studied for clostridia, and two yielded six strains of C. tetani, four of which proved to be toxigenic when mice were inoculated intraperitoneally with the culture supemates, These four isolates could be neutralized when their toxic supemates were admixed with tetanus antitoxin. Clínical evidence has long pointed to the existence of Clostridium tetani in Costa Rica. Thirty soil...

  7. Heterocigosis y aislamiento: el caso de las poblaciones andinas

    Directory of Open Access Journals (Sweden)

    Acreche, Noemí

    2003-01-01

    Full Text Available Poblaciones de la Puna y del Valle Calchaquí de la Provincia de Salta, de las que se conoce su condición de aislamiento reproductivo, fueron estudiadas con el objeto de analizar si existe asociación entre los niveles de heterocigosis por individuo para grupos sanguíneos eritrocitarios y STRs y el lugar de origen de sus padres. A tales efectos se considera para acda individuo la proporción de loci heterocigotos y la pertenencia de sus padres a una de las siguientes categorías: ambos no migrantes, no migrante-migrante de corta distancia/migrante de larga distancia, ambos migrantes de larga distancia, migrante de corta distancia-migrante de larga distancia. Los grupos sanguíneos presentan mayor variabilidad en el Valle que en la Puna, de acuerdo a lo esperado por el grado de aislamiento y diferencias significativas en los promedios de heterocigosisi por individuo en ambas zonas. Por el contrario, los STRs mantienen valores constantes por lo que los análisis a partir de grupos sanguíneos reflejarían mejor las condiciones de aislamiento de las diferentes poblaciones. No se observó asociación entre las categorías definidas según la procedencia de los padres y la proporción de loci heterocigotos en los individuos.

  8. Identificación por PCR-SSCP de genes de cefotaximasas en aislamientos hospitalarios de Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    José Ramón Mantilla Anaya

    2009-10-01

    Full Text Available Las cefotaximasas (CTX-M son las beta-lactamasas de espectro extendido más ampliamente diseminadas entre especies de la familia Enterobacteriaceae, y son la causa principal de resistencia en aislamientos causantes de infección intrahospitalaria. El objetivo del presente trabajo fue identificar variantes de cefotaximasas del grupo CTX-M-1 mediante el análisis del polimorfismo conformacional de cadena sencilla (SSCP de frag-mentos de restricción provenientes de los productos de la amplificación por PCR de los genes blaCTX-M. Con el procedimiento PCR-SSCP estandarizado, en este trabajo se analizaron 49 aislamientos de enterobacterias recolectados en 8 hospitales de Bogotá, D.C., adscritos a la Secretaría Distrital de Salud. Se detectaron las variantes CTX-M-12, CTX-M-15, CTX-M-12a, y CTX-M-1 y una nueva variante denominada CTX-M-60. Todas las variantes fueron detectadas tanto en aislamientos intrahospitalarios como de la comunidad, lo que indica posible movilidad de estos genes desde y hacia los centros hospitalarios. Esta publicación constituye el primer reporte en Colombia de la variante CTXM-12a y la nueva variante evolutiva CTX-M-60. Palabras clave: resistencia microbiana; cefotaximasas (CTX-M; polimorfismo conformacional de cadena sencilla (SSCP; beta-lactamasas de espectro extendido (BLEE; infección hospitalaria. Abstract CTX-M cefotaximases are the most widely distributed extended-spectrum beta-lactamases among Enterobacteriaceae and they are an important cause of microbial resistance in nosocomial infection-causing isolates. The object of this work was to identify group 1 CTX-M cefotaximase variants from PCR amplified blaCTX-M genes by single-stranded conformational polymorphism of restriction fragments (RF-SSCP. We analysed 49 Enterobacteria isolates using the RF-SSCP procedure standardised in this work; isolates were collected from eight hospitals attached to the Bogota Health Secretariat (Secretaría Distrital de Salud. CTX-M-12

  9. Fagotipificación de aislamientos de Salmonella enteritidis obtenidos de aves en México

    OpenAIRE

    Arturo Mancera Martínez; Jesús Vázquez Navarrete; Assad Heneidi Zeckua

    2004-01-01

    Estudios previos en México han demostrado la presencia de Salmonella enteritidis (SE) en la avicultura comercial. Una de las principales vías de infección del hombre con SE, es por medio del consumo de huevo crudo o subproductos no cocidos. El objetivo de este trabajo fue fagotipificar aislamientos de SE obtenidos de aves en México. Se utilizaron 73 aislamientos confirmados por serotipificación. Catorce aislamientos se identificaron como fagotipo 4, mientras que 29 pertenecieron al fagotipo 8...

  10. AISLAMIENTO Y CARACTERIZACIÓN DE CEPAS DE Gluconacetobacter diazotrophicus

    Directory of Open Access Journals (Sweden)

    Yoania Ríos Rocafull

    2016-01-01

    Full Text Available Gluconacetobacter diazotrophicus es un microorganismo endófito que presenta, dentro de sus características, mecanismos directos e indirectos de estimulación del crecimiento vegetal. A pesar de sus grandes perspectivas para constituir el principio activo de un bioproducto de uso agrícola, en Cuba no existe ninguno elaborado a partir de esta especie bacteriana. El aislamiento de cepas del microorganismo y su caracterización constituyen pasos importantes para la obtención de un biopreparado, pues permiten la selección inicial de cepas que tengan características adecuadas para la estimulación del crecimiento. En la presente investigación se purificaron 85 aislados de microorganismos endófitos, a partir de los diferentes órganos de 24 especies vegetales. Cuatro de ellos fueron identificados como Gluconacetobacter diazotrophicus, al comparar sus características con las de cepas patrones de la especie bacteriana. Los microorganismos seleccionados provenían de frutos de guayaba (Psidium guajava L. y mango (Mangifera indica L., así como de tallos de yuca (Manihot esculenta Crantz. y remolacha (Beta vulgaris L.. Se destacó la presencia del microorganismo en los dos primeros cultivos para Cuba y el aislamiento en la guayaba a nivel internacional. Las cuatro cepas mostraron diferencias en su capacidad de solubilizar fósforo, producir ácido indol acético y en su actividad antagonista frente a Fusarium moniliforme y Fusarium incarnatum. Al agruparse las cepas por sus características, se diferenciaron los microorganismos provenientes de mango y remolacha, los que se consideran promisorios para realizar estudios en condiciones in vivo del efecto de su interacción con otros cultivos.

  11. Aspectos económicos del aislamiento acústico

    Directory of Open Access Journals (Sweden)

    Amarilla, Beatriz C.

    1990-12-01

    Full Text Available The general objective of this study was to analyze the soundproofing/cost ratio with different building alternatives for interior walls and floors. This technical-economic study was divided into three parts: — Dividing walls (environmental noises — Floors (impact noises — Special Solutions (double walls, floating floors, etcetera The results show that in developing countries the most costly solutions are not always the best for housing, as far as soundproofing is concerned. A good knowledge of the economic aspects related to this matter allows obtaining a good quality at a moderate cost, which is a priority in this type of country.

    El objetivo general de este trabajo fue el de analizar el comportamiento de la relación costo-aislamiento acústico en soluciones constructivas alternativas para muros interiores y entrepisos. Este estudio técnico-económico comprende tres partes: * Muros divisorios (ruidos aéreos. * Entrepisos (ruidos de impacto. * Soluciones especiales (muros de doble hoja, pisos flotantes, etc. Se llega a la conclusión que, en los países en desarrollo, no siempre las mejores soluciones para la vivienda, desde el punto de vista acústico, son las de mayor costo. Conocer en profundidad los aspectos económicos de esta cuestión significa poder lograr una buena calidad con costos moderados, lo cual constituye una prioridad en este tipo de países.

  12. Necesidad del aislamiento térmico en la edificación actual

    Directory of Open Access Journals (Sweden)

    Alamán, A.

    1972-09-01

    Full Text Available The author attempts to clear up a few ideas on this subject, as not everyone knows enough about its correct use: what is meant by thermal insulation and thermal conductivity, essential requirements with respect to material, lightweight and heavy insulation, justification of insulation for reasons of building evolution, comfort, economy and to avoid condensation, as well as the influence of openings in outside walls.El autor trata de aclarar algunos conceptos sobre esta materia, ya que, en realidad, no todos conocen adecuadamente su correcto empleo: qué se entiende por aislamiento térmico y por conductividad térmica, condiciones que deben exigirse a los materiales, aislamientos ligeros y pesados, justificación del aislamiento por razones de evolución de la construcción, de confort, de economía y para evitar condensaciones, así como la influencia de los huecos en las fachadas.

  13. Caracterización de integrones de clase I en aislamientos hospitalarios de acinetobacter baumannii

    OpenAIRE

    Gáfaro Montejo, Alexis

    2012-01-01

    Se analizaron 129 aislamientos de Acinetobacter baumannii obtenidos de hospitales colombianos de tercer nivel con el objetivo de detectar y caracterizar integrones de tipo I (elementos genéticos importantes por la capacidad de adquirir determinantes genéticos de resistencia a los antibióticos) y su relación con el fenotipo de resistencia antibiótica. De los aislamientos estudiados el 24% fueron positivos para la presencia del integrón de tipo I. La caracterización de estos últimos demostró...

  14. Aislamiento del virus herpes bovino tipo 1 en bovinos del departamento de Córdoba - Colombia

    OpenAIRE

    Victor Vera A; César Betancur H.

    2008-01-01

    Objetivo. Realizar el aislamiento del virus herpes bovino tipo 1 (BHV-1) en ganado bovino con antecedentes de infertilidad. Materiales y métodos. A partir de 85 animales, provenientes de diferentes áreas rurales del departamento de Córdoba, Colombia, sin antecedentes de vacunación y con titulos neutralizantes contra la enfermedad de la rinotraqueitis bovina infecciosa (IBR) por seroneutralización, se escogieron dos toros y una vaca para hacer aislamiento de HVB-1. Los animales fueron inmun...

  15. Migración irregular y aislamiento social. Los jornaleros tamaulipecos indocumentados en los Estados Unidos

    Directory of Open Access Journals (Sweden)

    Izcara-Palacios, Simón Pedro

    2010-08-01

    Full Text Available “Social isolation” is a concept poorly developed in the analysis of poverty. “Social exclusion” and “marginality” are concepts more frequently used. “Social isolation” refers to an erosion of the relational sphere of the individual (i.e.: it is a lack of familial support and/or social networks, and an absence of social activity and recreational interaction. Moreover, “social isolation” is associated with anxiety and depression symptoms. This paper analyses the situation of “social isolation” of Tamaulipas’ undocumented farm workers employed in the United Stated.

    El concepto de “aislamiento social” ha sido insuficientemente utilizado en el análisis de la pobreza. “Exclusión social” y “marginalidad” son dos conceptos más desarrollados. El “aislamiento social” hace referencia a una erosión de las esferas relacionales del individuo (esto es, a una falta de soporte familiar y/o redes sociales, y a una ausencia de actividad social e interacción recreacional. Más aún, el “aislamiento social” está asociado a síntomas de ansiedad y depresión. Este artículo analiza la situación de aislamiento social de los jornaleros indocumentados tamaulipecos empleados en los Estados Unidos.

  16. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  17. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  18. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  19. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  20. Aislamiento y caracterización de Streptococcus bovis y estudio inicial para el aislamiento de su bacteriófago

    OpenAIRE

    2012-01-01

    El objetivo del presente estudio fue obtener un cultivo puro de la bacteria ruminal Streptococcus bovis a partir de líquido ruminal de ovinos alimentados con una dieta alta en sorgo (70 % en base seca). Además, se analizó su actividad fermentativa (producción de AGV y lactato) y el proceso de liofilizado como método de conservación, y se realizaron ensayos para expresar su bacteriófago. Para el aislamiento se usó un medio comercial para Streptococcus spp. (Merck) preparado...

  1. AISLAMIENTO DEL VIRUS HERPES BOVINO TIPO 1 EN BOVINOS DEL DEPARTAMENTO DE CÓRDOBA - COLOMBIA

    Directory of Open Access Journals (Sweden)

    Victor Vera A

    2008-12-01

    Full Text Available Objetivo. Realizar el aislamiento del virus herpes bovino tipo 1 (BHV-1 en ganado bovino con antecedentes de infertilidad. Materiales y métodos. A partir de 85 animales, provenientes de diferentes áreas rurales del departamento de Córdoba, Colombia, sin antecedentes de vacunación y con titulos neutralizantes contra la enfermedad de la rinotraqueitis bovina infecciosa (IBR por seroneutralización, se escogieron dos toros y una vaca para hacer aislamiento de HVB-1. Los animales fueron inmunosuprimidos con Dexametasona, y se obtuvieron muestras con hisopos nasales, oculares y de lavado prepucial en los toros y vaginales en la vaca respectivamente. Resultados. Se observó un efecto citopático a las 3 horas después de la inoculación de las células MDBK con el lavado genital de la vaca y a las 24 horas en los toros, con exposición del efecto en “racimo” a las 48 horas. El aislamiento en ambos tipos de muestras, sugiere que la reactivación viral fue seguida por una fase de viremia y excreción del virus en las secreciones naturales. Conclusiones. El aislamiento del virus HVB-1 en los reproductores aparentemente sanos pero con títulos a la prueba de seroneutralización, establece la presencia de latencia viral en éstos animales, importante factor epidemiológico en la difusión de la enfermedad a nivel de campo. Se deben iniciar los estudios necesarios para establecer el subtipo de virus actuante en el campo, para conocer sus características antigénicas y su correspondencia con las cepas vacunales.

  2. Medidor de aislamiento en enfermedades transmisibles dentro del ámbito hospitalario

    OpenAIRE

    Villanueva Rábano, Raúl

    2016-01-01

    En el ámbito hospitalario, son un problema frecuente las infecciones nosocomiales, causadas por las enfermedades transmisibles que pasan de unos pacientes a otros. Estas infecciones son potencialmente prevenibles, a través de medidas de aislamiento llevadas a cabo por el personal sanitario y no sanitario encargado de atender al paciente. En este aspecto, el papel del personal de enfermería es de fundamental importancia dado que mantienen un estrecho contacto con el paciente como cuidadores pr...

  3. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  4. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  5. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  6. Relación entre superantigenicidad, resistencia antimicrobiana y origen de aislamientos de Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Jose Ignacio Moncayo

    2016-04-01

    Full Text Available Introducción:Staphylococcus aureus, es un patógeno que causa intoxicación alimentaria e infecciones hospitalarias y comunitarias.Objetivo:Establecer el perfil de genes de superantígenos en aislamientos hospitalarios correlacionándolos con el tipo de muestra clínica, susceptibilidad antimicrobiana y origen hospitalario o comunitario.Métodos:Se analizaron 81 aislamientos de S. aureus de pacientes de un hospital colombiano. Fueron clasificadas por susceptibilidad antimicrobiana, tipo de muestra clínica y origen hospitalario o comunitario. Se detectó por PCR individual y múltiple 22 genes de superantígenos (18 enterotoxinas, una toxina del choque tóxico-1 y tres toxinas exfoliativas.Resultados:El 95.1% albergaban uno o más genes de superantígenos con un promedio de 5.6 genes. La prevalencia individual fue variable y el gen con mayor prevalencia fue seg (51.9%. Se obtuvieron 39 genotipos, y el genotipo gimnou (cluster egc completo fue el de mayor frecuencia (16.0% y asociado con otros genes (13.6%. La correlación de superantígenos frente a tipo de muestra clínica y susceptibilidad antimicrobiana no mostró diferencia estadística significativa, pero hubo diferencia significativa con el tipo de aislamiento hospitalario o comunitario (p= 0.049.Conclusiones:Los resultados muestran la diversidad genética en los aislados hospitalarios respecto a la presencia de superantígenos y no muestra una relación concluyente con el tipo de muestra clínica y susceptibilidad antimicrobiana pero sí con origen de los aislamientos comunitarios y hospitalarios. Un análisis de la interrelación entre la virulencia, epidemicidad y resistencia antimicrobiana de las poblaciones bacterianas es necesario para predecir el futuro de las enfermedades infecciosas.

  7. Aislamiento y reciblaje para reducir el consumo energético de las viviendas en Andalucia.

    OpenAIRE

    2011-01-01

    Se han realizado dentro del proyecto de investigación Aislamiento y Reciclaje para Reducir el Consumo Energético de las Viviendas en Andalucía (ARCEVA) diversos trabajos relacionados con la solución de fachadas. Se identifican cuatro trabajos principales: desarrollo de materiales de construcción reciclados que incluyen paneles de yeso y placas de hormigón, evaluación del consumo energético de las nuevas fachadas y finalmente evaluación de los impactos, técnico, ambiental, económico y social, ...

  8. Estimación de la incertidumbre en ensayos de aislamiento acústico.

    OpenAIRE

    Arribas del Olmo, Ángel M.

    2013-01-01

    En general la calidad de los resultados de una medición la establece su incertidumbre, que si está bien calculada y es suficientemente pequeña se puede decir que la medición es de buena calidad. Sin embargo, en medidas acústicas no existe un método estandarizado para la estimación de la incertidumbre. En este trabajo se comparan los valores de la incertidumbre del aislamiento acústico (en 1/3 de octavas y para la magnitud global) obtenidos por distintos métodos considerando el mayor número d...

  9. Relaciones serológicas entre aislamientos bacterianos de los géneros Erwinia, Pectobacterium Y Pantoea

    OpenAIRE

    Yonis Hernández; Gustavo Trujillo

    2004-01-01

    Este estudio fue realizado con el propósito de conocer las relaciones serológicas entre aislamientos pertenecientes a diferentes generos y especies de bacterias. Se utilizaron ocho aislamientos, tres de Pectobacterium chrysanthemi obtenidos de maíz (Zea mays), papa (Solanum tuberosum) y batata (Ipomoea batatas); tres de P. carotovora subsp. carotovora, provenientes uno de cafecito de jardín (Aglaonema commutatum ´María‘) y dos de tomate (Lycopersicon esculentum), con diferencias en el comport...

  10. Streptococcus pneumoniae: vigilancia molecular de aislamientos invasivos resistentes a penicilina recuperados de julio 2003 a junio 2004 en Colombia

    Directory of Open Access Journals (Sweden)

    Moreno Jaime

    2005-07-01

    Full Text Available Las infecciones neumocócicas afectan principalmente a niños y ancianos. Además, por el incremento de aislamientos resistentes a penicilina, S. pneumoniae es considerado como uno de los principales problemas de salud pública. El objetivo fue determinar las relaciones genéticas de los aislamientos
    invasores de S. pneumoniae con susceptibilidad disminuida a penicilina (SDP recuperados de julio-2003 a junio-2004. Se estudiaron 66 aislamientos utilizando la técnica de electroforesis de campo pulsado (PFGE, los patrones electroforéticos se compararon según los criterios de
    Tenover y se analizaron con el programa Fingerprinting TMII 3.0. En 12 aislamientos se identificaron los perfiles PBP, con la técnica del polimorfismo en la longitud de los fragmentos de restricción (RFLP de los genes pbp 2b, 2x y 1a, los cuales se interpretaron según lo establecido por el laboratorio. Las relaciones entre los grupos clonales y las características demográficas de los pacientes se analizaron con los programas EpiInfo 6.04 y MVSP 3.1. La mayoría de los aislamientos (71%
    presentaron el patrón PFGE B relacionado con el clon 3-España9V, seguido por los patrones C (6% agrupado con el clon 26-Colombia23F, D (4% con el clon 2-España6B y A (2% con el clon 1-España23F, los aislamientos restantes se distribuyeron en diez patrones no relacionados con clones internacionales. En los aislamientos relacionados con los clones 1, 2, y 26 se identificó el mismo perfil PBP del clon y los relacionados con el clon 3 presentaron una variante del perfil
    PBP del clon 3. En Colombia la prevalencia de aislamientos invasores resistentes a penicilina se debe a la circulación de los clones internacionales 1-España23F, 2-España6B, 3-España9V y
    26-Colombia23F.

  11. Caracterización molecular de aislamientos invasores colombianos de Streptococcus pneumoniae serotipo 5, recuperados entre 1994 y 2004

    Directory of Open Access Journals (Sweden)

    Leal C. Aura Lucía

    2006-06-01

    Full Text Available Streptococcus pneumoniae serotipo 5 es una causa importante de enfermedad invasiva en Colombia. Estudios preliminares han demostrado la circulación de un clon reconocido por la red de epidemiología molecular de neumococo (PMEN como clon 19-Colombia5, susceptible a penicilina pero asociado con resistencia a tetraciclina y cloranfenicol. Con el objetivo de establecer las relaciones genéticas de aislamientos invasores de S. pneumoniae serotipo 5 recuperados en Colombia entre 1994 y 2004, con el clon 19-Colombia5, se estudiaron
    83 aislamientos, que tenían datos de susceptibilidad a penicilina, vancomicina, ceftriaxona, eritromicina, trimetoprim sulfametoxazol, cloranfenicol y tetraciclina, de los cuales, 29 fueron recuperados de niños menores de cinco años. Se les determinó el patrón de restricción por electroforesis de campo pulsado (PFGE, usando la enzima Sma I. La similitud genética entre los aislamientos y el clon se estableció según los criterios de Tenover utilizando el programa Fingerprinting‰ II para la generación de dendrogramas. Todos los aislamientos se agruparon en el patrón electroforético A, del cual se derivaron 18 subtipos, todos relacionados con el clon 19-Colombia5. El patrón A se estableció en 32 aislamientos (38,6%, el subtipo A8 en 18 (21,7% y el A5 en 10 (12%, los patrones restantes agruparon los otros 23 aislamientos. Los 34 aislamientos
    resistentes a tetraciclina y cloranfenicol, estuvieron relacionados con el patrón electroforético A (n=32 y los subtipos A16 (n=1 y A28 (n=1, caracterizados por presentar una banda de 340 Kb, al igual que el clon. Estos resultados muestran la prevalencia y circulación continua de aislamientos de S. pneumoniae serotipo 5, los cuales están genéticamente relacionados con el clon 19-Colombia.

  12. Variabilidad en aislamientos de sclerotium cepivorum Berk. y su relación con arn de cadena doble

    OpenAIRE

    Noel Reyes Pérez; Nahum Marbán Mendoza; Felipe Delgadillo Sánchez; Rodolfo de la Torre Almaráz

    2003-01-01

    Se evaluó la variabilidad de la virulencia de 15 aislamientos de Sclerotium cepivorum Berk., agente causal de la pudrición blanca, en ajo y cebolla procedentes de Guanajuato, México, midiendo componentes de patogenicidad: días a producción de esclerocios (DPE), número de esclerocios (NE), diámetro de colonia (DC) y virulencia (VIR), expresada como la pérdida de peso en bulbos infectados con el hongo. Se encontraron diferencias significativas (p=0.05, Tukey) entre todos los aislamientos para l...

  13. AISLAMIENTO Y CARACTERIZACIÓN DE RIZOBIOS DE Crotalariasp. EN EL SUR DE ECUADOR

    Directory of Open Access Journals (Sweden)

    Francisco Guamán Díaz

    2016-01-01

    Full Text Available La presente investigación tuvo como objetivos aislar y caracterizar cepas nativas de bacterias diazotróficas y evaluar su efecto en la nodulación y el crecimiento de Crotalaria sp. Para el aislamiento se tomaron muestras de plantas de Crotalaria con presencia de nódulos en sus raíces, en diferentes condiciones agroclimáticas de la provincia de Loja, Ecuador. Se realizó una caracterización morfo-cultural, bioquímica y fisiológica de los aislados y se evaluó el efecto de cada uno de los aislados sobre las variables de nodulación, crecimiento y biomasa de Crotalaria en condiciones de invernadero. De los aislamientos realizados se obtuvieron 10 cepas con características correspondientes al orden Rhizobiales. Todos los aislados evidenciaron la capacidad de nodular la planta hospedante. Se destacaron los resultados en tres de los aislados por su mayor capacidad de nodulación y eficiencia en la inoculación de las plantas. Estos resultados constituyen un punto de partida en la obtención de inoculantes y su posible efecto sobre plantas de Crotalaria, utilizadas como fijadoras de N2 en condiciones de campo.

  14. Caracterización molecular de un aislamiento cubano de parvovirus canino

    Directory of Open Access Journals (Sweden)

    Anniet Fresneda-Disotuar

    2015-12-01

    Full Text Available El parvovirus canino tipo 2 (VPC-2 es el agente causal de una enfermedad infecto-contagiosa que produce gastroenteritis aguda hemorrágica que afecta a caninos jóvenes. El VPC-2 es un virus con genoma ADN, pequeño, desnudo y muy resistente a las condiciones ambientales que emergió y se expandió rápidamente a fines de la década de los años 70. En los años 80 surgieron consecutivamente dos variantes antigénicas, denominadas VPC-2a y VPC-2b. En el 2000 se detectó una nueva variante antigénica llamada VPC-2c, reportándose con frecuencia en comunidades caninas de varios países del mundo. El objetivo de este trabajo consistió en caracterizar un aislamiento cubano de parvovirus canino, atenuado y adaptado a cultivo celular. El material genético fue amplificado por reacción en cadena de la polimerasa y secuenciado posteriormente. Las secuencias obtenidas fueron analizadas y comparadas con secuencias de aislados y cepas conocidas depositadas en las bases de datos, donde se evidenció que el aislamiento cubano era del tipo VPC-2.

  15. AISLAMIENTO DE Bacillus SOLUBILIZADORES DE FOSFATOS ASOCIADOS AL CULTIVO DEL ARROZ

    Directory of Open Access Journals (Sweden)

    Berto Tejera-Hern\\u00E1ndez

    2013-01-01

    Full Text Available El objetivo de este trabajo fue determinar la capacidad de bacterias del género Bacillus pro- venientes del cultivo del arroz (Oryza sativa L. en solubilizar fosfatos. Los aislamientos se obtuvieron utilizando el modelo Microcosmos de los cultivares Iacuba 30 y Perla, en el año 2008 en Bauta, La Habana, Cuba. Hubo 58 aislados, tanto rizosféricos como endófitos de la raíz y de la parte aérea, que presentaban características distintivas del género Bacillus, como respuesta positiva a la tinción de Gram, forma bacilar y formación de endospora. Se realizó la detección cualitativa en cuanto a la capacidad de solubilización de fosfatos. Solo 19 aislamientos mostraron solubilización en medio sólido NBRIP y en algunos casos cambiaron la coloración del medio de azul a amarillo, lo que indica la producción de ácidos. Se seleccionaron los positivos para la cuantificación en medio líquido. Las cepas mostraron un comportamiento diferente cuando se midió el fosfato solubilizado a distintos tiempos, variando el máximo de solubilización.

  16. Nuevo método para el aislamiento y la cuantificación de insectos del orden Collembola

    Directory of Open Access Journals (Sweden)

    Kalyanne Fernández

    2000-01-01

    significativamente el tiempo de aislamiento de los individuos (cinco minutos vs cinco días, sino también porque permite cuantificar mayor cantidad de éstos, inclusive vivos y por tanto con mayor calidad biológica

  17. Caracterización de aislamientos clínicos de Leptospira para su uso en vacunas veterinarias

    Directory of Open Access Journals (Sweden)

    Yaritza Cuba-Romero

    2016-04-01

    Full Text Available Uno de los criterios más importantes para el desarrollo de inmunógenos de Leptospira es contar con cepas bien caracterizadas por su virulencia y representativa de los serogrupos circulantes desde el punto de vista clínico y veterinario. Todo lo cual permite garantizar inmunógenos capaces de proteger contra los serovares presente en la formulación y que afectan a los animales en riesgo. Este trabajo se realizó a partir de aislamientos del agente causal de cinco casos clínicos autóctonos de Leptospira en la provincia de Holguín, Cuba, mediante métodos convencionales: crecimiento a 13ºC, medio suplementado con 8-azaguanina y en presencia de cloruro de sodio. Además, los aislamientos se clasificaron hasta nivel de serogrupo mediante la técnica de microaglutinación. A partir de estos aislamientos fue seleccionada y caracterizada una cepa del serogrupo Ballum como candidato vacunal. Los aislamientos no mostraron crecimiento a 13ºC, ni cuando se le añadió al medio 8-azaguanina (2,25 mg/mL, mientras que todas las cepas mostraron conversión a forma esférica en presencia de cloruro de sodio (1M. La clasificación de los aislamientos permitió disponer de dos cepas pertenecientes al serogrupo Ballum y dos a Pomona. La cepa seleccionada mostró alta virulencia y patogenicidad en el biomodelo Hámster Sirio, además de buena estabilidad en los medios de cultivos. Su clasificación hasta el nivel de serovar mediante el uso de anticuerpos monoclonales determinó su pertenencia al serovar Ballum. El presente trabajo, por primera vez, sienta las bases para formulaciones vacunales novedosas en animales, conteniendo el serogrupo Ballum.

  18. El Aislamiento de las Venas Pulmonares como Tratamiento de la Fibrilación Auricular Refractaria

    OpenAIRE

    Fernando Scazzuso; Rivera Santiago; Gómez, Luis A.; Victoria Sammartino; Albina Gastón; Rubén Laiño; Alberto Giniger

    2011-01-01

    Introducción. La fibrilación auricular (FA) es la arritmia sostenida más común. En pacientes seleccionados, se realiza ablación por catéter a nivel de las venas pulmonares, en donde se genera actividad ectópica que la produce. Se presenta la experiencia en el tratamiento de la FA mediante el aislamiento de venas pulmonares en 152 casos consecutivos. Materiales y métodos. La población estuvo constituida por 152 pacientes (122 hombres), edad promedio de 55.58 años. El 81.9% de la población no p...

  19. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  20. Aislamiento de Salmonella en canales de aves y evaluación de la efectividad de diferentes medios de enriquecimiento y selectivos

    OpenAIRE

    2004-01-01

    Se evaluó la frecuencia de salmonela en canales de aves y la efectividad de su aislamiento en diferentes medios de cultivo de enriquecimiento y selectivos. Noventa y un canales de pollos fueron tomadas directamente de la cadena de procesamiento de dos plantas beneficiadoras (estado Zulia, Venezuela). Para el aislamiento, fueron usados medios de enriquecimiento y selectivos. Los medios de enriquecimiento incluyeron: Caldo Selenito Cistina (CS) y Caldo Tetrationato (CT). Los medios selectivos i...

  1. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  2. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  3. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  4. Alternative Teacher Compensation: A Primer

    Science.gov (United States)

    Koppich, Julia E.; Rigby, Jessica

    2009-01-01

    This policy primer is designed to provide base-line information about new forms of teacher pay that are emerging around the country, to support the local conversations and negotiations that will lead to the development of innovative compensation systems. It identifies reasons why teacher compensation is high on local, state, and federal policy…

  5. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  6. La situación sociolaboral de los migrantes internacionales en la agricultura: irregularidad laboral y aislamiento social

    Directory of Open Access Journals (Sweden)

    Simón Pedro Izcara Palacios

    2009-01-01

    Full Text Available Los jornaleros inmigrantes constituyen uno de los grupos sociales más pobres de las comarcas agrarias de Estados Unidos y España. Los trabajadores agrarios migratorios viven en áreas remotas y sufren de malnutrición, salarios bajos, alta movilidad laboral, condiciones laborales precarias y ambientes laborales inadecuados. Por una parte, el sector agrario, que constituye un refugio laboral para los trabajadores ilegales, opera fuera del mercado laboral formal; por otra parte, los jornaleros padecen un grave problema de "aislamiento social", esto ha sido señalado como una de las principales causas de falta de bienestar de éstos. El artículo analiza, de modo comparativo, la situación de irregularidad laboral y aislamiento social de los jornaleros tamaulipecos empleados en la agricultura estadounidense y los trabajadores marroquíes empleados en el sector agrario andaluz.

  7. El aislamiento social de los trabajadores con visas H-2A. El ejemplo de los jornaleros tamaulipecos

    Directory of Open Access Journals (Sweden)

    Simón Pedro Izcara Palacios

    2012-01-01

    Full Text Available La proximidad de Tamaulipas a la frontera estadounidense abarata los costos de transporte, y esto hace que en el estado se otorgue un número elevado de visas H-2A a trabajadores agrarios temporales. Sin embargo, los programas de trabajadores huéspedes empujan a la mano de obra al abuso y la explotación. El aislamiento social, que hace referencia a una erosión de la esfera relacional del individuo, constituye uno de los principales problemas sufridos por los trabajadores tamaulipecos con visa H-2A; aquí se analiza la situación de aislamiento social de éstos, en específico la de los empleados en el sector agrario estadounidense.

  8. Caracterización parcial de aislamientos de Trichomonas vaginalis:estudios relacionados con la virulencia y la patogenicidad

    OpenAIRE

    Rojas Rivero, Lázara

    2005-01-01

    La trichomonosis vaginal es la principal enfermedad de transmisiónn sexual de etiologí­a parasitaria. Es producida por un protozoo flagelado denominado Trichomonas vaginalis. Los mecanismos de patogenidad y los factores de virulencia relacionados con la enfermedad no están totalmente esclarecidos. En el presente trabajo se reportan los resultados de la caracterización parcial de 40 aislamientos de Trichomonas vaginalis obtenidos a partir de muestras de exudado vaginal de pacientes adolescente...

  9. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE Herpesvirus bovino TIPO 1

    Directory of Open Access Journals (Sweden)

    Vera V.

    2005-11-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  10. DETECCIÓN Y CARACTERIZACIÓN POR MÉTODOS MOLECULARES DE AISLAMIENTOS COLOMBIANOS DE HERPESVIRUS BOVINO TIPO 1

    Directory of Open Access Journals (Sweden)

    D. Piedrahita

    2005-01-01

    Full Text Available La Rinotraqueitis Infecciosa Bovina (RIB es una enfermedad, altamente contagiosa, de distribución mundial, de origen viral, causada por el Herpesvirus Bovino-1 (BoHV-1. Produce alteraciones en el sistema respiratorio y reproductivo, lo que la convierte en una enfermedad con un gran impacto económico para los sistemas de producción ganadera. Este trabajo tuvo como objetivo caracterizar, mediante técnicas de biología molecular, tres aislamientos colombianos del BoHV-1 (dos de la sabana de Bogotá y uno de los Llanos Orientales. Los aislamientos fueron analizados con las enzimas de restricción Bam HI, Bst EII, Eco RI Pst I y Hind III. En este estudio también se implementó una rápida, sensitiva y específica prueba de PCR para la detección de tres glicoproteínas de superficie del Herpesvirus Bovino-1 (BoHV-1, cuyos fragmentos fueron secuenciados, lo que permitió encontrar homologías del 100% comparadas con los reportes del Gene Bank. Por medio del análisis con la enzima de restricción Hind III se clasificaron los aislamientos de la sabana de Bogotá como subtipo BoHV-1.2a y el de los Llanos Orientales como subtipo BoHV-1.1.

  11. Deteccion de citomegalovirus mediante la tecnica de inmunoperoxidasa y aislamiento viral Cytomegalovirus detection by Immunoperoxidase assay and viral isolation

    Directory of Open Access Journals (Sweden)

    Maritza Alvarez

    1991-06-01

    Full Text Available En el presente estudio se comparó la técnica de inmunoperoxidasa para la detección de citomegalovirus (IPCMV utilizando anticuerpos monoclonales que reconocen proteínas precoces virales con el método convencional de aislamiento viral en fibroblastos humanos. Un total de 150 muestras de orina fueron examinadas encontrando una sensibilidad de un 89.8% y una especificidad de 91.3% de la técnica de IPCMV comparada con el aislamiento viral. Una de las ventajas que presentó la IPCMV fue la rapidez con que fueron obtenidos los resultados (48 horas mientras que el aislamiento viral fue como promedio 14 días.An Immunoperoxidase assay was applied to detect early antigens of Cytomegalovirus (CMV in 150 urine samples from immunocompromised patients, using the commercial available monoclonal antibody against CMV El3. The detection of early antigen by IP (IPCMV is compared to the conventional cell culture isolation regarding specificity and sensitivity in order to evaluate is usefulness in the diagnostic of CMV infections. The IPCMV showed a sensitivity of 89.8% and a specificity of 91.3% when compared to the isolation method. The great advantage of the IPCMV is based on the shorter time results are achieved, since 48-72 Hs can be enough to provide evidence of CMV infection, while in the isolation technique cytopatho-genic effect was present around 14 days after sample inoculation.

  12. Aislamiento en pacientes psiquiátricos Seclusion of psychiatric patients

    Directory of Open Access Journals (Sweden)

    Franklin Escobar Córdoba

    2009-01-01

    Full Text Available El objetivo del presente artículo es aportar pautas para la evaluación y tratamiento de pacientes agresivos mediante el uso del aislamiento. A esos efectos, se realizó una revisión narrativa de la literatura, basada en la búsqueda mediante la combinación de las palabras "seclusion" y/o "patient seclusion" y/o "Restraint, Physical" y/o "Mentally Ill Persons", en las bases de datos MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED y Latindex. Se seleccionaron 12 de 8.418 artículos de mayor relevancia para su aplicación en nuestro medio, teniendo como límites de la búsqueda revisiones, metanálisis, estudios controlados aleatorizados y estudios clínicos, adultos, ambos géneros, humanos, idioma inglés y español, de los años 2002 a 2007. Se halló un conocimiento amplio en el tratamiento del paciente agresivo. Las indicaciones del aislamiento no difieren con respecto a las de restricción, siendo importantes los riesgos de hetero o autoagresividad y de daño al entorno físico. Las contraindicaciones y consideraciones éticas, médicas y legales son claras y se deben implementar para una adecuada práctica clínica. El uso adecuado del aislamiento por parte del personal de salud debe formar parte de un plan terapéutico adecuado y tener en cuenta las recomendaciones para su uso en el contexto local.The objective of the present study is to contribute rules for the evaluation and treatment of an aggressive patient by means of seclusion. We searched the literature in the MEDLINE, Ovid, SciELO, HINARI, LILACS, IMBIOMED and Latindex databases, using the combination of the following words: "seclusion" and/or "patient seclusion" and/or "restraint, physical" and/or "mentally ill persons". Twelve out of 8,418 articles were selected for their application in Colombia according to the following limits of the search: clinical trial, meta-analysis, randomized controlled trial, review of the literature, adults, both genders, published between 2002 and

  13. El primer congreso constituyente mexicano

    OpenAIRE

    José Luis Soberanes Fernández

    2012-01-01

    En el presente trabajo se describe uno de los momentos más difíciles de la historia constitucional de México, por no decir el más difícil, que va desde la Consumación de la Independencia Nacional del 27 de septiembre de 1821 al 30 de noviembre de 1823 en que clausuró sus sesiones el Primer Congreso Constituyente. Fue cuando se erigió el Imperio de Iturbide y su ocaso, en consecuencia triunfó la república y se planteó seriamente el federalismo. Se eligió ese primer constituyente, se clausuró, ...

  14. Biological characterization of Citrus tristeza virus strains in lemon in Tucumán, Argentina Caracterización biológica de aislamientos del virus de la tristeza de los cítricos de limoneros en Tucumán, Argentina

    Directory of Open Access Journals (Sweden)

    Julia Figueroa

    Full Text Available Tucumán province is the largest lemon producer in the world, with a production of 1.3 million tons. Unfotunality, tristeza disease has been present in Argentina since 1930 and is endemic. Citrus tristeza virus isolates from the main lemon varieties in Tucumán province were biologically characterized on the basis of vein clearing, vein corking, leaf cupping, stunting, stem pitting and other symptoms using standard indicator plants. The lemon varieties were: Frost Eureka, Frost Lisbon, Limoneira 8A and Genoa EEAT. The indicator plants used were Mexican lime, Eureka lemon, Duncan grapefruit, Pineapple sweet orange and sour orange seedlings, plus Ruby Blood sweet orange budded on sour orange rootstock. Symptoms on each of the indicator plants were rated from 0 (no reaction to 5 (most severe. A total rating for each isolate was obtained by summing the ratings on each indicator plant. Differences among lemon isolates were observed. Genoa isolate induced least growth while Limoneira isolate induced the most severe stem pitting. Little difference was observed between Eureka and Lisbon isolate.La Argentina es el primer país productor de limón en el mundo y la provincia de Tucumán lidera esta producción con 1,3 millones de toneladas. Desafortunadamente la tristeza de los cítricos es una enfermedad endémica en la Argentina desde 1930. En el presente trabajo se informa sobre la caracterización biológica realizada a distintos aislamientos del virus de la tristeza de los cítricos de las principales variedades comerciales de limoneros. Las variedades de limoneros estudiadas fueron: Eureka Frost, Lisboa Frost, Lisboa Limoneira 8 A y Génova EEAT. La caracterización se realizó en las plantas indicadoras estándares para este tipo de pruebas y fueron: plantines de lima mexicana, limón Eureka, pomelo Duncan, naranjo dulce Pineapple y naranjo agrio; y plantas injertadas de naranjo dulce Ruby Blood en naranjo agrio. Los principales síntomas evaluados

  15. Environmental Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2008-05-01

    percussion primers typically consist of lead styphnate and antimony sulfide. Although highly effective, these heavy material compounds were identified under...Percussion primers, including those used in medium caliber ammunition, typically contain lead styphnate and antimony sulfide along with other constituents...Furthermore, current percussion primer compositions also contain barium nitrate. Although not negatively categorized by the Environmental Protection

  16. Estudio sobre las relaciones filogenéticas entre diversos aislamientos del hongo Paracoccidioides brasiliensis

    Directory of Open Access Journals (Sweden)

    Juan McEwen

    2003-01-01

    Full Text Available Aunque es poco lo que se conoce acerca de la biología evolutiva
    del hongo P. brasiliensis, varios estudios moleculares han demostrado que existen variaciones en secuencias de ADN entre sus aislamientos, las que se correlacionan con el origen geográfico de las mismas y con diferencias en su virulencia para modelos murinos (1,2. Se desconoce si estas variaciones son el resultado final de un proceso de especiación alopátrica que daría origen a especies aisladas genéticamente provistas de características fenotípicas (patogenicidad, inmunogenicidad y genotípicas diferentes, las que podrían ser usadas como una alternativa para mejorar e innovar los métodos actuales de diagnóstico. Por lo tanto, proponemos como objetivo general estudiar un aspecto fundamental de la biología evolutiva del hongo patógeno humano P. brasiliensis como es la especiación.

  17. Selección de aislamientos de Trichoderma spp. con potencial biocontrolador de Rhizoctonia solani Kühn en papa bajo condiciones de casa de malla

    Directory of Open Access Journals (Sweden)

    Garcés de Granada Emira

    2005-07-01

    Full Text Available El hongo fitopatógeno Rhizoctonia solani afecta raíces, tallos y tubérculos de papa, logrando reducir los rendimientos del cultivo hasta en un 50%. Con el propósito de ofrecer una alternativa biológica para el manejo de este problema, se evaluaron diez cepas nativas del hongo biocontrolador
    Trichoderma spp. Inicialmente se evaluó la actividad patogénica de dos aislamientos de R. solani (Rh005 y Rh006 inoculando suelo en proporciones del 2,5 y 10% peso a peso (p/p donde posteriormente fueron transplantadas plántulas de papa producidas in vitro, encontrando con ambos aislamientos 100% de incidencia de la enfermedad. Sin embargo, fue seleccionado el aislamiento Rh005 ya que presentó mayor porcentaje de daño expresado como volcamiento de las plantas. Como prueba preliminar de antagonismo, en recipientes con suelo se enterraron bolsas de muselina que contenían esclerocios de este último aislamiento y se trataron
    individualmente con suspensiones de los diferentes  aislamientos de Trichoderma spp.ajustadas a una concentración de 107conidios.ml-1, estableciéndose que los aislamientos de Trichoderma Th002, Th003, Th007, Th034 y Th181 parasitaron y degradaron más del 50% de los esclerocios. En el ensayo de protección al evaluar estos últimos aislamientos en casa de malla en donde se inoculó suelo con Rh005 (2% p/p se seleccionaron los aislamientos Th003 y Th034 por presentar diferencias con respecto a mayores pesos de biomasa fresca y seca en comparación con los restantes biocontroladores y los tratamientos químico, patógeno y testigo. Aunque no se logró disminuir la incidencia de la enfermedad, los aislamientos de Trichoderma seleccionados permitieron reducir el daño en las plantas observando mayor vigor, tallos normales con abundante follaje y mejor crecimiento radical.

  18. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  19. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  20. Loop quantum geometry: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Corichi, Alejandro [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, A. Postal 70-543, Mexico D.F. 04510 (Mexico)

    2005-01-15

    This is the written version of a lecture given at the 'VI Mexican School of Gravitation and Mathematical Physics' (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  1. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  2. Inhibición in vitro de aislamientos nativos de Trichoderma en presencia de la cepa comercial T22

    Directory of Open Access Journals (Sweden)

    Gabriela Hernández – Ramírez

    2013-06-01

    Full Text Available Título en ingles: In vitro inhibition from native isolates of Trichoderma against commercial strain T22.  Título corto: Inhibición in vitro de aislamientos nativos Resumen El objetivo de este trabajo fue evaluar 14 aislamientos nativos del género Trichoderma (Tn obtenidos de la rizósfera del cultivo de caña de azúcar de acuerdo con su efecto de inhibición In vitro en cultivos duales contra la cepa comercial de Trichoderma harzianum (T22. Los aislamientos nativos con mayor índice de inhibición fueron los denominados Palma (T12 y Hubero (T11, con un valor de 2, mientras que T01, T04, T05 y T08 presentaron un valor de 1. Además, el mayor porcentaje de inhibición fue causado por el aislamiento T03, con una media de 92.32 ± 2.64%, sin diferencias estadísticas con los nativos T07, con un valor inhibición de 88.99 ± 1.46%, T01 87.93 ± 2.28%, y T12; 87.71 ± 3.16. En este caso, los aislamientos T07 y T12 mostraron capacidad inhibitoria con mayores atributos para su selección como agentes de control biológico. Al evaluar la tolerancia In vitro de los aislamientos nativos de Trichoderma a la actividad del agua (aw, se observó efecto significativo sobre el desarrollo micelial de los aislamientos de Trichoderma nativo evaluados. Los aislamientos T03 (7919.3 ± 932.53 y T12 (6388.2 ± 623.40 presentaron el mejor desarrollo radial. Estos resultados sugieren que los aislamientos T03 y T12 podrían desarrollarse mejor bajo condiciones de estrés hídrico. Por lo anterior, concluimos que los aislamientos T07 y T12, son los mejores candidatos como agentes inhibidores y se sugiere evaluarlos In vitro o invernadero contra el agente causal de la enfermedad del muermo rojo en caña de azúcar (Colletotrichum falcatum. Palabras clave: Control Biológico; tolerancia;  ompetencia; estrés hídrico; actividad de agua. Abstract The objective of this work was to evaluate 14 native e Trichoderma genus isolates (Tn obtained from the rhyzosphere of

  3. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  4. Single-primer fluorescent sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.; Grone, D.L.; Brumbaugh, J.A.

    1987-05-01

    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal and temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.

  5. Aislamiento y caracterización de micromicetos biodegradadores de polietileno

    Directory of Open Access Journals (Sweden)

    Carmen R. Méndez

    2013-05-01

    Full Text Available La biodegradación del polietileno por microorganismos es una solución para la reducción de la contaminación por plásticos. En el presente trabajo se muestran los resultados del aislamiento y caracterización de cepas de hongos capaces de degradar el polietileno, así como la determinación de las condiciones de pH y temperatura en las que se logran la mayor actividad. Los hongos fueron aislados de productos elaborados con polietileno obtenidos de relleno sanitario, la identificación taxonómica en base a características macroscópicas del crecimiento en placa petri y el estudio microscópico empleando la técnica de microcultivo en lámina. La actividad biodegradadora se determinó con la técnica de Kavelman y Kendrick, a temperaturas entre 20 y 30 °C y a pH 4,5 – 8,0. Veinte cepas de micromicetos fueron aisladas e identificadas, en 5 (25% se evidencio la capacidad de biodegradar el polietileno a 20 °C, siendo el pH 6,5 el óptimo, la cepa de mayor rendimiento pertenece a la especie de Aspergillus flavus. A temperatura de 30 °C, 6 (30% cepas evidenciaron actividad degradadora, siendo pH 6,5 el óptimo, la cepa de mayor rendimiento fue la misma del caso anterior.

  6. Aislamiento y serotipificación de Salmonella sp. en estanques con Crocodylus intermedius y testudines cautivos en Villavicencio - Colombia

    Directory of Open Access Journals (Sweden)

    Diana Pachón C.

    2011-05-01

    Full Text Available Objetivo. Determinar la presencia de microorganismos del género Salmonella sp. en el ambiente acuático de los ejemplares Crocodylus intermedius y testudines en la Estación de Biología Tropical Roberto Franco (EBTRF. Materiales y métodos. En este estudio se utilizó la metodología estándar para aislar e identificar microorganismos del género Salmonella sp., a partir de muestras de agua y sedimento de 52 estanques (nEstanques Crocodylus=25; nEstanques testudines=27; se procedió a serotipificar los aislamientos por el método convencional de Kaufmann-White y se realizaron pruebas de sensibilidad a antimicrobianos por la técnica de Kirby Bauer. Resultados. Se determinó la presencia de Salmonella sp., en un 33% del total de estanques muestreados. El 29% de los aislamientos de Salmonella sp. serotipificados, correspondió al serogrupo B; los serogrupos C, C1, C2 y D1 presentaron menores porcentajes. Con las pruebas de sensibilidad a antimicrobianos se determinó que el 100% de los aislamientos fueron sensibles a norfloxacina. Conclusiones. La ocurrencia de Salmonella sp., en los estanques de la EBTRF fue del 33%, con la mayor presencia del serogrupo B, donde se encuentran especies con características ampliamente zoonóticas. Con los resultados obtenidos es necesario el seguimiento de las normas de bioseguridad establecidas en la estación para el manejo de las poblaciones allí mantenidas y evitar de esa manera la ocurrencia de cuadros zoonóticos.

  7. Brief exegesis on the existing legislation and the application of thermal insulation in the world - proposal for Mexico; Breve exegesis sobre legislacion existente en la aplicacion de aislamientos termicos en el mundo - propuesta para Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V., Mexico, D. F. (Mexico)

    1992-12-31

    -economias nacionales como a las microeconomias familiares individuales. En consecuencia directa de la reduccion en el consumo energetico, se reduce en forma proporcional la emision de los contaminantes derivados de la combustion. La reduccion se realiza en su gasto diario y transfiere sus beneficios en forma directa e inmediata. Otros efectos secundarios beneficos son; se mejora sensiblemente la calidad de vida de los habitantes de viviendas mas confortables, se generan nuevos empleos y necesidades de mayor capacitacion al personal de la construccion y se amplia la oferta de alternativas de sistemas constructivos. En primer termino, se hace una presentacion resumida y explicada de la legislacion y reglamentacion adoptada en una amplia lista de distintos paises del mundo; lideres en este aspecto. Posteriormente, se hace una presentacion de las medidas que se pudieran implementar a este respecto en Mexico y se sugieren valores especificos de aislamiento relativos a las distintas regiones climatologicas mexicanas.

  8. Nuevo método para el aislamiento y la cuantificación de insectos del orden Collembola

    OpenAIRE

    Kalyanne Fernández; F. Fernández; Pérez, E.

    2000-01-01

    Recientemente, se ha informado que algunos integrantes del orden Collembola se alimentan de las hifas externas y de los cuerpos de fructificación de los HMA, originando principalmente efectos negativos sobre el desarrollo de la simbiosis. Con el objetivo de obtener un método optimizado y eficiente que posibilite el aislamiento de colémbolos en suelos, se diseñaron dos experimentos: el primero estableció una comparación entre la metodología comúnmente empleada para aislar los animales (embudos...

  9. Aislamiento y caracterización de Mycoplasma sp.de pulmones de cerdos provenientes de mataderos

    OpenAIRE

    Copes, Julio; Nievas, Fabián; Cerdá, Raúl Oscar; Perfumo, Carlos J.

    1995-01-01

    Se realizó un estudio microbiológico de 100 pulmones obtenidos al azar provenientes de capones y hembras sin servicio faenados en diferentes mataderos. Estos fueron clasificados macroscópicamente en pulmones con lesiones neumónicas (CLN) (43) y sin lesiones neumónicas (SLN) (57). Las muestras fueron procesadas para realizar el aislamiento y caracterización de microorganismos perteneciente al género Mycoplasma, en particular Mycoplasma hyorhinis y Mycoplasma hyosynoviae. De casos seleccionados...

  10. Diseño de un sistema de aislamiento de vibraciones para un robot cuadrúpedo

    OpenAIRE

    2010-01-01

    El proyecto trata de analizar las vibraciones producidas por un robot y en concreto se pretende aislar las vibraciones producidas por el motor de un robot cuadrúpedo llamado “HyQ”. Los objetivos principales son: 1) Modelado mediante el uso de un programa de diseño en 3D del robot “HyQ”. 2) Realización de simulaciones dinámicas en diferentes modos de funcionamiento en los que puede operar el robot “HyQ”. 3) Diseño y cálculo de un sistema de aislamiento de las vibraciones producidas po...

  11. Aislamiento de microorganismos productores de biosurfactantes y lipasas a partir de efluentes residuales de camales y suelos contaminados con hidrocarburos

    OpenAIRE

    Lizzie Karen Becerra Gutiérrez; María Valeria Horna Acevedo

    2016-01-01

    Los biosurfactantes son moléculas anfipáticas que reducen la tensión en la interfase, incrementando así la solubilidad en agua y disponibilidad de compuestos orgánicos, son producidos por bacterias, hongos, y levaduras. Para el aislamiento de bacterias productoras de biosurfactante y lipasas, se sembró en medios inductores 10% de efluentes residuales procedentes de camales y suelos de grifos contaminados con hidrocarburos de la Provincia de Trujillo - Perú. Los cultivos aislados se sembraron ...

  12. Resistencia a antimicrobianos en aislamientos de Escherichia coli de origen animal Antimicrobial resistance of Escherichia coli isolated from animals

    Directory of Open Access Journals (Sweden)

    G. Carloni

    2011-12-01

    Full Text Available Se determinó el perfil de susceptibilidad a antimicrobianos de 100 aislamientos de E.coli provenientes de diversas patologías en bovinos, equinos, caninos y felinos, siguiendo metodología del Clinical and Laboratory Standards Institute y detectando la aparición de aislamientos multiresistentes. El panel de antibióticos ensayados incluyó amicacina, ampicilina/sulbactama, cefotaxima, ciprofloxacina, cloranfenicol, colistina, estreptomicina, gentamicina, nitrofurantoína, tetraciclina, trimetoprima/ sulfametoxazol. El mayor porcentaje de resistencia (R se detectó frente a tetraciclina en aislamientos de todas las especies animales (entre 34% en los de origen felino y 75% de origen equino. En las cepas de origen canino y felino se encontraron porcentajes considerables frente ampicilina/ sulbactama (27% de caninos y 53% de felinos y ante ciprofloxacina (30% y 67% respectivamente. En estos aislamientos también, se detectó el mayor porcentaje de multiresistencia (29% en caninos y 67% en felinos. La presión selectiva originada por la aplicación inadecuada de antibióticos puede resultar un factor, aunque no el único, responsable de la aparición de R. Además existe la posibilidad de que E.coli pueda constituirse en un eslabón de transmisión de genes de R a antimicrobianos, aunque no se conoce hasta el momento, el origen de ellos, humano o animal y, su permanencia en el tiempo.Antimicrobial susceptibility tests were determined in 100 isolates of E.coli from differents patologies in cattle, horses, dogs and cats, according to Clinical and Laboratory Standards Institute. Multiresistance isolates were detected in this assay. The antibiotics selected were amikacin, ampicillin /sulbactam, cefotaxime, ciprofloxacin, chloramphenicol, colistin, gentamicin, nitrofurantoin, streptomycin, tetracycline, trimethoprim/sulfamethoxazole. The antibiotic with the highest resistance was tetracycline (34% in cats and 75% in dogs. In isolated strains from dogs

  13. Caracterización molecular de aislamientos invasores de Streptococcus pneumoniae resistentes a la penicilina recuperados de pacientes adultos

    OpenAIRE

    Jaime Moreno; Elizabeth Castañeda

    2003-01-01

    La resistencia de Streptococcus pneumoniae a la penicilina está asociada con la dispersión deciertos clones internacionales. En Colombia, se ha establecido en la población infantil la presenciay circulación de los clones 1-España23F, 2-España6B, 3-España9V y 25-Colombia23F. El objetivode este trabajo fue evaluar las relaciones clonales entre 80 aislamientos invasores de S.pneumoniae con susceptibilidad disminuida a la penicilina recuperados de pacientes adultos.El análisis genotípico incluyó ...

  14. El aislamiento social de los trabajadores con visas H-2A. El ejemplo de los jornaleros tamaulipecos

    OpenAIRE

    Simón Pedro Izcara Palacios

    2012-01-01

    La proximidad de Tamaulipas a la frontera estadounidense abarata los costos de transporte, y esto hace que en el estado se otorgue un número elevado de visas H-2A a trabajadores agrarios temporales. Sin embargo, los programas de trabajadores huéspedes empujan a la mano de obra al abuso y la explotación. El aislamiento social, que hace referencia a una erosión de la esfera relacional del individuo, constituye uno de los principales problemas sufridos por los trabajadores tamaulipecos con visa ...

  15. Diseño de un sistema de tamizado semicontinuo para el aislamiento de almidón de plátano macho (musa paradisiaca l.)

    OpenAIRE

    Ramírez Cortes, Roberto

    2016-01-01

    El plátano macho (Musa paradisiaca L.) es un fruto climatérico que se recolecta en un estado de madurez fisiológica. En esta etapa posee un alto contenido de almidón, por lo cual es una importante fuente alterna para el aislamiento del polisacárido. Hasta ahora, los procesos reportados para su aislamiento, son llevados a cabo en lotes, y durante la operación de tamizado, se emplean grandes cantidades de agua para producir la liberación de los gránulos de almidón. El objetivo de este trabajo f...

  16. Variabilidad genética de aislamientos de Salmonella typhimurium (grupo B) obtenidos de hígados de pollo destinados para consumo humano

    OpenAIRE

    Martín Talavera Rojas; Nydia Edith Reyes Rodríguez; Salvador Lagunas Bernabé; Pomposo Fernández Rosas; Vladimir Morales Erasto; Edgardo Soriano Vargas E.

    2011-01-01

    Se determinó la frecuencia de aislamientos de Salmonella spp en hígados de pollo para venta, en cuatro mercados del área metropolitana de la ciudad de Toluca, México. El aislamiento bacteriológico se realizó de acuerdo a la norma NOM-114-SSA1- 1994 para la determinación de Salmonella en alimentos. Se realizó la prueba de ERIC-PCR para determinar la variedad genética de las cepas de Salmonella aisladas. De un total de 520 muestras incluidas en el estudio, 7 (1.34 %) resultaron positivas a Salm...

  17. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  18. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  19. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  20. Sistemas de conntrol pasivos y activos de aislamiento de base para edificios sometidos a acciones sísmicas

    Directory of Open Access Journals (Sweden)

    Nelson Molinares Amaya

    2003-01-01

    Full Text Available En este arUculo se examina la eficacia de los sistemas de control de aislamiento de base, tanto pasivos como activos, y se propone uno híbrido que aplica una fuerza sobre la base. La componente pasiva del sistema propuesto está constituida por un aparato de apoyo que puede ser de tipo histerético, friccional o una combinación de ambos. La fuerza de control activo tiene como objetivo la reducción del desplazamiento de la base y se calcula mediante una ley de control que garantiza un comportamiento estable del sistema estructura - aislamiento de base frente a una amplia clase de incertidumbres tanto del modelo dinámico como de la excitación s{smica. Mediante un amplio estudio numérico se muestra que el sistema propuesto mejora el comportamiento global del edificio, especialmente para excitaciones con frecuencias predominantes, para las cuales la respuesta de la estructura con control pasivo es máxima.

  1. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  2. ESCUELAS-ISLA: UN AISLAMIENTO INSTITUCIONAL (SCHOOLS- ISLAND: AN INSTITUTIONAL ISOLATION

    Directory of Open Access Journals (Sweden)

    Vergara Reyes, Claudio

    2012-05-01

    Full Text Available Resumen: Este trabajo trata acerca de un tipo de escuela en la realidad educativa chilena, denominada “escuela-isla”, caracterizada por su aislamiento institucional del entorno social, económico, político, religioso y cultural. El concepto nace de una serie de reflexiones bajo el marco formativo de las prácticas pedagógicas tempranas, a partir de un conjunto de experiencias que configuran al centro de enseñanza y que resultan clave para la comprensión de la naturaleza del término. El documento hace una caracterización de este tipo de escuela, reconociendo cualidades que no son propias de una institución social. Asimismo, se propone y justifica la necesidad de un tipo de “alianza simbiótica” entre la organización educativa y el resto de organizaciones de la comunidad (red de enlace para complementar y potenciar su función educativa (formativa. Por último, se destaca la importancia de la interacción de la escuela con otras instituciones de la sociedad, y que tales vínculos constituyen una estrategia educativa para el desarrollo social y comunitario.Abstract: This work is about a type of school the Chilean educational reality, to known as school-island, mainly by institutional isolation from the social, economic, political, religious and cultural. The concept stems from a series of reflections within the framework formative early teaching practices, based on a set of experiences that shape the educational unit and are keys to understanding the nature of the term. The document provides a characterization of this type of school, recognizing qualities that are not characteristic of a social institution. It also proposes and justifies the need for a kind of "symbiotic partnership" between the educational organization and other community organizations (network link to complement and enhance its educational. Finally, it highlights the importance of interaction between the school and other institutions of society and that such links

  3. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  4. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia

    Directory of Open Access Journals (Sweden)

    Muñoz Flórez Jaime Eduardo

    2008-09-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a –20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.

  5. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  6. Aislamiento de Mycobacterium avium subsp. Paratuberculosis de fecas en rebaños lecheros infectados mediante el Método de Cornell modificado Isolation of Mycobacterium avium subsp. Paratuberculosis from bovine feces of infected dairy herds by the Cornell’s Method modified

    Directory of Open Access Journals (Sweden)

    J. P SOTO

    2002-01-01

    Full Text Available Con la finalidad de aumentar la tasa de aislamiento de Mycobacterium avium subsp. paratuberculosis (Map, a partir de muestras de fecas bovinas, se evaluó un nuevo procedimiento de descontaminación y cultivo de muestras fecales en 250 animales clínicamente sanos, provenientes de 14 rebaños infectados del sur de Chile. Para la descontaminación de las muestras previo al cultivo se utilizó una solución al 0.9% de cloruro de hexadecilpiridinio (HPC y una solución antibiótica con amfotericina B, vancomicina y ácido nalidíxico. Para el aislamiento del agente se utilizó el medio de Herrold con yema de huevo y micobactina J adicionado de una solución antibiótica similar a la empleada para la descontaminación de las muestras. En el 16% (40 de las muestras analizadas fue posible aislar Map con un 7.6% de contaminación con hongos sólo a partir de la octava semana de incubación. La identidad de las cepas aisladas fue confirmada en el 100% de los casos mediante PCR, utilizando partidores específicos para este agente (P90 y P91. La alta tasa de aislamiento, la especificidad del medio de cultivo y la baja tasa de contaminación de los cultivos, durante el prolongado período de incubación, hacen de este procedimiento una buena alternativa de diagnóstico de Paratuberculosis bovinaIn order to improve the isolation rate of Mycobacterium avium subsp. paratuberculosis (Map from bovine feces a new bacteriological procedure for decontamination and cultivation of fecal samples was evaluated in 250 samples collected from asymptomatic animals in 14 infected dairy herds in southern Chile. Before culture all samples were treated with a decontaminant solution containing 0.9% hexadecylpiridinium chloride and an antibiotic solution containing amphotericin B, vancomycin and nalidixic acid. Herrold Egg Yolk Medium (HEYM and mycobactin J supplemented with the same antibiotics mentioned above was used for the isolation of the agent. Map was isolated from 40

  7. SUSCEPTIBILIDAD ANTIMICROBIANA DE AISLAMIENTOS DE Salmonella enterica PROVENIENTES DE PISOS, EQUIPOS, UTENSILIOS Y PRODUCTO TERMINADO EN PLANTAS DE BENEFICIO PORCINO EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    P. M. Bermúdez

    2016-01-01

    Full Text Available La diseminación de Salmonella spp. resistente a antimicrobianos en las cadenas productivas de alimentos de origen animal es una preocupación de salud pública de carácter mundial. Este estudio describe los patrones de resistencia antimicrobiana de 283 aislamientos de Salmonella enterica procedentes de plantas de beneficio porcino en Colombia. Se evaluó la susceptibilidad antimicrobiana frente a diez antimicrobianos mediante el método de difusión en disco: amoxacilina-ácido clavulánico (30 ug, ampicilina (10 ug, ceftiofur (30 ug, ciprofloxacina (5 ug, cloranfenicol (30 ug, florfenicol (30 ug, gentamicina (10 ug, sulfadiazina/trimetroprim (25 ug, tetraciclina (30 ug y tilmicosina (15 ug. Los resultados evidenciaron la presencia de 279 aislamientos multirresistentes de Salmonella enterica de origen porcino provenientes del ambiente y del producto terminado en las plantas de beneficio evaluadas (46,64% n: 132. Se detectaron 52 patrones de multiresistencia: el más común fue ceftiofur-tetraciclina-tilmicosina en el 9,89% (n: 28 de los aislamientos. Con referencia a estos antimicrobianos, 96,82% (n: 274 de los aislamientos fueron resistentes a tetraciclina, 73,14% (n: 207 a tilmicosina y 28,27% (n: 80 a ceftiofur. De especial interés fue la alta proporción de aislamientos resistentes a ceftiofur, debido a una posible resistencia cruzada con ceftriaxona. Los resultados obtenidos demuestran la necesidad de promover el diseño e implementación de un Programa oficial Integrado de Vigilancia de la Resistencia Antimicrobiana, además de sistemas de monitoreo voluntario en cada eslabón de la cadena productiva porcina, para contribuir a la prevención y control de la transmisión de microorganismos resistentes de origen alimentario en el marco del sistema de gestión de inocuidad alimentaria en Colombia.

  8. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  9. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast

  10. Caracterización de cristales de calcita bioprecipitada por un aislamiento nativo de Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Carolina Montoya

    2007-02-01

    Full Text Available Bacillus subtilis es una bacteria útil en algunas aplicaciones biotecnológicas por poseer enzimas como las amilasas, las cuales desempeñan un papel importante en diferentes procesos industriales. Una de sus propiedades, poco estudiada, ha sido su capacidad de inducir bioprecipitación química de carbonato de calcio (Ca2+ + HCO3 3> CaCO3 + H+ mediante un mecanismo similar al observado en la formación de rocas, suelos y estructuras biológicas como huesos, conchas y dientes. En esta investigación se estudiaron los cristales producidos por un aislamiento nativo de B. subtilis, tomado de una mina de oro situada en Segovia (Antioquia. Se determinó su capacidad calcificante utilizando el medio de cultivo B4. La caracterización del cristal producido se realizó con lupa binocular, microscopio petrográfico de luz plana polarizada (MOLP en su modo de luz transmitida, microscopio electrónico de barrido con analizador de estado sólido (ESEM/EDX y espectroscopía infrarroja con transformada de Fourier (FTIR. A partir de los resultados obtenidos por medio de la caracterización utilizando la combinación de las técnicas analíticas que se mencionaron, fue posible determinar que el aislado nativo de B. subtilis generó y por ende es productor de cristales de carbonato de calcio (CaCO3 en su forma polimórfica de baja temperatura (calcite.Palabras clave: Bacillus subtilis, calcita, bioprecipitación, mineralogía aplicada, biomineralogía.ABSTRACTBacillus subtilis, a bacterium useful in some biotechnology applications, contains enzymes such as amylases, which play an important role in several industrial processes. One of its properties, not very well studied, is its capacity to induce the chemical bioprecipitation of CaCO3 (Ca2+ + HCO3 —> CaCO3 + H+, a similar mechanism commonly observed in the formation of rocks, soils and biological structures like bones, shells and teeth. In this work we have studied carbonate crystals produced by a B

  11. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  12. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... in the News Press Room Assistance Society Overview Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  13. The thermal insulating materials and its coatings for underground piping; Los aislamientos termicos y sus recubrimientos para tuberias subterraneos

    Energy Technology Data Exchange (ETDEWEB)

    Salcido Lopez, Salvador [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    Energy Saving through the adequate selection and application of the thermal insulating materials, as well as its coatings for underground piping conducting fluids, both at high and at low temperature. The benefits are outlined at economical level for the investor as well as at ecological level (of vital importance today) and are observed as practical examples in industrial and commercial processes. [Espanol] Ahorro de energeticos mediante la adecuada seleccion y aplicacion de los aislamientos termicos, asi como de sus recubrimientos para tuberias subterraneas que conducen fluidos tanto en alta como en baja temperatura. Los beneficios son destacados tanto a nivel economico para el inversionista, como a nivel ecologico (de vital importancia en la actualidad), y son observados con ejemplos practicos en procesos industriales y comerciales.

  14. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  15. Ensayo de aislamiento acústico a ruido aéreo de los cerramientos exteriores y particiones realizados con paneles de madera

    Directory of Open Access Journals (Sweden)

    Pacios Álvarez, Antonia

    2007-06-01

    Full Text Available The house prototype of the Provisional Emergency House System uses wood and its derivatives for the facades, floor structure, roofing and partitions.  The extensive use of wooden panels for the construction and the lack of data, in Spain, about their acoustic behavior bring up the necessity to make in situ measurements of the acoustic isolation to airborne sound. Panels used for facades and partitions are built with a wooden framework and membrane of oriented strand board in both sides, for the facades, and of laminated plaster boards for the inner partitions. With the objective of verifying the sound insulation of the facades according to Spanish Standard UNE EN ISO 140-5, in situ measurements of airborne sound insulation of facade elements and facades have been made; according to Spanish Standard UNE EN ISO 140-4, in situ measurements of airborne sound insulation between rooms for internal walls have also been made. The procedure of the global insulation has been followed to measure the acoustic insulation of complete facades without making distinction between the elements that form it.El prototipo de vivienda del Sistema de Vivienda Provisional de Emergencia utiliza principalmente la madera y sus derivados tanto en los cerramientos y particiones como en el forjado y la cubierta. El empleo de soluciones constructivas ligeras y la falta de datos en España acerca del comportamiento acústico de los mismos plantea la necesidad de realizar mediciones in situ del aislamiento acústico a ruido aéreo. El panel base de cerramiento y particiones se construye partiendo de un entramado de montantes de madera con membrana en ambas caras de tableros de virutas de madera orientadas, para el caso de los cerramientos exteriores, y de tableros laminados de yeso para las particiones interiores. Con el objeto de comprobar el aislamiento acústico de dichos cerramiento se han realizado ensayos siguiendo la Norma UNE EN ISO 140-5 para la medición in situ del

  16. Resistencia a penicilina y otros antimicrobianos en 103 aislamientos clínicos de Streptococcus pneumoniae (2000-2001) Resistance to penicillin and other antimicrobials in 103 clinical isolations of Streptococcus pneumoniae (2000-2001)

    OpenAIRE

    J.J. García-Irure; A. Navascués; I. Martín; C. Gastesi

    2003-01-01

    Fundamentos. Conocer en nuestro hospital la sensibilidad a penicilina de aislamientos de Streptococcus pneumoniae, así como analizar la asociación de resistencia a penicilina y otros antimicrobianos y la actividad de cefotaxima y cefepima en cepas de Streptococcus pneumoniae resistentes a penicilina. Métodos. Se determinó la sensibilidad de 103 aislamientos de Streptococcus pneumoniae, procedentes de muestras clínicas durante los años 2000-2001, a penicilina, eritromicina, cloramfenicol, tetr...

  17. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  18. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  19. Aislamiento y caracterización molecular de bacteriófagos de bacterias enteropatógenas para biocontrol de enfermedades transmitidas por alimentos (ETA)

    OpenAIRE

    Dini, Cecilia

    2011-01-01

    Objetivos de la tesis: - Aislamiento de fagos de Escherichia coli enterohemorrágica (EHEC). - Caracterización de los fagos aislados. - Desarrollo de matrices de encapsulamiento de fagos y estudio in vitro de la capacidad protectora frente a la acidez para el suministro de bacteriófagos a bovinos por vía oral. - Determinación de las condiciones óptimas de conservación de los fagos. Departamento de Ciencias Biológicas

  20. Haemophilus influenzae : Caracterización de aislamientos recuperados de enfermedades invasivas en Cuba durante el período 2008-2011

    Directory of Open Access Journals (Sweden)

    Gilda Toraño

    2012-12-01

    Full Text Available Con el objetivo de caracterizar los aislamientos de Haemophilus influenzae, responsables de enfermedades invasivas en Cuba, en la etapa posterior a la vacunación se estudió el total de los recuperados durante el período 2008-2011, remitidos al Instituto "Pedro Kourí" desde diferentes provincias del país. La confirmación de especie y determinación de serotipos se realizó atendiendo al requerimiento de los factores V y X y empleando el método de aglutinación en lámina, respectivamente. Se definieron los biotipos a través de las pruebas de indol, urea y ornitina; se determinó la concentración mínima inhibitoria (CMI mediante la prueba del elipsómetro para la ampicilina, la ceftriaxona, el cloranfenicol y la rifampicina. Para 23 aislamientos se corroboró la identificación como H. influenzae : 21 fueron serotipables y 2 no tipables (HNT. El 90,4% de los serotipables fueron serotipo b y se detectaron dos serotipos a. Nueve aislamientos de H. influenzae b pertenecieron al biotipo I y los aislamientos, serotipo a y HNT, al biotipo II. En una cepa se demostró producción de la enzima ß-lactamasa y resistencia para la ampicilina y el cloranfenicol, con valores de CMI= 8 y 12 µg/mL, respectivamente. Se puso en evidencia que a pesar de la disminución de la incidencia de la enfermedad invasiva por Hib, este serotipo aún constituye el más frecuente y se alerta sobre la necesidad de una vigilancia sostenida que permita detectar fallos vacunales. La susceptibilidad antimicrobiana demostrada para este período pudiera considerarse como un beneficio adicional de la introducción de la vacunación en Cuba.

  1. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  2. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  3. Voltage pre-regulator without insulation with high efficiency; Pre-regulador de tension sin aislamiento con alta eficiencia

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ramos, Octaviano

    2003-04-15

    esta tesis se propone una nueva topologia de pre-regulador para fuentes de alimentacion con una alta eficiencia ({eta}), debido a una estrategia novedosa de manejo de la energia; asimismo corrige el FP. Esto representa un avance en lo que respecta a la investigacion sobre fuentes de alimentacion, debido a que normalmente dos parametros estan en oposicion: cuando se mejora la eficiencia ({eta}) se descuida el factor de potencia (FP), asimismo cuando se corrige el FP se descuida la {eta}, sin embargo es posible mejorar estos dos parametros al mismo tiempo aprovechando el concepto de pasar parte de la energia de entrada directo a la salida. El nuevo pre-regulador puede combinarse con reguladores tradicionales con aislamiento como el convertidor CD/CD flyback, o bien combinarse con reguladores de alta eficiencia como el llamado reductor de dos entradas. El regulador es necesario para obtener una fuente de alimentacion regulada con un alto factor de potencia y buena eficiencia. El documento de tesis esta organizado en cuatro capitulos. En el primer capitulo se examinan las propuestas de diversos autores, y finaliza con el planteamiento de la topologia propuesta para este trabajo de investigacion. El capitulo dos, titulado Teoria de operacion, analisis y diseno de la solucion propuesta, muestra las ecuaciones de diseno y formas de onda del convertidor propuesto que ayudan a entender su funcionamiento. En el capitulo tres, titulado Estrategia de control, se justifica el uso de un control no lineal debido a las caracteristicas de la topologia y el por que la utilizacion de modos deslizantes (SMC), se plantea el analisis y diseno de la etapa de control del convertidor propuesto por modos deslizantes. Ademas se presenta la forma en que se implemento fisicamente dicho control. El capitulo cuatro, titulado Analisis de resultados, se divide en dos partes: simulaciones y resultados experimentales. Adicionalmente se presenta un analisis comparativo entre la topologia propuesta y el

  4. Frecuencia de Aislamientos de Staphylococcus spp Meticilina Resistente en el Hospital Pediátrico "William Soler".

    Directory of Open Access Journals (Sweden)

    Leonora González

    2005-01-01

    Full Text Available Los Staphylococcus spp meticilina resistentes (SMR son importantes patógenos causantes de morbi-mortalidad en todo el mundo. Esta resistencia es mediada por la producción de una proteína de unión a penicilina alterada (PBP 2a, la cual tiene baja afinidad por los antibióticos beta-lactámicos y esta codificada por el gen mecA. Unos pocos antimicrobianos están disponibles para el tratamiento de estas infecciones, hoy en día la mayoría de los aislados permanecen sensibles vancomicina, única opción terapéutica en nuestro país, para el tratamiento de infecciones causadas por SMR. El presente estudio tuvo como objetivo determinar la frecuencia de aislamientos de SMR en el hospital pediátrico "William Soler". Fueron estudiados 128 aislados de Staphylococcus spp provenientes de muestras clínicas (32 Staphylococcus aureus y 96 Staphylococcus coagulasa negativos. La identificación de las especies se determino por el sistema Rapi Stha (Biomeriux. Los valores de concentración mínima inhibitoria (CMI, el crecimiento en placas de oxacilina y los patrones de resistencia de SMR a otros antimicrobianos, se realizaron siguiendo las recomendaciones de las guías NCCLS. Para la detección del gen mecA, se utilizo la reacción en cadena de la polimerasa. El 15% de los S. aureus y el 43% de los Staphylococcus coagulasa negativos fueron intrínsecamente resistentes a meticilina, CMI > 2 ¿g/mL y presentaban el gen mecA. Los SMR poseen resistencia cruzada a otras familias de antibióticos, especialmente macrolidos, no se encontró resistencia a vancomicina. Nosotros recomendados que se apliquen medidas de aislamientos a pacientes con infecciones por SMR, para evitar la diseminación de estos microorganismos.

  5. Issues Primer. EEE708 Negotiated Study Program.

    Science.gov (United States)

    Jennings, Leonie

    This issues primer is structured around a series of 20 contemporary concerns in the changing world of work and training in Australia in the early 1990s. It is part of the study materials for the one-semester distance education unit, Negotiated Study Program, in the Open Campus Program at Deakin University (Australia). Information on each issue is…

  6. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers

    Science.gov (United States)

    2007-10-31

    typically contain lead styphnate and antimony sulfide along with other constituents. Although highly effective, these heavy metal compounds have been...contain barium nitrate. Although not negatively categorized by the EPA itself, barium compounds are generally regarded as toxic and likewise should...contains the lead styphnate based FA956 composition2 which is a typical formulation of conventional military ammunition percussion primers. The

  7. A Primer on Policies for Jobs

    OpenAIRE

    Nallari, Raj; Griffith, Breda; Wang, Yidan; Andriamananjara, Soamiely; Derek H. C. Chen; Bhattacharya, Rwitwika

    2012-01-01

    A primer on policies for jobs is based on materials and input provided during the labor market courses conducted during the past 10 years. Its objective is to provide government policy makers, researchers, and labor market practitioners and other specialists with a practical guide on how to strengthen labor market institutions, especially in light of the global financial crisis. This prime...

  8. Characterization of some psorosis and concave gum isolates from northwestern Argentina Caracterización de aislamientos de psorosis y concave gum del noroeste argentino

    Directory of Open Access Journals (Sweden)

    Julia Figueroa

    Full Text Available The Citrus Sanitation Center of the Estación Experimental Agroindustrial Obispo Colombres in Tucumán, Argentina, has developed a virus bank of various graft-transmissible citrus pathogens found in northwestern Argentina. In this bank, several psorosis and concave gum isolates are maintained in Pineapple sweet orange seedlings. In order to characterize these pathogens, 11 isolates were indexed to seedlings of Pineapple sweet orange, Dweet tangor, Eureka lemon plus Etrog citron budded on rough lemon seedlings. Cross protection was applied for identifying psorosis-A. Symptoms obtained were variable and ranged from mild to very severe. A clear effect of temperature on symptom expression, and distinct differences in the reactions between psorosis-A and concave gum viruses were detected.El Centro de Saneamiento de Citrus de la Estación Experimental Agroindustrial Obispo Colombres, de Tucumán, Argentina, ha constituido un banco de virus de cítricos con material recolectado en la región noroeste del país. El mismo cuenta con varios aislamientos de psorosis y concave gum que se mantienen en plantas de naranjo dulce Pineapple. Con el objetivo de caracterizar biológicamente 11 de estos aislamientos, se inocularon plantines de naranjo dulce Pineapple, Dweet tangor, limonero Eureka y plantas injertadas de cidro Etrog en limoneros rugoso. Las pruebas con Pineapple se realizaron por duplicado bajo dos condiciones de temperatura: frías y calientes. La confirmación de psorosis A se realizó mediante prueba de protección cruzada con un aislamiento de psorosis B. Los resultados obtenidos muestran una amplia diversidad biológica entre los aislamientos, con expresión de síntomas que variaron desde suaves a muy severos. Se confirmó la presencia de psorosis A y se encontró que los aislamientos de "concave gum" del banco de virus no estaban en mezcla con psorosis. El efecto de la temperatura en la manifestación de los síntomas fue significativo y se

  9. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Ortiz Rojas Luz Yineth

    2012-03-01

    Full Text Available

    El análisis molecular del cistron, (ue codica para la proteina de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la pre- sencia de 65 nucleotidos adicionales (ue codican para (uince aminoãcidos, en la region amino de la secuencia de la proteina de la cubierta del aislamiento mexicano identicado con el nümero de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento DDDF6F, reportado en 1FF1 en Estados Unidos. El anãlisis logenHtico de 1I5  secuen- cias de la proteína de la cubierta de SCMV reportadas de Asia, África, Brasil y Argentina, entro otros, sugiere diJerentes origenes logeogrãcos de los aislamientos mexicanos. El aislamiento mexicano GU6N6OP5 es filogeneticamente mãs cercano a aislamientos de QCWV de Brasil X de EE.UU., mien- tras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son

    logenHticamente mãs cercanas al aislamiento mexicano EUDF1DN5. Las caracteristicas particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México X Brasil, sugieren un baYo control tosanitario en el intercambio de material vegetal.

  10. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2012-01-01

    Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.

  11. Aislamiento e identificación de Bacillus cereus a partir de dos variantes de arroz comercial (Oryza sativa L.

    Directory of Open Access Journals (Sweden)

    Irasema Pérez-Portuondo

    2011-01-01

    Full Text Available Bacillus cereus es una bacteria habitante común del suelo, de importancia tanto para la salud pública como para la Biotecnología. Con el objetivo de aislar ejemplares de esta bacteria para su utilización en estudios posteriores, así como de evaluar su permanencia en el arroz cocido, se desarrolló el protocolo propuesto por Kramer y cols. (1982. Con este fin, se tomaron muestras de arroz en grano con cáscara y de arroz cocido y se buscaron bacterias con propiedades hemolíticas y lecitinasa positiva. La identificación de los aislados se realizó mediante pruebas morfológicas y bioquímicas. Se obtuvieron 14 aislados, ocho de los cuales reunían las características distintivas de B. cereus, comparados con B. cereus ATCC 11778, incluida la resistencia a antibióticos. No se observó presencia de cuerpos parasporales típica de B. thuringiensis. Se comprobó que en el arroz cocido, transcurridas ocho horas de la cocción, pueden aislarse bacterias hemolíticas y lecitinasa positivas, en mayor número si este es conservado a temperatura ambiente, lo que convierte este alimento en potencialmente peligroso para su consumo. Estos resultados sugieren también la posibilidad de emplear al arroz como fuente para aislamiento de B. cereus.

  12. Técnicas de aislamiento y concentración de volátiles de aceites vegetales

    Directory of Open Access Journals (Sweden)

    Morales, M. T.

    1992-06-01

    Full Text Available One of the methods for food flavor evaluation is the analysis of volatile components. First step in this kind of analysis Is the isolation and concentration of volatiles. A review is carried out about different techniques applied in foods and especially in vegetable oils. Very different methods have been used, an explication of each one with its different cases are presented. Likewise the applications carried out in vegetable oils during last years are discussed.

    Uno de los métodos de evaluación del flavor de los alimentos consiste en la determinación de sus componentes volátiles. La primera etapa necesaria para realizar este tipo de análisis es el aislamiento y concentración de los mismos. Se ha realizado una revisión bibliográfica sobre las diferentes técnicas utilizadas para este fin en diferentes alimentos y especialmente en aceites vegetales. Los métodos utilizados son muy diversos, se ofrece una explicación de cada uno de ellos considerando las diferentes variantes existentes. Asimismo se detallan las aplicaciones realizadas en aceites vegetales durante los últimos años.

  13. Primer design using Primer Express® for SYBR Green-based quantitative PCR.

    Science.gov (United States)

    Singh, Amarjeet; Pandey, Girdhar K

    2015-01-01

    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  14. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  15. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    Science.gov (United States)

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  16. Genetics and health communication: a primer.

    Science.gov (United States)

    Greenberg, Marisa S

    2015-01-01

    The progress of genetic knowledge has been swift and steadfast. As we move forward in the genomic era, post Human Genome Project, and continue to explore how one's genes interact with one's environment, it becomes increasingly important for all audiences to have a firm grasp of the vocabulary used in this health context. This primer is intended to be used as a reference and to introduce and/or make more clear concepts related to genetics to increase understanding.

  17. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc -rich primers – General: internal funding in place through at least 2019 to...anodized aluminum, magnesium, high-strength steel with cadmium, aluminum and zinc - nickel , composites • Stress corrosion cracking and corrosion...this data, NAVAIR authorizes the use of PPG, Inc. – Deft 02-GN-084 over conversion coatings qualified to MIL-DTL-81706, Type I, Class 1A when used

  18. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians.

  19. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  20. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  1. Susceptibilidad de Delia platura a siete aislamientos de nematodos entomopatógenos de la zona Central Andina de Colombia

    Directory of Open Access Journals (Sweden)

    Carolina Jaramillo Contreras

    2013-07-01

    Full Text Available La mosca de la semilla, Delia platura, es una de las principales plagas en los cultivos de espinaca en la sabana de Bogotá. En Colombia la plaga es controlada mediante la aplicación de insecticidas y la información sobre su control sigue siendo limitada. Por ello el objetivo de este trabajo fue evaluar la susceptibilidad de D. platura a siete aislamientos de nematodos entomopatógenos de la zona Central Andina de Colombia. Además de evaluar diferentes dosis y producción de juveniles infectivos (JIs de la especie más virulenta, bajo condiciones de laboratorio. En el laboratorio se estableció la cría en papa amarilla (Solanum phureja para obtener larvas de tercer instar, las cuales se expusieron a 2500 JIs/especie NEPS. Seleccionada la especie más virulenta, se expuso D. platura a 500, 1000, 2000, 4000 y 8000 JIs/larva. Los mejores resultados obtenidos se encontraron con Steinernema sp3 con una mortalidad entre el 75 a 88% en las dosis de 4000 y 8000 JIs encontrando que la DL50 es de 1314JIs/larva y 15259 JIs/larva la DL95. Así mismo, se estableció que Steinernema sp3 se reproduce exitosamente en D. platura, encontrando un promedio de producción 670 ± 7.67 JIs/larva durante un periodo de dieciocho días. La mosca de la semilla es altamente susceptible a Steinernema sp3, el cual puede ser un agente potencial para el control de esta plaga.

  2. AISLAMIENTO DE ADN GENÓMICO DE Myrciaria dubia (HBK “CAMU CAMU” APROPIADO PARA ANÁLISIS MOLECULARES

    Directory of Open Access Journals (Sweden)

    Juan Carlos Castro Gómez

    2012-06-01

    Full Text Available Myrciaria dubia “camu-camu”, una especie nativa de la Amazonía que produce frutos con alto contenido de vitamina C y otras sustancias importantes. Sin embargo, los estudios moleculares de esta planta son escasos, por falta de un protocolo reproducible para purificar sus ácidos nucléicos. El objetivo de este trabajo fue establecer un protocolo para aislar el ADN genómico a partir de hojas de M. dubia, apropiado para análisis moleculares. El ADN se purificó con un protocolo modificado, la calidad y cantidad se estimó por espectrofotometría y electroforesis en gel de agarosa. Adicionalmente, la calidad se evaluó mediante RAPD. El ratio de calidad (A260/A280 promedio del ADN fue 1.9±0.1 y el espectro de absorción UV/Vis presentó un único pico de máxima absorbancia a 260nm. Mediante electroforesis el ADN fue íntegro y sin ARN. También, la síntesis de amplicones RAPD nos sugiere ausencia de inhibidores para polimerasas. La concentración promedio del ADN fue 99±33 ng/ml y el rendimiento promedio fue 237±80 mg ADN/g hoja. En conclusión, se ha establecido un protocolo de aislamiento de ADN genómico a partir de hojas de Myrciaria dubia “camu camu”, caracterizado por permitirnos obtener ADN de alta calidad y cantidad suficiente para análisis moleculares como el RAPD.

  3. Aislamiento de secuencias de cisteín proteasas expresadas en la interacción Brachiaria-Salivazo

    Directory of Open Access Journals (Sweden)

    Roda Fornaguera Federico

    2006-12-01

    Full Text Available El ataque del salivazo induce en genotipos resistentes de Brachiaria la transcripción de un mARN que codifica
    para una proteasa de la familia de las papainas. En tres genotipos del pasto, caracterizados por presentar
    diferentes grados de resistencia al insecto, se aislaron secuencias genómicas y cDNA de homólogos a este
    transcrito, candidato a mediador de la antibiosis. Estas secuencias conforman una familia génica en la cual
    habrían ocurrido recientes eventos de duplicación (la similitud entre ellas es superior al 97%. Las proteínas que se traducirían de estos genes (BCPs presentan las características distintivas de las papainas similares a
    Catepsinas L: una señal N-terminal de translocacion al ER, un propéptido inhibitorio con los motivos ERFNIN
    y GNFD y un dominio catalítico conservado. Las BCPs forman un clado muy divergente de los demás grupos
    de papinas reportados lo cual dificulta la realización de predicciones funcionales. Sin embargo (1 la detección
    de elementos reguladores en los mARNs, (2 el hecho de que las BCPs sean apoplásticas y similares a enzimas
    de xilema, y (3 el aislamiento de una proteasa truncada que podría tener un efecto inhibitorio sobre la BCP
    expresada en el suceptible infestado, permiten proponer rutas por las que se mediaría el efecto antibiótico.

  4. Aislamiento e identificación de patógenos de la estirpe silvestre del ajo (Allium sativum L.

    Directory of Open Access Journals (Sweden)

    Karina Astorga-Quirós

    2014-02-01

    Full Text Available El cultivo del ajo (Allium sativum L. en Costa Rica se podría convertir en una alternativa rentable para la producción y diversificación de los agricultores de hortalizas. Sin embargo, el tipo de reproducción vegetativa que presenta facilita la transmisión y diseminación de enfermedades, lo que provoca un debilitamiento progresivo de los bulbos. Actualmente, se buscan alternativas de manejo diferentes al control químico, para disminuir el impacto ecológico y ambiental de los patógenos que lo afectan. El control biológico es una de ellas, pero presenta dificultades para el aislamiento y la identificación certera de patógenos asociados a pudriciones que se dan en el suelo. Por lo anterior, el objetivo general de esta investigación consistió en aislar e identificar a nivel de especie cepas de Pseudomonas marginalis, Penicillium sp. y Sclerotium cepivorum a partir de material vegetativo de ajo en campo, para su utilización en futuros trabajos de control biológico de estas enfermedades. La metodología seguida permitió aislar e identificar con un alto porcentaje de certeza a P. marginalis, así como obtener cultivos monospóricos de Penicillium sp. y cultivos puros de S. cepivorum. Las técnicas descritas constituyen la base para futuros trabajos relacionados con las fitopatologías en el cultivo del ajo.

  5. Aislamiento y caracterización molecular de un fragmento de gen que codifica una polifenol oxidasa en lulo (solanum quitoense lam.) accesión ILS-388

    OpenAIRE

    Pulido Jiménez, Mauricio Antonio

    2009-01-01

    Se presenta el aislamiento y caracterización molecular de un fragmento de DNA genómico de lulo (Solanum quitoense Lam.) junto con evidencias que permiten postularlo como candidato a gen de polifenol oxidasa (ppo). Se diseñaron dos parejas de oligonucleótidos específicos que permitieron amplificar mediante PCR dos fragmentos de 950 y 920 pb correspondientes a las regiones 5´y 3?del gen| los productos de PCR fueron secuenciados y ensamblados para obtener una secuencia final de 1430 pb que pres...

  6. Identificación y aislamiento de una subpoblación de progenitores gliales SOX2+ de la sustancia blanca de cerebro humano adulto

    OpenAIRE

    Oliver de la Cruz, Jorge

    2013-01-01

    [ES]: Un número importante de enfermedades neurodegenerativas cursan con pérdida de mielina, lo que las hace candidatas para el desarrollo de terapias de reemplazo celular. La movilización de células madre neurales y/o progenitores gliales, junto a su aislamiento, expansión in vitro y posterior implantación, han sido propuestas como las dos aproximaciones más prometedoras. En este sentido, se ha descrito la existencia de células madre neurales de la zona subventricular (ZSV) y la ...

  7. “Determinantes genéticos asociados con la resistencia a cefalosporinas, aminoglicósidos y quinolonas en aislamientos hospitalarios de Acinetobacter Baumannii”

    OpenAIRE

    Medina Castro, Olga Esther

    2011-01-01

    139 aislamientos de Acinetobacter baumannii aislados de 4 hospitales colombianos entre el 2005 y 2009 se les detectaron varios genes de resistencia a antibióticos relacionados con el fenotipo de resistencia a cefalosporinas, aminoglicósidos y quinolonas. La presencia de la ISAba1 corriente arriba del gen blaADC se correlacionó con la resistencia a cefalosporinas. El integron de clase 1 se correlacionó con los genes de enzimas modificadoras de aminoglicósidos aadA1 y aacC1. La presencia del...

  8. Caracterización de los plásmidos presentes en tres aislamientos multirresistentes de: Acinetobacter baumannii, Acinetobacter nosocomialis y Acinetobacter pittii obtenidos en hospitales colombianos.

    OpenAIRE

    Rodríguez Méndez, Tatiana

    2014-01-01

    En las últimas décadas, el control de las infecciones asociadas al cuidado de la salud causadas por bacterias del género Acinetobacter se ha convertido en un problema global, ya que un gran porcentaje de aislamientos hospitalarios presentan resistencia a la mayoría de antibióticos de uso común, incluyendo: Penicilinas, cefalosporinas, aminoglicósidos, quinolonas, tetraciclinas, cloranfenicol y carbapenémicos; existen gran cantidad de estudios a nivel mundial que relacionan la presencia de ele...

  9. Aislamiento de Candida spp. y otras levaduras en el personal que labora en áreas críticas del Hospital San Juan de Dios

    OpenAIRE

    Pedro Carrillo-Dover; Carolina Álvarez-Vega; Ingrid Salas-Campos; Nury Mora-Brenes

    2009-01-01

    Justificación y objetivos: Los pacientes internados en hospitales, principalmente aquellos que se encuentran severamente enfermos, son más susceptibles a las infecciones por hongos oportunistas, en comparación con la población general. El personal hospitalario puede ser fuente potencial de infección para estos pacientes, ya que normalmente actúa como portador de gérmenes, que eventualmente podrían ser transmitidos a los pacientes. Se describe, en esta investigación, el aislamiento de hongos l...

  10. Modelo dinámico-probabilístico sobre el comportamiento de los pueblos indígenas en aislamiento de la Amazonia Ecuatoriana.

    OpenAIRE

    Heredia Rengifo, Marco G.; Hernández Díaz-Ambrona, Carlos Gregorio

    2013-01-01

    La supervivencia de los pueblos en aislamiento (PIAs), Tagaeri? Taromenane en la Amazonia ecuatoriana, está influida por agentes externos y características culturales. El área definida como Zona Intangible para el desplazamiento de los PIAs presenta cierta debilidad geográfica, lo que alterna el funcionamiento de estas comunidades. El objetivo de este trabajo es conocer el comportamiento de las comunidades aisladas en relación con las fronteras de contactos. Se ha utilizado el software libre ...

  11. Aplicación de las pruebas de PCR convencional simple y múltiple para la identificación de aislamientos de Leptospira spp. en Colombia Application of conventional and multiplex PCR assays for identification of isolates of Leptospira spp. in Colombia

    Directory of Open Access Journals (Sweden)

    Natali Moreno

    2010-12-01

    Full Text Available Debido a las dificultadas asociadas con la identificación serológica de aislamientos de Leptospira ssp, se genera gran interés en la pruebas moleculares por su poder discriminatorio, reproducibilidad y fácil interpretación. Objetivo. Aplicar y validar la prueba de PCR convencional, usando dos pares de iniciadores descritos previamente y dirigidos a los genes lipL32 (PCR simple y secY/flaB (PCR múltiple, con el fin de evaluar su aplicación para identificar especies patógenas y saprófitas de Leptospira spp. Materiales y métodos. Para la estandarización de las pruebas de PCR se usó 22 cepas de referencia internacional y 12 aislamientos colombianos. Se determinó el nivel de detección de cada pareja de iniciadores, su especificidad frente a otros microorganismos causantes de enfermedades endémicas en Colombia y su capacidad de identificar especies dentro del grupo de Leptospira. Resultados. El límite de detección de la PCR simple lipL32 fue una dilución 1:10000 y para la PCR múltiple secY/flaB fue una dilución 1:100 para el gen secY y 1:1000 para flaB. La especificidad de todos los iniciadores fue de 100%. La PCR simple lipL32, mostró amplificado específico para 21/22 cepas de referencia mientras que la PCR multiple secY/flaB lo fue para 18/22 cepas. De los 12 aislamientos colombianos, siete fueron positivos por PCR lipL32 y seis lo fueron por PCR secY/flaB. Conclusiones. Los resultados más consistentes fueron obtenidos con la PCR simple lipL32 tanto en límite de detección, especificidad y utilidad para la identificación de Leptospira spp, por lo que esta prueba es aplicable a la identificación molecular de aislamientos patógenos de Leptospira spp de diversas fuentes.Serological identification of Leptospira ssp isolates is difficult to achieve. Thus, molecular testing may be of great interest thanks to its high discrimination power, reproducibility and easy interpretation. Objective. To implement and validate conventional

  12. Estudio de la epidemiología molecular y resistencia antibiótica de aislamientos clínicos de Acinetobacter baumannii del Hospital Clínico Universitario Viergen de la Arrixaca

    OpenAIRE

    García Lucas, Teresa

    2016-01-01

    Objetivos: El principal objetivo de este estudio fue determinar el mecanismo de resistencia a carbapenems mediante métodos fenotípicos y genotípicos, en aislamientos de Acinetobacter baumannii, así como conocer la epidemiología molecular de estas cepas mediante diferentes técnicas de tipificación molecular. Metodología: Se realizó el estudio de 239 aislamientos de A. baumannii procedentes de 101 pacientes ingresados en la unidad de Reanimación (REA) y en la Unidad de Cuidados Intensivos ...

  13. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  14. Spectrophotometric determination of tetrazene in primers and primer mixes by use of resorcinol.

    Science.gov (United States)

    Norwitz, G; Keliher, P N

    1979-06-01

    A spectrophotometric method is proposed for the determination of tetrazene (tetracene) in primers and primer mixes that involves treatment of the tetrazene with resorcinol solution and measurement of the intensity of the yellow colour of the diazo-dye produced. In the application of the method, lead styphnate and barium nitrate are first removed by extraction with ammonium acetate solution and then nitrocellulose and PETN are removed by extraction with acetone. The insoluble matter containing the tetrazene is boiled with resorcinol reagent, the solution filtered, and the absorbance measured at 400 nm. Conditions for optimum colour development are studied and the nature of the reaction is considered.

  15. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  16. Emulsion primers, their contribution to bonding

    OpenAIRE

    González Sburlati, Rubén Osmar; Sapei, José

    2014-01-01

    Asphalt irrigation in its various types, performs specific functions in the structure of a road during the construction phase or their service life. In particular, the so-called "Irrigation Primer " is used in underlying layers, in order to generate a transition surface with the new asphalt layer; thus the tack or prime coat will be placed on a surface to ensure a good bond with the overlying layer. For a long time Diluted Asphalts (Cut Back mediums) where used, but have been discontinued for...

  17. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  18. An engineering primer on extreme value statistics

    Energy Technology Data Exchange (ETDEWEB)

    Novog, D.R.; Hoppe, F. [McMaster Univ., Hamilton, Ontario (Canada); Nainer, O. [Bruce Power, Tiverton, Ontario (Canada); Phan, B. [Ontario Power Generation, Toronto, Ontario (Canada)

    2009-07-01

    This primer is intended for individuals interested in gaining an understanding of Extreme Value Statistics (EVS). This work provides an explanation of EVS at a level that can be accessible to most people with an engineering or science background. While this work represents a simplification of the discussions from Reference 1, it is hoped that the authors will forgive any liberties taken in this paper. Some of the simplifications presented here may not be rigorous in all aspects, but the sacrifice in rigour is intended to aid the fundamental understanding of the EVS formulation and basic application. (author)

  19. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  20. Precedentes musulmanes y primer arte cristiano

    OpenAIRE

    Cabañero Subiza, Bernabé

    2006-01-01

    La comarca de las Cinco Villas en la que en los siglos X y XI no existió ningún centro artístico de primer orden en el que se crearan concepciones espaciales y soluciones formales propias. Por eso los monumentos de esta comarca pertenecientes a dichas centurias constituyen en casi todos los casos manifestaciones periféricas de corrientes artísticas creadas y desarrolladas fuera de sus confines. Esta llegada de soluciones formales foráneas a las Cinco Villas es tanto más explicable si...

  1. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  2. AISLAMIENTO, IDENTIFICACIÓN Y CARACTERIZACIÓN DE NUCLEOPOLIEDROVIRUS NATIVOS DE SPODOPTERA FRUGIPERDA EN COLOMBIA ISOLATION, IDENTIFICATION AND CHARACTERIZATION OF NATIVE NUCLEOPOLYHEDROVIRUS OF SPODOPTERA FRUGIPERDA IN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Juliana Andrea Gómez Valderrama

    2010-12-01

    Full Text Available El gusano cogollero del maíz Spodoptera frugiperda (J.E. Smith es considerado la plaga más importante del cultivo en el mundo. En varios países se han empleado exitosamente los nucleopoliedrovirus de la familia Baculoviridae para su control. Sin embargo, en Colombia, no se cuenta ningún bioplaguicida viral registrado para el control de la plaga. En el presente trabajo, se realizó la búsqueda de aislamientos nativos de nucleopoliedrovirus en los departamentos de Tolima, Meta y Córdoba, mediante la recolección de larvas en diferentes cultivos. Las muestras fueron analizadas por microscopía para la búsqueda de partículas virales y los aislamientos encontrados se caracterizaron física y biológicamente. Se recolectaron 2.140 larvas de S. frugiperda en los tres departamentos muestreados. Sin embargo, sólo en un lugar (Cereté, Córdoba, se encontraron larvas con síntomas de infección viral en campo. El 2% de las muestras colectadas mostraron síntomas típicos de infección y en total se identificaron 3 aislamientos codificados como NPV003 (Córdoba, NPV009 (Tolima y NPV011 (Meta. Los aislamientos presentaron un tamaño de partícula entre 1,93 µm y 2,14 µm. Las concentraciones letales medias (CL50 sobre larvas neonatas oscilaron entre 2,2 x 105 CI/mL y 7,0 x 105 CI/mL y no se registraron estadísticas entre los aislamientos, sugiriendo que todos tienen la misma patogenicidad sobre larvas neonatas del insecto. Estos virus nativos representan la base para el desarrollo de una nueva alternativa biológica para el control de la plaga, siendo necesario iniciar los estudios para su formulación.Worldwide, the fall armyworm Spodoptera frugiperda (J.E. Smith is considered the most important pest of maize crop. Nucleopolyhedrovirus of Baculoviridae family have been successfully used in several countries for its control. However, in Colombia there are not any biopesticide registered for the control of this pest. In the present work, native

  3. Aislamiento de microorganismos productores de biosurfactantes y lipasas a partir de efluentes residuales de camales y suelos contaminados con hidrocarburos

    Directory of Open Access Journals (Sweden)

    Lizzie Karen Becerra Gutiérrez

    2016-01-01

    Full Text Available Los biosurfactantes son moléculas anfipáticas que reducen la tensión en la interfase, incrementando así la solubilidad en agua y disponibilidad de compuestos orgánicos, son producidos por bacterias, hongos, y levaduras. Para el aislamiento de bacterias productoras de biosurfactante y lipasas, se sembró en medios inductores 10% de efluentes residuales procedentes de camales y suelos de grifos contaminados con hidrocarburos de la Provincia de Trujillo - Perú. Los cultivos aislados se sembraron en agar lecitina y agar rodamina para la determinación de productores de lipasas. Los microorganismos seleccionados se sembraron en agar sangre y agar Siegmund y Wagner (SW para la selección preliminar de bacterias biosurfactantes. Posteriormente se determinó a aquellos microorganismos productores de surfactantes mediante Índice de Emulsificación (IE y Medición de la Tensión superficial. Los cultivos positivos a estas pruebas fueron seleccionados e identificados mediante galerías API e identificación molecular por secuenciamiento de ADN. Los cultivos que redujeron en mayor medida la tensión superficial fueron P. aeruginosa y B. amyloliquefaciens, llegando a reducir la tensión superficial a 27,2 ± 0,4 y 31,03 ± 0,4 mN/m respectivamente, mientras que P. stutzeri y Pseudomonas sp. redujeron la tensión superficial a 48,3 y 52,6 ± 0,4 mN/m respectivamente. Se concluye, por tanto, que se obtuvo 49 cultivos productores de lipasas de la provincia de Trujillo, de los cuales se determinó que Pseudomonas stutzeri, Pseudomonas sp, Pseudomonas aeruginosa y Bacillus amyloliquefaciens son productores de biosurfactantes y pueden aplicarse en el área de la biotecnología ambiental para la remoción y biodegradación de contaminantes.

  4. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  5. GENOMEMASKER package for designing unique genomic PCR primers

    Directory of Open Access Journals (Sweden)

    Kaplinski Lauris

    2006-03-01

    Full Text Available Abstract Background The design of oligonucleotides and PCR primers for studying large genomes is complicated by the redundancy of sequences. The eukaryotic genomes are particularly difficult to study due to abundant repeats. The speed of most existing primer evaluation programs is not sufficient for large-scale experiments. Results In order to improve the efficiency and success rate of automatic primer/oligo design, we created a novel method which allows rapid masking of repeats in large sequence files, for example in eukaryotic genomes. It also allows the detection of all alternative binding sites of PCR primers and the prediction of PCR products. The new method was implemented in a collection of efficient programs, the GENOMEMASKER package. The performance of the programs was compared to other similar programs. We also modified the PRIMER3 program, to be able to design primers from lowercase-masked sequences. Conclusion The GENOMEMASKER package is able to mask the entire human genome for non-unique primers within 6 hours and find locations of all binding sites for 10 000 designed primer pairs within 10 minutes. Additionally, it predicts all alternative PCR products from large genomes for given primer pairs.

  6. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  7. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  8. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  9. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  10. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  11. [Analysis of effectiveness of cDNA synthesis, induced using complementary primers and primers containing a noncomplementary base matrix].

    Science.gov (United States)

    D'iachenko, L B; Chenchik, A A; Khaspekov, G L; Tatarenko, A O; Bibilashvili, R Sh

    1994-01-01

    We have studied the efficiency of DNA synthesis catalyzed by M-MLV reverse transcriptase or Thermus aquaticus DNA polymerase for primers (4-17 nucleotides long) either completely matched or possessing a single mismatched base pair at all possible positions in the primer. It has been shown that DNA synthesis efficiency depends not only on the position of mismatched base pair but on the length and primary structure of the primer. The enzyme, template, and primer concentrations determine the relative level of mismatched DNA synthesis.

  12. Aislamiento de Candida spp. y otras levaduras en el personal que labora en áreas críticas del Hospital San Juan de Dios

    Directory of Open Access Journals (Sweden)

    Pedro Carrillo-Dover

    2009-09-01

    Full Text Available Justificación y objetivos: Los pacientes internados en hospitales, principalmente aquellos que se encuentran severamente enfermos, son más susceptibles a las infecciones por hongos oportunistas, en comparación con la población general. El personal hospitalario puede ser fuente potencial de infección para estos pacientes, ya que normalmente actúa como portador de gérmenes, que eventualmente podrían ser transmitidos a los pacientes. Se describe, en esta investigación, el aislamiento de hongos levaduriformes a partir de las manos y la cavidad oral, en un grupo de 77 trabajadores del Hospital San Juan de Dios, en servicios donde se han reportado más casos de infecciones por este tipo de hongos. Métodos: Se realizó un hisopado de cavidad oral y manos de cada participante y se cultivaron placas con agar glucosado de Sabouraud (AGS y Mycosel. A los aislamientos de levaduras se les determinó la capacidad de crecimiento a 37°C, resistencia a la cicloheximida, producción de tubo germinativo, fosfolipasas y proteinasas y se determinó la sensibilidad in vitro al fluconazol por medio de método de microdilución en placa. Resultados: El 72,7% de los participantes resultaron positivos para el aislamiento de levaduras, la especie aislada con mayor frecuencia fue Candida parapsilosis, seguida de C. albicans y C. famata. La mayor positividad se obtuvo en el servicio de Cirugía 3 (83.3%, seguido de la UCI (71.4% y Neonatología (58%. Conclusión: Estos resultados instan a mejorar las acciones preventivas en el manejo de los pacientes, a ser más estrictos en las normas de higiene de manos y promover, en otros centros hospitalarios, la realización de este tipo de estudios, para disminuir los brotes nosocomiales por transmisión horizontal.

  13. AISLAMIENTO Y CARACTERIZACIÓN MORFOLÓGICA DE Rosellinia pepo Pat. EN PLANTAS DE MACADAMIA ISOLATION AND MORPHOLOGICAL CHARACTERIZATION OF Rosellinia pepo Pat. IN MACADAMIA PLANTS

    Directory of Open Access Journals (Sweden)

    Carmen Eliana Realpe Ortiz

    2006-12-01

    Full Text Available El hongo Rosellinia pepo Pat., causante de la llaga estrellada, se considera uno de los principales problemas fitosanitarios de la macadamia por ocasionar la muerte de la planta en su etapa productiva. Debido a que no existe una metodología de aislamiento confiable que asegure la recuperación del hongo con un porcentaje mínimo de contaminación y los estudios relacionados con este patógeno son escasos se planteó una investigación con el fin de perfeccionar una metodología de aislamiento y realizar algunas caracterizaciones morfológicas de este patógeno. La nueva metodología permitió obtener aislamientos con un 91,26% de pureza del hongo. La tasa de crecimiento fue de 4,68 mm día-1. Las colonias son de color blanco y apariencia algodonosa en su inicio, pero a medida que envejece el micelio toma un color café o negro y su apariencia se torna quebradiza. La observación de micelio blanco en forma de estrella en el lado interior del medio sintético permite diferenciarlo de otras especies como R. bunodes. Las mediciones microscópicas de los hinchamientos piriformes presentaron en promedio 106,4mm de largo y 75,3mm de ancho. Este trabajo también permitió determinar el nivel de inóculo infectivo.The fungus Rosellinia pepo Pat, the causal agent of star gall, is considered to be a main phytosanitary problem to the Macademia tree by causing the death of the tree while in its productive stage. Because no reliable isolation method exists that assures recovery of the mushroom with a minimum percentage of contamination and studies of this pathogen are scarce. This study was conducted to perfect an isolation methodology and permit some morphological characterizations of this pathogen. The new methodology allowed isolations with 91,26% purity of mushroom to be obtained. The rate of growth was 4,68 mm day-1. The colonies were of white color and cottony appearance in the beginning, but as the micelio aged it assumed a brown or black color and a

  14. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  15. Aislamiento y cultivo de protoplastos en Maracuyá Isolation and cultive of protoplast in passion fruit

    Directory of Open Access Journals (Sweden)

    Rivera Rodríguez Ricardo

    2004-12-01

    Full Text Available En este trabajo se ajustaron las condiciones para la regeneración de plántulas a partir del cultivo de protoplastos, proceso indispensable para avanzar hacia la obtención de híbridos somáticos. Se realizó el aislamiento de protoplastos a partir de cotiledones y hojas de plántulas in vitro de Passiflora edulis var. flavicarpa; estos explantes fueron sumergidos en solución CPW13M para inducir plasmólisis. Posteriormente se ensayaron tres combinaciones enzimáticas, los mayores rendimientos fueron 6,48 x 106 y 4,60 x 106 protoplastos viables /500 mg de tejido, obtenidos respectivamente con la
    combinación de Celulasa R-10 al 1% y Pectolyasa Y-23 al 0,05% a partir de hojas y la solución enzimática Celulasa al 2% y Macerozima al 0,4% para cotiledones. Las mejores densidades de cultivo para los protoplastos fueron 5 x 104 protoplastos/ml para los obtenidos de cotiledones y 1,5 x 105 protoplastos/ml para los aislados de hojas, empleando el sistema de cultivo en gotas de medio KM8p solidificadas con agarosa al 0,6% y recubiertas con medio líquido KM8p con 100 g/l de glucosa y cefotaxim 300 μg/ml. Con las primeras divisiones celulares, se empezó a disminuir el nivel osmótico al renovar el medio líquido con la mezcla de medio KM8p:KM8 en proporción 3:1 y se continuó cada siete días en proporciones 2:1, 1:1 y 1:3 hasta la obtención de colonias y callos. Los callos fueron transferidos a medio MS con 2 mg/l de BAP y 1 mg/l de AIB para inducir la regeneración en condiciones de iluminación; después de seis semanas de cultivo se diferenciaron yemas, posteriormente fueron subcultivadas a medio MS sin reguladores de crecimiento para su enraizamiento.
    In this research we adjust the protoplasts culture and regeneration conditions, necessary to advance into somatic hybrids obtention. Isolation of Passiflora edulis var. flavicarpa protoplasts from in vitro seedlings cotyledons and leaves was carried out. These tissues were

  16. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  17. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  18. High-speed measurement of firearm primer blast waves

    CERN Document Server

    Courtney, Michael; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast pressure of 8.2-25.0%. 3) Combined with smaller blast waves, these large variations in peak blast pressure of DDNP-based primers led to delayed ignition and failure to fire in brief field tests.

  19. DNA sequencing technology, walking with modular primers. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  20. Aislamiento y caracterización de microorganismos con actividad lipolítica provenientes de sedimentos del Humedal El Jaboque (Bogotá, Colombia

    Directory of Open Access Journals (Sweden)

    Valencia Zapata Hernando

    2006-12-01

    Full Text Available En el humedal el Jaboque (Engativá Bogotá, Colombia, se aislaron microorganismos lipolíticos provenientes de
    sedimentos, mediante la utilización de medios de cultivo selectivos (agar tributirina, agar aceite de girasol. Primero se evaluó la concentración del sustrato (aceite de girasol en la cual se encontraba el mayor número de morfotipos aislados, luego se comparó la eficiencia de los dos medios de cultivo de acuerdo a la cantidad de morfotipos aislados. Se evaluaron tres concentraciones diferentes de sustrato. Se aisló un total de 18 cepas pertenecientes a los géneros Bacillus, Pseudomonas, Acinetobacter, Streptomyces, Penicillium, Alternaria. Los medios evaluados constituyen alternativas sencillas de aislamiento de microorganismos con actividad lipolítica en sedimentos.

  1. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  2. Perfiles genéticos (IS6110 y patrones de resistencia en aislamientos de M. tuberculosis de pacientes con tuberculosis pulmonar. Lima Sur, Perú

    Directory of Open Access Journals (Sweden)

    Luis Capcha A

    2005-03-01

    Full Text Available Objetivos: Conocer los perfiles genéticos de M. tuberculosis y determinar el patrón de resistencia a drogas en una población de sujetos infectados provenientes del sur de Lima mediante el marcador genético IS6110 (RFLP-IS6110. Materiales y Métodos: Entre octubre de 2002 y abril de 2003 se incluyeron pacientes mayores de 15 años con tuberculosis (TB pulmonar frotis positivo procedentes de servicios de salud del distrito Villa María del Triunfo y del Hospital María Auxiliadora. Se realizó la prueba de sensibilidad a las cuatro drogas de primera línea rifampicina (RIF, isoniacida (INH, estreptomicina (SM y etambutol (EMB por el método de proporciones, y la genotipificación mediante el método estándar de RFLP-IS6110. Se recolectó información de los casos de los registros del establecimiento e historias clínicas. Resultados: De 118 aislamientos de M. tuberculosis se identificaron 97 perfiles genéticos variando entre 2 a 15 bandas por perfil. El 29,7% de los aislamientos dio origen a 14 grupos o clusters genéticos mientras que el resto mostró patrones variables de bandas. De otro lado, los perfiles de resistencia revelaron que cerca de 33% de los sujetos participantes nunca tratados presentaron resistencia a drogas y 58% de los tratados con anterioridad. La multidrogoresistencia fue de 8,42% y 36% en los nunca y anteriormente tratados respectivamente. Conclusiones: Nuestro análisis revela la existencia de grupos genéticos con relación epidemiológica o clonal sin evidencia de transmisión de cepas resistentes a múltiples drogas.

  3. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  4. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  5. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  6. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Technology Data Exchange (ETDEWEB)

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  7. A physicists guide to The Los Alamos Primer

    Science.gov (United States)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  8. Study on gene sensor based on primer extension

    Institute of Scientific and Technical Information of China (English)

    陈誉华; 宋今丹; 李大为

    1997-01-01

    Based on the fact that the resonant frequency of a piezoelectric crystal is the function of its surface deposit, and that the primer extends after it hybridizes with the template, the primer extension gene sensor technique was developed. The prominent feature of the technique is that fast and sensitive frequency signals are used as the monitoring system of gene hybridization and primer strand extension. Results show that this technique may be used in homologous analysis of nucleic acid, trace DNA detection, and determining the integration of DNA. It may also be used for isolation of target gene, gene mutation analysis, and predicting the location of a gene in its genome.

  9. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  10. MultiPLX: automatic grouping and evaluation of PCR primers.

    Science.gov (United States)

    Kaplinski, Lauris; Remm, Maido

    2015-01-01

    In this chapter we describe MultiPLX-a tool for automatic grouping of PCR primers for multiplexed PCR. Both generic working principle and step-by-step practical procedures with examples are presented. MultiPLX performs grouping by calculating many important interaction levels between the different primer pairs and then distributes primer pairs to groups so that the strength of unwanted interactions is kept below user-defined compatibility level. In addition it can be used to select optimal primer pairs for multiplexing from list of candidates. MultiPLX can be downloaded from http://bioinfo.ut.ee/?page_id=167. Graphical web-based interface to most functions of MultiPLX is available at http://bioinfo.ut.ee/multiplx/.

  11. Electrocoat Process for Non-Chromate Primers in DOD Manufacturing

    Science.gov (United States)

    2012-08-29

    Performance Benefits of Electrocoat Environmental, Health, and Safety Considerations • Aqueous based • Minimal waste discharge- closed loop...Electrocoat has larger area of blistering ; all surface corrosion • Spray primers have more localized, but deeper corrosion Scribe near fastener

  12. A Pollen Primer | NIH MedlinePlus the Magazine

    Science.gov (United States)

    ... please turn Javascript on. Feature: Managing Allergies A Pollen Primer Past Issues / Summer 2011 Table of Contents ... National Institute of Environmental Health Sciences (NIEHS) . Plant Pollen Ragweed and other weeds, such as curly dock, ...

  13. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    eliminate the lead styphnate and barium nitrate components in the current 20mm electric primer for the purposes of protecting our troops, production...Lead nitrate is added to the magnesium bis(trinitroresorcinol) to form lead styphnate and magnesium nitrate. The additional ingredient, barium ...conventional lead styphnate primers. On small scale samples, outstanding all-up round action times (AUR-ATs) were obtained for ambient (2.92 ms) and

  14. El medio de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y otros hongos patógenos Modified Kaminski agar for the isolation of dermatophytes and some other pathogenic fungi

    Directory of Open Access Journals (Sweden)

    Fernando Montoya

    1989-01-01

    Full Text Available

    Se evaluaron 3 medios de cultivo de composición diferente (Mycobiotic agar, agar de Kaminski y agar de Kaminski adicionado con nistatina para el aislamiento de dermatofitos y el reaislamiento de S. schenckii y hongos negros, agentes de cromomicosis. Con el objeto de puntualizar diferencias entre dichos medios se determinaron, para cada uno, la frecuencia de aislamiento de los hongos, sus características morfológicas y su tiempo de crecimiento, así como la rapidez e Intensidad de la contaminación bacteriana y/o micótica. Se estudiaron 150 muestras de pacientes con sospecha clínica de dermatofitosis y se hicieron 30 reaislamientos de S. schenckiiy 10 de agentes de cromomicosis. Se demostró la utilidad del agar de Kaminski modificado, tanto para el aislamiento como para el reaislamiento de los agentes señalados, a pesar de su mayor índice de contaminación microbiana. Fue, además, útil para el aislamiento de levaduras del género Candida.

    Three culture media with different composition (Mycobiotic agar, Kaminski agarand Kaminski agar modified with nystatin were evaluated for isolation of dermatophytes and reisolation of S. schenckiiand dematiaceous fungi. One hundred and fifty specimens of cases suspicious of dermatophytosis, as well as 30 strains of S. schenckiiand 10 of chromoblatomycosis agents were studied. The modified Kaminski agar was efficient for the isolation and reisolation of the tested agents, in spite of Its greater contamination rate; It was equally adequate for isolation of Candida species.

  15. Valoración de enfermería: detección de la soledad y del aislamiento social en los ancianos de riesgo Nursing assessment: detection of loneliness and social isolation in old people in risk

    Directory of Open Access Journals (Sweden)

    Montserrat Puig Llobet

    2009-03-01

    Full Text Available Objetivo: Identificar los instrumentos de valoración que pueden ser de utilidad en la profesión enfermera para detectar la soledad y el aislamiento social en los ancianos de riesgo. Metodología: Se ha realizado una revisión de los instrumentos multidisciplinares que valoran la soledad y el aislamiento social, a partir de bases de datos y búsqueda manual de diagnósticos y escalas que determinen la soledad y el aislamiento social en la Taxonomía NANDA y la Taxonomía Nursing Outcomes Classification (NOC. Resultados: De los once instrumentos analizados, siete de ellos estiman la soledad tanto de forma subjetiva como objetiva. Sin embargo, existen diferencias en la forma de valoración. Conclusión: Las escalas de valoración social y de soledad son un elemento útil en la detección de ancianos con riesgo de percibir y sufrir la soledad. Los resultados corroboran que los profesionales de enfermería tienen herramientas adecuadas en la detección de los factores de riesgo de la soledad y del aislamiento social.Objectives: Identify the valuation instruments that can be useful in the nursing profession to detect loneliness and social isolation in the elderly at risk. Methodology: The review of multidisciplinary instruments that value the loneliness and social isolation from databases and search manual diagnostic and scales to determine the loneliness and social isolation in the NANDA Taxonomy and Taxonomy Nursing Outcomes Classification (NOC. Results: Of the eleven instruments analyzed, seven of them feel the loneliness of both subjective and objective manner. However, differences exist in the form of valuation. Conclusions: The scales of social value and loneliness are a useful element in the detection of elderly at risk of perceiving and suffer loneliness. The results confirm that nursing professionals have adequate instruments to detect the risk factors of loneliness and social isolation.

  16. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  17. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  18. Características de aislamientos de Rhizoctonia solani Huhn y su importancia como patógenos de Stylosanthes guianensis (Aubl. Sw.

    Directory of Open Access Journals (Sweden)

    Lenne Jilliam M.

    1986-06-01

    Full Text Available Se encontró considerable variación en el crecimiento, color, zonificación, esclerocios, textura del micelio y en la virulencia de siete aislamientos de R. solani. Como seis aislamientos fueron multinucleados y uno binucleado, se demostró que es indispensable determinar ésta característica en ensayos con R. solani. Los aislamientos se ubicaron en los grupos de anastomosis AG -1, AG-2, AG-4; pero en los ensayos con electroforesis de isoenzirnas los modelos de bandas para los a islamientos probadores de los AG y los probados en éste estudio fueron diferentes, lo que llevó a cuestionar la importancia de los AG. Los ecotípos de Centrosema spp y P. phaseoloides fueron más afectados que los de S. guianensis, D. ovalifolium y S. capitata. La reacción al daño de R. solani fue diferencial en los ecotipos CIAT 1283 (tardío y 184 (común y tuvo mucha relación con la edad; en general, la enfermedad se incrementó con la edad en el eco tipo tardío y disminuyó con ésta o fue independiente en el ecotipo común; el ecotipo más fectado fue el tardío; las pérdidas de forraje no fueron considerables, pero el efecto en la digestibilidad fue notorio; la capacidad de rebrote fue buena en 184. Se observó un estímulo en el crecimiento de las plantas de S.guianensis y D. ovalifolium.Considerable variation was found in the growth, color, zonation, sclerotia, mycelial texture and virulence of seven isolates of R. solani. Six multinuclease and one binuclease isolates were determined, demonstrating that it is indispensable to determine this characteristic in trials with this pathogen. The isolates were placed in three anastomosis group AG -1, AG -2 and AG -4; but with electrophoresis of isoenzymes it was found that the band models were different for the known rest AG iso lates and those isolates proven in this study which questions the importance of anastomosis qroups. Ecotypes of Centrosema spp. and P. phaseoloides were more affected than those of S

  19. Análisis de Vías Libres para mantenimiento partiendo de las Configuraciones de Aislamiento. // Analysis of free access for maintenance starting from isolation configurations.

    Directory of Open Access Journals (Sweden)

    A. Torres Valle

    2005-01-01

    Full Text Available La seguridad durante las intervenciones de mantenimiento se trata de manera limitada y en general independiente de lossistemas de gestión del mantenimiento. Esta variable está afectada por múltiples factores de tipo técnico o humano, muchasveces subjetivos y difíciles de cuantificar, lo que limita el diseño de planes preventivos. Sin embargo, algunos factoresconstituyen puntos comunes: las configuraciones de aislamiento durante las vías libres y los errores humanos asociados a suviolación. Esta característica permitió desarrollar el análisis de tales situaciones a través de la metodología de árboles defallos que vincula coherentemente fallos de equipos y errores humanos. La metodología ha sido automatizada dentro delcódigo MOSEG Win Ver 1.0 y la misma puede abarcar desde el análisis de una situación particular de vía libre hasta el deuna estrategia completa de mantenimiento desde el punto de vista de la seguridad del personal mantenedor.Palabras Claves: Vía libre, configuración de aislamiento, árbol de fallos, errores humanos, estrategias demantenimiento._____________________________________________________________________________Abstract.Safety during maintenance operations have been studied in a limited way and generally isolated from the maintenancemanagement system. Safety is affected by multiple both technical and human factors, of a subjective nature and difficult toquantify, this limits its value for designing preventive plans. However, some factors constitute common points namely:isolating configurations during the work protection code and human errors associated with its violation. Such situationswere able to be analyzed by following this feature through the fault tree methodology that matches equipment failures andhuman errors coherently. The methodology is automated as part of MOSEG Win Ver 1.0 code. It ranges from the analysisof particular situations up to complete maintenance strategy from the point of view of

  20. Aislamiento de hongos solubilizadores de fosfatos de la rizósfera de Arazá (Eugenia stipitata, Myrtaceae Isolation of phosphate solubilizer fungi from Araza rhizosphere

    Directory of Open Access Journals (Sweden)

    Valencia Hernando

    2002-06-01

    Full Text Available Arazá (Eugenia stipitataMcVaugh, es una planta originaria de la región amazónica,que ha sido descrita como especie promisoria ya que su fruto comestible presentaexcelentes posibilidades de comercialización (Quevedo, 1995. El frutal muestra unaelevada productividad aún en suelos con muy bajo contenido de fósforo. La presenciade microorganismos solubilizadores de fosfatos podría contribuir a aumentar la dispo-nibilidad de este macroelemento. Dado que no se han publicado estudios al respecto,durante esta investigación se realizó el aislamiento y la caracterización de hongos so-lubilizadores a partir de 12 muestras de suelo en cultivos de Arazá, procedentes de 2Unidades Fisiográficas (paisajes del departamento del Guaviare (Colombia, utilizandoel método de lavado de suelo. Se obtuvieron 18 aislamientos de hongos a partir de1.152 agregados de suelo, los cuales demostraron capacidad de solubilizar fosfato nodisponible, procedente de 2 fuentes diferentes (hidrogenofosfato de calcio y fosfato dehierro III hidratados. Los principales solubilizadores del fosfato de calcio fueron Trichodermaaureoviride, Aspergillus aculeatus, Trichodermacepa 1 y Trichodermacepa 2 y para el fosfatode hierro: Aspergillus oryzae, Paecilomycescepa 3, Gongronella butleriy Fusarium oxysporum.Araza is an eatable plant, original from the Amazon region which has been describedas a promising species for commercialization (Quevedo 1995. This plant has highproductivity even in low content phosphate soil but the presence of phosphatesolubilizazing microorganisms may contribute to increase this element availability.In this study we report the isolation and characterization of solubilizing fungiprocessed using the soil washing method, from soil samples were Araza is cultivated attwo regions in Guaviare, Colombia. Eighteen isolates of fungi capable of solubilizingphosphate were obtained from 2 different sources. The most importat species that solubilized phosphate from

  1. Perfiles genéticos (RFLP-IS6110 y resistencia a drogas en aislamientos de M. tuberculosis de pacientes internados en un hospital referencial del Callao, Perú

    Directory of Open Access Journals (Sweden)

    Christian Baldeviano V

    2003-04-01

    Full Text Available Objetivo: evaluar la frecuencia y el agrupamiento de los perfiles genéticos (RFLP-IS6110 y los niveles de resistencia a drogas en aislamientos de M. tuberculosis de pacientes hospitalizados con tuberculosis pulmonar frotis positivo (TBP-FP en un hospital general de la provincia del Callao, Lima, Perú. Materiales y métodos: se incluyeron pacientes con TBP-FP hospitalizados en el Hospital Nacional Daniel A. Carrión entre agosto de 2000 y febrero de 2001. Se realizó la prueba de sensibilidad a las cuatro drogas de primera linea (INH, RIF, SM, EMB por el método de las proporciones y la genotipificación mediante el método estándar de RFLP-IS6110. Se recolectó la información de los pacientes de los registros de laboratorio e historias clínicas. Resultados: en 74 aislamientos, el número de bandas en los perfiles genéticos variaron entre 2 y 16, 4 perfiles (5,5% mostraron menos de 5 bandas. En total 50 perfiles genéticos fueron obtenidos de 70 pacientes. 34 aislamientos (48,6 % se agruparon en 14 "clusters" y 36 tuvieron ocurrencia única. La resistencia a drogas en pacientes nunca y antes tratados fue 45,2% y 71,1%, respectivamente. La multidrogorresistencia fue 16,1% y 36,8%, respectivamente. 10 de los 14 "clusters" incluyeron por lo menos un aislamiento resistente y un cluster agrupó 6 aislamientos resistentes. Conclusiones: No se encontró evidencia de algún genotipo predominante en la población estudiada. Sin embargo, se observaron «clusters» agrupando pacientes con TB sensible y resistente. Nuestros resultados sugieren que existen genotipos asociados a resistencia lo cual indicaría transmisión activa de cepas resistentes en la provincia del Callao. Es necesario llevar a cabo un estudio poblacional para confirmar nuestros resultados.

  2. Novel multiple 5'-amino-modified primer for DNA microarrays.

    Science.gov (United States)

    Han, Jing; Lee, Hin; Nguyen, Nga Yen; Beaucage, Serge L; Puri, Raj K

    2005-08-01

    For DNA microarray analysis, total RNA is reverse-transcribed, labeled by incorporating fluorescent dye into the cDNA, and used to hybridize microarray. This protocol requires a minimum of 20 microg of total RNA. To overcome the sample limitation, an RNA amplification technique has been developed. Although it needs less RNA, this amplification technique is relatively expensive, time consuming, and, unfortunately, has been found to introduce bias. In this study, we designed a novel 5'-amino-modified primer and used it for priming cDNA synthesis. The novel primer has a special structure that contains four Uni-Link molecules with two nucleotide (thymine) residues inserted between them as spacers. This novel primer is used in the reverse-transcription reaction for cDNA synthesis. Using the novel 5'-modified primer combined with indirect labeling method, cDNA probes can be prepared with much less total RNA (5 microg or less) without amplification producing optimal results after hybridization of arrays. This primer can also be used to label nucleotides for other purposes.

  3. Friction Stir Welding of Shipbuilding Steel with Primer

    Directory of Open Access Journals (Sweden)

    José Azevedo

    2016-03-01

    Full Text Available Abstract Friction Stir Welding has proven its merits for welding of aluminium alloys and is focused in expanding its material database to steel and titanium and also to assess new joint configurations. The use of welded structures in shipbuilding industry has a long tradition and continuously seeks for innovation in terms of materials and processes maintaining, or even, reducing costs. Several studies have been performed in the past years on FSW of steel. However, just recently were reported defect-free welds, free of martensite with stable parameters in steel without Primer. FSW of steel with primer has not been addressed. This work aims to fulfil a knowledge gap related to the use of friction stir for welding shipbuilding steel by analysing the effect of welding parameters on the metallurgical characteristics and mechanical properties of welds obtained with an innovative FSW tool in joining steel plates with a primer. Welds were performed in 4mm thick GL-A36 steel plates painted with a zinc based primer followed by a detailed microscopic, chemical and mechanical analysis. The results that matching fatigue properties are obtained using this technique, in FSW of shipbuilding steel with Primer.

  4. Isolation and Characterization of Potential Phytase-Producing Fungi from Environmental Samples of Antioquia (Colombia Aislamiento y Caracterización de Hongos Productores de Fitasa a partir de Muestras Ambientales de Antioquia (Colombia

    Directory of Open Access Journals (Sweden)

    Maritza Ocampo Betancur

    2012-06-01

    Full Text Available Abstract. Phytases are enzymes used as feed additive that enhance the phosphorus and mineral uptake in monogastric animals and reduce the level of phosphate excretion in their manure. Due to their easy cultivation and high production of extracellular enzymes, filamentous fungi are one of best sources of phytase for use in the feed industry. Phytase has been found principally in the genera Aspergillus, Penicillium, Mucor and Rhizopus. In this work, we report the isolation and characterization of environmental fungi producers of phytase with potential use as feed additives. Samples were collected from soils, fruits and cereals in Antioquia (Colombia. A total of 26 fungal strains were isolated and identified using ITS sequencing and morphological analysis. Strains belonged to the following genera: Penicillium, Aspergillus, Fusarium, Mortierella, Pestalotiopsis, Phoma, Paecilomyces and Rigidoporus. Fifty percent of isolates exhibited halos in phytase screening agar indicating that acidic phytases are common enzymes secreted by environmental fungi. Ten isolates were also able to grow in liquid phytase screening medium revealing their potential use for enzyme production in submerged fermentations. Molecular detection of the PhyA gene from Aspergillus was achieved. Partial sequence of the phyA gene from one A. niger isolate was obtained and analyzed.Resumen. Las fitasas son enzimas utilizadas como aditivo en productos de alimentación animal, con el fin de mejorar la asimilación de fósforo y minerales en animales monogástricos y disminuir la excreción de fósforo al ambiente. Los hongos filamentosos son una de las mejores fuentes de fitasas debido a su facilidad de cultivo y altos niveles de producción de enzimas extracelulares. Los principales productores de fitasas corresponden a miembros de los géneros Aspergillus, Penicillium, Mucor y Rhizopus. En este trabajo se reporta el aislamiento y caracterización de hongos ambientales productores de

  5. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base......, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer...

  6. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  7. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site.......(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus......Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching tRNA...

  8. Aislamiento e identificación bioquímica de microorganismos bacterianos a partir de infecciones de piel en caninos

    Directory of Open Access Journals (Sweden)

    Iovana Castellanos L.

    2011-12-01

    Full Text Available Las dermatitis bacterianas o piodermas en caninos son ocasionadas por microorganismos patógenos, de los cuales el Staphylococcus intermedius es el más frecuente. Los tratamientos empíricos de este grupo de enfermedades permiten la proliferación de cepas resistentes de importancia en salud pública como es el caso del S. aureus. De igual forma, el riesgo de zoonosis reversa a partir de mascotas portadoras de cepas resistentes crea un serio problema de salud pública que requiere vigilancia epidemiológica. El objetivo de la investigación fue aislar e identificar bioquímicamente los microorganismos presentes en infecciones de piel en caninos; para esto se obtuvieron las muestras de caninos con problemas dermatológicos, y se identificaron los microorganismos bacterianos involucrados utilizando el kit de identificación rápida BBL Crystal para grampositivos. Los resultados obtenidos demostraron que el 80% de los aislamientos correspondieron a S. intermedius. Sin embargo, es necesario realizar estudios moleculares para relacionar la severidad de las lesiones dermatológicas con la identificación de los estafilococos presentes en el pioderma, y así establecer medidas de control, tratamiento y profilaxis.

  9. Screening para el aislamiento y caracterización de microorganismos y enzimas potencialmente útiles para la degradación de celulosas y hemicelulosas

    Directory of Open Access Journals (Sweden)

    Mikán Venegas José Fernando

    2004-07-01

    Full Text Available Se presenta un modelo práctico de microbiología aplicada y biotecnología para aislar y caracterizar microorganismos, como una minús­cula muestra de la extensa biodiversidad de nuestros suelos. Se analiza su capacidad para producir depolimerasas e hidrolasas accesorias para la degradación de xiloglucanos-pectatos o glucoarabinoxilanos, con el fin de evaluar su potencial como degradadores de material vegetal. Se propone el uso del cultivo en paredes celulares vegetales como única fuente de carbono, como inductores de las actividades hidrolíticas, y el uso de las mismas paredes celulares y de xilano entrecruzado para purificar en forma rápida y económica enzimas degradadoras de celulosas y hemicelulosas. Con estos soportes de afinidad se logró un redimiento de purificación de xilanasas del 500% en un solo paso. Partiendo de 65 aislamientos se seleccionaron cinco, a los cuales se les hizo caracterización isoenzimática para celulasas y xilanasas. Se les sugiere como potencialmente útiles en compostaje y otros procesos industriales. Palabras clave: celulasas, hemicelulasas, cromatografía de afinidad, sustratos entrecruzados, diversidad microbiológica, compostaje.

  10. The insulation condition diagnosis of high tension generator stators; Diagnostico del estado de aislamiento de estatores de generadores de alta tension

    Energy Technology Data Exchange (ETDEWEB)

    Robles Pimentel, Edgar Guillermo; Rosales Sedano, Inocente [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1989-12-31

    The high tension electrical generators are very high cost equipment, therefore they need to be very reliable. The generators preventive maintenance based in diagnosis techniques of the insulation condition might mean substantial savings for the user. In this article the most common techniques employed all over the world are presented, the greatest part of them already implemented in Mexico by the authors. The techniques and the equipment employed are analyzed and are exemplified with the results obtained in some field experiences. [Espanol] Los generadores electricos de alta tension son equipos de muy alto costo, por lo que necesitan ser muy confiables. El mantenimiento preventivo de los generadores basado en tecnicas de diagnostico del estado del aislamiento puede significar ahorros sustanciales al usuario. En este articulo se presentan las tecnicas mas comunes empleadas en el mundo, la mayor parte de ellas ya implantadas en Mexico por los autores. Se analizan las tecnicas y el equipo empleado, y se ejemplifica con resultados obtenidos de algunas de las experiencias en el campo.

  11. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  12. A High Temperature Hermetic Primer and a Variable Spring Tester

    Energy Technology Data Exchange (ETDEWEB)

    Begeal, D.R.

    1994-05-01

    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  13. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  14. Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

    Science.gov (United States)

    Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

    2008-01-01

    In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera.

  15. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  16. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  17. The development, characterization and testing of magnesium-rich primers

    Science.gov (United States)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  18. Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification

    OpenAIRE

    2012-01-01

    “Barcode-tagged” PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.

  19. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  20. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  1. STITCHER 2.0: primer design for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-03-30

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.

  2. STITCHER 2.0: primer design for overlapping PCR applications

    Science.gov (United States)

    O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin

    2017-01-01

    Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011

  3. Análisis espacio-temporal de aislamientos del Citrus tristeza virus de Yucatán y Tamaulipas Spatio-temporal analysis of Citrus tristeza virus isolates from Yucatán and Tamaulipas

    Directory of Open Access Journals (Sweden)

    Patricia Rivas-Valencia

    Full Text Available Se estudiaron huertas comerciales de cítricos (Citrus sinensis L., ubicadas en las principales regiones productoras de Yucatán de 2003 a 2006 y en Tamaulipas en 2004. En Yucatán se realizó un estudio espacio-temporal de la dispersión de la tristeza de los cítricos, ocasionada por el Citrus tristeza virus, en presencia de Toxoptera citricida Kirkaldy. La incidencia inicial (X0 fue de 4.41% y la final (Xf de 39.33%. Los índices de agregación de Morisita y Lloyd dependientes del tamaño óptimo de cuadrante, mostraron un patrón agregado con valores entre 1.41 y 2.39. Además, se caracterizaron molecularmente aislamientos del Citrus tristeza virus, para examinar la diversidad del virus presente. Se analizaron aislamientos del virus con single-strand conformation polymorphism, observándose hasta dos haplotipos por aislamiento y tres tipos de patrones en Yucatán. En Tamaulipas, con la caracterización molecular, se identificaron tres haplotipos por aislamiento y siete patrones. El coeficiente de similaridad calculado para estas dos poblaciones de aislamientos fue de 0.7, asumiéndose un origen común de ambas poblaciones. El análisis de varianza molecular, indicó mayor variabilidad dentro de las poblaciones (69% y entre ellas (31%, comprobando que ambas regiones citrícolas, comparten variantes caracterizadas como de tipo moderado, mismo que puede justificar la ausencia de sintomatología atribuible a tristeza. Los análisis realizados para identificar el patrón de dispersión de los aislamientos en campo no evidenciaron la dispersión entre árboles e hileras.Citric (Citrus sinensis L. commercial vegetable gardens were studied, located in the main producing regions of Yucatán from 2003 to 2006 and in Tamaulipas in 2004. In Yucatán it was carried out a space-time study of dispersion of citric tristeza, caused by Citrus tristeza virus, in presence of Toxoptera citricida Kirkaldy. The initial incidence (X0 was of 4.41% and the final (Xf

  4. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  5. In vitro antimicrobial susceptibility in clinical isolates of Enterococcus species Susceptibilidad antimicrobiana in vitro en aislamientos clínicos de Enterococcus species

    Directory of Open Access Journals (Sweden)

    Ernesto Calderón-Jaimes

    2003-04-01

    Full Text Available OBJECTIVE: To describe the antimicrobial activity of several antimicrobial agents against 97 clinical significant isolates of Enterococcus spp. MATHERIAL AND METHODS: During a 2-year prospective study at Instituto Nacional de Pediatria (National Institute of Pediatrics in Mexico City. Ninety seven strains of Enterococcus spp. (60 E. faecalis and 37 E. faecium were tested against 11 antibiotics. Susceptibility tests were performed with agar, according to the standards of the sNational Committee for Clinical Laboratory Standards (NCCLS. Isolates were screened for high-level resistance (HLR to beta-lactams, aminoglycosides, glycopeptides and other antibiotics, as well as for vancomycin-phenotypes. Differences between proportions were evaluated with chi2 of Fisher exact fest. RESULTS: Overall resistance rates to the antibiotics tested were: 17/97 (17.5% to penicillin, ampicillin, amoxicillin-clavulanate and imipenem. There was neither HLR nor beta-lactamase production; 74/97 (48.4% were resistant to erythromycin; 60% to ciprofloxacin; 31/97 (32% to gentamicin, and 55/97 (56.7% to streptomycin. Seven strains were vancomycin-resistant enterococci (VRE, all of them identified as E. faecium; 5/7 with Van A and 2/7 with Van B phenotypes. All the isolates were susceptible to linezolid. The difference in susceptibility among species was significant. CONCLUSIONS: Mutidrug-resistant enterococci is a real problem and continuous surveillance is necessary. The microbiology laboratory is the first line of defense against the spread of multiantibiotic-resistan enterococci in the hospital environment . All the strains recovered should be tested for susceptibility to ampicillin, streptomycin, gentamicin and glycopeptides.OBJECTIVO: Describir la actividad antimicrobiana de varios antibióticos, contra 97 cepas de Enterococcus spp., consideradas como aislamientos clínicamente significativos. MATERIAL Y MÉTODOS: En un estudio prospectivo de dos años, (enero de 1998

  6. Aislamiento y selección de una cepa bacteriana degradadora de hidrocarburos a partir de suelos contaminados con petróleo

    Directory of Open Access Journals (Sweden)

    Rosa María Pérez Silva

    2008-01-01

    Full Text Available El conocimiento científico acerca del papel que desempeñan los microorganismos en el tratamiento de agentes contaminantes del medio ambiente como el petróleo, es esencial para prevenir y controlar los daños que puedan ocasionar los derrames o fugas de estos contaminantes. La degradación de petróleo es un proceso que puede ocurrir de forma natural por los microorganismos nativos de las zonas contaminadas aprovechando sus rutas metabólicas. Por esta razón, en estos momentos se prevé que los microorganismos pueden ofrecer esta posibilidad en tecnologías basadas en el uso de estos en la remediación de la contaminación ambiental por petróleo y sus derivados. En el presente trabajo, se estudió la biodegradación de petróleo por cepas aisladas de suelos contaminados con petróleo, mediante un aislamiento realizado por enriquecimiento secuencial utilizando petróleo Mesa 30/Puerto escondido (80 : 20 como única fuente de carbono y energía. Se aislaron 9 cepas bacterianas, cinco Gram negativas y cuatro Gram positivas, que fueron identificadas según el Manual Bergey's, 1994. Las pruebas bioquímicas evaluadas confirmaron que las cepas aisladas AT14, AT15, AT16, AT17 y AT18 corresponden a Pseudomonas aeruginosa. En este estudio, se seleccionó la cepa Pseudomonas aeruginosa AT18, por mostrar mayor crecimiento sobre petróleo como única fuente de carbono y energía al obtenerse 1,83 g/L de biomasa celular, lo que representa un 57 % de biodegradación de petróleo.

  7. DETERMINACIÓN DE Escherichia coli 0157 A PARTIR DE PRODUCTOS CÁRNICOS Y LÁCTEOS ARTESANALES EMPLEANDO DOS SISTEMAS DE AISLAMIENTO

    Directory of Open Access Journals (Sweden)

    Franco U. Lina

    2001-06-01

    Full Text Available Con el objeto de determinar la presencia de E.coli 0157 en alimentos, se analizaron 300 muestras de productos cárnicos y lácteos artesanales. Para su aislamiento e identificación se utilizaron dos técnicas; una tradicional donde después de seis horas de incubación de la muestra en agua peptonada al 1% suplementada con novobiocina (20 mg!L se inocularon placas con agar Mac Conkey Sorbitol. Por medio de esta técnica se identificó Esclzericlzia coli 0157 a partir de una sola muestra (0.33% de las 300 analizadas correspondiente a un derivado cárnico (hamburguesa; también se identificó E.coli en un 1.6%. Simultáneamente se realizó una técnica rápida con Agar Fluorocult, para E.coli 0157: H7, y de las trescientas muestras aisladas se identificaron microorganismos como Esclzericlzia coli 0157 (0.33%, E. coli (25%, Slzigella sonnei (10% , E. aerogenes (9%, P. mirabilis (4% . De las dos técnicas ensayadas estas presentaron el mismo porcentaje de recuperación de Esclzericlzia coli 0157.El método rápido, utilizando Agar Fluorocult, para E. coli O157: H7 permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en 48 horas. En contraste el método tradicional utilizando agar Mac Conkey Sorbitol permitió obtener resultados presuntivos para E. coli 0157 en 24 horas y resultados confirmatorios en cinco días. Los métodos y técnicas utilizadas permiten que este estudio pueda reproducirse fácilmente con resultados puntuales.

  8. Análisis de la diversidad genética de 21 aislamientos del hongo Moniliophthora roreri basado en marcadores RAPD

    Directory of Open Access Journals (Sweden)

    Boris Gutarra Castillo

    2013-12-01

    Full Text Available Objetivos: Estudiar la diversidad genética de 21 aislamientos del hongo que afecta al cultivo del cacao, Moniliophthora roreri, en tres zonas cacaoteras del Perú (Tocache, Mariscal Cáceres y Leoncio Prado. Métodos: Se utilizó 14 iniciadores RAPD (random amplified polymorphic DNA polimórficos y una pareja de oligonucleótidos, los que fueron empleados bajo condiciones de amplificación estandarizadas. Con los datos obtenidos se construyó un dendograma utilizando el coeficiente de Jaccard y el algoritmo UPGMA (Unweighted Pair-Group Method using Arithmetic Average. La estructura genética fue estimada en función del análisis molecular de variancia (AMOVA y la diversidad mediante los índices de Shannon y Nei. Resultados: Fueron conseguidas 59 bandas RAPD con un 73% de polimorfismo. El dendograma obtenido a un índice de similitud de 0,70, claramente dividió los individuos en tres grupos. El análisis de la diversidad genética mostró altos valores en las zonas estudiadas de acuerdo con el índice de Shannon (0,3936 y de Nei (0,2622, con mayor riqueza en Leoncio Prado. Estas zonas presentan alta variabilidad, y según el AMOVA realizado: 88% entre accesiones por zona y solo 12% entre zonas. Conclusiones: Existe más de un grupo genético de Moniliophthora roreri en la Amazonía del Perú. Estos grupos, provenientes del Ecuador, pudieron haber ingresado por el intercambio de semillas y/o de forma natural por medio de los ríos en común y estarían originando nuevos grupos genéticos locales.

  9. Energy saving by means of air conditioning equipment replacement and the household application of thermal insulation; Ahorro de energia electrica por reemplazo de equipos de aire acondicionado y aplicacion de aislamiento termico en viviendas

    Energy Technology Data Exchange (ETDEWEB)

    Peralta Solorio, Jose Luis [Fideicomiso para el Ahorro de la Energia (Mexico)

    2005-07-15

    An extension study of the Financing Program for Energy Saving looked for the evaluation of the electric energy saving potential obtained by the replacement of air conditioning equipment and the application of thermal insulation in 30 houses of two Mexican cities with warmth climate. In a joint effort with Comision Federal de Electricidad the consumption files of the users were analyzed and field measurements of electric demand and of refrigeration were made. As a following step the change of the refrigeration necessities derived from the application of thermal insulation were evaluated as well as the energy efficiency improvement obtained by the substitution of the air conditioning equipment and the favorable results obtained by the implementation of both measures - thermal insulation and change of air conditioning equipment in a joint form. This way, as a conclusion, the optimum sequence of application of these measures is revealed. [Spanish] Un estudio extension del Programa de Financiamiento para el Ahorro de Energia Electrica busco evaluar el potencial de ahorro de energia electrica alcanzado por el reemplazo de equipos de aire acondicionado y la aplicacion de aislamiento termico en 30 viviendas de dos ciudades mexicanas con clima calido. En un esfuerzo conjunto con la Comision Federal de Electricidad se analizaron los historiales de consumo de los usuarios y se efectuaron las mediciones de campo de demanda electrica y de refrigeracion. Como paso siguiente se valoro el cambio en las necesidades de refrigeracion derivado de la aplicacion de aislamiento termico al igual que la mejora en eficiencia energetica obtenida por la sustitucion de aire acondicionado y se identificaron los resultados favorecedores arrojados por la implementacion de ambas medidas -aislamiento termico y cambio de equipo de aire acondicionado- en forma conjunta. De esta manera, como conclusion, se devela la mas optima secuencia de aplicacion de estas medidas.

  10. Importancia del aislamiento y del rango de concentración de conidias en el efecto de Trichoderma asperellum sobre el crecimiento de plántulas de Solanum lycopersicum L.

    Directory of Open Access Journals (Sweden)

    Sebastián Reynaldi

    2013-06-01

    Full Text Available Normal 0 21 false false false ES-MX X-NONE X-NONE Título en inglés: Importance of strain and concentration range of conidia in the effect of Trichoderma asperellum on the growth of tomato seedlings Solanum lycopersicum L.Resumen El crecimiento longitudinal de tallos y raíces fue investigado en plántulas de tomate (Solanum lycopersicum L, luego de la aplicación de cuatro aislamientos de Trichoderma asperellum: T25, T46, T84 y T109. Sólo la aplicación del aislamiento T109 causó un incremento significativo (p ≤ 0,05 del crecimiento longitudinal de tallos y raíces. El peso seco de las plántulas también fue estimulado desde la primera semana luego de la aplicación de T109. El crecimiento fue estimulado significativamente (p ≤ 0,05 por la aplicación de 105 y 106 conidias/ml, pero no lo fue por la aplicación de 104, 107 y 108 conidias/ml. Estos resultados indican que el estímulo del crecimiento producido por T. asperellum en plántulas de tomate, sólo ocurre con aislamientos particulares y un rangos de concentración específicos.Palabras claves: Trichoderma asperellum, Estímulo del crecimiento, Plántulas de tomate, Aislamientos de Trichoderma, Rango de concentraciones.AbstractLongitudinal growth of shoot and roots was investigated in tomato seedlings (Solanum lycopersicum L after application of four isolates of T. asperellum (T25, T46, T84 y T109. Only the isolate T109 caused a significant (p ≤ 0.05 increase of longitudinal growth of roots and shoots, and dry weight of seedlings was also stimulated from the first week after T109 application. The growth was significantly (p ≤ 0.05 stimulated by 105 and 106 conidia/ml, but it was not by 104, 107 and 108 conidia/ml. These results indicate that growth stimulus caused by T. asperellum in tomato seedlings, occurs only with specific isolates and at a specific concentration ranges. Key words: Trichoderma asperellum, Growth stimulation, Tomato seedlings, Trichoderma strains

  11. Aislamiento de especies termotolerantes de Campylobacter de aguas fluviales utilizando dos métodos de colecta Isolation of thermotolerant species of Campylobacter from river water using two collection methods

    OpenAIRE

    Fernandez, H; L. OTTH; M. Wilson

    2003-01-01

    Campylobacter jejuni y C. coli son agentes zoonóticos de infecciones intestinales que pueden contaminar cuerpos de agua. Varios brotes de gastroenteritis por Campylobacter asociados al consumo de agua han sido descritos. En este estudio se compara el rendimiento de los métodos de la tórula de Moore (MSM) y de filtración por membrana para el aislamiento de Campylobacter en 181 muestras de agua obtenidas del curso urbano del río Calle-Calle. En el 24.3% de las muestras obtenidas por MSM y en el...

  12. Aislamiento, caracterización genética y análisis filogenético de Rickettsia massiliae, Ciudad Autónoma de Buenos Aires

    OpenAIRE

    Gabriel L Cicuttin

    2016-01-01

    Rickettsia massiliae es un miembro del grupo de la fiebre manchada del género Rickettsia que fue aislado por primera vez en una garrapata Rhipicephalus turanicus de Francia. En el nuevo mundo, se detectó en garrapatas Rhipicephalus sanguineus de diferentes lugares de Argentina y EE.UU., pero sólo fue aislada en Arizona. El objetivo de este estudio fue el aislamiento y la caracterización genética de R. massiliae desde garrapatas R. sanguineus colectadas en perros de la Ciudad Autónoma de Bueno...

  13. VARIABILIDAD GENÉTICA DE AISLAMIENTOS COLOMBIANOS DE Phytophthora infestans (Mont de Bary EN SOLANÁCEAS CULTIVADAS EN COLOMBIA GENETIC VARIABILITY OF ISOLATES OF Phytophthora infestans (Mont. de Bary IN SOLANACEOUS CROPS FROM COLOMBIA

    Directory of Open Access Journals (Sweden)

    Natalia Raigosa Gómez

    2009-06-01

    Full Text Available Se estudio el nivel de variabilidad genética de una población de 35 aislamientos de Phytophthora infestans obtenidos en diferentes hospedantes y regiones geográficas de Colombia, mediante las técnicas de haplotipos mitocondriales y RAPD. Los resultados encontrados sugieren la existencia en el país de los haplotipos mitocondriales Ia en los aislamientos que afectan tomate de árbol (Solanum betaceum y IIa en cultivos de papa; dichos haplotipos están asociados a los linajes genéticos EC-3 y EC-1, respectivamente. Sin embargo, tres aislamientos obtenidos en tomate de mesa (S. lycopersicum, pimentón (Capsicum sp. y pepino de agua (S. muricatum requieren de un análisis posterior, debido a la falta de correlación entre los perfiles de restricción generados con los cuatro pares de cebadores utilizados en esta prueba y los haplotipos mitocondriales mencionados en la literatura. De otra parte, mediante cuatro cebadores RAPD, fue posible encontrar variabilidad al interior de los dos linajes genéticos, siendo interesante el hecho que los aislamientos obtenidos en tomate de árbol (EC-3 fueron divididos en dos grupos, relacionados con una distancia genética de 0,17. Estos hallazgos indican que es importante contemplar las fuentes de variación asexual en el análisis de la estructura poblacional de este oomycete y por tanto en el diseño de las estrategias de control de las enfermedades que causa P. infestans en cultivos de solanáceas de importancia económica.The level of genetic variability of 35 isolates of Phytophthora infestans obtained from different hosts and geographical regions of Colombia was studied through mitochondrial haplotypes and RAPD techniques. Results suggested the existence of mitochondrial haplotypes Ia affecting tree tomato (Solanum betaceum and IIa in potato, which are associated with genetic lineages EC-3 and EC-1, respectively. However, three isolates obtained from tomato (S. lycopersicum, capsicum (Capsicum sp. and

  14. Nuevo dispositivo para el aislamiento de la fracción estromal vascular a partir de lipoaspirados humanos: método de obtención y análisis de calidad celular

    OpenAIRE

    S. Dos-Anjos; J. Mercader; Katz, A. J.; Llull, R.

    2013-01-01

    El tejido adiposo obtenido mediante liposucción es una fuente idónea para aislar células con potencial terapéutico, las denominadas células de la fracción estromal vascular (FEV), que incluyen células madre mesenquimales. Estas células se han convertido en una de las principales herramientas de terapia celular autóloga para diversas aplicaciones médicas, y en los últimos años se han ido desarrollando diversas tecnologías para su aislamiento y uso clínico. En este trabajo presentamos un nuevo ...

  15. Utilización del medio Mrs-s en el aislamiento de bacterias lácticas mesofilas en leche de cabra Utilización del medio Mrs-s en el aislamiento de bacterias lacticas mesofilas en leche de cabra

    Directory of Open Access Journals (Sweden)

    Fortes F. Celia L. de Luces

    1990-12-01

    Full Text Available Con el fin de evaluar el MRS-S (Sorbato al 0.10% en el aislamiento de bacterias lácticas se cultivaron muestras de leche de cabra cruda en MRS-S y PCA en profundidad y se incubaron en aerobiósis a 320C durante 48 horas. Los cocos gram positivos, catalasa negativos que crecieron en MRS-S se aislaron y sometieron a caracterización preliminar a través del crecimiento en agar MRS-S, MRS-T (tetraciclina 0.20 µg/ml, N-L (bacterias aromáticas, reducción de la leche tornasolada a 40 y 21oC y crecimiento a 45 y 10oC.Las cepas seleccionadas se sometieron a caracterización fisiológica y Bioquímica. El medio MRS-S mostró ser efectivo con un porcentaje de inhibición de la flora indeseable del 86.56%, y adecuado por el aislamiento de Lactococcus. De acuerdo con los perfiles taxonómicos se consiguió aislar de un total de 156 colonias dos Lactococcus lactis subsp. lactis y un Lactococcus lactis biovar diacetilactis.With the objective of evaluating the MRS-S (0.10% of sorbate in the isolation of lactic bacteria samples of raw goat milk were cultivated in MRS-S and PCA in deep and incubated in aerobic conditions for 48 hours al 32oC. Gram positive coccus, negative catalase which grew in MRS-S were isolated and preliminarly characterized through the growing process in agar MRS-S, MRS-T (O.20ltg/ml tetracycline, N-L (aromatic bacteria, litmus milk reduction at 40 and 210C and growing at 45 and 10oC. Selected strains were subject to the physiological and biochemical characterization. MRS-S media showed to be effective with an 86.56% of inhibition for indesirable bacteria and adequated for Lactococcus isolation. Related to taxonomic profiles from 156 colonies were isolated two lactococcus lactis subsp. lactis and one Lactococcus luctis biovar diacetilactis.

  16. CARACTERIZACIÓN MOLECULAR DE AISLAMIENTOS DE ENTEROBACTER CLOACAE MULTIRRESISTENTES, PRODUCTORES â-LACTAMASAS PROVENIENTES DE PACIENTES DE UN HOSPITAL DE TERCER NIVEL DE BOGOTÁ Molecular characterizacion of multi-cephalosporin resistan Enterobacter cloacae isolates from a third level hospital in Bogota-Colombia

    OpenAIRE

    Ibonne Aydee García Romero; Emilia María Valenzuela de Silva; Carlos Humberto Saavedra; Aura Lucía Leal Castro; Javier Eslava Schmalbac; José Ramón Mantilla Anaya

    2005-01-01

    Antecedentes. Las enterobacterias, antaño flora normal del tracto gastrointestinal, han cambiado su biología y emergido como agentes patógenos nosocomiales que se tornan resistentes los antibióticos conocidos. Objetivo. Realizar la caracterización epidemiológico-molecular de 20 aislamientos de Enterobacter cloacae resistentes a cefalosporinas de tercera generación; provenientes de un hospital de tercer nivel de Bogotá-Colombia. Material y métodos. Los aislamientos fueron identificados mediant...

  17. White primer permits a corrosion-resistant coating of minimum weight

    Science.gov (United States)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  18. Identidad genética del hongo causante del primer caso de coccidioidomicosis descripto por Alejandro Posadas en 1892 Genetic characterization of the fungus involved in the first case of coccidioidomycosis described by Alejandro Posadas in 1892

    Directory of Open Access Journals (Sweden)

    Cristina E Canteros

    2009-04-01

    Full Text Available En 1892, Alejandro Posadas documentó el primer caso mundial de coccidioidomicosis en un paciente argentino de nombre Domingo Escurra. Con el objetivo de identificar la especie de Coccidioides involucrado en ese caso, analizamos una pieza de necropsia del paciente, conservada en el Museo de Patología de la Facultad de Medicina de la Universidad de Buenos Aires, Argentina. La porción del tejido con mayor número de endosporas del hongo libres e integras fue elegida utilizando una coloración inmunohistoquímica específica. El ADN fúngico fue amplificado usando una PCR anidada que reconoce un fragmento del gen Ag2/PRA cuyo polimorfismo diferencia Coccidioides immitis y C. posadasii. Se amplificó además, el ADN de dos cepas de referencia: C. immitis (M38-05 y C. posadasii (1-NL y de cuatro aislamientos de Coccidioides de pacientes argentinos. Los fragmentos amplificados fueron secuenciados en ambas hebras. Las secuencias fueron editadas, alineadas y comparadas con las depositadas en GenBank C. posadasii (Acceso N° AY536446, cepa Silveira y C. immitis (Acceso N° AY536445. Las secuencias del Coccidioides del caso Escurra, de los aislamientos argentinos y de la cepa 1-NL fueron idénticos entre sí y mostraron una mutación puntual de C→G en la posición 1228 en comparación con la secuencia de C. posadasii, cepa Silveira. Este es el primer trabajo donde se busca ADN de Coccidioides en una pieza anatómica de museo con más de 100 años de antigüedad. Los resultados confirman que el primer caso de coccidioidomicosis o enfermedad de Posadas documentado mundialmente fue producido por el recientemente descripto C. posadasii.In 1892 Alejandro Posadas described the first worldwide case of coccidioidomycosis in a patient named Domingo Escurra. A preserved necropsy piece from the patient's remains is conserved in the Museum of Pathology of the Medical School, Buenos Aires University. Paraffin-embedded specimens obtained from this piece served to

  19. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.

    Science.gov (United States)

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A

    1995-03-01

    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  20. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  2. Microsatellite Primers for the Pacific Northwest Conifer Callitropsis nootkatensis (Cupressaceae

    Directory of Open Access Journals (Sweden)

    Tara N. Jennings

    2013-09-01

    Full Text Available Premise of the study: Microsatellite primers were developed for Nootka cypress (Callitropsis nootkatensis to provide quantitative measures for gene conservation that can assist in guiding management decisions for a species experiencing climate-induced decline. Methods and Results: Using multiplexed massively parallel sequencing, we identified 136,785 microsatellite-containing sequences from 489,625 Illumina paired-end 80-bp reads. After stringent filtering, we selected 144 primer pairs and screened variation at these loci in five populations of C. nootkatensis. Loci show between three and 36 dinucleotide repeats per locus, with an average of 13. Screening of these markers in the Pacific Northwest relative Chamaecyparis lawsoniana demonstrated no marker transferability. This finding highlights the narrow taxonomic utility of microsatellite markers in Callitropsis. Conclusions: These microsatellites show high polymorphism and can be used for routine screening of natural variation in Callitropsis nootkatensis, and will be particularly helpful in identifying clones and inbred relatives at the stand-level.

  3. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  4. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  5. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  6. Development of a Nonchromate Structural Adhesive Bond Primer

    Science.gov (United States)

    2014-11-01

    Prevent corrosion of base metal • Applied to porous anodized surface • Overcoated with non- inhibited epoxy adhesive • High adhesive bond strength...primers •Long-running surveillance of chromate-free alternatives by UTC companies shows weak corrosion inhibition • (A) strontium chromate... corrosion inhibiter achieved Electrokinetic Confirmation of Active Inhibition in Coatings 7 Schematic of defect production and samples for salt

  7. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  8. Two generic PCR primer sets for the detection of members of the genus Torradovirus

    NARCIS (Netherlands)

    Verbeek, M.; Tang, J.; Ward, L.

    2012-01-01

    Two degenerate primer pairs were designed for the universal detection of members of the genus Torradovirus. Primer pair Torrado-1F/Torrado-1R was designed based on the RNA-dependent RNA polymerase region located in RNA1 and primer pair Torrado-2F/Torrado-2R based on a region overlapping the two firs

  9. Design of primers and probes for quantitative real-time PCR methods.

    Science.gov (United States)

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  10. Wash Primer Replacement Based on the Superprimer Technology

    Science.gov (United States)

    2011-09-01

    DoD­P­15328D wash primer. Figure 51. FTIR  spectra  of ECO­008 and ECO5­1. viii Figure 52. FTIR  spectra  of ECO5­1 with different drying conditions. Figure 53...MIL­ PRF­85582 primers, in which  strontium  chromate is used as the major corrosion inhibitor.  The MIL­DTL­53030B primer contains zinc phosphate as...is obtained through the use of the silane. 5.2.5. FTIR characterization FTIR  spectra  of DoD­P­15328D, ECO­008 and ECO5­1 are shown in Figures 50­52

  11. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  12. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  13. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  14. El cultivo "in vitro" como instrumento práctico para el diagnóstico y aislamiento primario de Leishmania braziliensis braziliensis. 2. Estudios en pacientes de áreas endémicas

    Directory of Open Access Journals (Sweden)

    C. A. Cuba Cuba

    1986-10-01

    Full Text Available El cultivo "in vitro" de Leishmania braziliensis braziliensis constituye un método útil en el trabajo de campo, para el aislamiento primario de ésta subes-pécie de Leishmania. Cultivos en dos medios difásicos de agar sangre (DAB y EVANS y dos medios líquidos (SCHNEIDER'S y AR-103 realizados en pacientes con lesiones cutáneas de Leishmaniasis Tegumentaria Americana (LTA demostraron: 1 Similar sensibilidad de los medios DAB y Schneider's cuando utilizamos el procedimiento de aspiración de las muestras con aguja. 2 Rendimiento sensible y reproducible, con el medio DAB, cuando comparado, en repetidas ocasiones, con el medio EVANS. 3 Incremento significativo en el aislamiento primario de Leishmania braziliensis brazilensis mediante la ejecución, en la misma lesión de cada paciente, de tres aspiraciones consecutivas en sitios diferentes de la úlcera activa (50% de positividad, con el medio DAB.

  15. Nuevo dispositivo para el aislamiento de la fracción estromal vascular a partir de lipoaspirados humanos: método de obtención y análisis de calidad celular

    Directory of Open Access Journals (Sweden)

    S. Dos-Anjos

    2013-12-01

    Full Text Available El tejido adiposo obtenido mediante liposucción es una fuente idónea para aislar células con potencial terapéutico, las denominadas células de la fracción estromal vascular (FEV, que incluyen células madre mesenquimales. Estas células se han convertido en una de las principales herramientas de terapia celular autóloga para diversas aplicaciones médicas, y en los últimos años se han ido desarrollando diversas tecnologías para su aislamiento y uso clínico. En este trabajo presentamos un nuevo método rápido, sencillo y eficiente para el aislamiento de células de la FEV mediante un dispositivo médico cerrado que permite recoger y procesar lipoaspirados humanos en el mismo procedimiento quirúrgico de manera coste-efectiva. Además describimos los métodos llevados a cabo para cuantificar la calidad, seguridad y eficacia del inóculo celular obtenido.

  16. Preliminary Evaluation of the Acute Toxicity of Desensitized Primer Compounds and Primer Waste Effluents to Representative Aquatic Organisims

    Science.gov (United States)

    1975-11-01

    daphnids, with 48-hour LC50 values for these two materials being several orders of magnitude lower than those observed for lead styphnate , PETN and... styphnate (PoTNR), tetracene (= tetrazene), pentaerythritol tetranitrate (PETN), .and FA 956 priming mixture. The FA 956 mixture is composed of: 37...PbTNR, 4% tetracene, 5% PETN, 32% barium nitrate, 15% antimony sulfide and 7% aluminum (Small and Rosenblatt, 1974). Each of these primer components was

  17. Cuantificación, aislamiento e identificaciónde comunidades anaerobias amilolíticas de un manantial termomineral de Paipa, Boyacá

    Directory of Open Access Journals (Sweden)

    Posada Yully

    2004-12-01

    Full Text Available Se cuantif icaron microorganismos anaerobios termofílicos amilolíticos de un manantial termomineral en la región andina (5° 45' 69’’ N, 73° 6' 61’’ W, 2500 msnm a través del Número Más Probable (NMP. Los recuentos microbianos de las poblaciones presentaron valores entre 1,9*102 células/100 mL y 5.8*102 células/100 mL en presencia de almidón y tiosulfato como aceptor de electrones y 1,4*102células/100 mL y 3,4*102 células/100 mL en presencia solamente de almidón. Se realizaron aislamientos microbianos a partir de las últimas diluciones positivas del NMP y se aislaron 8 cepas bacterianas denominadas P4-6, P4-7, P4-8, P4-9, P4-10, P4-11, P4-12 y P4-13. Estas cepas crecieron a temperaturas óptimas entre 60 y 65 °C, y exhibieron un metabolismo fermentativo. El principal producto de fermentación fue etanol seguido de acetato, CO2 e hidrógeno. El tiosulfato fue utilizado como aceptor externo de electrones, pero el sulfato o el hierro férrico no fue reducido. La diversidad filogenética de estas 8 cepas fue evaluada por medio de geles de electroforesis de gradiente denaturalizante (DGGE. Se analizó la secuencia del gen 16S rRNA de dos de las cepas aisladas (P4-6 y P4-9 y el análisis indicó que éstas pertenecen a la familia Thermoanaerobiaceae del dominio Bacteria. Del análisis fenotípico y genotípico se deduce que estos organismos pertenecen al género Thermoanaerobacter, y con base en el análisis de las secuencias del 16S rDNA se observa una similitud del 98% con Thermoanaerobacter italicus y Thermoanaerobacter mathranii. Palabras clave: termofilia, manantiales termominerales, anaerobiosis, Thermoanaerobacter, DGGE.

  18. Susceptibilidad antimicrobiana de aislamientos clínicos en el Hospital "Jose Martí y Perez" de Sancti Spíritus, Cuba

    Directory of Open Access Journals (Sweden)

    Estrella Álvarez Varela

    2009-01-01

    Full Text Available Se realizó un análisis retrospectivo de la información de la base de datos de antibiogramas de un grupo de microorganismos aislados en el hospital "José Martí y Pérez" de la provincia de Sancti Spíritus, perteneciente a la Red Nacional del Sistema DIRAMIC, durante el periodo enero de 2000 a diciembre de 2007. El procesamiento de los datos de susceptibilidad se realizó utilizando el sistema de programas para la confección de los Mapas Microbianos versión 6.1. Fueron estudiadas un total de 4 695 cepas, de ellas 3 766 correspondientes a muestras procedentes de la consulta externa hospitalaria y 929 intrahospitalarias. Los gérmenes aislados con mayor frecuencia fueron Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa y Proteus mirabilis, provenientes de infecciones del tracto urinario, lesiones de la piel y partes blandas, secreciones óticas, bacteriemias e infecciones de las vías respiratorias superiores. Los aislados intrahospitalarios de Escherichia coli alcanzaron porcentajes de resistencia significativamente superiores (p = 0,02 con respecto a los de consulta externa hospitalaria para ampicilina (63,2 % contra 71,0 % y gentamicina (28,2 % contra 35,8 %. Los porcentajes de resistencia de Proteus mirabilis de consulta externa hospitalaria fueron superiores que los intrahospitalarios, siendo significativos para cefazolina (p = 0,02, 63,6 % contra 40,0 % y norfloxacina (p = 0,005, 26,7 % contra 12,5 %. Pseudomonas aeruginosa mostró porcentajes de resistencia superiores en el ámbito hospitalario, siendo significativo (p = 0,04 para gentamicina (26,3 % contra 37,8 %. Staphylococcus aureus resistente a oxacilina representa más del 70 % de los aislamientos, tanto de la consulta externa hospitalaria como de pacientes hospitalizados. Se hace necesario estrechar la vigilancia del comportamiento futuro de la susceptibilidad para los antibióticos estudiados.

  19. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  20. Estudio de la repetibilidad de los ensayos de aislamiento acústico según el nuevo Documento Básico de Protección frente al ruido del Código Técnico de la Edificación

    OpenAIRE

    PASTOR SANANTONIO, RAQUEL

    2011-01-01

    Pastor Sanantonio, R. (2011). Estudio de la repetibilidad de los ensayos de aislamiento acústico según el nuevo Documento Básico de Protección frente al ruido del Código Técnico de la Edificación. http://hdl.handle.net/10251/9965. Archivo delegado

  1. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies.

    Directory of Open Access Journals (Sweden)

    Michiel Op De Beeck

    Full Text Available Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS region in the ribosomal RNA (rRNA operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4 and a primer pair (ITS86F/ITS4 that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding.

  2. Determinación de la relación clonal de los aislamientos de Salmonella typhi recuperados en el programa de vigilancia por el laboratorio de EDA en Colombia durante el período 1997-2003 mediante la electroforesis en campo pulsado

    Directory of Open Access Journals (Sweden)

    Hidalgo Marylin

    2005-07-01

    Full Text Available La tipificación molecular de Salmonella typhi y paratyphi es necesaria para complementar los análisis epidemiológicos de las fiebres entéricas en Colombia. El objetivo del trabajo fue establecer la relación genética de los aislamientos de Salmonella typhi y paratyphi recuperados durante el período 1997-2003, en varias regiones del país. Se utilizaron 58 aislamientos de S. typhi, tres de S. paratyphi A, dos de S. paratyphi B y 1 de S. paratyphi C, recibidos por el programa de vigilancia de EDA del Instituto Nacional de Salud (INS. Para determinar la relación genética se empleó la electroforesis en gel de campo pulsado y se calculó un dendrograma; para evaluar la asociación entre los patrones electroforéticos obtenidos y las características de los aislamientos, como datos
    demográficos de los pacientes, tipo de muestra, año y procedencia, se utilizó un análisis de correspondencias. Los datos de S. typhi se analizaron en conjunto con 15  islamientos tipificados anteriormente en el INS. Se obtuvieron 36 patrones electroforéticos, 31/36 (86,1%, representados en 68/73 (93,1% aislamientos, estuvieron relacionados genéticamente. Los patrones S.Ty0001 y S.Ty0012 predominaron en el país. En el análisis de correspondencias, no se encontró asociación entre los patrones electroforéticos y las características de los aislamientos. Los aislamientos de S. paratyphi A estuvieron relacionados genéticamente mientras que los de S. paratyphi B no guardaron relación. A pesar de la considerable heterogeneidad de los aislamientos colombianos de Salmonella typhi, definida por el número de patrones electroforéticos, la mayoría de ellos guardan una relación genética, sugiriendo un origen común de los mismos.

  3. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  4. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  5. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  6. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  7. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  8. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIRÓS-RODRÍGUEZ

    2015-01-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin- Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito, Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  9. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  10. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  11. Cribado de aneuploidias de primer trimestre en las gestaciones gemelares

    OpenAIRE

    Prats Rodríguez, Pilar

    2013-01-01

    Esta tesis está basada en dos artículos: Articulo 1: Early first-trimester free-β-hCG and PAPP-A serum distributions in monochorionic and dichorionic twins Objetivo: Examinar la distritución en primer trimestre de los marcadores bioquímicos de aneuploidias en gestaciones gemelares dependiendo de su corionicidad. Métodos: La free-β-human chorionic gonadotropin (hCG) en sangre materna y la pregnancy-associated plasma protein A (PAPP-A) fueron analizadas entre las semanas 8–13 + de ...

  12. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. (eds.); Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  13. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  14. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  15. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  16. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  17. Sequence analysis of the capsid and polimerase genes of different raspberry bushy dwarf virus (rbdv samples Análisis de la secuencia de nucleótidos del gen de la capside y la polimerasa entre diferentes aislamientos del virus motoso del enanismo de la frambuesa

    Directory of Open Access Journals (Sweden)

    Mayo M.

    1998-12-01

    Full Text Available This work was aimed to find sequence variability between capsid and polymerase gene sequences of five RBDV samples. Capsid and polymerase cDNAs were obtained by reverse transcription and PCR (RT-PCR of RNA extracted from plants inoculated with each of the respective isolated samples. The amplified products were cloned in pGEM-T and sequenced. The results showed that the capsid and polymerase sequences varied less than 1% among the isolated samples. These data suggested that capsid and polymerase transgenic sequences that protect against a particular RBDV sample might protect against the others.Este proyecto tuvo como objetivo determinar el grado de variabilidad existente al interior de las secuencias correspondientes al gen de la cápside y de la polimerasa entre cinco aislamientos de RBDV. Para este propósito, el DNA complementario (cDNA, correspondiente al gen de la cápside y de la polimerasa, fueron obtenidos por transcriptasa reversa y reacción en cadena de la polimerasa (RT-PCR, a partir de RNA de plantas inoculadas con cada uno de los respectivos aislamientos. El cDNA correspondiente al gen de la cápside y de la polimerasa, obtenido de cada aislamiento de RBDV, mediante esta metodología se clonó en el plásmido pGEM-T para ser secuenciado posteriormente. Los resultados mostraron que tanto el gen de la cápside, como el de la polimerasa, variaron menos del 1% entre estos aislamientos. Por lo tanto, se puede esperar que una secuencia transgénica de RBDV (de la cápside o de la polimerasa que proteja contra un aislamiento de RBDV, podría también proteger contra otras cepas de RBDV.

  18. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  19. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  20. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  1. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  2. FullSSR: Microsatellite Finder and Primer Designer

    Science.gov (United States)

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia

    2016-01-01

    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  3. Aislamiento y caracterización de cepas nativas de Lactobacillus spp. para su uso como probióticos en la industria láctea

    Directory of Open Access Journals (Sweden)

    Sylvia Vázquez

    2011-05-01

    Full Text Available La utilización de fermentos en la elaboración de productos lácteos es una práctica diaria a nivel industrial. En nuestro país los mismos son comprados a multinacionales extranjeras que se dedican a producir y comercializar fermentos; muchos de los cuales incorporan bacterias probióticas. Los probióticos pueden definirse como microorganismos que luego de ser consumidos en cantidades adecuadas, confieren algún efecto benéfico en el huésped. En el presente trabajo se realizó el aislamiento de una cepa de Lactobacillus de origen humano. Se identificó por tinción gram, prueba catalasa, crecimiento en anaerobiosis y aerobiosis y un test API 50 CH. Con el objetivo de probar propiedades probióticas de la cepa se llevaron a cabo estudios de resistencia al pH, tolerancia a sales biliares y se realizó un Modelo Gástrico in vitro. Los resultados permiten afirmar que estamos en presencia de una cepa nativa de Lactobacillus acidophilus caracterizada fenotípicamente con un 97% de confianza. Presentaría la habilidad de sobrevivir al pasaje a través del tubo digestivo ya que resistió la exposición a un pH similar al estomacal, pudo crecer en un medio con sales biliares y sobrevivió a la acción conjunta de la pepsina y una simulación de jugo gástrico; características que permiten clasificarla como posible cepa probiótica.Abstract  The use of starters to elaborate dairy products is a current practice in the industry. In our Country we import these starters from foreign companies dedicated to make and sale it, and most of them include probiotic bacterias. Probiotics can be defined as microorganisms that after be consumed in adequate amount, can give some advantageous effect to the host. In this study a strain of Lactobacillus was isolated from a human. The identification was done through gram stain, catalase test, aerobic and anaerobic growth, and an API 50 CH test. In order to prove the probiotic properties of the strain, studies of p

  4. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Pedersen, F S

    2000-01-01

    . While most of the selected primer binding sites are complementary to the 3'-end of tRNA((Pro)), we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNA(Arg(CCU)), tRNA(Phe(GAA))and a hitherto unknown......Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNA(Pro)molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian...... retro-viruses have revealed evidence of molecular adapt-ation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites...

  5. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    CERN Document Server

    Courtney, Elya; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blast waves, muzzle velocities, and ignition delay are presented after environmental conditioning (150 days) for two lead based and two DDNP based primers under cold and dry (-25 deg C,0% relative humidity), ambient (20 deg C, 50% relative humidity), and hot & humid (50 deg C, 100% relative humidity) conditions in 5.56 mm NATO. Taken together, these results indicate that DDNP based primers are not sufficiently reliable for service use.

  6. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...... settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...

  7. Foamglas D. 1. T. N.° 19 Convalidación del Agrément 1. N. L n.° 1.031. Aislamiento de cubiertas isolation pour toitures roof insulation

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1968-11-01

    Full Text Available Not availableEl Foamglas es un material constituido por vidrio químicamente puro, de tipo boro-silicato, inorgánico, sin adición de aglomerante. Se presenta y utiliza en placas de diferentes dimensiones estandarizadas. Estas placas se colocan en cubiertas planas o con pendiente. Se unen con betún y se recubren con una impermeabilización. Otros empleos no considerados en el presente documento son: en el doblado de muros, en las cámaras frigoríficas, en las fachadas ligeras, falsos techos, en el aislamiento de depósitos de agua y tuberías.

  8. Caracterización de aislamientos clínicos de Leptospira por métodos fenotípicos y moleculares en la República de Nicaragua

    OpenAIRE

    Daniel Francisco Arencibia; Niurka Batista; William Jirón; Yolanda Emilia Suárez; Juan Francisco Infante

    2012-01-01

    En este trabajo se caracterizaron ocho cepas de Leptospira, aisladas de casos clínicos en Nicaragua mediante métodos fenotípicos y moleculares, las cuales no mostraron crecimiento a 13 °C ni en medio suplementado con 8-azaguanina (2,25 mg/mL). Se observó la conversión a formas esféricas a los 60 min de estar expuestas en un medio suplementado con NaCl 1M. Para la caracterización molecular de los aislamientos se realizó la reacción en cadena de la polimerasa (RCP) de genes conservados con cepa...

  9. MÉTODO EFECTIVO PARA LA DESINFECCIÓN TOTAL DE ESPORAS DE HONGOS MICORRIZÓGENOS ARBUSCULARES (HMA: AISLAMIENTO Y CARACTERIZACIÓN DE BACTERIAS ENDOSPÓRICAS EN Glomus clarum

    Directory of Open Access Journals (Sweden)

    Lorelí Mirabal

    2002-01-01

    Full Text Available Los hongos micorrizógenos arbusculares (HMA son endosimbiontes obligados, presentes en muchos ecosistemas naturales y agrícolas, con gran responsabilidad en la integridad fisiológica de la planta. Esta investigación se basa en la realización de diferentes aislamientos de Glomus clarum, proveniente de cultivos puros del cepario del INCA. Se aislaron y purificaron 25 cepas bacterianas endospóricas, a las cuales se les realizaron varias pruebas morfológicas y bioquímicas, siendo muy interesantes la aerobiosis y la capacidad nitrofijadora. Tres cepas bacterianas aisladas tienen características coincidentes con el endófito diazótrofo Gluconoacetobacter diazotrophicus. Además, se estableció un método efectivo para la desinfección total de la pared externa de las esporas de HMA.

  10. Aplicación de señales deterministas e impulsivas en los nuevos métodos de medición del aislamiento a ruido aéreo en edificios

    OpenAIRE

    Otto Granados, Leroy

    2016-01-01

    Se pueden adoptar diferentes tipos de señales de excitación y procedimientos para determinar el nivel de aislamiento a ruido aéreo de un cerramiento en mediciones de acústica de la edificación. A partir de los fundamentos teóricos de la propagación del sonido en espacios cerrados, se realiza una revisión del método clásico de medida según la norma ISO 16283f1,del método de la función de transferencia con un barrido sinusoidal, y de un método alternativo que se basa en la excitación sonora...

  11. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  12. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...gun, percussion, electric primer, capacitor 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT UU 18. NUMBER OF PAGES 30 19a. NAME...initial pull of the solenoid, which can be over 50 A. The old linear power supply has large filter capacitors on its output, which does provide the surge

  13. Genus-specific primers for study of Fusarium communities in field samples

    OpenAIRE

    2016-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium- specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+...

  14. The impact of the use of thermal insulating materials in the global climatic change; El impacto del uso de los aislamientos termicos en el cambio de los climas globales

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S.A. de C.V. (Mexico)

    1996-12-31

    One of the technologies for energy saving easier to understand and one of the fastest and economical to install in the dwelling, commercial and industrial, construction is represented by the use of thermal insulation for the thermal energy losses control. As a result of the application of this technology in direct form for the smaller consumption of energy fuels, will have the effect of a lesser emission of pollution gases that produce the green house effect of the earth atmosphere. The thermal insulating materials, made from a variety of raw materials, many of which utilize large amounts of recycled products in the benefit of the smaller use of natural resources, offer annually and permanently reductions in the energy consumption much higher than the energy resources utilized just once in its manufacture. Therefore, they are also an economical way in contributing in the reduction of atmospheric pollutants of the so-called greenhouse gases. [Espanol] Una de las tecnologias para el ahorro de energia mas faciles de comprender y de las mas rapidas y economicas de instalar en la edificacion de vivienda, comercial e industrial, es la que representa el uso de aislamientos termicos para el control de las perdidas de energia termica. Como resultado de la aplicacion de esta tecnologia, en forma directa por el menor consumo de energeticos combustibles, tendra como efecto la menor emision de gases contaminantes que producen el efecto de invernadero en la atmosfera terrestre. Los aislamientos termicos, fabricados de una gran variedad de materiales, muchos de los cuales utilizan grandes cantidades de productos reciclados en beneficio del menor uso de los recursos naturales, ofrecen anualmente y permanentemente reducciones de consumo de energia muy superiores a los recursos energeticos utilizados una sola vez en su manufactura. Por ende, tambien son una forma economica a coadyuvar en la reduccion de contaminantes atmosfericos de los llamados gases de invernadero.

  15. A model for the A(H1N1 epidemic in Mexico, including social isolation Un modelo para la epidemia de A(H1N1 en México incorporando aislamiento social

    Directory of Open Access Journals (Sweden)

    Jorge X Velasco-Hernández

    2011-02-01

    Full Text Available OBJECTIVE: We present a model for the 2009 influenza epidemic in Mexico to describe the observed pattern of the epidemic from March through the end of August (before the onset of the expected winter epidemic in terms of the reproduction number and social isolation measures. MATERIAL AND METHODS: The model uses a system of ordinary differential equations. Computer simulations are performed to optimize trajectories as a function of parameters. RESULTS: We report on the theoretical consequences of social isolation using published estimates of the basic reproduction number. The comparison with actual data provides a reasonable good fit. CONCLUSIONS: The pattern of the epidemic outbreak in Mexico is characterized by two peaks resulting from the application of very drastic social isolation measures and other prophylactic measures that lasted for about two weeks. Our model is capable of reproducing the observed pattern.OBJETIVO: Se presenta un modelo de la epidemia de influenza en México en 2009 para describir el patrón observado desde marzo hasta finales de agosto (antes del inicio de la epidemia invernal, en términos del número reproductivo y las medidas de aislamiento social. MATERIAL Y MÉTODOS: El modelo es un sistema de ecuaciones diferenciales ordinarias. Se realizaron simulaciones computacionales para la optimización de trayectorias como función de los parámetros. RESULTADOS: Se exploran las consecuencias de esta última medida combinada con los valores estimados en la literatura médica del número reproductivo básico. CONCLUSIONES: El patrón de la epidemia mexicana de influenza es bimodal debido a la aplicación del aislamiento social y otras medidas profilácticas que duró aproximadamente dos semanas. Este modelo es capaz de reproducir el patrón observado.

  16. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y Testudines de la Estación de Biología Tropical Roberto Franco en Villav icencio, Colombia

    Directory of Open Access Journals (Sweden)

    D. A. Pachón

    2010-01-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos en mamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal. La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programa de recuperación del Caimán Llanero ( Crocodylus intermedius , que se encuentra en inminente peligro de extinción; adicionalmente cuenta con una colección viva de Testudines que comprende más de 20 especies. Con el fin de determinar la presencia de potenciales enteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientales y cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagar Orientación BD® para realizar los aislamientos y la identificación microbiológica. Los resultados muestran una mayor presentación de flora gram negativa predominando microorganismos de los géneros Escherichia coli (28%, Klebsiella sp (26%, Salmonella sp. (6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del género Enterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todas las muestras sin importar el origen de las mismas. Conscientes del riesgo que implica el aislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico, se dio inicio a la implementación de un manual de bioseguridad para la Estación con el fin disminuir el riesgo para la población humana y animal.

  17. Use of self-quenched, fluorogenic LUX primers for gene expression profiling.

    Science.gov (United States)

    Kusser, Wolfgang

    2006-01-01

    Application of a real-time detection system based on a novel primer design in gene expression profiling is described. In this system, called LUX (Light Upon eXtension), the generation of signal is based on a single fluorescent dye molecule that is attached to an oligonucleotide close to the 3'-end. A primer design software is available that identifies LUX primer pairs based on a set of rules for optimum signal development. The use of LUX fluorogenic primers to determine the expression patterns of various transcripts during differentiation in the P-19 mouse neuronal model is described.

  18. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  19. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  20. Antibiotic resistance: a primer and call to action.

    Science.gov (United States)

    Smith, Rachel A; M'ikanatha, Nkuchia M; Read, Andrew F

    2015-01-01

    During the past century, discoveries of microorganisms as causes of infections and antibiotics as effective therapeutic agents have contributed to significant gains in public health in many parts of the world. Health agencies worldwide are galvanizing attention toward antibiotic resistance, which is a major threat to public health (Centers for Disease Control and Prevention, 2013; World Health Organization, 2014). Some life scientists believe that we are approaching the post-antibiotic age (Davies & Davies, 2010). The growing threat of antimicrobial resistance is fueled by complex factors with biological, behavioral, and societal aspects. This primer provides an overview of antibiotic resistance and its growing burden on public health, the biological and behavioral mechanisms that increase antibiotic resistance, and examples of where health communication scholars can contribute to efforts to make our current antibiotic drugs last as long as possible. In addition, we identify compelling challenges for current communication theories and practices.

  1. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  2. Microsatellite primers for the rare sedge Lepidosperma bungalbin (Cyperaceae)1

    Science.gov (United States)

    Nevill, Paul G.; Wardell-Johnson, Grant

    2016-01-01

    Premise of the study: Microsatellite markers were developed for the rare sedge Lepidosperma bungalbin (Cyperaceae) to assess genetic variation and its spatial structuring. Methods and Results: We conducted shotgun sequencing on an Illumina MiSeq and produced 6,215,872 sequence reads. The QDD pipeline was used to design 60 primer pairs that were screened using PCR. We developed 17 loci, of which 12 loci were identified that were polymorphic, amplified reliably, and could be consistently scored. We then screened these loci for variation in individuals from three populations. The number of alleles observed for these 12 loci across the three populations ranged from nine to 19 and expected heterozygosity ranged from 0.41 to 0.89. Conclusions: These markers will enable the quantification of the potential impact of mining on genetic variation within L. bungalbin and establish a baseline for future management of genetic variation of the rare sedge. PMID:27843727

  3. Postpositivism and Accounting Research : A (Personal Primer on Critical Realism

    Directory of Open Access Journals (Sweden)

    Jayne Bisman

    2010-12-01

    Full Text Available This paper presents an overview and primer on the postpositivist philosophy of critical realism. Theexamination of this research paradigm commences with the identification of the underlying motivations thatprompted a personal exploration of critical realism. A brief review of ontology, epistemology andmethodology and the research philosophies and methods popularly applied in accounting is then provided.The meta-theoretical basis of critical realism and the ontological and epistemological assumptions that gotowards establishing the ‘truth’ and validity criteria underpinning this paradigm are detailed, and therelevance and potential applications of critical realism to accounting research are also discussed. The purposeof this discussion is to make a call to diversify the approaches to accounting research, and – specifically – toassist researchers to realise the potential for postpositivist multiple method research designs in accounting.This is aided through an illustration that functions to highlight how and why this approach was applied in areal-world accounting research study.

  4. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  5. Development of a ceramic primer with higher bond durability for resin cement.

    Science.gov (United States)

    Li, Rui

    2010-07-01

    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers.

  6. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  7. Selection and development of representative simple sequence repeat primers and multiplex SSR sets for high throughput automated genotyping in maize

    Institute of Scientific and Technical Information of China (English)

    WANG FengGe; ZHAO JiuRan; DAI JingRui; YI HongMei; KUANG Meng; SUN YanMei; YU XinYan; GUO JingLun; WANG Lu

    2007-01-01

    In the current study, 1900 maize simple sequence repeat (SSR) primers published in MaizeGDB were screened utilizing reference literature, 15 representative Chinese maize inbred lines and 15 Chinese maize hybrids from national regional testing. In total, 500 highly polymorphic primers were identified and used to construct a genetic map. 100 evenly distributed primers, 10 primers per chromosome, were further selected as a set of universal SSR core primers, recommended as preferred primers for general studies. These core primers were then redesigned and used to construct a high throughput multiplex PCR system based on a five-color fluorescence capillary detection system. We report here that two sets of ten-plex PCR combinations have been constructed, each consisting of 10 primers, with one primer per chromosome.

  8. Determinación de la variabilidad genética entre aislamientos de Rosellinia sp. Rosellinia bunodes y Rosellinia pepo mediante la técnica de amplificación aleatoria de polimorfismos de DNA (RAPD y análisis de los espaciadores de transcritos internos (ITSS

    Directory of Open Access Journals (Sweden)

    Ángel Díaz Jorge Evelio

    2004-12-01

    Full Text Available Teniendo en cuenta que las medidas preventivas son las más eficientes para reducir la incidencia de muchas enfermedades, la implementación de estrategias que permitan el diagnóstico temprano y oportuno de fitopatógenos de cultivos, en especial aquellos de tardío rendimiento, es el objetivo principal de este trabajo. Los hongos fitopatógenos del género Rosellinia se consideran habitantes naturales del suelo. Sin embargo, su fase parasítica se asocia a la aparición de enfermedades radiculares principalmente en cultivos de café, papa y cacao, que generalmente se
    relaciona con el aumento en la oferta de materia orgánica, lo cual beneficia el crecimiento sus poblaciones y las de otros microorganismos que pueden ser patógenos. Con el fin de avanzar en el conocimiento de las especies Rosellinia sp., Rosellinia bunodes y Rosellinia pepo y de desarrollar estrategias de diagnóstico para evitar las pudriciones radiculares que estas ocasionan en cultivos de importancia agroeconómica y forestal, se utilizaron dos metodologías moleculares que permiten
    realizar un primer acercamiento a la variabilidad genética que presentan diferentes aislamientos de estas especies. Mediante el análisis de RAPD (Amplificación Aleatoria de Polimorfismos de ADN y la secuenciación de las regiones de rDNA-ITS (Espaciadores de Transcritos Internos fue posible establecer un alto grado de variabilidad entre las cepas, aún dentro de una misma especie. Dichas metodologías están basadas en la reacción en cadena de la polimerasa (PCR que ha sido extensamente utilizada tanto en la identificación de un organismo por medio de la amplificación selectiva de su ADN, como al ser aplicada para explorar la variabilidad que posee un genoma. Las cepas de Rosellinia sp. presentaron gran variación en los perfiles electroforéticos de RAPD constituyendo dos ramas aisladas en el dendrograma de similaridad construido a partir de matrices binarias. De la misma manera

  9. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    Science.gov (United States)

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  10. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...

  11. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  12. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.

    Science.gov (United States)

    Summerfield, Marc R; Feemster, Agnes Ann

    2015-09-01

    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information.

  13. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej;

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  14. Novel computational methods for increasing PCR primer design effectiveness in directed sequencing

    Directory of Open Access Journals (Sweden)

    Busam Dana

    2008-04-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR is used in directed sequencing for the discovery of novel polymorphisms. As the first step in PCR directed sequencing, effective PCR primer design is crucial for obtaining high-quality sequence data for target regions. Since current computational primer design tools are not fully tuned with stable underlying laboratory protocols, researchers may still be forced to iteratively optimize protocols for failed amplifications after the primers have been ordered. Furthermore, potentially identifiable factors which contribute to PCR failures have yet to be elucidated. This inefficient approach to primer design is further intensified in a high-throughput laboratory, where hundreds of genes may be targeted in one experiment. Results We have developed a fully integrated computational PCR primer design pipeline that plays a key role in our high-throughput directed sequencing pipeline. Investigators may specify target regions defined through a rich set of descriptors, such as Ensembl accessions and arbitrary genomic coordinates. Primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the specified target regions. As part of the tiling process, primer pairs are computationally screened to meet the criteria for success with one of two PCR amplification protocols. In the process of improving our sequencing success rate, which currently exceeds 95% for exons, we have discovered novel and accurate computational methods capable of identifying primers that may lead to PCR failures. We reveal the laboratory protocols and their associated, empirically determined computational parameters, as well as describe the novel computational methods which may benefit others in future primer design research. Conclusion The high-throughput PCR primer design pipeline has been very successful in providing the basis for high-quality directed sequencing results and for minimizing

  15. Multi-primer target PCR for rapid identification of bovine DRB3 alleles.

    Science.gov (United States)

    Ledwidge, S A; Mallard, B A; Gibson, J P; Jansen, G B; Jiang, Z H

    2001-08-01

    Multi-primer target polymerase chain reaction (MPT-PCR) is a rapid method for the identification of specific BoLA-DRB3 alleles. In a single PCR reaction, the presence of two alleles associated with increased risk, DRB3.2*23 (DRB3*2701-2703, 2705-2707) and decreased risk, DRB3.2*16 (DRB3*1501, 1502), of mastitis in Canadian Holstein can be detected. Two outer primers amplify exon 2 of DRB3. Simultaneously, two inner, allele-specific primers amplify individual alleles. Initially, 40 cows previously typed by PCR-restriction fragment length polymorphism (PCR-RFLP) were genotyped using the multi-primer approach. An additional 30 cows were first genotyped by multi-primer target PCR, then by PCR-RFLP. All animals were correctly identified and there were no false positives. This technique can readily be modified to identify other BoLA alleles of interest.

  16. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Science.gov (United States)

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  17. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    Directory of Open Access Journals (Sweden)

    Kenan Hadziavdic

    Full Text Available High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  18. Caracterización molecular de 15 aislamientos de Beauveria bassiana asociados con Cosmopolites y Metamasius en plátano y banano en tres regiones de Colombia Molecular characterization of 15 isolations of Beauveria bassiana related to Cosmopolites and Metamasius in plantain and banana in three regions of Colombia

    Directory of Open Access Journals (Sweden)

    Diego Fernando Marmolejo

    2008-10-01

    Full Text Available Se colectaron picudos de Cosmopolites y Metamasius en municipios del Valle del Cauca, Caldas y Quindío. Se obtuvieron cultivos monospóricos con diluciones de 10-10 y 10-11. Los aislamientos fueron almacenados a -80°C con glicerol al 10% y el ADN a -20°C. Los marcadores moleculares RAM generaron 82 fragmentos de los cuales 67% fueron polimórficos con una heterocigocidad de 0.24, que indica diversidad media a alta. A un índice de similitud 0.84 se formaron 5 grupos: uno con 11 aislamientos y 4 con un solo aislamiento. En el gran grupo se detectó un duplicado y se encontró diversidad del hongo en los sitios muestreados. No se encontró relación entre aislamientos sobre Cosmopolites y Metamasius o zona geográfica en la formación de grupos genéticos.Weevils Cosmopolites and Metamasius in municipalities of the Valle del Cauca, Caldas and Quindío departaments of Colombia were collected. Monosporic cultures were obtained from10-10 and 10-11 dilutions of Beauveria bassiana. Isolates were kept at -80°C with 10% glycerol and DNA stored at -20°C. RAMs molecular markers generated a total of 82 fragments of which 67% were polymorphic. A heterozygosity value of 0.24 indicated a medium - high diversity. Five groups were formed which have a similarity value of 0.84 and one big group with 11 isolates and four groups with only one isolate. In the big group was detected a duplicate and fungi genetic diversity in the sampled places. Neither relationship among isolates of Cosmopolites and Metamasius nor geographical zone related to the formation of genetic groups.

  19. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  20. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  1. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  2. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    2014-12-01

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  3. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIROZ-RODRÍGUEZ

    2015-07-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.First Report of Family Cheiridiidae (Arachnida: Pseudoscorpionida in ColombiaDuring a study of the arthropod fauna associated with mounds of detritus produced by Atta colombica (Hymenoptera: Formicidae in the Santa Isabel estate, locality of Patio Bonito, Department of Córdoba, were found representatives of the family Cheiridiidae. Therefore, these pseudoscorpions becomes in the first report of the family to Colombia and for the first time is recorded its presence in ant detritus. Also, this report extends its known distribution range in South America.   

  4. Primer of statistics in dental research: Part II.

    Science.gov (United States)

    Shintani, Ayumi

    2014-04-01

    The Part I of Primer of Statistics in Dental Research covered five topics that are often mentioned in statistical check list of many peer-review journals including (1) statistical graph, (2) how to deal with outliers, (3) p-value and confidence interval, (4) testing equivalence, and (5) multiplicity Adjustment. The Part II of the series covers another set of important topics in dental statistics including (1) selecting the proper statistical tests, (2) repeated measures analysis, (3) epidemiological consideration for causal association, and (4) analysis of agreement. First, a guide in selecting the proper statistical tests based on the research question will be laid out in text and with a table so that researchers choose the univariable statistical test by answering five simple questions. Second, the importance of utilizing repeated measures analysis will be illustrated. This is a key component of data analysis as in many dental studies, observations are considered repeated in a single patient (several teeth are measured in a single patient). Third, concepts of confounding and the use of regression analysis are explained by going over a famous observational cohort study. Lastly, the use of proper agreement analysis vs. correlation for study of agreement will be discussed to avoid a common pitfall in dental research.

  5. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  6. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  7. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    Directory of Open Access Journals (Sweden)

    Rygiewicz Paul T

    2005-05-01

    Full Text Available Abstract Background The Internal Transcribed Spacer (ITS regions of fungal ribosomal DNA (rDNA are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR, Length Heterogeneity PCR (LH-PCR and Terminal Restriction Fragment Length Polymorphism (T-RFLP analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was

  8. Resistencia a penicilina y otros antimicrobianos en 103 aislamientos clínicos de Streptococcus pneumoniae (2000-2001 Resistance to penicillin and other antimicrobials in 103 clinical isolations of Streptococcus pneumoniae (2000-2001

    Directory of Open Access Journals (Sweden)

    J.J. García-Irure

    2003-04-01

    Full Text Available Fundamentos. Conocer en nuestro hospital la sensibilidad a penicilina de aislamientos de Streptococcus pneumoniae, así como analizar la asociación de resistencia a penicilina y otros antimicrobianos y la actividad de cefotaxima y cefepima en cepas de Streptococcus pneumoniae resistentes a penicilina. Métodos. Se determinó la sensibilidad de 103 aislamientos de Streptococcus pneumoniae, procedentes de muestras clínicas durante los años 2000-2001, a penicilina, eritromicina, cloramfenicol, tetraciclina, cotrimoxazol, cefotaxima, cefepima y levofloxacino. Resultados. El 68% de los aislamientos fueron sensibles a penicilina, mientras que un 32% de las cepas de Streptococcus pneumoniae aisladas fueron resistentes a penicilina, presentando el 7,7% resistencia de alto grado a la misma. La resistencia a eritromicina, cloramfenicol, tetraciclina, cotrimoxazol y levofloxacino fue del 38,8; 9,7; 20,4; 25,2 y 2,9% respectivamente, incrementándose a valores del 66,6; 30,3; 48,5; 72,7 y 9,1% en las 33 cepas con resistencia a penicilina. La resistencia a cefotaxima y cefepima fue del 9,7 y 10,6% respectivamente. Conclusiones. Un alto porcentaje de cepas de Streptococcus pneumoniae presentaron algún grado de resistencia a penicilina, pero con cifras menores que las presentadas en otros estudios de ámbito nacional. Asimismo, se demostró que la resistencia a penicilina se asociaba significativamente (p Background. To determine in our hospital the sensitivity of isolations of Streptococcus pneumoniae to penicillin, as well as to analyse the association of resistance to penicillin and other antimicrobials and the activity of cefotaxime and cefepime in pencillin resistant strains of Streptococcus pneumoniae. Methods. The sensitivity was determined on 103 isolations of Streptococcus pneumoniae, from clinical samples from the years 2000-2001, to penicillin, eritromycine, cloramfenicol, tetracycline, cotrimoxazol, cefotaxime, cefepime and levofloxacine

  9. Annealing to sequences within the primer binding site loop promotes an HIV-1 RNA conformation favoring RNA dimerization and packaging

    OpenAIRE

    Seif, Elias; Niu, Meijuan; Kleiman, Lawrence

    2013-01-01

    Experiments are presented which suggest that the binding of the primer tRNA to the primer binding site of the HIV-1 5′ UTR is involved in the dimerization of the genome, as part of the packaging process.

  10. In vitro short-term bonding performance of zirconia treated with hot acid etching and primer conditioning etching and primer conditioning.

    Science.gov (United States)

    Xie, Haifeng; Chen, Chen; Dai, Wenyong; Chen, Gang; Zhang, Feimin

    2013-01-01

    This study aimed to investigate and compare the resin bond strengths of zirconia conditioned as follows: alumina sandblasting; alumina sandblasting+application of 10-MDP-containing primer; alumina sandblasting+application of Z-Prime Plus or Metal/Zirconia Primer (new zirconia primers); tribochemical silica coating+silanization; hot acid etching in three different combinations [H2SO4/(NH4)2SO4, HF/HNO3, H2SO4/HF/HNO3]+application of 10-MDP-containing primer. Shear bond strengths (SBS) after water storage for 24 h and 40 days were measured to assess resin bonding performance. Surface and chemical properties of conditioned zirconia surfaces and primers were characterized using scanning electron microscopy, energy dispersive X-ray spectrometry, Fourier transform infrared spectroscopy, and atomic force microscopy. Surface roughness ranked in descending order was: hot acid etching > tribochemical silica coating > alumina sandblasting. Combination of tribochemical silica coating and silanization showed the highest initial SBS (12.46±2.13 MPa) (P<0.01). Etching with H2SO4/(NH4)2SO4 (13.15±3.24 MPa) and HF/HNO3 (13.48±2.15 MPa) showed significantly better bond durability (P<0.01). Hot acid etching seemed to be a promising surface roughening treatment to improve resin-zirconia bonding.

  11. Comprehensive primer design for analysis of population genetics in non-sequenced organisms.

    Directory of Open Access Journals (Sweden)

    Ayumi Tezuka

    Full Text Available Nuclear sequence markers are useful tool for the study of the history of populations and adaptation. However, it is not easy to obtain multiple nuclear primers for organisms with poor or no genomic sequence information. Here we used the genomes of organisms that have been fully sequenced to design comprehensive sets of primers to amplify polymorphic genomic fragments of multiple nuclear genes in non-sequenced organisms. First, we identified a large number of candidate polymorphic regions that were flanked on each side by conserved regions in the reference genomes. We then designed primers based on these conserved sequences and examined whether the primers could be used to amplify sequences in target species, montane brown frog (Rana ornativentris, anole lizard (Anolis sagrei, guppy (Poecilia reticulata, and fruit fly (Drosophila melanogaster, for population genetic analysis. We successfully obtained polymorphic markers for all target species studied. In addition, we found that sequence identities of the regions between the primer sites in the reference genomes affected the experimental success of DNA amplification and identification of polymorphic loci in the target genomes, and that exonic primers had a higher success rate than intronic primers in amplifying readable sequences. We conclude that this comparative genomic approach is a time- and cost-effective way to obtain polymorphic markers for non-sequenced organisms, and that it will contribute to the further development of evolutionary ecology and population genetics for non-sequenced organisms, aiding in the understanding of the genetic basis of adaptation.

  12. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  13. Design and evaluation of reverse transcription nested PCR primers for the detection of betanodavirus in finfish.

    Science.gov (United States)

    Rajan, J Joseph Sahaya; Praveena, P Ezhil; Bhuvaneswari, T; Jithendran, K P

    2016-06-01

    Viral encephalopathy and retinopathy otherwise known as viral nervous necrosis (VNN) is a neuropathological condition affecting more than 50 fish species worldwide, mostly marine. Different PCR protocols with specific primers were reported from many countries for confirmation of VNN in fishes. In the present study, two pairs of primers were designed and evaluated for the diagnosis of clinical and subclinical cases of infections from field. These primers designated as BARL-F1/BARL-R1 amplified a 902 bp product in the variable region (T4) of the coat protein gene by first step PCR. Nested PCR primers BARL-F2/BARL-R2 amplified a fragment of 313 bp. The results were comparable with other commonly used primer sets such as F2/R3 and RG668f/RG919r primers. These new primers could detect betanodavirus in standard reference samples containing low, moderate and high viral load. Known positive and negative control samples of fish also revealed a predictive value of 100 % by RT-PCR diagnosis.

  14. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  15. MRPrimerV: a database of PCR primers for RNA virus detection

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  16. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  17. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  18. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    Directory of Open Access Journals (Sweden)

    Shea N. Gardner

    2014-01-01

    Full Text Available Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.

  19. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  20. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.

    Science.gov (United States)

    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter

    2014-09-01

    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow.

  1. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Science.gov (United States)

    Chen, Chen; Cheng, Lei; Weir, Michael D; Lin, Nancy J; Lin-Gibson, Sheng; Zhou, Xue-Dong; Xu, Hockin HK

    2016-01-01

    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to: (1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested: SBMP control primer P, P+2.5% DMADDM, P+5% DMADDM, P+7.5% DMADDM, P+10% DMADDM, and P+10% QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10% DMADDM was 10 times that of control primer (P0.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria. PMID:27811846

  2. PCR primers for metazoan nuclear 18S and 28S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. METHODOLOGY/PRINCIPAL FINDINGS: Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. CONCLUSIONS/SIGNIFICANCE: The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other

  3. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  4. Robust SNP genotyping by multiplex PCR and arrayed primer extension

    Directory of Open Access Journals (Sweden)

    Podder Mohua

    2008-01-01

    Full Text Available Abstract Background Arrayed primer extension (APEX is a microarray-based rapid minisequencing methodology that may have utility in 'personalized medicine' applications that involve genetic diagnostics of single nucleotide polymorphisms (SNPs. However, to date there have been few reports that objectively evaluate the assay completion rate, call rate and accuracy of APEX. We have further developed robust assay design, chemistry and analysis methodologies, and have sought to determine how effective APEX is in comparison to leading 'gold-standard' genotyping platforms. Our methods have been tested against industry-leading technologies in two blinded experiments based on Coriell DNA samples and SNP genotype data from the International HapMap Project. Results In the first experiment, we genotyped 50 SNPs across the entire 270 HapMap Coriell DNA sample set. For each Coriell sample, DNA template was amplified in a total of 7 multiplex PCRs prior to genotyping. We obtained good results for 41 of the SNPs, with 99.8% genotype concordance with HapMap data, at an automated call rate of 94.9% (not including the 9 failed SNPs. In the second experiment, involving modifications to the initial DNA amplification so that a single 50-plex PCR could be achieved, genotyping of the same 50 SNPs across each of 49 randomly chosen Coriell DNA samples allowed extremely robust 50-plex genotyping from as little as 5 ng of DNA, with 100% assay completion rate, 100% call rate and >99.9% accuracy. Conclusion We have shown our methods to be effective for robust multiplex SNP genotyping using APEX, with 100% call rate and >99.9% accuracy. We believe that such methodology may be useful in future point-of-care clinical diagnostic applications where accuracy and call rate are both paramount.

  5. A primer on incentive regulation for electric utilities

    Energy Technology Data Exchange (ETDEWEB)

    Hill, L.J.

    1995-10-01

    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  6. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  7. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  8. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  9. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    to investigate the potential failure mechanism of a primer applied prior to an intumescent coating. The analysis was carried out using; (1) gas-fired test furnace, (2) a specially designed electrically heated oven, and (3) thermo gravimetric analysis. When tested below an acrylic intumescent coating, exposed...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen...

  10. Design and evaluation of a specific primer pair for the diagnosis and identification of Acanthamoeba polyphaga.

    Science.gov (United States)

    Ortega-Rivas, Antonio; Lorenzo-Morales, Jacob; Martinez-Carretero, Enrique; Villa Lloberas, Mercedes; Valladares Hernández, Basilio; del Castillo-Remiro, Antonio

    2004-05-01

    Random amplified polymorphism DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that may be useful for species diagnosis. In this study, a distinctive a 962-bp band in A. polyphaga band patterns was found, by using the OPC20 primer (ACTTCGCCAC). The DNA fragment was used to design a specific primer pair that was useful for the identification of different isolates as A. polyphaga species. A case of A. polyphaga in disseminated acanthamoebiasis affecting mesenteric nodes is also reported.

  11. Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes).

    Science.gov (United States)

    Lohman, David J; Prawiradilaga, Dewi M; Meier, Rudolf

    2009-01-01

    The All Birds Barcoding Initiative aims to assemble a DNA barcode database for all bird species, but the 648-bp 'barcoding' region of cytochrome c oxidase subunit I (COI) can be difficult to amplify in Southeast Asian perching birds (Aves: Passeriformes). Using COI sequences from complete mitochondrial genomes, we designed a primer pair that more reliably amplifies and sequences the COI barcoding region of Southeast Asian passerine birds. The 655-bp region amplified with these primers overlaps the COI region amplified with other barcoding primer pairs, enabling direct comparison of sequences with previously published DNA barcodes.

  12. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  13. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  14. Evidencia de orígenes filogenéticos diferentes de dos aislamientos mexicanos del virus del mosaico de la caña de azúcar (SCMV Evidence of different phylogenetic origins of two mexican Sugarcane mosaic virus (SCMV isolates

    Directory of Open Access Journals (Sweden)

    Giovanni Chaves-Bedoya

    2012-01-01

    Full Text Available El análisis molecular del cistrón, que codifica para la proteína de la cubierta del virus del mosaico de la caña de azúcar (SCMV reportado en la base de datos del banco de genes (GenBank, reveló la presencia de 45 nucleótidos adicionales que codifican para quince aminoácidos, en la región amino de la secuencia de la proteína de la cubierta del aislamiento mexicano identificado con el número de acceso GU474635. El análisis BLAST indicó que esta característica particular también está presente en el aislamiento D00949, reportado en 1991 en Estados Unidos. El análisis filogenético de 185 secuencias de la proteína de la cubierta de SCMV reportadas de Asia, áfrica, Brasil y Argentina, entro otros, sugiere diferentes orígenes filogeográficos de los aislamientos mexicanos. El aislamiento mexicano GU474635 es filogenéticamente más cercano a aislamientos de SCMV de Brasil y de EE.UU., mientras que secuencias de la proteína de la cubierta del virus SCMV reportadas en China y Alemania son filogenéticamente más cercanas al aislamiento mexicano EU091075. Las características particulares que comparten aislamientos virales de tres países del continente americano, a saber, EE.UU., México y Brasil, sugieren un bajo control fitosanitario en el intercambio de material vegetal.The molecular analysis of the Sugarcane mosaic virus (SCMV for coat protein cistron reported in the public GenBank database, revealed the presence of 45 additional nucleotides coding for 15 amino acids in the N-terminal region of the coat protein sequence of the mexican isolate GU474635. BLAST analysis indicates this particular feature is also present in the coat protein sequence identified with the accession number D00949 reported in the USA in 1991. Phylogenetic analysis of 185 SCMV coat protein sequences reported from Asia, Africa, Brazil and Argentina among others, suggest a putative different phylogeographical origin of the mexican SCMV isolates. Coat protein

  15. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    Science.gov (United States)

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  16. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  17. New Primers for Denaturing Gradient Gel Electrophoresis Analysis of Nitrate-Reducing Bacterial Community in Soil

    Institute of Scientific and Technical Information of China (English)

    R.PASTORELLI; R.PICCOLO; S.SIMONCINI; S.LANDI

    2013-01-01

    The narG gene is frequently used as a molecular marker for bacterial nitrate-reducing community analysis.In this study,a new set of primers targeting the narG gene was designed and applied to semi-nested polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) assay.The potential of the new primers was verified on DNA directly extracted from soils from five different experimental sites distributed in Central and Southern Italy.Specificity of the primers was determined by excision,amplification,and sequencing of bands resolved by DGGE.A phylogenetic analysis showed the correlation between the sequences retrieved from the soils studied and the narG sequences from β and γ-Proteobacteria.These primers expanded the existing molecular tools for ecological study on the size and diversity of nitrate-reducing bacterial community in soil.

  18. Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells

    Directory of Open Access Journals (Sweden)

    Chen Gang

    2011-01-01

    Full Text Available Abstract Background Real-time quantitative RT-PCR (RT-qPCR is a "gold" standard for measuring steady state mRNA levels in RNA interference assays. The knockdown of the epidermal growth factor receptor (EGFR gene with eight individual EGFR small interfering RNAs (siRNAs was estimated by RT-qPCR using three different RT-qPCR primer sets. Results Our results indicate that accurate measurement of siRNA efficacy by RT-qPCR requires careful attention for the selection of the primers used to amplify the target EGFR mRNA. Conclusions We conclude that when assessing siRNA efficacy with RT-qPCR, more than one primer set targeting different regions of the mRNA should be evaluated and at least one of these primer sets should amplify a region encompassing the siRNA recognition sequence.

  19. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  20. Abridged adapter primers increase the target scope of Hi-Plex.

    Science.gov (United States)

    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J

    2015-01-01

    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required.

  1. Paralog-specific primers for the amplification of nuclear Loci in tetraploid barbels (barbus: cypriniformes).

    Science.gov (United States)

    Gante, Hugo F; Alves, Maria Judite; Dowling, Thomas E

    2011-01-01

    Thirty paralog-specific primers were developed, following an intron-primed exon-crossing strategy, for S7 and growth hormone genes in Barbus (subgenera Barbus and Luciobarbus). We found that paralog-specific amplification requires the use of only one paralog-specific primer, allowing their simultaneous use with universal exon-primed intron-crossing primers of broad taxonomic applicability. This hybrid annealing strategy guarantees both specificity and generality of amplification reactions and represents a step forward in the amplification of duplicated nuclear loci in polyploid organisms and members of multigene families. Assays of several representative taxa identified high levels of segregating single nucleotide polymorphisms (SNPs) and nucleotide diversity within each of these subgenera. Additionally, several insertions-deletions (indels) that are diagnostic across species are found in intronic regions. Therefore, these primers provide a reliable source of valuable nuclear SNP and indel data for population and species level studies of barbels, such as applied conservation and basic evolutionary studies.

  2. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-06

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs.

  3. Rapid DNA extraction methods and new primers for randomly amplified polymorphic DNA analysis of Giardia duodenalis.

    Science.gov (United States)

    Deng, M Q; Cliver, D O

    1999-08-01

    A randomly amplified polymorphic DNA (RAPD) procedure using simple genomic DNA preparation methods and newly designed primers was optimized for analyzing Giardia duodenalis strains. Genomic DNA was extracted from in vitro cultivated trophozoites by five freezing-thawing cycles or by sonic treatment. Compared to a conventional method involving proteinase K digestion and phenol extraction, both freezing-thawing and sonication were equally efficient, yet with the advantage of being much less time- and labor-intensive. Five of the 10 tested RAPD primers produced reproducible polymorphisms among five human origin G. duodenalis strains, and grouping of these strains based on RAPD profiles was in agreement among these primers. The consistent classification of two standard laboratory reference strains, Portland-1 and WB, in the same group confirmed previous results using other fingerprinting methods, indicating that the reported simple DNA extraction methods and the selected primers are useful in RAPD for molecular characterization of G. duodenalis strains.

  4. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  5. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    Energy Technology Data Exchange (ETDEWEB)

    Matamala, G.; Droguett, G. (Universidad de Concepcion (Chile)); Smeltzer, W. (McMaster Univ., Hamilton, Ontario (Canada). Inst. for Materials Research)

    1994-04-01

    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.

  6. El método de cultivo "in vitro" como instrumento práctico en el diagnóstico y el aislamiento primário de Leishmania braziliensis braziliensis I. Observaciones de laboratório

    Directory of Open Access Journals (Sweden)

    Eduardo M. Netto

    1986-06-01

    Full Text Available Comparamos diferentes medios artificiales y procedimientos de cultivo in vitro de Leishmania braziliensis braziliensis (Lbb aislada de lesiones de hamsteres experimentalmente infectados. Observamos que la aspiración de material de la lesión, usando jeringa de 5 mlyaguja 22g(25 x 8mm, mostró resultados satisfactorios siendo un procedimiento conveniente de colecta. El medio de Agar Sangre Difco (DAB es un medio eficiente para el aislamiento de Lbb. El medio de Evans demostro similares resultados al DAB, mientras que el medio líquido de Schneider y el químicamente definido AR-103 fueron nitidamente inferiores. En la propagación in vitro de Lbb, el medio de Schneider permitió un buen crecimiento del flagelado, alcanzando densidades de 0,21 - 2,57 x 10(8 promastigotes por ml ya, en el 5.° dia de cultivo. La adición de 5-fluorocytosine a los tubos de cultivo (150/jg/mlpara evitar la contaminación por hongos, no inhibió el crecimiento de Lbb.

  7. AISLAMIENTO, CARACTERIZACIÓN Y CONSERVACIÓN DE BACTERIAS ÁCIDO-ACÉTICAS A PARTIR DE PRODUCTOS FERMENTADOS TRADICIONALES COMO UNA HERRAMIENTA PEDAGÓGICA. Pág. 146-149

    Directory of Open Access Journals (Sweden)

    Cindy Lucía Martínez

    2012-01-01

    Full Text Available El Trabajo de Grado titulado: “Aislamiento, caracterización y conservación de bacterias acido-acéticas a partir de productos fermentados tradicionales” se desarrolló determinando los géneros bacterias ácido-acéticas Acetobacter sp. y Gluconobacter sp., aisladas a partir de productos fermentados tradiciones como son la chicha de maíz y el masato de arroz, para verificar estas bacterias se realizó un bioproceso a pequeña escala demostrando la producción de ácido acético característica propia de estos microorganismos. Finalmente se establecieron métodos de conservación que aseguran la estabilidad genética, bioquímica y morfológica de las bacterias ácido-acéticas aisladas para la introducción en el Cepario del Departamento de Biología de la Universidad Pedagógica Nacional (CDBUPN con el fin de ser utilizadas por los docentes y estudiantes de Biología de la Universidad Pedagógica Nacional como herramienta para la enseñanza de conceptos relacionados con temáticas frente a procesos de orden biológico.

  8. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  9. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    Science.gov (United States)

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  10. Effects of acidic primer/adhesives on primary and permanent dentin

    OpenAIRE

    2009-01-01

    Purpose: To evaluate the quality of primary and permanent dentin by Fourier transformed Raman spectroscopy (FT-Raman), and scanning electron microscopy/energy-dispersive spectroscopy (SEM/EDS). Methods: The middle dentin of crowns was reached by carbide bur abrading providing a uniform smear layer. Self-etching primers were applied in order to simulate the etching of self-etching adhesive systems. The groups were (n = 6): G1 (primary dentin smear layer); G2 (primary dentin etched by primer of...

  11. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    OpenAIRE

    Wawan Abdullah Setiawan; Utut Widyastuti; Munti Yuhana

    2015-01-01

    Whiteleg shrimp (Litopenaeus vannamei) is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ64...

  12. Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture

    Science.gov (United States)

    2015-08-01

    ARL-MR-0896 ●AUG 2015 US Army Research Laboratory Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture...SUBTITLE Design of a Combined Ballistic Simulator and Primer Force Experimental Fixture 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...Contents List of Figures iv Acknowledgments v 1. Introduction 1 2. Background 1 3. Technical Approach 4 3.1 Hardware Design 4 3.2 Experimental Setup

  13. Eighteen SSR-primers for tetraploid Adansonia digitata and its relatives

    OpenAIRE

    Larsen, Anders Søndergaard; Vaillant, Alexandre; Verhaegen, Daniel; Kjær, Erik Dahl

    2009-01-01

    International audience; Co-dominant markers suitable for molecular ecological studies in the genus Adansonia are highly desirable in order to be able to address a number of interesting research questions related to the special life history traits, gene flow, and distribution dynamics of the Adansonia species. This note presents a set of 18 SSR- primers developed for Adansonia digitata, and tested for cross-amplification on all members of the Adansonia genus. All reported primers were found to a...

  14. Chrome-Free Paint Primer for Zn/Ni Plated High-Strength Steel (Briefing Charts)

    Science.gov (United States)

    2014-11-19

    Approach Primer technology development steps:  Corrosion inhibitor chemistries modeling and high-throughput screening in solution  Promising inhibitor ...95% CI Effectiveness of Corrosion Inhibitors SrCrO4 Low(-) High(+) High(+) High(+) Low(-) Low(-) Ce3+ MoO4 2- WO4 2-B A C Approved for Public Release...Chrome-free Primer TCP LHE= Low Hydrogen Embrittlement CCC= Chromate (Cr6+) Conversion Coating TCP= Trivalent (Cr3+) Chromium Process  Regulatory EHS

  15. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    Science.gov (United States)

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  16. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G.J.; Bekeris, P.A. [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  17. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A;

    1999-01-01

    Retroviral reverse transcription is primed by a cellular tRNA molecule annealed to an 18-bp primer binding site sequence. The sequence of the primer binding site coincides with that of a negatively acting cis element that mediates transcriptional silencing of murine leukemia virus (MLV......) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... to findings from cell culture studies of primer binding site-modified human immunodeficiency virus type 1 and avian retroviruses, our findings were that SL3-3 MLV may stably and efficiently replicate with tRNA primers other than tRNAPro. Although lymphoma induction of the SL3-3 Lys3 mutant was significantly...

  18. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  19. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  20. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus......Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  1. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity...... of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed...

  2. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    Science.gov (United States)

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice

    2015-01-01

    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  3. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.

    Science.gov (United States)

    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A

    2012-01-01

    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength.

  4. Primer containing dimethylaminododecyl methacrylate kills bacteria impregnated in human dentin blocks

    Institute of Scientific and Technical Information of China (English)

    Chen Chen; Lei Cheng; Michael D Weir; Nancy J Lin; Sheng Lin-Gibson; Xue-Dong Zhou; Hockin HK Xu

    2016-01-01

    Antibacterial dimethylaminododecyl methacrylate (DMADDM) was recently synthesized. The objectives of this study were to:(1) investigate antibacterial activity of DMADDM-containing primer on Streptococcus mutans impregnated into dentin blocks for the first time, and (2) compare the antibacterial efficacy of DMADDM with a previous quaternary ammonium dimethacrylate (QADM). Scotchbond Multi-Purpose (SBMP) bonding agent was used. DMADDM and QADM were mixed into SBMP primer. Six primers were tested:SBMP control primer P, P+2.5%DMADDM, P+5%DMADDM, P+7.5%DMADDM, P+10%DMADDM, and P+10%QADM. S. mutans were impregnated into human dentin blocks, and each primer was applied to dentin to test its ability to kill bacteria in dentinal tubules. Bacteria in dentin were collected via a sonication method, and the colony-forming units (CFU) and inhibition zones were measured. The bacterial inhibition zone of P+10%DMADDM was 10 times that of control primer (Po0.05). CFU in dentin with P+10%DMADDM was reduced by three orders of magnitude, compared with control. DMADDM had a much stronger antibacterial effect than QADM, and antibacterial efficacy increased with increasing DMADDM concentration. Dentin shear bond strengths were similar among all groups (P40.1). In conclusion, antibacterial DMADDM-containing primer was validated to kill bacteria inside dentin blocks, possessing a much stronger antibacterial potency than the previous QADM. DMADDM-containing bonding agent was effective in eradicating bacteria in dentin, and its efficacy was directly proportional to DMADDM mass fraction. Therefore, DMADDM may be promising for use in bonding agents as well as in other restorative and preventive materials to inhibit bacteria.

  5. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  8. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    Science.gov (United States)

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR.

  9. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted of ...

  10. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  11. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Science.gov (United States)

    Sonthiphand, Puntipar; Neufeld, Josh D

    2013-01-01

    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r

  12. Universal isolation precautions for patients at an academic hospital Precauciones universales en el aislamiento de pacientes en un hospital universitario Precauções universais em isolamentos de pacientes em hospital universitário

    Directory of Open Access Journals (Sweden)

    Vanessa Gomes Maziero

    2012-01-01

    Full Text Available OBJECTIVE: To apply universal isolation precautions for patients at an academic hospital by a nursing team. METHODS: This descriptive and prospective study used data from advice service of quality control and nursing care that were gathered in observational reports of universal isolation precautions for patients admitted in two surgical inpatient units during 2008 and 2010. RESULTS: The mean general classification for both units was between desirable and adequate in the observational analysis of universal precaution. A borderline effect was observed only in November 2008 at the Men's Surgical Unit. The units assessed had compromised biosecurity, however, as time advanced data showed an improvement on their performance. CONCLUSION: The effective involvement of nurses in the unit is critical to prevent and control nosocomial infections.OBJETIVO: Utilización de las precauciones universales por el equipo de Enfermería en el aislamiento de pacientes en un Hospital Universitario. MÉTODOS: Estudio descriptivo, prospectivo. Fueron utilizados datos de la Asesoría de Control de Calidad de la Asistencia de Enfermería, correspondientes a los informes de las observaciones respecto a las precauciones universales en el aislamiento de pacientes en dos unidades de internamiento Médico - Quirúrgico, en el período comprendido entre 2008 y 2010. RESULTADOS: Las dos unidades de la institución presentaron un promedio general de clasificación, del análisis observacional de precaución universal, entre deseable y adecuada, siendo limítrofe apenas en noviembre del 2008 en la unidad Médico-Quirúrgica Masculina. Las unidades evaluadas, respecto a la adhesión a las precauciones universales, presentaron compromiso con la bioseguridad, y los datos exhibidos se mostraron mejores en cada año descrito. CONCLUSIÓN: La participación activa del enfermero responsable por la unidad es importante en la prevención y control de infecciones hospitalarias

  13. Energy consumption and the use of thermal insulating materials. A comparative analysis on the tendencies over the time; Consumo de energia y uso de aislamientos termicos - un analisis comparativo de tendencias en el tiempo

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez C, Luis Felipe [Aislantes Minerales, S. A. de C. V. Mexico, D. F. (Mexico)

    1994-12-31

    positivas y son semejantes a las tendencias en el consumo de aislamientos termicos y a cifras semejantes de otros paises. El analisis de estas cifras nos permiten detectar si se pueden correlacionar los esfuerzos de ahorro de energia con el consumo de aislamientos termicos y con el nivel de vida de un pais (determinado por su ingreso per capita), y establecer un indice futuro de efectividad de conservacion de energia por el uso adecuado de materiales de espesor economico. El indice propuesto en esta ponencia sirve este proposito y nos arroja resultados interesantes. A lo largo de los anos recientes y como resultado del cambio en el nivel de industrializacion y de vida en Mexico, el consumo de energeticos ha aumentado en proporcion mayor al crecimiento de poblacion, tomando como base las cifras de 1980. En ese mismo periodo, el producto interno bruto per capita ha aumentado en proporcion tambien ligeramente menor al crecimiento poblacional. Esto significa que la cifra de Intensidad Energetica, definida como la proporcion de consumo de energeticos sobre el producto interno bruto, ha aumentado ligeramente en el mismo periodo en consideracion, significando que el pais se ha vuelto mas ineficiente en anos recientes. Al mismo tiempo, la capacidad de produccion de materiales aislantes termicos ha permanecido constante desde 1980 hasta principios de 1994. Esto compara desfavorablemente con todos los paises desarrollados, en los cuales la intensidad energetica ha disminuido considerablemente en los ultimos anos, al tiempo que la produccion de materiales aislantes termicos ha crecido a un ritmo de proporciones semejantes.

  14. Multiplex PCR based on a universal biotinylated primer to generate templates for pyrosequencing.

    Science.gov (United States)

    Chen, Zhiyao; Liu, Yunlong; Duan, Wenbang; Ye, Hui; Wu, Haiping; Li, Jinheng; Zhou, Guohua

    2014-06-01

    Pyrosequencing is a powerful tool widely used in genetic analysis, however template preparation prior to pyrosequencing is still costly and time-consuming. To achieve an inexpensive and labor-saving template preparation for pyrosequencing, we have successfully developed a single-tube multiplex PCR including a pre-amplification and a universal amplification. In the process of pre-amplification, a low concentration of target-specific primers tagged with universal ends introduced universal priming regions into amplicons. In the process of universal amplification, a high concentration of universal primers was used for yielding amplicons with various SNPs of interest. As only a universal biotinylated primer and one step of single-stranded DNA preparation were required for typing multiple SNPs located on different sequences, pyrosequencing-based genotyping became time-saving, labor-saving, sample-saving, and cost-saving. By a simple optimization of multiplex PCR condition, only a 4-plex and a 3-plex PCR were required for typing 7 SNPs related to tamoxifen metabolism. Further study showed that pyrosequencing coupled with an improved multiplex PCR protocol allowed around 30% decrease of either typing cost or typing labor. Considering the biotinylated primer and the optimized condition of the multiplex PCR are independent of SNP locus, it is easy to use the same condition and the identical biotinylated primer for typing other SNPs. The preliminary typing results of the 7 SNPs in 11 samples demonstrated that multiplex PCR-based pyrosequencing could be promising in personalized medicine at a low cost.

  15. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    Science.gov (United States)

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  16. The effect of various primers on shear bond strength of zirconia ceramic and resin composite

    Directory of Open Access Journals (Sweden)

    Sasiwimol Sanohkan

    2013-01-01

    Full Text Available Aims: To determine the in vitro shear bond strengths (SBS of zirconia ceramic to resin composite after various primer treatments. Materials and Methods: Forty zirconia ceramic (Zeno, Wieland Dental specimens (10 mm in diameter and 2 mm thick were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10. Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE, AP (Alloy Primer, Kuraray Medical, and MP (Monobond Plus, Ivoclar Vivadent AG. One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa were analyzed with one-way analysis of variance (ANOVA and the Tukey′s Honestly Significant Difference (HSD test (α = 0.05. Results: Group AP yielded the highest mean and standard deviation (SD value of SBS (16.8 ± 2.5 MPa and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa. The SBS did not differ significantly among the groups (P = 0.079. Conclusions: Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  17. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  18. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  19. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode.

  20. Effect of 4-MET- and 10-MDP-based primers on resin bonding to titanium.

    Science.gov (United States)

    Tsuchimoto, Youhei; Yoshida, Yasuhiro; Mine, Atsushi; Nakamura, Mariko; Nishiyama, Norihiro; Van Meerbeek, Bart; Suzuki, Kazuomi; Kuboki, Takuo

    2006-03-01

    The purpose of this study was to investigate the effect of a 4-MET- and 10-MDP-based primer on the bond strength of two resin cements (SuperBond C&B, Sun Medical; Panavia Fluoro Cement, Kuraray) to titanium (Ti). Ti plates were treated with six experimental primers consisting of, respectively, 10-MDP and 4-MET in concentrations of 0.1, 1 and 10wt%, or were kept untreated (control). The highest tensile bond strength of Panavia Fluoro Cement to Ti was obtained when the Ti surface was pre-treated with 10wt% 10-MDP and was significantly higher than that when a lower concentrated 10-MDP-based primer or any 4-MET-based primer was used. On the contrary, no significant difference in tensile bond strength of SuperBond C&B was found for the untreated and six pre-treated Ti surfaces, although pre-treatment with each 10-MDP-based primer resulted in a higher tensile bond strength as compared to any 4-MET pre-treatment. Altogether, the data obtained strongly suggest that 10-MDP is effective to improve the adhesive performance of resin to titanium.

  1. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  2. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra

    2015-01-01

    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (Pveneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  3. El método de cultivo "in vitro" como instrumento práctico en el diagnóstico y el aislamiento primário de Leishmania braziliensis braziliensis I. Observaciones de laboratório

    Directory of Open Access Journals (Sweden)

    Eduardo M. Netto

    1986-06-01

    Full Text Available Comparamos diferentes medios artificiales y procedimientos de cultivo in vitro de Leishmania braziliensis braziliensis (Lbb aislada de lesiones de hamsteres experimentalmente infectados. Observamos que la aspiración de material de la lesión, usando jeringa de 5 mlyaguja 22g(25 x 8mm, mostró resultados satisfactorios siendo un procedimiento conveniente de colecta. El medio de Agar Sangre Difco (DAB es un medio eficiente para el aislamiento de Lbb. El medio de Evans demostro similares resultados al DAB, mientras que el medio líquido de Schneider y el químicamente definido AR-103 fueron nitidamente inferiores. En la propagación in vitro de Lbb, el medio de Schneider permitió un buen crecimiento del flagelado, alcanzando densidades de 0,21 - 2,57 x 10(8 promastigotes por ml ya, en el 5.° dia de cultivo. La adición de 5-fluorocytosine a los tubos de cultivo (150/jg/mlpara evitar la contaminación por hongos, no inhibió el crecimiento de Lbb.We have compared differeni media and isolation procedures to cultivate Leishmania braziliensis braziliensis/rom hamster tissues. Wefmd that aspiration of the lesion using a 22 g needle and a five ml syringegives satisfactorv results, and is a convenient sampling method. Difco Blood agar is an efficient medium for isolation. Evans medium gave equal results while Schneiders and AR-103 medium were inferior. In Schneider's medium flagellate growth achieved 0.21 - 2.57 x 10(8 promastigotes/ml bv the fifth day 5-fluorocytosine added to the cultures to avoid fungal contamination does not inhibit the growth of L. b. brasiliensis.

  4. Fractal analysis of the electrical discharges' surface paths in polymeric insulation considering different pollution levels; Analisis fractal de las trayectorias de descargas electricas superficiales en aislamiento polimerico considerando diferentes niveles de contaminacion

    Energy Technology Data Exchange (ETDEWEB)

    Palacios Lopez, Arturo

    2002-07-01

    In this thesis tree patterns of superficial breakdown in polymeric insulator of Silicon Rubber are generated. Experimental arrangement rod-rod was used on the basis of norm ASTM D 2303-85. Pollution levels on the basis of norm IEC 507 were also used. The experimental values of Fractal Dimension for each case of pollution were reported. A self similar method called Box Counting for the fractal dimension calculus and for the self affine methods an R/S and Variogram were used. According to the results, it was concluded that the tree patterns of superficial electric breakdown in Silicon Rubber is self similar and its value does not depend on the degree of pollution, that is equivalent to the concentration of salt for liter of water or to the Equivalent Salt Deposition (ESDD), in the surface of an insulator. [Spanish] En el presente trabajo se inducen descargas electricas superficiales en un aislamiento polimerico de Hule Silicon, el arreglo experimental que se utilice es punta-punta con base en la norma ASTM D 2303-85 y los niveles de contaminacion con base en la norma IEC 507. Se reportan los valores experimentales de la Dimension Fractal para cada caso de contaminacion, se utilice el metodo auto similar de conteo de cuadros, para el calculo de la Dimension Fractal y para metodos auto afines se utilice analisis R/S y variograma. Con los resultados obtenidos se concluye que la trayectoria de la descarga electrica superficial en un polimero de Hule Silicon es auto similar y su valor no depende del grado de contaminacion, el cual es equivalente a la concentracion de gramos de sal por litro de agua o a la densidad de sal depositada (DESD), en la superficie de un aislador.

  5. Aislamiento e identificación de microorganismos entéricos en muestras ambientales y cloacales en Crocodylus intermedius y testudines de la Estación de Biología Tropical Roberto Franco en Villavicencio, Colombia

    Directory of Open Access Journals (Sweden)

    C. A. Moreno

    2010-04-01

    Full Text Available Los microorganismos entéricos han sido frecuentemente reportados como patógenos enmamíferos, aves, peces, reptiles y humanos, a pesar de hacer parte de su flora normal intestinal.La Estación de Biología Tropical Roberto Franco (EBTRF, lidera el programade recuperación del Caimán Llanero (Crocodylus intermedius, que se encuentra en inminentepeligro de extinción; adicionalmente cuenta con una colección viva de Testudinesque comprende más de 20 especies. Con el fin de determinar la presencia de potencialesenteropatógenos en el hábitat de los ejemplares, se obtuvieron 129 muestras ambientalesy cloacales de las especies allí encontradas; se utilizó el medio de cultivo CHROMagarOrientaciónBD® para realizar los aislamientos y la identificación microbiológica. Los resultadosmuestran una mayor presentación de flora gram negativa predominando microorganismosde los géneros (28%, Klebsiella sp (26%, Salmonella sp.(6%, Proteus sp (3% y Citrobacter sp. (1% Sin embargo, microorganismos del géneroEnterococcus sp. (gram positivo, fueron hallados en un mayor porcentaje (31% en todaslas muestras sin importar el origen de las mismas. Conscientes del riesgo que implica elaislamiento de microorganismos entéricos que pueden presentar un carácter zoonótico,se dio inicio a la implementación de un manual de bioseguridad para la Estación con elfin disminuir el riesgo para la población humana y animal.

  6. A low cost method to produce a gaseous environment for the isolation of Helicobacter pylori Un método de bajo costo para producir el ambiente gaseoso para el aislamiento de Helicobacter pylori

    Directory of Open Access Journals (Sweden)

    Francisco Hernández

    1992-04-01

    Full Text Available A low cost method (LCM to produce a gaseous environment for the isolation of Helicobacter pylori, was compared with the standard Gas Park system. The LCM uses a carbonated antacid tablet, a plastic bag with tap water, a candle, and a wide-mouthed glass jar provided with a tight-fitting metalic screw cap and a rubber gasket. Antral gastric biopsies from 153 cases were incubated by duplicate on blood agar plates and treated with the two methods. In 95 cases the agent was isolated from both, and only from the standard method in 10 cases; the opposite condition was found in five cases, and 43 were negative. That difference is not significant (Pearson's X²= 93.25 p > 0,05Se comparó un método de bajo costo (MBC para producir el ambiente gaseoso para el aislamiento de Helicobacter pylori, con el sistema estándar de gas Pak. El MBC usa una tableta carbonata de antiácido, una bolsa plástica con agua, una candela y un frasco de vidrio con boca ancha, provisto de tapa metálica de rosca con empaque de hule. Las biopsias de antro de 153 pacientes se inocularon por duplicado en platos de agar sangre y se incubaron bajo los dos sistemas. En 195 casos el agente se aisló de ambos platos, y sólo del incubado bajo el método estándar en diez casos; la condición opuesta se presentó en cinco casos; 43 casos fueron negativos. Esa diferencia no es significativa (X² de Pearson = 93,25 p > 0,05

  7. Evaluación de aislamientos de baculovirus para el control de Spodoptera frugiperda (Smith, 1797 (LEP.: NOCTUIDAE, plaga clave del maíz en el noroeste argentino Evaluation of baculovirus strains to control the fall armyworm, Spodoptera frugiperda (Smith, 1797 (LEP.: NOCTUIDAE, a key corn pest in North Western Argentina

    Directory of Open Access Journals (Sweden)

    Marta G. Yasem de Romero

    Full Text Available Para el control de Spodoptera frugiperda (Smith, plaga clave del maíz en el noroeste argentino (NOA, se utilizan insecticidas químicos que muestran en muchas ocasiones, una baja efectividad. Los baculovirus constituyen una alternativa biológica para el manejo del gusano cogollero. El propósito de este trabajo fue evaluar la susceptibilidad de estadios larvales de S. frugiperda a distintas concentraciones de tres aislamientos del Nucleopolyhedrovirus de diferentes procedencias. Los resultados obtenidos permitieron constatar que la mortalidad de las orugas de S. frugiperda aumentó con el incremento de la concentración viral y que la susceptibilidad larval al virus decreció con el aumento de la edad del insecto. Se determinó una concentración letal media (CL50 de 7,6 x 10(4 y 4,5 x 10(5 poliedros/ml en larvas de tres y cinco días respectivamente, para el VPN aislamiento Leales (Tucumán, Argentina. Con niveles similares se ubicó el aislamiento Oliveros (Santa Fe, Argentina, cuya CL50 fue de 8,6 x 10(4 poliedros/ml y 4 x 10(5 poliedros/ml, respectivamente. Por último, el aislamiento oriundo de Brasil presentó CL50 igual a 5,9 x 105 poliedros/ml para larvas de tres días, y 1,5 x 106 poliedros/ml para orugas de cinco días. El aislamiento local demostró la mayor virulencia en la población nativa de larvas de S. frugiperda, registrando para larvas jóvenes (tres y cinco días de edad y a los valores de concentración letal media, un tiempo medio de mortalidad de seis días, resultando siete días para el aislamiento Oliveros y nueve días para el aislamiento Brasil. Considerando los resultados obtenidos, el VPNSf aislamiento Leales tuvo el mejor desempeño y sería conveniente continuar los estudios destinados a desarrollar un bioinsecticida para uso local, ya que evidencia una adecuada virulencia. Además, al ser un aislamiento nativo, su empleo sería el más apropiado en términos de impacto ambiental.Chemical insecticides are used

  8. Análisis de la eficiencia del sistema de aislamiento de vibraciones de grupos electrógenos MAN 18 V48/60 B // Efficiency analysis of vibration isolation system installed on engine generator sets type MAN 18 V48/60 b

    Directory of Open Access Journals (Sweden)

    Evelio Palomino‐Marín

    2011-01-01

    Full Text Available Todo sistema de aislamiento de vibraciones está encaminado en primera instancia a aislarvibraciones como su propio nombre lo indica. En ocasiones es menester que a la máquina no laperturben vibraciones procedentes del entorno, como lo puede ser por ejemplo, el caso de unarectificadora en un taller de mecanizado. Así mismo, en otras ocasiones resulta necesario aislar lamáquina para evitar que las vibraciones producidas por ella misma afecten al entorno. Tal es el casode los grupos electrógenos MAN 18 V48/60 B, cuyos motores de combustión interna responden a undiseño de 18 cilindros en “V” distribuidos en 13 metros de longitud. El sistema de aislamiento deestos motores consta de 14 paquetes de ocho resortes cada uno, incluyendo un amortiguadorviscoso por cada calzo. Se efectuaron mediciones espectrales de vibraciones en cada uno de estoscalzos antivibratorios, sobre y debajo de estos respectivamente y se evaluó la eficiencia de estoscalzos en todo el espectro, determinándose aquellas frecuencias que por determinadas razones noalcanzan los niveles de eficiencia en el aislamiento establecidos a tales efectos. De esta manera, sepresenta una metodología para conducir este análisis.Palabras claves: calzos antivibratorios, aislamiento de vibraciones, grupos electrógenos.___________________________________________________________________AbstractA vibroisolation system has a priority goal which is isolate vibrations. Such vibrations can come fromthe environment and could affect the machine behavior and could affect its technological functionstoo. That’s the case of a machine tool, for instance. However, it is also possible that vibrations comefrom the own machine and in this case the main goal of vibroisolation system is to avoid thatvibrations go to machine foundations. This is the case on which this paper is focused. Twelvevibration isolators with eight springs each one including a viscous damper are mounted asvibroisolation system on

  9. Diseño de un panel sándwich semi-ligero con aislamiento de fibra natural proveniente del Ecuador que supere las prestaciones de los paneles existentes actualmente en el mercado, en base a parámetros térmicos, acústicos y de respeto por el medio ambiente

    OpenAIRE

    Monge Pontón, Alex Guillermo

    2016-01-01

    Esta investigación se la realiza con el objetivo de generar un panel sándwich que pueda competir con los paneles sándwich actualmente comercializados en el Ecuador. El panel propuesto es elaborado con cascarilla de arroz como aislante, y demuestra ser una alternativa energéticamente eficiente y amigable con el ambiente, ya que logra competir con los paneles sándwich con aislamientos derivados del petróleo, los cuales repercuten negativamente en el equilibrio ecológico. Además en la investiga...

  10. Secuenciación y clonación de los genes dihidrofolatoreductasa (dhfr) y dihidropteroatosintetasa (dhps) de la cepa RH y de 2 aislamientos de Toxoplasma gondii / Sequencing and cloning dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes of the RH reference strain and two isolates of Toxoplasma gondii

    OpenAIRE

    Cortés Cortés, Liliana Jazmín

    2012-01-01

    El presente trabajo tuvo por objetivo realizar la clonación y secuenciación de los genes dihidrofolatoreductasa (dhfr) y dihidropteroatosintetasa (dhps) de la cepa de referencia RH y de dos aislamientos de Toxoplasma gondii obtenidos a partir de líquido céfalo-raquídeo (LCR) de pacientes HIV positivos con toxoplasmosis cerebral. Se realizó la optimización de las técnicas de extracción del DNA parasitario y de la Reacción en Cadena de la Polimerasa (PCR), la secuenciación de los productos puri...

  11. Aislamiento de Candida spp. y otras levaduras en el personal que labora en áreas críticas del Hospital San Juan de Dios Isolation of Candida spp. and other yeasts from Health Care Workers in Critical Care Units of the San Juan de Dios Hospital

    OpenAIRE

    Pedro Carrillo-Dover; Carolina Álvarez-Vega; Ingrid Salas-Campos; Nury Mora-Brenes

    2009-01-01

    Justificación y objetivos: Los pacientes internados en hospitales, principalmente aquellos que se encuentran severamente enfermos, son más susceptibles a las infecciones por hongos oportunistas, en comparación con la población general. El personal hospitalario puede ser fuente potencial de infección para estos pacientes, ya que normalmente actúa como portador de gérmenes, que eventualmente podrían ser transmitidos a los pacientes. Se describe, en esta investigación, el aislamiento de hongos l...

  12. Comparación de condiciones de cultivo para el aislamiento y recuento simultáneo de levaduras de suelos de bosques nativos de Nothofagus spp. (Fagaceae) de la Patagonia Argentina Comparison of culture conditions for isolation and count of soil yeasts from Nothofagus spp. (Fagaceae) native forest of Argentinean Patagonia

    OpenAIRE

    2009-01-01

    Se compararon las condiciones de cultivo para aislar y contar levaduras del suelo de los bosques nativos de Nothofagus spp. en la Patagonia de Argentina. En este trabajo se propone la utilización de medios de cultivo adicionados con Rosa de Bengala 25 >g/mL y 200 >g/mL de Cloranfenicol. En estas condiciones se obtuvieron recuentos de levaduras que rondan 10³ UFC/g de suelo (aproximadamente 4% de la flora microbiana detectada). Se compararon los resultados de aislamientos por el método enrique...

  13. Desarrollo y validación intralaboratorio de una metodología para la detección y aislamiento de Escherichia coli productor de toxina shiga en carne bovina molida : Desarrollo de estrategias de control

    OpenAIRE

    2016-01-01

    Escherchia coli productor de toxina Shiga (STEC) es un patógeno asociado a ETA y la carne molida es uno de los alimentos involucrados en su transmisión. El objetivo del trabajo fue disminuir la contaminación con STEC en la carne bovina molida destinada a consumo minorista. El trabajo se desarrollo en tres etapas: 1) evaluación de diferentes medios de cultivo para el enriquecimiento y aislamiento de STEC en carne bovina molida, 2) desarrollo y validación de dos técnicas de tamizaje para la det...

  14. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    OpenAIRE

    Pena, S D; Barreto, G.; Vago, A. R.; De Marco, L; Reinach,F. C.; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites wi...

  15. Demonstration and Validation of a Replacement Alternative to the Chromate Wash Primer DOD-P-15328D

    Science.gov (United States)

    2006-04-01

    system. The current wash primer is a low-solids, solvent-based polyvinyl butyral that contains phosphoric acid and zinc chromate that promotes adhesion...prior to the application of an epoxy primer/polyurethane topcoat CARC system. The current wash primer is a low-solids, solvent-based polyvinyl ... butyral that contains phosphoric acid and zinc chromate that promotes adhesion and minimizes corrosion. This coating contains large amounts of volatile

  16. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  17. Effect of primers containing copper salts on bonding of TBB resin to enamel.

    Science.gov (United States)

    Taira, Y; Imai, Y

    1994-12-01

    The effect of primers containing copper salts on adhesion between enamel and stainless steel was studied in a trial to improve durability of TBB type resin cements. Bovine enamel surfaces were treated with 10% phosphoric acid, then with acetone primers containing copper salts, and finally bonded with TBB resins. Tensile strengths of the bonded specimens were measured after thermocycling testing in water and compared with those obtained for commercial composite type resin cements. A combination of a primer containing copper (II) methacryloyloxyethyl succinate and 4-META/MMA-TBB resin was most effective in improving the durability, and superior to the commercial resin cements. The mean and lowest bond strength values of 21 MPa and about 12 MPa, respectively, were retained after 2,000 thermocycles.

  18. Analysis of Two Chinese Yak(Bos grunniens) Population Using Bovine Microsatellite Primers

    Institute of Scientific and Technical Information of China (English)

    Wang Minqiang; S.Weigend; A.Barre-Dirie; J.W.Carnwath; Lou Zhonglin; H.Niemann

    2005-01-01

    Two Chinese domestic yak populations representing the Plateau type and the Huanhu Alpine type were analysed with 12 bovine microsatellite primers. All primer pairs functioned in the yak genome and polymorphism was found at all loci. The allele size ranges and frequencies of the two yak populations were similar and there was considerable overlap with the allele size ranges observed in cattle. Data for European cattle breeds was obtained from the Cattle Diversity Database(CaDBase)to interpret the heterozygosity and genetic distance estimates in yak populations. Heterozygosity estimated for the two yak populations was comparable to that of European cattle while Nei's Genetic Distance DA between the two yak populations was less than distances between the most closely related German cattle breeds. Bovine microsatellite primers proved to be a valuable tool for characterization of yak populations.

  19. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  20. Efficient newly designed primers for the amplification and sequencing of bird mitochondrial genomes.

    Science.gov (United States)

    Amer, Sayed A M; Ahmed, Mohamed Mohamed; Shobrak, Mohammed

    2013-01-01

    In the present study, 27 mitochondrial genomes of diverse avian supra-orders were collected from the Genbank database and their genes were aligned separately. From the alignments, the conserved sequences were selected to design novel conserved primers for amplification and sequencing of the different mitochondrial genes. The reproducibility of these primers was tested in the amplification and sequencing of diverse avian supra-order mitochondrial genomes and was confirmed. This method helped in designing a new set of primers to accelerate both the amplification and the sequencing of bird mitogenomes. It also aids in building mitogenome markers in studying the genetic framework of endemic birds as a preliminary strategy for conservation management of them.

  1. Kisspeptin: a new neuronal target of primer pheromones in the control of reproductive function in mammals.

    Science.gov (United States)

    Jouhanneau, Mélanie; Szymanski, Laura; Martini, Mariangela; Ella, Arsène; Keller, Matthieu

    2013-07-01

    Pheromones are known to trigger either short-term behavioral responses, usually referred to as "releaser effects", or more long-term physiological changes, known as "primer effects", which especially affect reproductive function at the level of the gonadotrope axis. The precise mechanisms through which pheromones interact with the gonadotrope axis in the hypothalamus is not fully known. We propose that the neuropeptide Kisspeptin, could be a specific target of primer pheromones, allowing these pheromones to modulate the gonadotrope axis and GnRH activity. This emerging hypothesis is discussed in the context of puberty acceleration in female mice and the male effect in female ungulates (sheep or goat). These examples have been chosen to illustrate the diversity of the reproductive contexts in mammals and potential mechanisms affected by primer effects at the level of the gonadotrope axis.

  2. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).

    Science.gov (United States)

    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P

    2014-11-01

    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice.

  3. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus;

    2004-01-01

    One of the most promising techniques for typing of multiple single-nucleotide polymorphism (SNP) is detection of single base extension primers (SBE) by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). We present a new MALDI-TOF MS protocol for typing...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal......, and the potential use of MALDI-TOF MS for SNP typing is discussed....

  4. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    Science.gov (United States)

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  5. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  6. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik;

    2001-01-01

    Simian immunodeficiency viruses (SIV) harbor primer binding sites (PBS) matching tRNA or tRNA. To study determinants of primer usage in SIV, a SIVmac239-based vector was impaired by mutating the PBS to a sequence (PBS-X2) with no match to any tRNA. By cotransfection of a synthetic gene encoding a tRNA...... could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold......(Pro)-like RNA with a match to PBS-X2, the activity of this vector could be restored to a transduction efficiency slightly lower than that of the wild-type vector. A vector with a PBS matching tRNA(Pro) was functional at a level slightly below that of the wild-type vector, but higher transduction efficiency...

  7. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  8. Design and implementation of degenerate microsatellite primers for the mammalian clade.

    Directory of Open Access Journals (Sweden)

    Emmanuel Buschiazzo

    Full Text Available Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1 identify conserved microsatellite loci from a multiple genome alignments, (2 design degenerate primer pairs, with (3 a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ~1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120-160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced.

  9. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  10. Phosphatizing of Mg particles to improve the protective performance of Mg-rich primer on A2024 Al alloy

    Science.gov (United States)

    Wang, Jianguo; Zuo, Yu; Tang, Yuming; Lu, Xiangyu

    2014-02-01

    Mg-rich primer as a new type protective coating provides cathodic protection for Al alloy. In this paper, a kind of phosphatizing surface treatment on Mg particles was studied in order to improve the protective performance of Mg-rich primer. After treated with phosphoric acid, a protective magnesium phosphate layer was formed on the surface of Mg particles, which had no negative influence on the cathodic protection of the Mg-rich primer for Al alloy. The coating resistance of the treated Mg-rich primer was bigger than that of untreated primer, meanwhile the coating capacitance of the treated Mg-rich primer was smaller than that of untreated primer, suggesting that the barrier effect of the primer was improved and the lifetime was extended. The magnesium phosphate layer could reduce the consumption rate of Mg particles. Meanwhile, the phosphate radicals transported to Al alloy substrate to form a product layer composed of magnesium phosphate and aluminum phosphate on the substrate surface, which decreased the corrosion rate of Al alloy and improved the protective performance of the primer.

  11. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka

    2016-01-01

    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera , including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera . We feel that a PCR-based approach still has its place in m...

  12. Joint DoD Demonstration And Validation Of Magnesium-Rich Primer Coating Technology

    Science.gov (United States)

    2012-01-01

    AAC-K16 .. K18 896-AAC-D19 .. D21 896-AAC-X22 .. X24 Deft 02-Y-40 ANAC Aerodur 5000 MEK Wipe Brulin GD815 Butyl Alcohol 35% IPA 25% Phosphoric Acid ...Joint DoD Demonstration and Validation of Magnesium -Rich Primer Coating Technology ESTCP Project WP-0731 Dr. Craig J. Price Rachel M...Validation of Magnesium -Rich Primer Coating Technology 5a. CONTRACT NUMBER 5b. GRANT NUMBER WP-0731 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S

  13. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy......The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au...

  14. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...

  15. Alteraciones del primer radio en el plano sagital. Tratamiento ortopodológico

    OpenAIRE

    Prats Climent, Baldiri; Alcorisa Rodero, Olga; Verdaguer Sanmartí, Josefina; Vázquez Amela, F. Xavier (Francesc Xavier); Vergés Salas, Carles; Vila Espinalt, Rosa M.

    2004-01-01

    Las alteraciones posicionales del primer radio en un plano sagital, dorsiflexionado o plantarflexionado, son causas de alteraciones en el funcionamiento de la articulación subastragalina y en consecuencia de la posición resultado del retropié. Esta relación causa-efecto depende de la movilidad (flexible, semiflexible o rígido) y de la adaptación del primer radio al suelo en la fase de apoyo total durante la marcha. Dependiendo de ello el tratamiento ortopodólogico será diferente, ...

  16. El arte de cozina de Diego Granado (1599), primer libro de cocina en lengua castellana

    OpenAIRE

    Redondo Buey, Patricia

    2014-01-01

    El Siglo de Oro es un periodo histórico que abarca desde el Renacimiento del siglo XVI hasta el Barroco del siglo XVII, durante el cual se publicó el primer tratado gastronómico de España. En este trabajo científico haremos un estudio meticuloso y minucioso sobre lo que se considera el primer recetario del Siglo de Oro español y así analizar las fuentes primarias de la cocina española, cosa que nunca se había hecho.

  17. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    OpenAIRE

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong

    2007-01-01

    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-...

  18. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  19. ANALISIS PRODUCT MAPPING DAYA SAING EKSPOR PRODUK PRIMER INDONESIA DAN CHINA

    Directory of Open Access Journals (Sweden)

    Sulthon Sjahril Sabaruddin

    2015-11-01

    Full Text Available This research attempts to analyze the mapping competition of the Indonesian and Chinese primary products in order to identify and map the strengths and weaknesses of Indonesian products vis-à-vis China. To examine this, the study uses tools such as the SMART Model (Software for Market Analysis and Restrictions on Trade, Social Accounting Matrix 2008 (SAM 2008, Normalized Revealed Comparative Advantage (NRCA and the Product Mapping. The results of the competition analysis found that Indonesia which rely on the export of primary products, in overall it is predicted to win the competition against China as the Indonesian primary products have better competitiveness than China. However, in the future, the competition will be fiercer, therefore, Indonesia should make efforts to improve further the competitiveness of Indonesian exports. Penelitian ini dimaksudkan untuk mengevaluasi peta persaingan produk primer Indonesia dan China guna mengidentifikasi dan memetakan kekuatan dan kelemahan produk Indonesia dalam persaingan dengan produk-produk primer asal China. Guna menelaah studi ini, beberapa perangkat dimanfaatkan yakni SMART Model (Software for Market Analysis and Restrictions on Trade, Sistem Neraca Sosial Ekonomi 2008 (SNSE 2008, Normalized Revealed Comparative Advantage (NRCA dan Product Mapping. Hasil analisis peta persaingan kedua negara, Indonesia yang mengandalkan ekspor produk primer diperkirakan secara keseluruhan unggul dibandingkan produk primer dari China karena Indonesia memiliki daya saing yang lebih baik dibandingkan China. Namun demikian, perlu diperhatikan bahwa persaingan ke depan akan berlangsung semakin ketat, oleh karena itu Indonesia perlu melakukan upaya untuk meningkatkan daya saing ekspor Indonesia.

  20. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.

    Science.gov (United States)

    Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I

    2016-09-01

    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.

  3. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  4. Primer registro de Tiaris fuliginosa (Wied, 1830) para la Argentina

    OpenAIRE

    Mazar Barnett, Juan; Herrera, Justo

    1996-01-01

    El primer registro de Argentina de Tiaris fuliginosa , basado en dos pájaros encontrados en el Parque Nacional Iguazú. The first record for Argentina of the Sooty Grassquit ( Tiaris fuliginosa ) is given, based on two birds notted at Iguazú National Park.

  5. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used par

  6. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  7. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    2014-01-01

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future effo

  8. Primer Sets Developed for Functional Genes Reveal Shifts in Functionality of Fungal Community in Soils

    NARCIS (Netherlands)

    Hannula, S.E.; van Veen, J.A.

    2016-01-01

    Phylogenetic diversity of soil microbes is a hot topic at the moment. However, the molecular tools for the assessment of functional diversity in the fungal community are less developed than tools based on genes encoding the ribosomal operon. Here 20 sets of primers targeting genes involved mainly in

  9. Shortening distance of forward and reverse primers for nucleic acid isothermal amplification.

    Science.gov (United States)

    Haitao, Qu; Wenchao, Zhang; Xiaohui, Zhang; Xiujun, Wang; Sulong, Li

    2014-06-01

    Existent nucleic acid isothermal detection techniques for clinical diseases are difficult to promote greatly due to limitations in such aspects as methodology, costs of detection, amplification efficiency and conditions for operation. There is therefore an urgent need for a new isothermal amplification method with the characteristics of high accuracy, easy operation, short time of detection and low costs. We have devised a new method of nucleic acid isothermal amplification using Bst DNA polymerase under isothermal conditions (60-65°C). We call this method of amplification by shortening the distance between forward and reverse primers for nucleic acid isothermal amplification SDAMP. The results demonstrated that this technique is highly sensitive, specific and has short reaction times (40-60 min). Results of sequencing show that the products of SDAMP amplification are mainly polymers formed by series connection of monomers formed through linkage of forward primer and complementary sequences in reverse primer via a few bases. The method is different from current methods of nucleic acid amplification. Our study shows, however, that it is a specific method of nucleic acid isothermal amplification depending on interactions between primers and DNA template.

  10. Ecophysiological, ecological, and soil processes in terrestrial ecosystems: a primer on general concepts and relationships

    NARCIS (Netherlands)

    Kirschbaum, M.U.F.; Bullock, P.; Evans, J.R.; Goulding, K.; Jarvis, P.G.; Noble, I.R.; Rounsevell, M.; Sharkey, T.D.; Austin, M.P.; Brookes, P.; Brown, S.; Bugmann, H.K.M.; Cramer, W.P.; Diaz, S.; Gitay, H.; Hamburg, S.P.; Harris, J.

    1996-01-01

    This ecophysiological primer serves as an introductory chapter on the concepts applied in subsequent chapters reviewing the state of knowledge concerning the effects of climate change on ecological processes that affect impacts on terrestrial ecosystems and some socio-economic systems. Because many

  11. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  12. Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii.

    Science.gov (United States)

    Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon; Lee, Jae-Dong

    2005-06-01

    Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species.

  13. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

    Science.gov (United States)

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.

    2015-01-01

    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  14. Experimental Studies of the Number 41 Primer and Ignition 5.56-mm Ammunition

    Science.gov (United States)

    2006-09-01

    caliber primers are lead styphnate , barium nitrate, and antimony sulfide, Sb2S3. Lesser amounts of aluminum powder, tetracene, and...this particle, which apparently did not melt, consists primarily of Barium . ...........................................................14 Figure 17...15 Figure 21. Reference spectrum of barium nitrate (top) compared to a spectrum representative (**splat) of many residual particles from

  15. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism

    Science.gov (United States)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  16. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  17. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

    Science.gov (United States)

    Carter-Harris, Lisa

    2016-11-01

    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment.

  18. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  19. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    ARL-TR-7479 ● SEP 2015 US Army Research Laboratory Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition...Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...

  20. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  1. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  2. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  3. CARACTERIZACIÓN MOLECULAR DE AISLAMIENTOS DE ENTEROBACTER CLOACAE MULTIRRESISTENTES, PRODUCTORES â-LACTAMASAS PROVENIENTES DE PACIENTES DE UN HOSPITAL DE TERCER NIVEL DE BOGOTÁ Molecular characterizacion of multi-cephalosporin resistan Enterobacter cloacae isolates from a third level hospital in Bogota-Colombia

    Directory of Open Access Journals (Sweden)

    Ibonne Aydee García Romero

    2005-07-01

    Full Text Available Antecedentes. Las enterobacterias, antaño flora normal del tracto gastrointestinal, han cambiado su biología y emergido como agentes patógenos nosocomiales que se tornan resistentes los antibióticos conocidos. Objetivo. Realizar la caracterización epidemiológico-molecular de 20 aislamientos de Enterobacter cloacae resistentes a cefalosporinas de tercera generación; provenientes de un hospital de tercer nivel de Bogotá-Colombia. Material y métodos. Los aislamientos fueron identificados mediante sistemas automatizados Microscan y VITEK, se utilizó el Enterobacter asbureae como control externo inter-especie. La confirmación de resistencia se hizo por técnica de difusión en agar, y una vez establecida se realizó BLEE para comprobación. La determinación de puntos isoeléctricos se hizo, mediante lisis por ultrasonido y la genotipificación mediante la metodología para bacterias Gramnegativas propuesta por Versalovic. Resultados: Los aislamientos colectados durante un año fueron causantes de 15 casos de infección Intrahospitalaria y dos colonizaciones. Todos los aislamientos presentaron resistencia a cefotaxima, ceftazidima, ceftriaxona, aztreonam y ciprofloxacina, 95% a amikacina, gentamicina y cloranfenicol, 75% a trimetoprim/sulfametoxazol, 20% a cefepime y todos fueron sensibles a imipenem. Dos aislamientos fueron confirmados como productores de â-lactamasas de espectro extendido (BLEE por la técnica microbiológica de disco combinado. Por isoelectroenfoque presentaron dos â-lactamasas con puntos isoeléctricos (pI de 5,4 y 8,2. En los 18 aislamientos no inhibidos por ácido clavulánico, se detectaron entre 2 y 4 â-lactamasas con pI de 5,4; 6,0; 7,0; 8,2 y mayor que 8,2; la resistencia a cefalosporinas de tercera generación podría ser atribuida a la hiperproducción de AmpC; los valores de pI sugieren la producción simultánea de â-lactamasas tipo SHV y TEM. La genotipificación mediante tres metodologías de rep

  4. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  5. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  6. Design of phylum-specific hybrid primers for DNA barcoding: addressing the need for efficient COI amplification in the Echinodermata.

    Science.gov (United States)

    Hoareau, T B; Boissin, E

    2010-11-01

    Recent research has shown the usefulness of the Folmer region of the cytochrome oxidase I (COI) as a genetic barcode to assist in species delimitation of echinoderms. However, amplification of COI is often challenging in echinoderms (low success or pseudogenes). We present a method that allows the design of phylum-specific hybrid primers, and use this to develop COI primers for the Echinodermata. We aligned COI sequences from 310 echinoderm species and designed all possible primers along the consensus sequence with two methods (standard degenerate and hybrid). We found much lower degeneracy for hybrid primers (4-fold degeneracy) than for standard degenerate primers (≥48-fold degeneracy). We then designed the most conserved hybrid primers to amplify a >500-bp region within COI. These primers successfully amplified this gene region in all tested taxa (123 species across all echinoderm classes). Sequencing of 30 species among these confirmed both the quality of the sequences (>500 bp, no pseudogenes) and their utility as a DNA barcode. This method should be useful for developing primers for other mitochondrial genes and other phyla. The method will also be of interest for the development of future projects involving both community-based genetic assessments on macroorganisms and biodiversity assessment of environmental samples using high-throughput sequencing.

  7. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  8. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.

    Science.gov (United States)

    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A

    2016-01-01

    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  9. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  10. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced.

  11. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Institute of Scientific and Technical Information of China (English)

    Jun-Wen Li; Xin-Wei Wang; Chang-Qing Yuan; Jin-Lai Zheng; Min Jin; Nong Song; Xiu-Quan Shi; Fu-Huan Chao

    2002-01-01

    AIM: To develop a rapid detection method ofenteroviruses and Hepatitis A virus (HAV).METHODS: A one-step, single-tube consensus primersmultiplex RT-PCR was developed to simultaneouslydetect Poliovirus, Coxsackie virus, Echovirus and HAV.A general upstream primer and a HAV primer and fourdifferent sets of primers (5 primers) specific forPoliovirus, Coxsacki evirus, Echovirus and HAV cDNAwere mixed in the PCR mixture to reverse transcriptand amplify the target DNA.Four distinct amplified DNAsegments representing Poliovirus, Coxsackie virus,Echovirus and HAV were identified by gelelectrophoresis as 589-,671-, 1084-, and 1128bpsequences, respectively. Semi-nested PCR was used toconfirm the amplified products for each enterovirus andHAV.RESULTS: All four kinds of viral genome RNA weredetected, and producing four bands which could bedifferentiated by the band size on the gel.To confirmthe specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strainstested gave positive results .The detection sensitivityof multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU forCoxsackie virus,60 PFU for Echovirus and 105 TCID50for HAV. The minimum amount of enteric viral RNAdetected by semi-nested PCR was equivalent to 2.4 PFUfor Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU forEchovirus and 10.5 TCID50 for HAV.CONCLUSION: The consensus primers multiplex RT-PCRhas more advantages over monoplex RT-PCR for entericviruses detection, namely, the rapid turnaround timeand cost effectiveness.

  12. Primer caso de onicomicosis causada por Cylindrocarpon lichenicola, en un paciente inmunosuprimido en Costa Rica

    Directory of Open Access Journals (Sweden)

    Mauricio Lizano-Calvo

    2013-12-01

    Full Text Available Antecedentes: la onicomicosis es una infección fúngica de las uñas, que puede ser causada por dermatofitos, levaduras y hongos filamentosos no dermatofitos. El objetivo del presente trabajo fue identificar -morfológica y molecularmente- un aislamiento realizado a partir de la uña del dedo medio de la mano derecha de un paciente inmunosuprimido con trasplante renal. Métodos: a la muestra se le realizó un examen microscópico directo en KOH 40%, y las características de la colonia fueron evaluadas en medio de cultivo Agar Sabouraud Glucosado y Agar Mycosel. El hongo aislado se identificó molecularmente mediante la amplificación, por reacción en cadena de la polimerasa (PCR y secuenciación de la región espaciadora transcrita (ITS de los genes ribosomales y de una porción del gen del factor de elongación 1alfa (EF-1α. La secuencia de nucleótidos de cada región fue comparada con las secuencias publicadas en la base de datos del Banco de Genes del Centro Nacional para la Información Biotecnológica (NCBI. Resultados: las características macro y microscópicas de la colonia concordaron con las descritas para Cylindrocarpon lichenicola (sinónimo Fusarium lichenicola. La secuencia de nucleótidos, tanto de la región ITS (544 pb como de la porción del gen EF-1α (710 pb, presentó un 100% de similitud con secuencias de F. lichenicola. Conclusión: se identificó por primera vez en Costa Rica C. lichenicola asociado con onicomicosis en un paciente inmunosuprimido. Este tipo de pacientes deben ser instruidos sobre las posibles fuentes de agentes infecciosos.

  13. EFECTO SOBRE LA SARNA POLVOSA DE CUATRO AISLAMIENTOS DEL HONGO Trichoderma asperellum EN TRES TIPOS DE SUELO EFFECT ON THE POWDERY SCAB OF FOUR ISOLATES OF THE FUNGUS Trichoderma asperellum IN THREE TYPES OF SOILS

    Directory of Open Access Journals (Sweden)

    Elizabeth Gilchrist

    2009-06-01

    Full Text Available El protozoario Spongospora subterranea f. sp. subterranea es un parásito obligado que replica en raíces y tubérculos de papa causando la sarna polvosa. Esta enfermedad se ha difundido a escala global debido al comercio de tubérculos-semilla infectados y a la ausencia de tratamientos efectivos. En este trabajo se investigó la influencia sobre la sarna polvosa de cuatro aislamientos de Trichoderma asperellum en tres tipos de suelo: Andisol, Entisol e Inceptisol. Tubérculos de Solanum tuberosum variedad Diacol Capiro fueron plantados en parcelas infectadas con 1942 ± 226 quistosoros por gramo de suelo. No se observaron diferencias entre las plantas tratadas y no tratadas con T. asperellum. La superficie de raíz ocupada por agallas fue en promedio 2,2%, sin encontrarse diferencias significativas (PThe protozoan Spongospora subterranea f. sp. subterranea is an obligate parasite that replicates in roots and tubers of potato causing the powdery scab. This disease has disseminated on a global scale, because the commercial traffic of infected tubers used as seed and the absence of effective treatments. The present work investigated the effects of four isolates of Trichoderma asperellum in three soil types: Andisol, Entisol and Inceptisol. The soils were infected with 1942 ± 226 cystosori per gram of soil. It was used Solanum tuberosum variety Diacol Capiro. No differences were observed between treated and non treated plants with T. asperellum. The root surface affected by galls was an average of 2.2 %, and no significant differences (p<0.05 were observed among the soils. The reduction of plant growth was of 41, 32 and 28 % for the Andisol, Entisol and Inceptisol, respectively. The reduction in tubers production was of 40, 28 and 0,1% for the Andisol, Entisol and Inceptisol, respectively. Similar percent of root surface covered with galls resulted in production reduction of 40%, but also of 0,1%, indicating the necessity of other methods to

  14. Streptococcus pneumoniae isolates in healthy children attending day-care centers in 12 states in Mexico Aislamientos de S. pneumoniae en niños sanos de estancias infantiles en 12 estados de México

    Directory of Open Access Journals (Sweden)

    Luz Elena Espinosa-de los Monteros

    2007-08-01

    Full Text Available OBJECTIVE: The aim of this study was to determine the prevalence of asymptomatic nasopharyngeal carriage of Streptococcus pneumoniae, which is a major factor in the transmission of this bacterium. MATERIAL AND METHODS: Nasopharyngeal cultures were performed on children attending 32 day-care centers in 12 states in Mexico. RESULTS: Streptococcus pneumoniae was isolated from the nasopharynx of 829 out of 2 777(29.9% subjects aged two months to six years. All children lived in urban areas and 80% spent more than six hours daily in a day-care center. Streptococcus pneumoniae serotypes most frequently identified were: 19F (23%, 6B (15.6%, 23F (11.2% and 6A (14.9%. Thirty-six percent of the isolates were susceptible to penicillin. CONCLUSIONS: Serotype distribution suggests the possible benefits that could be obtained from the heptavalent pneumococcal conjugate vaccine.OBJETIVO: La intención de este estudio fue determinar la prevalencia de portadores nasofaríngeos asintomáticos de Streptococcus pneumoniae, el cual es el principal factor en la transmisión de esta bacteria. MATERIAL Y MÉTODOS: Los cultivos nasofaríngeos fueron realizados en niños que asisten a 32 estancias infantiles en 12 estados de México. RESULTADOS: Streptococcus pneumoniae fue aislado de la nasofaringe de 829 (29.9% niños de los 2 777 incluidos en el estudio con un rango de edad de 2 meses a 6 años. Todos los niños vivían en áreas urbanas y 80% permanecían más de seis horas diarias en la estancia infantil. Los serotipos de Streptococcus pneumoniae más frecuentemente identificados fueron: 19F (23%, 6B (15.6%, 23F (11.2% y 6 A (14.9%. Treinta y seis por ciento de los aislamientos fueron susceptibles a penicilina. CONCLUSIONES: La distribución de serotipos nos da una idea de los posibles beneficios que podrían obtenerse de la vacuna neumocóccica conjugada heptavalente.

  15. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    Science.gov (United States)

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  16. Evaluation of single liquid primers with organic sulfur compound for bonding between indirect composite material and silver-palladium-copper-gold alloy.

    Science.gov (United States)

    Shimoe, Saiji; Tanoue, Naomi; Satoda, Takahiro; Murayama, Takeshi; Nikawa, Hiroki; Matsumura, Hideo

    2010-01-01

    The purpose of this study was to evaluate the effect of primers on bonding between a silver-palladium-copper-gold alloy and an indirect composite material. Cast disks were air-abraded with alumina, conditioned with one of five primers (Alloy Primer, Luna-Wing Primer, Metal Primer II, Metaltite, M.L. Primer), and bonded with a light-activated indirect composite. Shear bond strengths were determined after 20,000 times of thermocycling. The results showed that four of the primers, except the Luna-Wing Primer, were effective in enhancing the bond strength as compared with the unprimed control group. Of these four primers, Alloy Primer, Metal Primer II, and M.L. Primer exhibited significantly greater bond strengths. It can be concluded that the effectiveness of primers varies considerably according to the organic sulfur compounds added to the solvent, and that care must be taken in selecting priming agents for bonding the composite material and the silver-palladium-copper-gold alloy.

  17. Aislamiento del virus de PRRS en México: Estudio clínico, serológico y virológico Isolation of PRRS virus in Mexico: A clinical, serological and virological study

    Directory of Open Access Journals (Sweden)

    N. Sierra

    2000-01-01

    Full Text Available La enfermedad de PRRS en México es reconocida por los clínicos de cerdos como un problema importante en la patología porcina nacional desde hace varios años. Los brotes surgidos por infecciones con PRRS en poblaciones susceptibles trae consigo efectos económicamente devastadores. Los objetivos del estudio fueron identificar los signos clínicos de cada granja y contrastarlos con los de otras para identificar un patrón de presentación clínica, realizar la integración sindrómica que nos permitiera conocer los síndromes predominantes en cada granja, además de conocer el nivel de anticuerpos de las granjas muestreadas y clasificarlas de acuerdo al rango S/P (muestra de suero/control positivo y, finalmente, intentar el aislamiento del virus. Se seleccionaron 8 granjas porcinas comerciales y se llevó a cabo un estudio clínico, serológico y virológico en todas las edades y etapas fisiológico-productivas. Se tomaron 100 muestras sanguíneas en promedio por granja para los estudios virológico y serológico. En los resultados, todas las granjas fueron seropositivas además de aislarse el virus, sin embargo, sólo una granja presentó falla reproductiva. El virus estuvo presente en todas las granjas, pero se manifestó de diferentes formas, por lo cual no pudimos establecer un patrón de presentación clínica ya que fue distinto para las 8 granjas. Respecto de la edad y etapa fisiológica productiva en la que se aisló el virus, llama la atención el haberse encontrado con mayor frecuencia en cerdas de sexto parto en 7 de las 8 granjas estudiadas; así como en lechones lactantes de un mes de edad en 6 de las 8 granjas. Lo anterior sugiere que las cerdas de sexto parto así como los lechones lactantes y de un mes de edad son los más adecuados para intentar el aislamiento viralThe PRRS disease is recognized in Mexico by the swine practitioners as an important problem within the national swine pathology since several years ago. The

  18. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    Directory of Open Access Journals (Sweden)

    Mario Antolinez

    2013-11-01

    Full Text Available El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al mismo tiempo, se distanciaba de manera sustancial del proceso tradicional imperante durante años. Esta iniciativa se vio entorpecida, sin embargo, no solo por los problemas en Gaimusho –la entidad encargada de llevar a la práctica la diplomacia nipona–, sino también por el escenario geopolítico externo y por factores de política interna propios del momento histórico en consideración.

  19. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  20. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    Science.gov (United States)

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  1. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  2. Mineralogical Transformation and Electrochemical Nature of Magnesium-Rich Primers during Natural Weathering

    Directory of Open Access Journals (Sweden)

    Shashi S. Pathak

    2014-07-01

    Full Text Available Magnesium-rich primers (MgRP have generated great interest as a promising alternative to chromium-based primers for the protection of aluminum substrates but their performance during exterior exposure has not been well documented. This paper focuses on the evaluation of MgRP during natural weathering to gain insight into its mineralogical phase transformation and electrochemical nature. Control studies were conducted on Mg and AA2024-T3 coupons. The results indicate that Mg particles in MgRP transform into a variety of hydroxide, carbonate, and hydroxy carbonates. During natural weathering, CO2 inhibited the dissolution of both Mg and AA2024-T3 as a result of protective carbonate layer formation in the coating.

  3. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  4. The Astrobiology Primer: An Outline of General Knowledge - Version 1, 2006

    CERN Document Server

    Mix, L J; Mandell, A M; Mosier, A C; Raymond, J; Raymond, S N; Stewart, F J; Von Braun, K; Zhaxybayeva, O; Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-01-01

    Astrobiology, the study of life as a planetary phenomenon, aims to understand the fundamental nature of life on earth and the possibility of life elsewhere. To achieve this goal, astrobiologists have initiated unprecedented communication between the disciplines of astronomy, biology, chemistry, and geology. The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Because of the great diversity of material, each section was written by a different author with a different expertise. The Primer was constructed collaboratively. Ninety researchers from around the world contributed information with regard to what they expected from other astrobiologists and what they would like to know themselv...

  5. STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

    Science.gov (United States)

    O'Halloran, Damien M

    2015-06-01

    Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

  6. Effect of dentin primer on shear bond strength of composite resin to moist and dry enamel.

    Science.gov (United States)

    Jain, P; Stewart, G P

    2000-01-01

    The etched enamel-composite resin bond is the most reliable bond known to us. Moisture and dentin primers are the two most important variables that can interfere with this bond. This study investigated the effect of dentin primer on bond strengths of composite resin to moist and dry enamel. One hundred freshly extracted molar teeth were used for shear bond strength testing. The teeth were mounted in phenolic rings with an approximal enamel surface exposed. The exposed enamel surface on each tooth was flattened using 320- 400- and 600-grit silicon carbide papers and etched using 34-38% phosphoric acid gel. The teeth were then divided into 10 groups (n = 10). Four groups were assigned to each of the two dentin bonding systems, Scotchbond Multi-Purpose and OptiBond FL. Two groups were assigned to the single-bottle bonding agent (Single Bond). Each bonding system was tested on moist and dry enamel. OptiBond FL and Scotchbond MP were tested with and without the use of primer. All samples were thermocycled and tested in shear. Fracture analysis was performed using a binocular microscope. For scanning electron microscopy, approximal samples of enamel (1 mm thick) were flattened, etched, and bonded with and without primer on moist and dry enamel. A 1 mm-thick layer of Z100 was bonded to the specimens, which were then immersed in 10% HCl for 24 hours to dissolve the enamel. The specimens were viewed under a scanning electron microscope. Results indicated that the use of primer on dry enamel did not significantly affect (P > 0.05) shear bond strengths for the two bonding systems, Scotchbond MP (primed 24.10 +/- 4.83 MPa, unprimed 29.57 +/- 7.49 MPa) and OptiBond FL (primed 26.82 +/- 4.44, unprimed 25.66 +/- 2.95). However, the use of primer was found to be essential on moist enamel to obtain acceptable bond strengths with both Scotchbond MP (primed 25.61 +/- 10.29 MPa, unprimed 3.26 +/- 0.95 MPa) and OptiBond FL (primed 30.28 +/- 3.49 MPa, unprimed 8.37 +/- 3.31 MPa

  7. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  8. Summary of the primer on tumor immunology and the biological therapy of cancer

    OpenAIRE

    Margolin Kim; Liu Shujuan; Li Yufeng; Hwu Patrick

    2009-01-01

    Abstract The International Society for Biological Therapy of Cancer (iSBTc) is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this pro...

  9. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

    2013-01-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  10. An in silico approach to design T-arms primers for VDR locus to detect osteoporosis

    OpenAIRE

    Maheswari, C.; Sheebanancy, K.; Kavitha, V. J.

    2017-01-01

    Osteoporosis is a skeletal disorder characterized by an increased risk of fractures. Studies have shown that BMD and bone turnover are under strong genetic control. The polymorphisms in the Vitamin D receptor (VDR) have been implicated in many studies as a cause of osteoporosis. We aimed at developing a molecular diagnostic kit to detect osteoporosis. We started with designing multiplex primers and finally designed T-ARMS PCR Kit for the VDR locus. We used the currently available softwares fo...

  11. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus).

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B; Wu, Hong; Johnson, Nicholas S; Li, Weiming

    2013-08-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1h exposure. After 2h exposure, 3kACA increased lGnRH-I and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  12. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  13. Combination Primer Polymerase Chain Reaction for Multi-Site Mutagenesis of Close Proximity Sites

    OpenAIRE

    Jensen, Pia Hønnerup; Weilguny, Dietmar

    2005-01-01

    We describe a rapid and efficient polymerase chain reaction procedure for multi-site-directed mutagenesis for cases in which the sites to be mutated are in close proximity. The combination primer polymer chain reaction method is based on a multi-site directed mutagenesis protocol together with a splicing by overlapping extension polymerase chain reaction protocol. several different combinations of multiple mutations were successfully performed with this method and are reported in this study.

  14. Perfil del alumnado normalista castellano-leonés del primer tercio del siglo XX

    Directory of Open Access Journals (Sweden)

    Juan Francisco CEREZO MANRIQUE

    2009-11-01

    Full Text Available Nos proponemos en este trabajo dibujar el perfil del alumnado que acudió a los establecimientos normalistas castellano-leoneses durante el primer tercio del siglo XX. El análisis cuantitativo de una serie de variables de tipo clasificatorio nos ayudará a explicitar las características de entrada de un colectivo sobre el que la acción institucional de las Escuelas Normales habría de incidir.

  15. Avulsión de canino y subluxación del primer premolar superiores derechos

    OpenAIRE

    1996-01-01

    Se presenta un caso clínico de avulsión de canino y subluxación del primer remolar, superiores derechos, secundario a traumatismo por piedra lanzada al aire. El tiempo extraoral fue de cuatro horas en medio seco. Se trató con reimplante, ferulización y tratamiento endodóncico. Los controles posteriores a los cuatro años del tratamiento mostraron la evolución favorable del caso.

  16. Demonstration of Metastable Intermolecular Composites (MIC) on Small Caliber Cartridges and CAD/PAD Percussion Primers

    Science.gov (United States)

    2009-07-01

    Tetracene 4.0 Barium Nitrate 32.0 Antimony Sulfide 15.0 Aluminum Powder 7.0 PETN 5.0 Ingredient Weight % Normal Lead Styphnate 26.0 Barium Nitrate...Current Process Application Current Specification Affected Programs Candidate Parts/Substrate Lead Styphnate , Barium Nitrate, & Antimony...FA-956 and 5086 primer formulations which are based on lead styphnate , barium nitrate and antimony sulfide. The MIC mixture is an environmentally

  17. Comprehensive Evaluation and Transition of Non-Chromate Primers within DoD

    Science.gov (United States)

    2012-01-01

    Materials Engineering Division ASETS Defense 2012 NAVAIR Distribution Statement – Distribution A Report Documentation Page Form...Primers : Akzo Nobel MgO 2111 PPG CA 7236 PPG CA 7211 PPG CA 7222 PPG CA 7233 Topcoat Deft ELT Corrosion tests: ASTM B117 (x2) ASTM...control. • Compare & correlate NAVAIR and AFRL galvanic panel test methods 10 NAVAIR/USAF Statement of Need 0 . 5 1.5 3 0 .5 1

  18. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  19. Single primer amplification reaction methods reveal exotic and indigenous mulberry varieties are similarly diverse

    Indian Academy of Sciences (India)

    Esha Bhattacharya; S B Dandin; Shirish Anand Ranade

    2005-12-01

    Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the most two methods. However, no comprehensive study on a large number of varieties has been carried out. In present study, single primer amplification reaction (SPAR) methods have been used for determination of diversity in 27 mulberry varieties (exotic as well as indigenous), using four minisatellite core sequence primers for directed amplification of minisatellite DNA (DAMD), three simple sequence repeat (SSR) motifs as primers for inter simple sequence repeat (ISSR) and 20 arbitrary sequence decamer primers for random amplified polymorphic DNA (RAPD) reactions. The Jaccard coefficients were determined for the DAMD, ISSR and RAPD band data (total of 58, 39 and 235 bands respectively). All three methods revealed wide range of distances supporting a wide range of mulberry genetic diversity. A cumulative analysis of the data generated by three methods resulted in a neighbour-joining (NJ) tree that gave a better reflection of the relatedness and affinities of the varieties to each other. Comparison of the three methods by marker indices and the Mantel test of correlation indicated that though all methods were useful for the assessment of diversity in mulberry, the DAMD method was better. When considered as two groups (10 exotic and 17 indigenous varieties), the mulberry varieties in the exotic group were found to have slightly greater diversity than the indigenous ones. These results support the concept of naturalization of mulberry varieties at locales distant from their origins.

  20. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

    Science.gov (United States)

    Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

    2016-01-01

    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.