Directory of Open Access Journals (Sweden)
A.C.C.F.F. De Paula
2005-06-01
Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar
2017-03-01
Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.
β-glucan extract from oat bran and its industrial importance
Ibrahim, M. N. G.; Selezneva, I. S.
2017-09-01
The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.
Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.
2011-01-01
Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme
Arabinose and ferulic acid rich pectic polysaccharides extracted from sugar beet pulp.
Oosterveld, A.; Beldman, G.; Schols, H.A.; Voragen, A.G.J.
1996-01-01
Arabinose and ferulic acid rich polysaccharides were extracted from sugar beet pulp using two extraction methods: a sequential extraction with H2O (2 times), NaOH/EDTA (2 times), and 4 M NaOH (2 times; method A) and a sequential extraction in which the NaOH/EDTA extraction was replaced by an
Directory of Open Access Journals (Sweden)
Claudia Zielke
Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.
Zhao, Yong-Ming; Yang, Jian-Ming; Liu, Ying-Hui; Zhao, Ming; Wang, Jin
2018-02-01
The aim of this study was to optimize the extraction process of polysaccharides from the fruiting bodies of Lentinus edodes and investigate its anti-hepatitis B virus activity. The extracting parameters including ultrasonic power (240-320W), extraction temperature (40-60°C) and extraction time (15-25min) was optimized by using three-variable-three-level Box-Behnken design based on the single-factor experiments. Data analysis results showed that the optimal conditions for extracting LEPs were an extraction temperature of 45°C, extraction time of 21min and ultrasonic power of 290W. Under these optimal conditions, the experimental yield of LEPs was 9.75%, a 1.62-fold increase compared with conventional heat water extraction (HWE). In addition, crude polysaccharides were purified to obtain two fractions (LEP-1 and LEP-2). Chemical analysis showed that these components were rich in glucose, arabinose and mannose. Furthermore, HepG2.2.15 cells were used as in vitro models to evaluate their anti-hepatitis B virus (HBV) activity. The results suggest that LEPs possesses potent anti-HBV activity in vitro. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Hansen, Mads A.T.; Ahl, Louise I.; Pedersen, Henriette L.
2014-01-01
to about 20, but mostly around 3-8, and notably more acetylated in stems. Arabinoxylan (AX) and mixed-linkage glucan (MLG) became water-extractable while xylan, xyloglucan (XG), mannan and glucan remained only alkali-extractable. All polysaccharides became partly digestible after pretreatment however......, regardless their extractability in water or only alkali. Based on the results, AX and MLG appear to be loosely bound in the cell wall matrix while the other polysaccharides are bound more tightly and shielded from enzymatic attack by AX and MLG until pretreatment. The gradual solubilisation and digestion...
Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song
2017-01-01
Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.
Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou
2004-03-26
The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.
Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina
2017-01-01
Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.
Peasura, Napassorn; Laohakunjit, Natta; Kerdchoechuen, Orapin; Wanlapa, Sorada
2015-11-01
Ulva intestinalis, a tubular green seaweed, is a rich source of nutrient, especially sulphated polysaccharides. Sulphated polysaccharides from U. intestinalis were extracted with distilled water, 0.1N HCl, and 0.1N NaOH at 80°C for 1, 3, 6, 12, and 24h to study the effect of the extraction solvent and time on their chemical composition and antioxidant activity. Different types of solvents and extraction time had a significant influence on the chemical characteristics and antioxidant activity (pMonosaccharide composition and FT-IR spectra analyses revealed that sulphated polysaccharides from all solvent extractions have a typical sugar backbone (glucose, rhamnose, and sulphate attached at C-2 or C-3 of rhamnose). Sulphated polysaccharides extracted with acid exhibited greater antioxidant activity than did those extracted with distilled water and alkali. The results indicated that solvent extraction could be an efficacious method for enhancing antioxidant activity by distinct molecular weight and chemical characteristic of sulphated polysaccharides. Copyright © 2015 Elsevier B.V. All rights reserved.
Sulfated Polysaccharides in Marine Sponges: Extraction Methods and Anti-HIV Activity
Directory of Open Access Journals (Sweden)
Ana I. S. Esteves
2011-01-01
Full Text Available The extraction, fractionation and HIV-1 inhibition potential of polysaccharides extracted from three species of marine sponges, Erylus discophorus, Cliona celata and Stelletta sp., collected in the Northeastern Atlantic, is presented in this work. The anti-HIV activity of 23 polysaccharide pellets and three crude extracts was tested. Crude extracts prepared from Erylus discophorus specimens were all highly active against HIV-1 (90 to 95% inhibition. Cliona celata pellets showed low polysaccharide content (bellow 38.5% and almost no anti-HIV activity (<10% inhibition. Stelletta sp. pellets, although quite rich in polysaccharide (up to 97.3%, showed only modest bioactivity (<36% HIV-1 inhibition. Erylus discophorus pellets were among the richest in terms of polysaccharide content (up to 98% and the most active against HIV-1 (up to 95% inhibition. Chromatographic fractionation of the polysaccharide pellet obtained from a specimen of Erylus discophorus (B161 yielded only modestly active fractions. However, we could infer that the active molecule is most probably a high molecular weight sulfated polysaccharide (>2000 kDa, whose mechanism is possibly preventing viral attachment and entry (fusion inhibitor.
DEFF Research Database (Denmark)
Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.
2017-01-01
-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....
Dourado, Fernando; Madureira, Pedro; Carvalho, Vera; Coelho, Ricardo; Coimbra, Manuel A; Vilanova, Manuel; Mota, Manuel; Gama, Francisco M
2004-10-20
The structure and bioactivity of a polysaccharide extracted and purified from a 4M KOH + H3BO3 solution from Prunus dulcis seed cell wall material was studied. Anion-exchange chromatography of the crude extract yielded two sugar-rich fractions: one neutral (A), the other acidic (E). These fractions contain a very similar monosaccharide composition: 5:2:1 for arabinose, uronic acids and xylose, respectively, rhamnose and galactose being present in smaller amounts. As estimated by size-exclusion chromatography, the acidic fraction had an apparent molecular mass of 762 kDa. Methylation analysis (from the crude and fractions A and E), suggests that the polysaccharide is an arabinan-rich pectin. In all cases, the polysaccharides bear the same type of structural Ara moieties with highly branched arabinan-rich pectic polysaccharides. The average relative proportions of the arabinosyl linkages is 3:2:1:1 for T-Araf:(1-->5)-Araf:(1-->3,5)-Araf:(1-->2,3,5)-Araf. The crude polysaccharide extract and fractions A and E induced a murine lymphocyte stimulatory effect, as evaluated by the in vitro and in vivo expression of lymphocyte activation markers and spleen mononuclear cells culture proliferation. The lymphocyte stimulatory effect was stronger on B- than on T-cells. No evidence of cytotoxic effects induced by the polysaccharide fractions was found.
Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.
Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij
2015-07-20
Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.
Kozarski, M.; Klaus, A.; Niksic, M.; Jakovljevic, D.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.
2011-01-01
Partially purified polysaccharides were obtained from four medicinal mushroom species, Agaricus bisporus, Agaricus brasiliensis, Phellinus linteus and Ganoderma lucidum by hot water extraction, followed by ethanol precipitation. The four samples contained varying amounts of both a- and ß-glucans as
Immunomodulatory dietary polysaccharides: a systematic review of the literature
Directory of Open Access Journals (Sweden)
Nelson Erika D
2010-11-01
Full Text Available Abstract Background A large body of literature suggests that certain polysaccharides affect immune system function. Much of this literature, however, consists of in vitro studies or studies in which polysaccharides were injected. Their immunologic effects following oral administration is less clear. The purpose of this systematic review was to consolidate and evaluate the available data regarding the specific immunologic effects of dietary polysaccharides. Methods Studies were identified by conducting PubMed and Google Scholar electronic searches and through reviews of polysaccharide article bibliographies. Only articles published in English were included in this review. Two researchers reviewed data on study design, control, sample size, results, and nature of outcome measures. Subsequent searches were conducted to gather information about polysaccharide safety, structure and composition, and disposition. Results We found 62 publications reporting statistically significant effects of orally ingested glucans, pectins, heteroglycans, glucomannans, fucoidans, galactomannans, arabinogalactans and mixed polysaccharide products in rodents. Fifteen controlled human studies reported that oral glucans, arabinogalactans, heteroglycans, and fucoidans exerted significant effects. Although some studies investigated anti-inflammatory effects, most studies investigated the ability of oral polysaccharides to stimulate the immune system. These studies, as well as safety and toxicity studies, suggest that these polysaccharide products appear to be largely well-tolerated. Conclusions Taken as a whole, the oral polysaccharide literature is highly heterogenous and is not sufficient to support broad product structure/function generalizations. Numerous dietary polysaccharides, particularly glucans, appear to elicit diverse immunomodulatory effects in numerous animal tissues, including the blood, GI tract and spleen. Glucan extracts from the Trametes versicolor
Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do
2017-02-01
Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.
Extraction, characterisation and antioxidant activity of Allium sativum polysaccharide.
Cheng, Hao; Huang, Gangliang
2018-07-15
Extraction and antioxidant activity of polysaccharide from Allium sativum were investigated. The crude polysaccharide was obtained by the hot-water extraction method. The molecular weight of polysaccharide deproteinized with CaCl 2 was 7.35×10 3 . It indicated that polysaccharide from Allium sativum consisted of three monosaccharides, namely fructose, glucose, and galactose by HPLC. The polysaccharide had the β-glycosidic bond. Moreover, it was proved that the polysaccharide had the potential scavenging ability to superoxide anions and hydroxyl radicals. So, it should be a potential antioxidant. Copyright © 2018 Elsevier B.V. All rights reserved.
Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S
2013-03-01
β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.
Miao, X P; Sun, X N; Wei, H; Liu, Z J; Cui, L J; Deng, T Z
2015-02-01
The therapeutic potential of pectic polysaccharides extracted from Rauvolfia verticillata (Lour.) Baill. var. hainanensis Tsiang in ulcerative colitis were investigated. This study showed that pectic polysaccharides extracted from Rauvolfia verticillata (Lour.) Baill. var. hainanensis Tsiang ameliorated ulcerative colitis and were proposed to exhibit anti-inflammatory effects via increased expression of IκB-α proteins and suppressing NF-αB translocation.
Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G
2014-01-01
Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....
Directory of Open Access Journals (Sweden)
Hui-Fen Liao
2015-11-01
Full Text Available A dry sample of Nostoc commune from an organic farm in Pingtung city (Taiwan was used to prepare polysaccharide-rich (NCPS extract. The conditioned medium (CM from NCPS-treated human peripheral blood (PB-mononuclear cells (MNC effectively inhibited the growth of human leukemic U937 cells and triggered differentiation of U937 monoblast cells into monocytic/macrophagic lines. Cytokine levels in MNC-CMs showed upregulation of granulocyte/macrophage-colony stimulatory factor and IL-1β and downregulation of IL-6 and IL-17 upon treatment with NCPS. Moreover, murine macrophage RAW264.7 cells treated with NCPS exhibited the stimulatory effects of nitric oxide and superoxide secretion, indicating that NCPS might activate the immunity of macrophages. Collectively, the present study demonstrates that NCPS from N. commune could be potentially used for macrophage activation and consequently inhibited the leukemic cell growth and induced monocytic/macrophagic differentiation.
Preparation, characterization, and biological properties of β-glucans
Directory of Open Access Journals (Sweden)
Sandeep Rahar
2011-01-01
Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Extraction, Characterization and Immunological Activity of Polysaccharides from Rhizoma gastrodiae
Directory of Open Access Journals (Sweden)
Juncheng Chen
2016-06-01
Full Text Available A response surface and Box-Behnken design approach was applied to augment polysaccharide extraction from the residue of Rhizoma gastrodiae. Statistical analysis revealed that the linear and quadratic terms for three variables during extraction exhibited obvious effects on extraction yield. The optimum conditions were determined to be a liquid-to-solid ratio of 54 mL/g, an extraction temperature of 74 °C, an extraction time of 66 min, and three extractions. These conditions resulted in a maximum Rhizoma gastrodiae polysaccharide (RGP extraction yield of 6.11% ± 0.13%. Two homogeneous polysaccharides (RGP-1a and RGP-1b were obtained using DEAE cellulose-52 and Sephadex G-100 columns. The preliminary characterization of RGP-1a and RGP-1b was performed using HPLC-RID, HPGPC, and FTIR. Tests of the immunological activity in vitro showed that the two polysaccharides could significantly stimulate macrophages to release NO and enhance phagocytosis in a dose-dependent manner. In particular, RGP-1b (200 μg/mL and LPS (2 μg/mL had almost the same influence on the NO production and phagocytic activity of RAW 264.7 macrophages (p > 0.05. All the data obtained indicate that RGP-1a and RGP-1b have the potential to be developed as a health food.
DEFF Research Database (Denmark)
Ale, Marcel Tutor; Mikkelsen, Jørn Dalgaard; Meyer, Anne S.
2012-01-01
Fucose-containing sulfated polysaccharides can be extracted from the brown seaweed, Sargassum sp. It has been reported that fucose-rich sulfated polysaccharides from brown seaweeds exert different beneficial biological activities including anti-inflammatory, anticoagulant, and anti-viral effects....... Classical extraction of fucose-containing sulfated polysaccharides from brown seaweed species typically involves extended, multiple-step, hot acid, or CaCl2 treatments, each step lasting several hours. In this work, we systematically examined the influence of acid concentration (HCl), time, and temperature...... on the yield of fucosecontaining sulfated polysaccharides (FCSPs) in statistically designed two-step and single-step multifactorial extraction experiments. All extraction factors had significant effects on the fucose-containing sulfated polysaccharides yield, with the temperature and time exerting positive...
A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.
Semedo, Magda C; Karmali, Amin; Fonseca, Luís
2015-02-01
Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Kaira E.S. da Silva-Leite
Full Text Available Abstract Ximenia americana L., Olacaceae, barks are utilized in folk medicine as analgesic and anti-inflammatory. The objective was to evaluate the toxicity and antinociceptive effect of polysaccharides rich fractions from X. americana barks. The fractions were obtained by extraction with NaOH, followed by precipitation with ethanol and fractionation by ion exchange chromatography. They were administered i.v. or p.o. before nociception tests (writhing, formalin, carragenan-induced hypernociception, hot plate, or during 14 days for toxicity assay. The total polysaccharides fraction (TPL-Xa: 8.1% yield presented 43% carbohydrate (21% uronic acid and resulted in two main fractions after chromatography (FI: 12%, FII: 22% yield. FII showed better homogeneity/purity, content of 44% carbohydrate, including 39% uronic acid, arabinose and galactose as major monosaccharides, and infrared spectra with peaks in carbohydrate range for COO- groups of uronic acid. TPL-Xa (10 mg/kg and FII (0.1 and 1 mg/kg presented inhibitory effect in behavior tests that evaluate nociception induced by chemical and mechanical, but not thermal stimuli. TPL-Xa did not alter parameters of systemic toxicity. In conclusion, polysaccharides rich fractions of X. americana barks inhibit peripheral inflammatory nociception, being well tolerated by animals.
Mekoue Nguela, J; Poncet-Legrand, C; Sieczkowski, N; Vernhet, A
2016-11-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored by binding experiments, ITC and DLS. Depending on the tannin structure, a different affinity between the polyphenols and the YPE was observed, as well as differences in the stability of the aggregates. This was attributed to the mean degree of polymerization of tannins in the polyphenol fractions and to chemical changes that occur during winemaking. Much lower affinities were found between polyphenols and polysaccharides, with different behaviors between mannoproteins and β-glucans. Copyright © 2016 Elsevier Ltd. All rights reserved.
Visual effects of β-glucans on wound healing in fish
DEFF Research Database (Denmark)
Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær
2011-01-01
Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...
The structure of cell wall alpha-glucan from fission yeast
Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
The structure of cell wall alpha-glucan from fission yeast.
Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
Anjaneyalu, Y V; Jagadish, R L; Raju, T S
1997-06-01
Polysaccharide components present in the pseudo-stem (scape) of M. paradisiaca were purified from acetone powder of the scape by delignification followed by extraction with aqueous solvents into water soluble polysaccharide (WSP), EDTA-soluble polysaccharide (EDTA-SP), alkali-soluble polysaccharide (ASP) and alkali-insoluble polysaccharide (AISP) fractions. Sugar compositional analysis showed that WSP and EDTA-SP contained only D-Glc whereas ASP contained D-Glc, L-Ara and D-Xyl in approximately 1:1:10 ratio, respectively, and AISP contained D-Glc, L-Ara and D-Xyl in approximately 10:1:2 ratio, respectively. WSP was further purified by complexation with iso-amylalcohol and characterized by specific rotation, IR spectroscopy, Iodine affinity, ferricyanide number, blue value, hydrolysis with alpha-amylase and glucoamylase, and methylation linkage analysis, and shown to be a amylopectin type alpha-D-glucan.
Directory of Open Access Journals (Sweden)
Pai-Feng Kao
2012-01-01
Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.
Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus
Directory of Open Access Journals (Sweden)
Ira Widjiastuti
2017-03-01
Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of
Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets.
Knudsen, Knud Erik Bach
2014-09-01
The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β-glucan (β-glucan), cellulose, and the noncarbohydrate component lignin are the predominant polymers in cereals. They occur in different proportions depending on the species and tissue type. Rye, triticale, wheat, corn, and sorghum are all rich in AX, whereas barley and oats contain a high level of β-glucan. The AX from rye, wheat, and triticale and β-glucan from barley and oats are to a large extent soluble, whereas the solubility of AX found in corn and sorghum is lower than the other cereals. The ratio of arabinose to xylose gives a crude indication of the AX structure, which varies between the endosperm, the aleurone and the outer grain layers as well as between the same tissues from different grains. Varietal differences in AX structure of the endosperm are also identified. From the analysis of the released oligomers after hydrolysis with a specific (1→3,1→4)-β-d-glucan hydrolase, it is found that the ratio of trisaccharides (degree of polymerization 3) and tetrasaccharides (degree of polymerization 4) varies depending on the source, being higher in barley than in oats but lower than in wheat. The molecular weight of β-glucan is higher than that of AX, and both polymers contribute to the viscosity of the extract. However, because AX molecules are more resistant to degradation than β-glucan, the use of AX rich grains in broiler diets is usually more problematic than those containing high concentrations of β-glucan. The cereal coproducts (brans and hulls) are concentrated sources of cellulose, lignin, and insoluble AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are
Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan
Directory of Open Access Journals (Sweden)
Eduardo Madrigal-Bujaidar
2015-06-01
Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.
DEFF Research Database (Denmark)
Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo
2008-01-01
Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...
Directory of Open Access Journals (Sweden)
Fhernanda R Smiderle
Full Text Available The Ascomycete Cordyceps militaris, an entomopathogenic fungus, is one of the most important traditional Chinese medicines. Studies related to its pharmacological properties suggest that this mushroom can exert interesting biological activities. Aqueous (CW and HW and alkaline (K5 extracts containing polysaccharides were prepared from this mushroom, and a β-D-glucan was purified. This polymer was analysed by GC-MS and NMR spectrometry, showing a linear chain composed of β-D-Glcp (1→3-linked. The six main signals in the 13C-NMR spectrum were assigned by comparison to reported data. The aqueous (CW, HW extracts stimulated the expression of IL-1β, TNF-α, and COX-2 by THP-1 macrophages, while the alkaline (K5 extract did not show any effect. However, when the extracts were added to the cells in the presence of LPS, K5 showed the highest inhibition of the pro-inflammatory genes expression. This inhibitory effect was also observed for the purified β-(1→3-D-glucan, that seems to be the most potent anti-inflammatory compound present in the polysaccharide extracts of C. militaris. In vivo, β-(1→3-D-glucan also inhibited significantly the inflammatory phase of formalin-induced nociceptive response, and, in addition, it reduced the migration of total leukocytes but not the neutrophils induced by LPS. In conclusion, this study clearly demonstrates the anti-inflammatory effect of β-(1→3-D-glucan.
Composition and antioxidant activities of four polysaccharides extracted from Herba Lophatheri.
Ge, Qing; Mao, Jian-wei; Guo, Xiao-qing; Zhou, Yi-feng; Gong, Jing-yan; Mao, Shuang-rong
2013-09-01
Four polysaccharides (BLF80-A, BLF80-B, BLF80-C and BLF80-D) were isolated by hot-water extraction and purified from the leaves of Herba Lophatheri by DEAE-Sepharose fast flow. Their chemical and physical characteristics were determined and antioxidant activities were investigated on the basis of DPPH radical assay, hydroxyl radical assay and superoxide radical assay. The results showed that four polysaccharides exhibited antioxidant activities in a concentration-dependent manner, and the higher molecular weight, the stronger antioxidant activities of polysaccharides. Besides, the monosaccharide compositions of polysaccharides also influence their antioxidant activities. BLP80-D showed the strongest scavenging ability, followed by BLP80-C, BLP80-B and BLP80-A. Copyright © 2013 Elsevier B.V. All rights reserved.
Hsu, Kai-Di; Wu, Shu-Pei; Lin, Shin-Ping; Lum, Chi-Chin; Cheng, Kuan-Chen
2017-10-01
Extracellular polysaccharide (EPS) is one of the major bioactive ingredients contributing to the health benefits of Ganoderma spp. In this study, response surface methodology was applied to determine the optimal culture conditions for EPS production of Ganoderma formosanum. The optimum medium composition was found to be at initial pH 5.3, 49.2 g/L of glucose, and 4.9 g/L of yeast extract by implementing a three-factor-three-level Box-Behnken design. Under this condition, the predicted yield of EPS was up to 830.2 mg/L, which was 1.4-fold higher than the one from basic medium (604.5 mg/L). Furthermore, validating the experimental value of EPS production depicted a high correlation (100.4%) with the computational prediction response model. In addition, the percentage of β-glucan, a well-recognized bioactive polysaccharide, in EPS was 53±5.5%, which was higher than that from Ganoderma lucidum in a previous study. Moreover, results of monosaccharide composition analysis indicated that glucose was the major component of G. formosanum EPS, supporting a high β-glucan percentage in EPS. Taken together, this is the first study to investigate the influence of medium composition for G. formosanum EPS production as well as its β-glucan composition. Copyright © 2017. Published by Elsevier B.V.
Biochemical Aspects of Non-Starch Polysaccharides
Directory of Open Access Journals (Sweden)
Rodica Căpriţă
2010-05-01
Full Text Available Polysaccharides are macromolecules of monosaccharides linked by glycosidic bonds. Non-starch polysaccharides (NSP are principally non-α-glucan polysaccharides of the plant cell wall. They are a heterogeneous group of polysaccharides with varying degrees of water solubility, size, and structure. The water insoluble fiber fraction include cellulose, galactomannans, xylans, xyloglucans, and lignin, while the water-soluble fibers are the pectins, arabinogalactans, arabinoxylans, and β-(1,3(1,4-D-glucans (β-glucans. Knowledge of the chemical structure of NSP has permitted the development of enzyme technology to overcome their antinutritional effects. The physiological effects of NSP on the digestion and absorption of nutrients in human and monogastric animals have been attributed to their physicochemical properties: hydration properties, viscosity, cation exchange capacity and organic compound absorptive properties. This paper reviews and presents information on NSPs chemistry, physicochemical properties and physiological effects on the nutrient entrapment.
Maca polysaccharides: Extraction optimization, structural features and anti-fatigue activities.
Li, Yujuan; Xin, Yizhou; Xu, Fangxue; Zheng, Mengmeng; Xi, Xiaozhi; Cui, Xiaowei; Cao, Hui; Guo, Hong; Han, Chunchao
2018-08-01
The maca polysaccharides optimal extraction conditions were obtained by using response surface methodology (RSM) method and the anti-fatigue activity of maca polysaccharides (MCP) was explored. The maca polysaccharides extract yield of RSM could reach 9.97 mg/g by using the model predicts, and the total sugar and protein purity were 61.00% and 4.46% with the further isolation process, respectively. And the monosaccharide compositions obtained by gas chromatograph (GC) were composed of rhamnose (rha), glucose (glc), galactose (gal) with the ratio of 2.34:10.21:1.00. Furthermore, the anti-fatigue activity was evaluated by the swimming parameter, biochemistry parameters (liver glycogen (LG), blood urea nitrogen (BUN), and lactic acid (LD)), the result indicated that the low-dose maca polysaccharides group had the significant anti-fatigue activity. Copyright © 2018 Elsevier B.V. All rights reserved.
Ganoderma lucidum Polysaccharide Peptide (GLPP for the Cancer Treatment
Directory of Open Access Journals (Sweden)
Imam Rasjidi
2015-06-01
Full Text Available Ganoderma lucidum mushroom (also known as Ling Zhi in China, Mannetake /Reishi in Japan has been widely used for thousands of years to prevent and treat various diseases, such as heart disease, diabetes mellitus, viral infection, and cancer. Polysaccharides from Ganoderma lucidum has been extensively investigated for free radical scavenging activity. Both in vivo and in vitro studies suggest that G. lucidum have anti-tumor effects, which mediated by its immunomodulatory, anti-angiogenesis, and cytotoxic effects. Ganoderma lucidum polysaccharide peptide (GLPP which extracted from Ganoderma lucidum mycelium tissue culture, give the best quality of β-D-Glucans bioactive compounds. These biologically active glucans interact with receptors on the surface of immune cells such as macrophage and natural killer cell (NK cell to induce immunomodulatory and tumoricidal effects. However, many studies still need to answer those mechanisms.
Hu, Jie; Jia, Xuejing; Fang, Xiaobin; Li, Peng; He, Chengwei; Chen, Meiwan
2016-04-01
Ultrasonic-assisted extraction technology was employed to prepare Ligusticum chuanxiong Hort polysaccharide. Single factor test and orthogonal experimental design were used to optimize the extraction conditions. The results showed that the optimal extraction conditions consisted of ultrasonic temperature of 80°C, ultrasonic time of 40 min and water to raw material ratio of 30 mL/g. Three novel polysaccharides fractions, LCX0, LCX1 and LCX2, were isolated and purified from the crude polysaccharides using DEAE-52 cellulose and Sephadex G-100 column chromatography. The molecular weight and monosaccharide composition of three LCX polysaccharides fractions were analyzed with gel permeation chromatography (GPC) and HPLC analysis, respectively. Furthermore, the antioxidant and in vitro anticancer activities of the polysaccharides were investigated. Compared with LCX0, LCX2 and LCX1 showed relative higher antioxidant activity and inhibitory activity to the growth of HepG2, SMMC7721, A549 and HCT-116 cells. It is suggested that the novel polysaccharides from rhizome of L. chuanxiong could be promising bioactive macromolecules for biomedical use. Copyright © 2016. Published by Elsevier B.V.
Ahmad, Ajaz; Alkharfy, Khalid M; Wani, Tanveer A; Raish, Mohammad
2015-01-01
The objective of the present work was to study the ultrasonic assisted extraction and optimization of polysaccharides from Paeonia emodi and evaluation of its anti-inflammatory response. Specifically, the optimization of polysaccharides was carried out using Box-Behnken statistical experimental design. Response surface methodology (RSM) of three factors (extraction temperature, extraction time and liquid solid ratio) was employed to optimize the percentage yield of the polysaccharides. The experimental data were fitted to quadratic response surface models using multiple regression analysis with high coefficient of determination value (R) of 0.9906. The highest polysaccharide yield (8.69%) as per the Derringer's desirability prediction tool was obtained under the optimal extraction condition (extraction temperature 47.03 °C, extraction time 15.68 min, and liquid solid ratio 1.29 ml/g) with a desirability value of 0.98. These optimized values of tested parameters were validated under similar conditions (n = 6), an average of 8.13 ± 2.08% of polysaccharide yield was obtained in an optimized extraction conditions with 93.55% validity. The anti-inflammatory effect of polysaccharides of P. emodi were studied on carrageenan induced paw edema. In vivo results showed that the P. emodi 200mg/kg of polysaccharide extract exhibited strong potential against inflammatory response induced by 1% suspension of carrageenean in normal saline. Copyright © 2014 Elsevier B.V. All rights reserved.
Jing, Changliang; Yuan, Yuan; Tang, Qi; Zou, Ping; Li, Yiqiang; Zhang, Chengsheng
2017-10-01
Single-factor experiment and Central Composite Design (CCD) was applied to optimize the ultrasound-assisted extraction (UAE) conditions of polysaccharides from Glycine soja (CGPS), and a preliminary characterization of three polysaccharide fractions (CGPS, GPS-1, and GPS-2) and their antioxidant activities were investigated. Under the optimal conditions: ratio of liquid to solid 42.7mL/g, extraction power 293.7W, extraction temperature 68.9°C, and extraction time 34.7min, the experimental CGPS yield was 6.04mg/g. CGPS was further purified by DEAE-cellulose and Sephadex-100 chromatography to obtain two fractions (GPS-1 and GPS-2), and their monosaccharides compositions were characterized by HPLC. Fourier-transform infrared spectra (FT-IR) indicated the chemical structures of them. Moreover, they exhibited high antioxidant activities in a concentration-dependent manner in vitro. In summary, the present study suggested that UAE was a very effective method to extract polysaccharides from Glycine soja and the polysaccharides could be explored as potential antioxidant agents for medicine and function food. Copyright © 2017 Elsevier B.V. All rights reserved.
Recent insight in α-glucan metabolism in probiotic bacteria
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm
2014-01-01
α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...
Cheong, Kit-Leong; Wang, Lan-Ying; Wu, Ding-Tao; Hu, De-Jun; Zhao, Jing; Li, Shao-Ping
2016-09-01
Cordyceps sinensis is a well-known tonic food with broad medicinal properties. The aim of the present study was to investigate the optimization of microwave-assisted extraction (MAE) and characterize chemical structures and chain conformation of polysaccharides from a novel C. sinensis fungus UM01. Ion-exchange and gel filtration chromatography were used to purify the polysaccharides. The chemical structure of purified polysaccharide was determined through gas chromatography-mass spectrometry. Moreover, high performance size exclusion chromatography combined with refractive index detector and multiangle laser light scattering were conducted to analyze the molecular weight (Mw ) and chain conformation of purified polysaccharide. Based on the orthogonal design L9 , optimal MAE conditions could be obtained through 1300 W of microwave power, with a 5-min irradiation time at a solid to water ratio of 1:60, generating the highest extraction yield of 6.20%. Subsequently, the polysaccharide UM01-S1 was purified. The UM01-S1 is a glucan-type polysaccharide with a (1→4)-β-d-glucosyl backbone and branching points located at O-3 of Glcp with a terminal-d-Glcp. The Mw , radius of gyration (Rg ) and hydrodynamic radius (Rh ) of UM01-S1 were determined as 5.442 × 10(6) Da, 21.8 and 20.2 nm, respectively. Using the polymer solution theory, the exponent (ν) value of the power law function was calculated as 0.38, and the shape factor (ρ = Rg /Rh ) was 1.079, indicating that UM01-S1 has a sphere-like conformation with a branched structure in an aqueous solution. These results provide fundamental information for the future application of polysaccharides from cultured C. sinensis in health and functional food area. © 2016 Institute of Food Technologists®
Ferreira, Isabel C F R; Heleno, Sandrina A; Reis, Filipa S; Stojkovic, Dejan; Queiroz, Maria João R P; Vasconcelos, M Helena; Sokovic, Marina
2015-06-01
Ganoderma genus comprises one of the most commonly studied species worldwide, Ganoderma lucidum. However, other Ganoderma species have been also reported as important sources of bioactive compounds. Polysaccharides are important contributors to the medicinal properties reported for Ganoderma species, as demonstrated by the numerous publications, including reviews, on this matter. Yet, what are the chemical features of Ganoderma polysaccharides that have bioactivity? In the present manuscript, the chemical features of Ganoderma polysaccharides with reported antioxidant, antitumor and antimicrobial activities (the most studied worldwide) are analyzed in detail. The composition of sugars (homo- versus hetero-glucans and other polysaccharides), type of glycosidic linkages, branching patterns, and linkage to proteins are discussed. Methods for extraction, isolation and identification are evaluated and, finally, the bioactivity of polysaccharidic extracts and purified compounds are discussed. The integration of data allows deduction of structure-activity relationships and gives clues to the chemical aspects involved in Ganoderma bioactivity. Copyright © 2014 Elsevier Ltd. All rights reserved.
β-Glucans: Relationships between Modification, Conformation and Functional Activities
Directory of Open Access Journals (Sweden)
Qiang Wang
2017-02-01
Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.
Yan, Jing-Kun; Ding, Zhi-Chao; Gao, Xianli; Wang, Yao-Yao; Yang, Yan; Wu, Di; Zhang, He-Nan
2018-08-01
In this study, hot water, 0.9% NaCl, citric acid, and 1.25 M NaOH/0.05% NaBH 4 were separately used for the extraction of water-soluble H. erinaceus polysaccharides (HEPs; HEP-W, HEP-S, HEP-C, and HEP-A) from the fruit body of Hericium erinaceus. The physicochemical properties and biological activities were then investigated and compared. Results showed that the extraction solvents exhibited significant effects on the extraction yields, molecular weights, monosaccharide compositions, preliminary structural characteristics, microstructures of HEPs and on their contents, such as neutral sugar, uronic acid, protein, and β-(1 → 3)-glucan. In vitro antioxidant activity assays indicated that HEP-C extracted with citric acid solution showed stronger scavenging abilities on hydroxyl and DPPH radicals and antioxidant capacities than HEP-W and HEP-S. Moreover, HEP-C exhibited the strongest inhibitory effects on α-glycosidase and α-amylase activities. Therefore, HEP-C extracted with citric acid can be developed as a potential bioactive ingredient for applications in food, medicine, and cosmetics industries. Copyright © 2018 Elsevier Ltd. All rights reserved.
Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.
Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong
2017-02-01
(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis
Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods
Directory of Open Access Journals (Sweden)
Vesna Zechner-Krpan
2010-01-01
Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.
DEFF Research Database (Denmark)
Sárossy, Zsuzsa; Tenkanen, Maija; Pitkänen, Leena
2013-01-01
.9 and 1.0 cm3 mm/m2 d kPa). However, the water vapor permeability increased with addition of increasing amounts of BG to WE-AX. To our knowledge, this is the first study on the effect of β-glucans on the material and permeability properties of arabinoxylan-based films. © 2012 Elsevier Ltd. All rights......Water-extractable hemicellulose (WEH) fractions, containing approximately 65% arabinoxylans (WE-AX) and 20% mixed-linkage b-glucans were isolated from rye bran. In addition, water-extractable mixedlinkage β-glucans (BG) were isolated from oat bran as a reference material. The β-glucan content....../mol. The material properties of films prepared from the rye hemicellulose isolate and WE-AX as such, or with varying amounts of added BG (20:80; 50:50; 80:20 ratios) were studied. Prior removal of β-glucan from the isolate decreased the tensile strength of the films significantly as well as the elongation at break...
Is torrefaction of polysaccharides-rich biomass equivalent to carbonization of lignin-rich biomass?
Bilgic, E; Yaman, S; Haykiri-Acma, H; Kucukbayrak, S
2016-01-01
Waste biomass species such as lignin-rich hazelnut shell (HS) and polysaccharides-rich sunflower seed shell (SSS) were subjected to torrefaction at 300°C and carbonization at 600°C under nitrogen. The structural variations in torrefied and carbonized biomasses were compared. Also, the burning characteristics under dry air and pure oxygen (oxy-combustion) conditions were investigated. It was concluded that the effects of carbonization on HS are almost comparable with the effects of torrefaction on SSS in terms of devolatilization and deoxygenation potentials and the increases in carbon content and the heating value. Consequently, it can be proposed that torrefaction does not provide efficient devolatilization from the lignin-rich biomass while it is relatively more efficient for polysaccharides-rich biomass. Heat-induced variations in biomass led to significant changes in the burning characteristics under both burning conditions. That is, low temperature reactivity of biomass reduced considerably and the burning shifted to higher temperatures with very high burning rates. Copyright © 2015 Elsevier Ltd. All rights reserved.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
Energy Technology Data Exchange (ETDEWEB)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2010-07-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
International Nuclear Information System (INIS)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon
2010-01-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity
Chemical Methods for the Determination of Soluble and Insoluble Non-Starch Polysaccharides - Review
Directory of Open Access Journals (Sweden)
Rodica Căpriţă
2011-10-01
Full Text Available Polysaccharides are macromolecules of monosaccharides linked by glycosidic bonds. Non-starch polysaccharides(NSP are principally non-α-glucan polysaccharides of the plant cell wall. They are a heterogeneous group ofpolysaccharides with varying degrees of water solubility, size, and structure. The water insoluble fiber fractioninclude cellulose, galactomannans, xylans, xyloglucans, and lignin, while the water-soluble fibers are the pectins,arabinogalactans, arabinoxylans, and β-(1,3(1,4-D-glucans (β-glucans. Both the enzymatic-gravimetric andenzymatic-chemical methods used for the determination of soluble and insoluble non-starch polysaccharides haveundergone a number of modifications and improvements, most occurring over the last 20 years.
Ho, Hoang V T; Sievenpiper, John L; Zurbau, Andreea; Blanco Mejia, Sonia; Jovanovski, Elena; Au-Yeung, Fei; Jenkins, Alexandra L; Vuksan, Vladimir
2016-10-01
Oats are a rich source of β-glucan, a viscous, soluble fibre recognised for its cholesterol-lowering properties, and are associated with reduced risk of CVD. Our objective was to conduct a systematic review and meta-analysis of randomised-controlled trials (RCT) investigating the cholesterol-lowering potential of oat β-glucan on LDL-cholesterol, non-HDL-cholesterol and apoB for the risk reduction of CVD. MEDLINE, Embase, CINAHL and Cochrane CENTRAL were searched. We included RCT of ≥3 weeks of follow-up, assessing the effect of diets enriched with oat β-glucan compared with controlled diets on LDL-cholesterol, non-HDL-cholesterol or apoB. Two independent reviewers extracted data and assessed study quality and risk of bias. Data were pooled using the generic inverse-variance method with random effects models and expressed as mean differences with 95 % CI. Heterogeneity was assessed by the Cochran's Q statistic and quantified by the I 2-statistic. In total, fifty-eight trials (n 3974) were included. A median dose of 3·5 g/d of oat β-glucan significantly lowered LDL-cholesterol (-0·19; 95 % CI -0·23, -0·14 mmol/l, Pcholesterol (-0·20; 95 % CI -0·26, -0·15 mmol/l, PLDL-cholesterol (I 2=79 %) and non-HDL-cholesterol (I 2=99 %). Pooled analyses showed that oat β-glucan has a lowering effect on LDL-cholesterol, non-HDL-cholesterol and apoB. Inclusion of oat-containing foods may be a strategy for achieving targets in CVD reduction.
Zhang, Anqiang; Xiao, Nannan; He, Pengfei; Sun, Peilong
2011-12-01
Boletus edulis is a well-known delicious mushroom. In this study, three crude polysaccharides (BEPF30, BEPF60 and BEPF80) were isolated from the fruiting bodies of B. edulis with boiling water. Chemical and physical characteristics of the three crude polysaccharides were investigated by the combination of chemical and instrumental analysis methods. Their antioxidant activities were investigated in vitro systems including hydroxyl assay, superoxide radical assay, reducing power and chelating activity. Among these three polysaccharides, BEPF60 showed more significant reducing power and chelating activity; and highest inhibitory effects on superoxide radical and hydroxyl radical. These results indicated that polysaccharides extracted from B. edulis might be employed as ingredients in healthy and functional food to alleviate the oxidative stress. Copyright © 2011 Elsevier B.V. All rights reserved.
Pakrokh Ghavi, Peyman
2015-04-01
Response surface methodology (RSM) with a central composite rotatable design (CCRD) based on five levels was employed to model and optimize four experimental operating conditions of extraction temperature (10-90 °C) and time (6-30 h), particle size (6-24 mm) and water to solid (W/S, 10-50) ratio, obtaining polysaccharides from Althaea officinalis roots with high yield and antioxidant activity. For each response, a second-order polynomial model with high R(2) values (> 0.966) was developed using multiple linear regression analysis. Results showed that the most significant (P < 0.05) extraction conditions that affect the yield and antioxidant activity of extracted polysaccharides were the main effect of extraction temperature and the interaction effect of the particle size and W/S ratio. The optimum conditions to maximize yield (10.80%) and antioxidant activity (84.09%) for polysaccharides extraction from A. officinalis roots were extraction temperature 60.90 °C, extraction time 12.01 h, particle size 12.0mm and W/S ratio of 40.0. The experimental values were found to be in agreement with those predicted, indicating the models suitability for optimizing the polysaccharides extraction conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
You, Qinghong; Yin, Xiulian; Ji, Chaowen
2014-01-30
Four methods for extracting polysaccharides from Boletus edulis, namely, hot-water extraction, ultrasonic clearer extraction, static probe ultrasonic extraction, and pulsed counter-current probe ultrasonic extraction (CCPUE), were studied. Results showed that CCPUE has the highest extraction efficiency among the methods studied. Under optimal CCPUE conditions, a B. edulis polysaccharide (BEP) yield of 8.21% was obtained. Three purified fractions, BEP-I, BEP-II, and BEP-III, were obtained through sequential purification by DEAE-52 and Sephadex G-75 chromatography. The average molecular weights of BEP-I, BEP-II, and BEP-III were 10,278, 23,761, and 42,736 Da, respectively. The polysaccharides were mainly composed of xylose, mannose, galactose, and glucose; of these, mannose contents were the highest. The antioxidant activities of the BEPs were further investigated by measurement of their ability to scavenge DPPH and hydroxyl radicals as well as their reducing power. The results indicated that the BEPs have good antioxidant activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Marília S. Nascimento
2012-02-01
Full Text Available Several pharmacological properties are attributed to polysaccharides and glucans derived from fungi such as tumor, anti-inflammatory, and immunomodulatory activity. In this work, the anti-inflammatory potential of polysaccharides from the fungus Scleroderma nitidum and their possible action mechanism were studied. The effect of these polymers on the inflammatory process was tested using the carrageenan and histamine-induced paw edema model and the sodium thioglycolate and zymosan-induced model. The polysaccharides from S. nitidum were effective in reducing edema (73% at 50 mg/kg and cell infiltrate (37% at 10 mg/kg in both inflammation models tested. Nitric oxide, a mediator in the inflammatory process, showed a reduction of around 26% at 10 mg/kg of body weight. Analysis of pro-and anti-inflammatory cytokines showed that in the groups treated with polysaccharides from S. nitidum there was an increase in cytokines such as IL-1ra, IL-10, and MIP-1β concomitant with the decrease in INF-γ (75% and IL-2 (22%. We observed the influence of polysaccharides on the modulation of the expression of nuclear factor κB. This compound reduced the expression of NF-κB by up to 64%. The results obtained suggest that NF-κB modulation an mechanisms that explain the anti-inflammatory effect of polysaccharides from the fungus S. nitidum.
Thao, Cao Phuong; Tien, Le Thi Thuy
2017-09-01
β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2014-01-01
Full Text Available β-glucan is a well-known polysaccharide for its chemopreventive effect. This study aimed to evaluate the chemopreventive ability of β-glucan in somatic and germ cells through the dominant lethal and micronucleus assays, and its influence on the reproductive performance of male mice exposed to cyclophosphamide. The results indicate that β-glucan is capable of preventing changes in DNA in both germ cells and somatic ones. Changes in germ cells were evaluated by the dominant lethal assay and showed damage reduction percentages of 46.46% and 43.79% for the doses of 100 and 150 mg/kg. For the somatic changes, evaluated by micronucleus assay in peripheral blood cells in the first week of treatment, damage reduction percentages from 80.63-116.32% were found. In the fifth and sixth weeks, the percentage ranged from 10.20-52.54% and -0.95-62.35%, respectively. Besides the chemopreventive efficiency it appears that the β-glucan, when combined with cyclophosphamide, is able to improve the reproductive performance of males verified by the significant reduction in rates of post-implantation losses and reabsorption in the mating of nulliparous females with males treated with cyclophosphamide.
Optimization of microwave-assisted extraction of polysaccharide from Psidium guajava L. fruits.
Amutha Gnana Arasi, Michael Antony Samy; Gopal Rao, Manchineela; Bagyalakshmi, Janardanan
2016-10-01
This study deals with the optimization of microwave assisted extraction of polysaccharide from Psidium guajava L. fruit using Response surface methodology. To evaluate the effect of three independent variables, Water to plant material ratio, microwave power used for extraction and Irradiation time, central composite design has been employed. The yield is considered as dependent variable. The design model estimated the optimum yield of 6.81677% at 200W microwave power level, 3:1 water to plant material ratio and 20min of irradiation time. Three factors three levels Central composite design coupled with RSM was used to model the extraction process. ANOVA was performed to find the significance of the model. The polysaccharide extracted using microwave assisted extraction process was analyzed using FTIR Spectroscopy. Copyright © 2016 Elsevier B.V. All rights reserved.
Chen, Yong; Yin, Luoyi; Zhang, Xuejiao; Wang, Yan; Chen, Qiuzhi; Jin, Chenzhong; Wang, Jihua
2014-01-01
The present study is to explore the optimal extraction parameters, antioxidant activity, and antimicrobial activity of alkaline soluble polysaccharides from rhizome of Polygonatum odoratum. The optimal extraction parameters were determined as the following: NaOH concentration (A) 0.3 M, temperature (B) 80°C, ratio of NaOH to solid (C) 10-fold, and extraction time (D) 4 h, in which ratio of NaOH to solid was a key factor. The order of the factors was ratio of NaOH to solid (fold, C) > extraction temperature (°C, B) > NaOH concentration (M, A) > extraction time (h, D). The monosaccharide compositions of polysaccharides from P. odoratum were rhamnose, mannose, xylose, and arabinose with the molecular ratio of 31.78, 31.89, 11.11, and 1.00, respectively. The reducing power, the 1, 1-diphenyl-2-picryl-hydrazil (DPPH) radical scavenging rate, the hydroxyl radicals scavenging rate, and the inhibition rate to polyunsaturated fatty acid (PUFA) peroxidation of the alkaline soluble polysaccharides from P. odoratum at 1 mg/mL were 9.81%, 52.84%, 19.22%, and 19.42% of ascorbic acid at the same concentration, respectively. They also showed antimicrobial activity against pathogenic bacteria Staphylococcus aureus, Pseudomonas aeruginosa, Bacillus subtilis, and Escherichia coli. PMID:25093173
Bioactive polysaccharides and gut microbiome (abstract)
Many polysaccharides have shown the ability to reduce plasma cholesterol or postprandial glycemia. Viscosity in the small intestine seems to be required to slow glucose uptake. Cereal mixed linkage beta-glucans, psyllium, glucomannans, and other polysaccharides also seem to require higher molecula...
Qiao, De-Liang; Zhao, Feng; Huang, Hai-Zhong; Fan, Chun-Chun; Han, Lei
2012-08-01
To optimize ultrasonic-assisted extraction parameters of polysaccharides from Agaricus bisporus and evaluate antioxidant activities of A. bisporus polysaccharides. Polysaccharides from A. bisporus was extracted by using methods of ultrasonic-assisted hot water lixiviation, ethanol precipitation, Sevag's deproteination and ethanol precipitation again. Extraction temperature, extraction time, ratio of water to raw material and ultrasonic power were selected in single-factor tests. Based on the single-factor tests, parameters combination for the ultrasonic-assisted extraction of A. bisporus polysaccharides was optimized by using four-factor-three-level orthogonal test. Antioxidant activities (reductive potential, superoxide anion scavenging activity and H2O2 scavenging activity) of A. bisporus polysaccharides were evaluated in vitro. Optimum conditions for the extracting of A. bisporus polysaccharides were extracting temperature 65 degrees C, extracting time 40 min, ratio of water to raw material 30 mL/g and ultrasonic power 170 w. Practicing this optimal condition, extraction yield of polysaccharides from A. bisporus was 5.6 014%. In crude polysaccharides of A. bisporus, carbohydrates content, determined by applying the phenol-sulfuric acid method, was 75.48%. Polysaccharides of A. bisporus could reduce ferric ion, scavenge superoxide anion and hydrogen peroxide in a dose-dependent manner. Utrasonic-assisted extraction could be used in the extracting of A. bisporus polysaccharides. Polysaccharides of A. bisporus, had direct and potent antioxidant activities, might be developed and utilized as natural antioxidant.
Zhang, Yi; Wang, Hongxin; Wang, Peng; Ma, ChaoYang; He, GuoHua; Rahman, Md Ramim Tanver
2016-11-01
Polyethylene glycol (PEG) as a green solvent was employed to extract polysaccharide. The optimal conditions for PEG-based ultrasonic extraction of Dendrobium nobile Lindl. polysaccharide (JCP) were determined by response surface methodology. Under the optimal conditions: extraction temperature of 58.5°C; ultrasound power of 193W, and the concentration of polyethylene glycol-200 (PEG-200) solution of 45%, the highest JCP yield was obtained as 15.23±0.57%, which was close to the predicted yield, 15.57%. UV and FT-IR analysis revealed the general characteristic absorption peaks of both JCP with water extraction (JCP w ) and PEG-200 solvent extraction (JCP p ). Thermal analysis of both JCPs was performed with Thermal Gravimetric Analyzer (TGA) and Differential Scanning Calorimeter (DSC). Antioxidant activities of two polysaccharides were also compared and no significant difference in vitro was obtained. Copyright © 2016 Elsevier B.V. All rights reserved.
High-quality total RNA isolation from melon (Cucumis melo L. fruits rich in polysaccharides
Directory of Open Access Journals (Sweden)
Gabrielle Silveira de Campos
2017-08-01
Full Text Available Melon, a member of the family Cucurbitaceae, is the fourth most important fruit in the world market and, on a volume basis, is Brazil’s main fresh fruit export. Many molecular techniques used to understand the maturation of these fruits require high concentrations of highly purified RNA. However, melons are rich in polyphenolic compounds and polysaccharides, which interfere with RNA extraction. This study aimed to determine the most appropriate method for total RNA extraction from melon fruits. Six extraction buffers were tested: T1 guanidine thiocyanate/phenol/chloroform; T2 sodium azide/?-mercaptoethanol; T3 phenol/guanidine thiocyanate; T4 CTAB/PVP/?-mercaptoethanol; T5 SDS/sodium perchlorate/PVP/?-mercaptoethanol, and T6 sarkosyl/PVP/guanidine thiocyanate, using the AxyPrepTM Multisource Total RNA Miniprep Kit. The best method for extracting RNA from both mature and green fruit was based on the SDS/PVP/?-mercaptoethanol buffer, because it rapidly generated a high quality and quantity of material. In general, higher amounts of RNA were obtained from green than mature fruits, probably due to the lower concentration of polysaccharides and water. The purified material can be used as a template in molecular techniques, such as microarrays, RT-PCR, and in the construction of cDNA and RNA-seq data.
[Variation of polysaccharides and alcohol-soluble extracts content of Dendrobium officinale].
Yu, Qiao-xian; Guo, Ying-ying; Si, Jin-ping; Wu, Ling-shang; Wang, Lin-hua
2014-12-01
To reveal the variation of polysaccharides and alcohol-soluble extract contents of Dendrobium officinale, the polysaccharides and alcohol-soluble extracts contents of three D. officinale strains were determined by phenol-sulfuric acid method and hot-dip method, respectively. The results showed that the contents of polysaccharides and alcohol-soluble extracts and their total content were significantly different among D. officinale samples collected in different periods, and the variations were closely related to the phenology of D. officinale. Additionally, the quality variation of polysaccharides was closely related to the flowering of D. officinale, while the alcohol-soluble extracts was closely associated to the formation and germination of buds. According to the dynamic variation of these two compounds, it is more reasonable to harvest D. officinale at biennials pre-bloom than at specific harvesting month considering polysaccharides content. It is better to harvest before the germination of buds considering alcohol-soluble extracts. While with regards to both polysaccharides and alcohol-soluble extract, it is better to harvest this plant at the period from the sprouting to pre-bloom next year.
Directory of Open Access Journals (Sweden)
G. Kanagasabapathy
2013-01-01
Full Text Available Mushrooms have been used in folk medicine for thousands of years. In this study, the effect of β-glucan-rich extract of P. sajor-caju (GE on lipid lowering and antioxidant potential was assessed in C57BL/6J mice fed on a high-fat diet. Obesity was induced in C57BL/6J mice by feeding a high-fat diet. The control groups in this study were ND (for normal diet and HFD (for high-fat diet. The treated groups were ND240 (for normal diet (240 mg/kg b.w and HFD60, HFD120, and HFD240 (for high-fat diet, where the mice were administrated with three dosages of GE (60, 120, and 240 mg GE/kg b.w. Metformin (2 mg/kg b.w served as positive control. GE-treated groups showed significantly reduced body weight, serum lipid, and liver enzymes levels. GE also attenuated protein carbonyl and lipid hydroperoxide levels by increasing the enzymic antioxidants (SOD, CAT, and GPx activities in the mice. GE-treated groups induced the expression of hormone sensitive lipase (HSL and adipose triglyceride lipase (ATGL while downregulated the expression of peroxisome proliferator-activated receptor gamma (PPAR-γ, sterol regulatory binding protein-1c (SREBP-1c, and lipoprotein lipase (LPL. Hence, GE prevented weight gain in the mice by inducing lipolysis and may be valuable in the formulation of adjuvant therapy for obesity.
Yin, Xiulian; You, Qinghong; Jiang, Zhonghai; Zhou, Xinghai
2016-02-01
Ultrasonic-microwave synergistic extraction (UMSE) of polysaccharides from Cornus officinalis was optimized by response surface methodology (RSM). The effect of four different factors on the yield of C. officinalis polysaccharides (COP) was studied. RSM results showed that the optimal conditions were extraction time of 31.49823 min, microwave power of 99.39769 W, and water-to-raw material ratio of 28.16273. The COP yield was 11.38±0.31% using the modified optimal conditions, which was consistent with the value predicted by the model. The crude COP was purified by DEAE-Cellulose 52 chromatography and Sephadex G-100 chromatography. Five fractions, namely, crude COP, COP-1, COP-2, COP-3, and COP-4, were obtained. Monosaccharide composition analysis revealed that the COP was composed of glucose, arabinose, fucose, xylose, mannose, and rhamnose. Preliminary structural characterizations of COP were conducted by scanning electron microscopy and Fourier transform infrared spectroscopy. Copyright © 2015 Elsevier B.V. All rights reserved.
Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Optimized extraction of polysaccharides from Cymbopogon citratus and its biological activities.
Thangam, Ramar; Suresh, Veeraperumal; Kannan, Soundarapandian
2014-04-01
In this study the extraction of hot water soluble polysaccharides (HWSPs) from Cymbopogon citratus using hot water decoction was discussed. Response surface methodology (RSM) based on a three level, three variable central composite rotatable design (CCRD), was employed to obtain best possible combination of extraction time (X1: 30-180 min), extraction temperature (X2: 70-100 °C) and water to the raw material ratio (X3: 10-60) for maximum HWSPs extraction. The optimum extraction conditions were as follows: extraction time was around 113.81 min, extraction temperature at 99.66 °C and the ratio of water to raw material was 33.11 g/mL. Under these conditions, the experimental yield was 13.24±0.23%, which is well in close agreement with the value predicted by RSM model yield (13.19%). The basic characterization of HWSPs was determined by using the FTIR. These preliminary in vitro biological studies indicated that lemongrass polysaccharides were useful for anticancer therapy. Copyright © 2014 Elsevier B.V. All rights reserved.
Structural Features and Healthy Properties of Polysaccharides Occurring in Mushrooms
Directory of Open Access Journals (Sweden)
Eva Guillamón
2012-12-01
Full Text Available Polysaccharides from mushrooms have attracted a great deal of attention due to the many healthy benefits they have demonstrated, such as immunomodulation, anticancer activity, prevention and treatment of cardiovascular diseases, antiviral and antimicrobial effects, among others. Isolation and purification of polysaccharides commonly involve several steps, and different techniques are actually available in order to increase extraction yield and purity. Studies have demonstrated that the molecular structure and arrangement significantly influence the biological activity; therefore, there is a wide range of analytical techniques for the elucidation of chemical structures. Different polysaccharides have been isolated from mushrooms, most of them consisting of β-linked glucans, such as lentinan from Lentinus edodes, pleuran from Pleurotus species, schizophyllan from Schizophyllum commune, calocyban from Calocybe indica, or ganoderan and ganopoly from Ganoderma lucidum. This article reviews the main methods of polysaccharide isolation and structural characterization, as well as some of the most important polysaccharides isolated from mushrooms and the healthy benefits they provide.
Extraction optimization and characterization of polysaccharide ...
African Journals Online (AJOL)
Purpose: To investigate the optimum extraction conditions of polysaccharides from Pinellia Rhizoma (PRP) and their antioxidant activities. Methods: Response surface methodology (RSM) was applied to optimize the water extraction conditions of PRP by Box-Benhnken design (BBD). A high performance liquid ...
Xylose-rich polysaccharides from the primary walls of embryogenic cell line of Pinus caribaea.
Mollard, A; Domon, J M; David, H; Joseleau, J P
1997-08-01
Embryogenic cell lines of Pinus caribaea were isolated from somatic embryogenesis from zygotic embryos. Previous studies showed that the proteins and glycoproteins were characteristic of the embryogenic state. In the present work we were seeking typical feature in the polysaccharide from the cell walls of embryogenic calli at nine days of culture. Sequential extraction with water, ammonium oxalate, dimethyl sulfoxide, sodium borohydride and 4.3 M potassium hydroxide revealed that the extracted polysaccharides contained high proportions of arabinose and significant amounts of xylose. Fractionation of the hydrosoluble polymers on DEAE cellulose afforded a xylose-rich fraction (80% xylose, 24% glucose and lower properties of fucose and mannose). Methylation analysis and 13C-NMR spectra showed that the glycan backbone consisted of beta 1 --> 4 linked xylosyl residues Similar study of the fractions extracted respectively with DMSO and 4.3 M KOH showed the presence of polydisperse glycoxylans but excluded the presence of xyloglucan in significant amount. This could be a characteristic feature of embryogenic cells walls of Pinus caribaea or could be typical of cells grown as calluses. In the various fractions obtained from DEAE cellulose chromatography of the alkaline extract the infrequent occurrence of fucoxylans beside an arabinogalactan showed again the unusual nature of the cell wall polymers of this embryogenic lines, which seems to differ greatly from those found in the primary wall of cells from suspension cultures.
Directory of Open Access Journals (Sweden)
Sri Puji Astuti Wahyuningsih
2016-03-01
Full Text Available Mycobacterium tuberculosis is a major infection agent of tuberculosis that is controlled by the response of cell-mediated immunity. It is macrophages and cytolytic T lymphocytes. Activated macrophages will produce free radicals. Excessive free radicals cause tissue damage. Polysaccharide krestin contains β-glucan. It is a scavenger of free radicals. This research aimed to identify the influence of polysaccharide krestin from C. versicolor on nitrite and malondialdehyde concentrations of mice serum exposed by M. tuberculosis. Nitrite concentration was determined by nitrite assay. Malondialdehyde concentration was determined by TBARS assay. The result showed that adding polysaccharide krestin before exposure (P1 and adding polysaccharide krestin before-after exposure (P3 had the best potential to decrease nitrite concentration. Nitrite concentrations of P1 and P3 were 1.364 ± 0.523 M and 1.456 ± 0.712 M respectively. Meanwhile, P1 group and adding polysaccharide krestin after exposure (P2 had the best potential to decrease malondialdehyde concentration. Malondialdehyde concentrations of P1 and P2 were 1125.86 ± 97.96 µM and 953.86 ± 328.16 µM respectively. Their nitrite and malondialdehyde concentrations decreased, compared to K and K- groups. The research conclusion was that adding polysaccharide krestin before exposure could decrease both nitrite and malondialdehyde concentrations.How to CiteWahyuningsih, S., Pramudya, M., & Sugiharto, S. (2016. Influence of Polysaccharide Krestin from Coriolus versicolor Extract on Nitrite and Malondialdehyde Concencentrations of Mus musculus Serum Exposed by Mycobacterium tuberculosis. Biosaintifika: Journal of Biology & Biology Education, 8(1, 12-17.
Romdhane, Molka Ben; Haddar, Anissa; Ghazala, Imen; Jeddou, Khawla Ben; Helbert, Claire Boisset; Ellouz-Chaabouni, Semia
2017-02-01
In the present work, optimization of hot water extraction, structural characteristics, functional properties, and biological activities of polysaccharides extracted from watermelon rinds (WMRP) were investigated. The physicochemical characteristics and the monosaccharide composition of these polysaccharides were then determined using chemical composition analysis, Fourier transform infrared (FT-IR) spectroscopy, scanning electron microscopy (SEM) and gas chromatography-flame ionization detection (GC-FID). SEM images showed that extracted polysaccharides had a rough surface with many cavities. GC-FID results proved that galactose was the dominant sugar in the extracted polysaccharides, followed by arabinose, glucose, galacturonic acid, rhamnose, mannose, xylose and traces of glucuronic acid. The findings revealed that WMRP displayed excellent antihypertensive and antioxidant activities. Those polysaccharides had also a protection effect against hydroxyl radical-induced DNA damage. Functional properties of extracted polysaccharides were also evaluated. WMRP showed good interfacial dose-dependent proprieties. Overall, the results suggested that WMRP presents a promising natural source of antioxidants and antihypertensive agents. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Leqin KE
2016-01-01
Full Text Available Abstract Crude polysaccharides of Lentinus edodes were extracted using homogenate method. Factors affecting the yield of crude polysaccharides were investigated and optimized by response surface methodology. The homogenate extraction method was compared with traditional heating extraction method. The antioxidant activity of crude polysaccharides from Lentinus edodes was evaluated. Results showed that, the optimal conditions of homogenate extraction were as follows: solvent pH, 10; liquid-solid ratio, 30: 1 (mL: g, extraction time, 66 s; number of extraction, 1. Under these conditions, the yield of crude polysaccharides was (13.2 ± 0.9%, which was 29.82% higher than that of traditional heating extraction. Crude polysaccharides of Lentinus edodes had good DPPH scavenging activity. Compared with the traditional heating extraction, the homogenate extraction had notable advantages including good extraction yield, short extraction time and low extraction temperature. It is an efficient way to extract crude polysaccharides from Lentinus edodes.
Zheng, Quan; Ren, Daoyuan; Yang, Nana; Yang, Xingbin
2016-10-01
Artemisia sphaerocephala Krasch seeds polysaccharides have been reported to have a variety of important biological activities. However, effective extraction of Artemisia sphaerocephala Krasch seeds polysaccharides is still an unsolved issue. In this study, the orthogonal rotatable central composite design was employed to optimize ultrasound-assisted extraction conditions of Artemisia sphaerocephala Krasch seeds polysaccharides. Based on a single-factor analysis method, ultrasonic power, extraction time, solid-liquid ratio and extraction temperature were shown to significantly affect the yield of polysaccharides extracted from the A. sphaerocephala Krasch seeds. The optimal conditions for extraction of Artemisia sphaerocephala Krasch seeds polysaccharides were determined as following: ultrasonic power 243W, extraction time 125min, solid-liquid ratio 64:1 and extraction temperature 64°C, where the experimental yield was 14.78%, which was well matched with the predicted value of 14.81%. Furthermore, ASKP was identified as a typical heteropolysaccharide with d-galacturonic acid (38.8%) d-galactose (20.2%) and d-xylose (15.5%) being the main constitutive monosaccharides. Moreover, Artemisia sphaerocephala Krasch seeds polysaccharides exhibited high total reducing power and considerable scavenging activities on DPPH, hydroxyl and superoxide radicals, in a concentration-dependent manner in vitro. Copyright © 2016 Elsevier B.V. All rights reserved.
Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast
Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans
2007-01-01
The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential
Characterization of EDTA-soluble polysaccharides from the scape of Musa paradisiaca (banana).
Raju, T S; Jagadish, R L; Anjaneyalu, Y V
2001-02-01
The polysaccharide components present in the scape of Musa paradisiaca (banana) were fractionated into water-soluble (WSP), EDTA-soluble (EDTA-SP), alkali-soluble (ASP) and alkali-insoluble (AISP) polysaccharide fractions [Anjaneyalu, Jagadish and Raju (1997) Glycoconj. J. 14, 507-512]. The EDTA-SP was further fractionated by iso-amyl alcohol into EDTA-SP-A and EDTA-SP-B. The homogeneity of these two polysaccharides was established by repeated precipitation with iso-amyl alcohol, gel-filtration chromatography and sedimentation analysis. The polysaccharides were characterized by monosaccharide composition analysis, methylation linkage analysis, iodine affinity, ferricyanide number, blue value, hydrolysis with alpha-amylase, gold-electron microscopy and X-ray diffraction spectroscopy. Data from all of these studies suggest that EDTA-SP-A is a branched amylose-type alpha-D-glucan and that EDTA-SP-B is a highly branched amylopectin-type polymer. The nature of the branching patterns of these polysaccharides suggests that they are unique to M. paradisiaca.
Extraction optimization and characterization of polysaccharide ...
African Journals Online (AJOL)
Keywords: Pinellia rhizoma, Polysaccharides Optimization extraction, Monosaccharide composition,. Antioxidant ..... mean yield of PRP was 2.47 %. Therefore ... Table 3: Analysis of variance (ANOVA) for the fitted quadratic polynomial model.
Immunostimulatory properties and antitumor activities of glucans (Review)
Czech Academy of Sciences Publication Activity Database
Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.
2013-01-01
Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013
Directory of Open Access Journals (Sweden)
AHMAD THONTOWI
2007-10-01
Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.
Bera, K; Nosalova, G; Sivova, V; Ray, B
2016-01-01
Zingiber officinale is used for the management of fever, bronchial asthma and cough for thousands of years. While the link to a particular indication has been established in human, the active principle of the formulation remains unknown. Herein, we have investigated a water extracted polysaccharides (WEP) containing fraction from its rhizome. Utilizing a traditional aqueous extraction protocol and using chemical, chromatographic and spectroscopic methods a fraction containing a branched glucan and polygalaturonan in a ratio of 59:1 was characterized. This glucan, which has a molecular mass of 36 kDa, is made up of terminal-, (1,4)- and (1,4,6)-linked α-Glcp residues. Oral administration of WEP in doses of 25 and 50 mg/kg body weight significantly inhibited the number of citric acid-induced cough efforts in guinea pigs. It does not alter the specific airway smooth muscle reactivity significantly. Thus, traditional aqueous extraction method provides molecular entities, which induces antitussive activity without addiction. Copyright © 2015 John Wiley & Sons, Ltd.
β-Glucans and Resistant Starch Alter the Fermentation of Recalcitrant Fibers in Growing Pigs.
Directory of Open Access Journals (Sweden)
Sonja de Vries
Full Text Available Interactions among dietary ingredients are often assumed non-existent when evaluating the nutritive value and health effects of dietary fiber. Specific fibers can distinctly affect digestive processes; therefore, digestibility and fermentability of the complete diet may depend on fiber types present. This study aimed to evaluate the effects of readily fermentable fibers (β-glucans and resistant starch on the degradation of feed ingredients containing more persistent, recalcitrant, fibers. Six semi-synthetic diets with recalcitrant fibers from rapeseed meal (pectic polysaccharides, xyloglucans, and cellulose or corn distillers dried grain with solubles (DDGS; (glucuronoarabinoxylans and cellulose with or without inclusion of β-glucans (6% or retrograded tapioca (40% substituted for corn starch were formulated. Six ileal-cannulated pigs (BW 28±1.4 kg were assigned to the diets according to a 6×6 Latin square. β-glucan-extract increased apparent total tract digestibility (ATTD of non-glucosyl polysaccharides (accounting for ~40% of the fiber-fraction from rapeseed meal (6%-units, P10%-units, P<0.001, indicating that the large amount of resistant starch entering the hindgut was preferentially degraded over recalcitrant fibers from rapeseed meal and DDGS, possibly related to reduced hindgut-retention time following the increased intestinal bulk. Fermentation of fiber sources was not only dependent on fiber characteristics, but also on the presence of other fibers in the diet. Hence, interactions in the gastrointestinal tract among fibrous feed ingredients should be considered when evaluating their nutritive value.
de Jesus, Liana Inara; Smiderle, Fhernanda R; Ruthes, Andrea C; Vilaplana, Francisco; Dal'Lin, Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Van Griensven, Leo J L D; Iacomini, Marcello
2017-12-20
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle laser light scattering, showing a polysaccharide with an average molecular weight of 2.5 × 10 5 Da with a random coil conformation for molecular weights below 1 × 10 6 Da. Typical signals of β-(1 → 3)-linkages were observed in NMR spectrum (δ 102.7/4.76; 102.8/4.74; 102.9/4.52; and δ 85.1/3.78; 85.0/3.77) and also signals of O-6 substitution at δ 69.2/4.22 and 69.2/3.87. The analysis of partially O-methylated alditol acetates corroborates the NMR results, indicating the presence of a β-D-glucan with a main chain (1 → 3)-linked, substituted at O-6 by single-units of glucose. The β-D-glucan showed no toxicity on human colon carcinoma cell line (Caco-2) up to 1000 μg mL -1 and promoted cell migration on in vitro scratch assay, demonstrating a potential wound healing capacity. Copyright © 2017. Published by Elsevier B.V.
A pH-responsive carboxylic β-1,3-glucan polysaccharide for complexation with polymeric guests.
Lien, Le Thi Ngoc; Shiraki, Tomohiro; Dawn, Arnab; Tsuchiya, Youichi; Tokunaga, Daisuke; Tamaru, Shun-ichi; Enomoto, Naoya; Hojo, Junichi; Shinkai, Seiji
2011-06-07
The helix-forming nature of β-1,3-glucan polysaccharides is a characteristic that has potential for producing gene carriers, bio-nanomaterials and other chiral nanowires. Herein, carboxylic curdlan (CurCOOH) bearing the β-1,3-polyglucuronic acid structure was successfully prepared from β-1,3-glucan polysaccharide curdlan (Cur) by one-step oxidation using a 4-acetamido-TEMPO/NaClO/NaClO(2) system as the oxidant. The resulting high-molecular-weight CurCOOH was proved to bear the 6-COOH group in 100% purity. The optical rotatory dispersion (ORD) spectra indicated that the obtained CurCOOH behaves as a water-soluble single-strand in various pH aqueous media. This advantage has allowed us to use CurCOOH as a polymeric host to form various macromolecular complexes. For example, complexation of CurCOOH with single-walled carbon nanotubes (SWNTs) resulted in a water-soluble one-dimensional architecture, which formed a dispersion in aqueous solution that was stable for several months, and much more stable than SWNTs complexes of the similar negatively-charged polyacrylic acid (PAA) and polymethacrylic acid (PMAA). It was shown that in the complex, SWNTs are effectively wrapped by a small amount of CurCOOH, enabling them to avoid electrostatic repulsion. This pH-responsive CurCOOH formed a very stable complex with cationic water-soluble polythiophenes (PT-1), which was stabilized not only by the hydrophobic interaction but also by the electrostatic attraction between trimethylammonium cations in PT-1 and dissociated anionic COO(-) groups in CurCOOH. The included PT-1 became CD-active only in the neutral to basic pH region, and the positive Cotton effect suggested that the conjugated main chain is twisted in the right-handed direction. We also found that CurCOOH can interact with polycytidylic acid (poly(C)) only under high NaCl concentrations, the binding and release of which could be controlled by a change in the salt concentration. We believe, therefore, that Cur
International Nuclear Information System (INIS)
Cai, C.; Yang, Y.; Zhao, M.; Jia, R.; He, P.
2017-01-01
This paper deals with the preparation and antioxidation of polysaccharide from Porphyra haitanensis. The ratio of water to raw material, extraction temperature and extraction time were taken in sequence as independent variables in single factor test, and polysaccharide yield as response value. Using Box-Benhnken central combination experimental design principles and response surface methodology, interactions of variables and their influence on polysaccharide yield of P. haitanensis were studied and the prediction model of quadratic polynomial regression equation was inferred by simulation, in which the optimum parameters for preparing polysaccharide from P. haitanensis were 88.4°C of extraction temperature, 1.97 h of extraction time and 40:1 (ml/g) of ratio of water to raw material, and polysaccharide of 15.19 % in yield from P. haitanensis was verified after two parallel test. Furthermore, the polysaccharide of P. haitanensis showed good antioxidant capacity which could be used as potential natural antioxidant products in food additives industries. (author)
Wang, Yun; Hu, Xiaowei; Han, Juan; Ni, Liang; Tang, Xu; Hu, Yutao; Chen, Tong
2016-03-01
A polymer-salt aqueous two-phase system (ATPS) consisting of thermosensitive copolymer ethylene-oxide-b-propylene-oxide-b-ethylene-oxide (EOPOEO) and NaH2PO4 was employed in deproteinization for lycium barbarum polysaccharide (LBP). The effects of salt type and concentration, EOPOEO concentration, amount of crude LBP solution and temperature were studied. In the primary extraction process, LBP was preferentially partitioned to the bottom (salt-rich) phase with high recovery ratio of 96.3%, while 94.4% of impurity protein was removed to the top (EOPOEO-rich) phase. Moreover, the majority of pigments could be discarded to top phase. After phase-separation, the LBP in the bottom phase was further purified by dialysis membrane to remove salt and other small molecular impurities. The purity of LBP was enhanced to 64%. Additionally, the FT-IR spectrum was used to identify LBP. EOPOEO was recovered by a temperature-induced separation, and reused in a new ATPS. An ideal extraction and recycle result were achieved. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Schmidt, W.E.; Ebel, J.
1987-01-01
Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay
Chen, Yun; Yao, Fangke; Ming, Ke; Wang, Deyun; Hu, Yuanliang; Liu, Jiaguo
2016-12-13
Traditional Chinese Medicine (TCM) has been used to treat diseases in China for thousands of years. TCM compositions are complex, using as their various sources plants, animals, fungi, and minerals. Polysaccharides are one of the active and important ingredients of TCMs. Polysaccharides from TCMs exhibit a wide range of biological activities in terms of immunity- modifying, antiviral, anti-inflammatory, anti-oxidative, and anti-tumor properties. With their widespread biological activities, polysaccharides consistently attract scientist's interests, and the studies often concentrate on the extraction, purification, and biological activity of TCM polysaccharides. Currently, numerous studies have shown that the modification of polysaccharides can heighten or change the biological activities, which is a new angle of polysaccharide research. This review highlights the current knowledge of TCM polysaccharides, including their extraction, purification, modification, and biological activity, which will hopefully provide profound insights facilitating further research and development.
Directory of Open Access Journals (Sweden)
Yun Chen
2016-12-01
Full Text Available Traditional Chinese Medicine (TCM has been used to treat diseases in China for thousands of years. TCM compositions are complex, using as their various sources plants, animals, fungi, and minerals. Polysaccharides are one of the active and important ingredients of TCMs. Polysaccharides from TCMs exhibit a wide range of biological activities in terms of immunity- modifying, antiviral, anti-inflammatory, anti-oxidative, and anti-tumor properties. With their widespread biological activities, polysaccharides consistently attract scientist's interests, and the studies often concentrate on the extraction, purification, and biological activity of TCM polysaccharides. Currently, numerous studies have shown that the modification of polysaccharides can heighten or change the biological activities, which is a new angle of polysaccharide research. This review highlights the current knowledge of TCM polysaccharides, including their extraction, purification, modification, and biological activity, which will hopefully provide profound insights facilitating further research and development.
Alhudhud, M; Sadiq, S; Ngo, H N; Hidalgo-Cantabrana, C; Ruas-Madiedo, P; van Sinderen, D; Humphreys, P N; Laws, A P
2018-04-26
Three strains of Bifidobacterium breve (JCM 7017, JCM 7019 and JCM 2258) and two strains of Bifidobacterium animalis subsp. lactis (AD011 and A1dOxR) were grown in broth cultures or on plates, and a standard exopolysaccharide extraction method was used in an attempt to recover exocellular polysaccharides. When the extracted materials were analysed by NMR it was clear that mixtures of polysaccharides were being isolated including exopolysaccharides (EPS) cell wall polysaccharides and intracellular polysaccharides. Treatment of the cell biomass from the B. breve strains, or the B. animalis subsp. lactis AD011 strain, with aqueous sodium hydroxide provided a very similar mixture of polysaccharides but without the EPS. The different polysaccharides were partially fractionated by selective precipitation from an aqueous solution upon the addition of increasing percentages of ethanol. The polysaccharides extracted from B. breve JCM 7017 grown in HBM media supplemented with glucose (or isotopically labelled D-glucose-1- 13 C) were characterised using 1D and 2D-NMR spectroscopy. Addition of one volume of ethanol generated a medium molecular weight glycogen (Mw=1×10 5 Da, yield 200 mg/l). The addition of two volumes of ethanol precipitated an intimate mixture of a low molecular weight β-(1→6)-glucan and a low molecular weight β-(1→6)-galactofuranan which could not be separated (combined yield 46 mg/l). When labelled D-glucose-1- 13 C was used as a carbon supplement, the label was incorporated into >95% of the anomeric carbons of each polysaccharide confirming they were being synthesised in situ. Similar 1 H NMR profiles were obtained for polysaccharides recovered from the cells of B. animalis subsp. lactis AD011and A1dOxR (in combination with an EPS), B. breve JCM 7017, B. breve JCM 7019, B. breve JCM 2258 and from an EPS (-ve) mutant of B. breve 7017 (a non-EPS producer).
The hypobranchial mucin of the whelk Buccinum undatum L. The polysaccharide sulphate component.
Hunt, S; Jevons, F R
1966-02-01
1. A polysaccharide sulphate has been isolated from the hypobranchial mucin of the whelk Buccinum undatum. 2. The molecular weight of this polysaccharide, which is a glucan carrying one ester sulphate group per monosaccharide residue, is 1.7x10(5). 3. Some investigations bearing on the location of the ester sulphate groups are reported. 4. The viscosity of the whole mucin has been shown to depend mainly on the glucan sulphate.
Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi
Directory of Open Access Journals (Sweden)
Akira Yoshimi
2017-11-01
Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.
Mekoue Nguela, Julie; Poncet-Legrand, Celine; Sieczkowski, N.; Vernhet, Aude
2016-01-01
At present, there is a great interest in enology for yeast derived products to replace aging on lees in winemaking or as an alternative for wine fining. These are yeast protein extracts (YPE), cell walls and mannoproteins. Our aim was to further understand the mechanisms that drive interactions between these components and red wine polyphenols. To this end, interactions between grape skin tannins or wine polyphenols or tannins and a YPE, a mannoprotein fraction and a β-glucan were monitored b...
He, Jinzhe; Xu, Yaoyang; Chen, Hongbo; Sun, Peilong
2016-01-01
Four seaweed polysaccharides were extracted from Sarcodia ceylonensis, Ulva lactuca L., Gracilaria lemaneiformis, and Durvillaea antarctica, respectively, by microwave-assisted extraction. The effect of three significant variables (extraction time, extraction temperature, and the ratio of water to raw material) on the process for extracting polysaccharides was investigated, along with the optimization of the extraction using the response surface method (RSM) with a Box–Behnken design. The polysaccharide structure, monosaccharide composition, degree of sulfation, and molecular weight (MW) distribution were analyzed by infrared (IR) spectrometry, gas chromatography (GC), and high-performance gel permeation chromatography (HPGPC). IR spectrometry showed that Sarcodia ceylonensis polysaccharide (SCP), Ulva lactuca L. polysaccharide (ULLP), and Durvillaea antarctica polysaccharide (DAP) were all sulfated polysaccharides and, except Gracilaria lemaneiformis polysaccharide (GLP), all belong to β-pyranosidic polysaccharides. The average molecular weight (MW) of SCP, ULLP, GLP, and DAP was 466, 404, 591, and 482 kDa, respectively. The quantitative and comparative results with external standards indicated that the main monosaccharide in SCP and ULLP was mannose; and GLP and DAP were mainly composed of galactose and glucose, respectively. Then the in vitro antioxidant activity of all of the polysaccharides was evaluated using different assays—2,2–azino –bis (3-ethylbenzthiazoline-6- sulfonate) (ABTS), hydroxyl radical, nitrite scavenging capacity, and reducing power—and the relationship between their antioxidant activity and chemical characteristics were also examined. ULLP presented the highest ABTS radical scavenging activity; ULLP, SCP and DAP also showed a strong effect on the ABTS radical scavenging activity. SCP and ULLP exhibited excellent hydroxyl radical scavenging activities, about 83.33% ± 2.31% and 80.07% ± 2.17%, respectively, at 4 mg/mL. The
Directory of Open Access Journals (Sweden)
Jinzhe He
2016-11-01
Full Text Available Four seaweed polysaccharides were extracted from Sarcodia ceylonensis, Ulva lactuca L., Gracilaria lemaneiformis, and Durvillaea antarctica, respectively, by microwave-assisted extraction. The effect of three significant variables (extraction time, extraction temperature, and the ratio of water to raw material on the process for extracting polysaccharides was investigated, along with the optimization of the extraction using the response surface method (RSM with a Box–Behnken design. The polysaccharide structure, monosaccharide composition, degree of sulfation, and molecular weight (MW distribution were analyzed by infrared (IR spectrometry, gas chromatography (GC, and high-performance gel permeation chromatography (HPGPC. IR spectrometry showed that Sarcodia ceylonensis polysaccharide (SCP, Ulva lactuca L. polysaccharide (ULLP, and Durvillaea antarctica polysaccharide (DAP were all sulfated polysaccharides and, except Gracilaria lemaneiformis polysaccharide (GLP, all belong to β-pyranosidic polysaccharides. The average molecular weight (MW of SCP, ULLP, GLP, and DAP was 466, 404, 591, and 482 kDa, respectively. The quantitative and comparative results with external standards indicated that the main monosaccharide in SCP and ULLP was mannose; and GLP and DAP were mainly composed of galactose and glucose, respectively. Then the in vitro antioxidant activity of all of the polysaccharides was evaluated using different assays—2,2–azino –bis (3-ethylbenzthiazoline-6- sulfonate (ABTS, hydroxyl radical, nitrite scavenging capacity, and reducing power—and the relationship between their antioxidant activity and chemical characteristics were also examined. ULLP presented the highest ABTS radical scavenging activity; ULLP, SCP and DAP also showed a strong effect on the ABTS radical scavenging activity. SCP and ULLP exhibited excellent hydroxyl radical scavenging activities, about 83.33% ± 2.31% and 80.07% ± 2.17%, respectively, at 4 mg/mL. The
Yuan, Qingxia; Xie, Yufeng; Wang, Wei; Yan, Yuhua; Ye, Hong; Jabbar, Saqib; Zeng, Xiaoxiong
2015-09-05
Extraction optimization, characterization and antioxidant activity in vitro of polysaccharides from mulberry leaves (MLP) were investigated in the present study. The optimal extraction conditions with an extraction yield of 10.0 ± 0.5% for MLP were determined as follows: extraction temperature 92 °C, extraction time 3.5h and ratio (v/w, mL/g) of extraction solvent (water) to raw material 34. Two purified fractions, MLP-3a and MLP-3b with molecular weights of 80.99 and 3.64 kDa, respectively, were obtained from crude MLP by chromatography of DEAE-Cellulose 52 and Sephadex G-100. Fourier transform-infrared spectroscopy revealed that crude MLP, MLP-3a and MLP-3b were acidic polysaccharides. Furthermore, crude MLP and MLP-3a had more complicated monosaccharide compositions, while MLP-3b had a relatively higher content of uronic acid. Crude MLP, MLP-3a and MLP-3b exhibited potent Fe(2+) chelating power and scavenging activities on 1,1-diphenyl-2-picrylhydrazyl, hydroxyl, superoxide and 2,2'-azinobis-(3-ethyl-benzothiazolin-6-sulfonic acid) radicals. The results suggested that MLP could be explored as natural antioxidant. Copyright © 2015 Elsevier Ltd. All rights reserved.
Zhang, Xiao-Ling; Liu, Jing-Jing; Wu, Ling-Shang; Si, Jin-Ping; Guo, Ying-Ying; Yu, Jie; Wang, Lin-Hua
2013-11-01
Using phenol-sulfuric acid method and hot-dip method of alcohol-soluble extracts, the contents of polysaccharides and alcohol-soluble extracts in 11 F1 generations of Dendrobium officinale were determined. The results showed that the polysaccharides contents in samples collected in May and February were 32.89%-43.07% and 25.77%-35.25%, respectively, while the extracts contents were 2.81%-4.85% and 7.90%-17.40%, respectively. They were significantly different among families. The content of polysaccharides in offspring could be significantly improved by hybridization between parents with low and high polysaccharides contents, and the hybrid vigor was obvious. Cross breeding was an effective way for breeding new varieties with higher polysaccharides contents. Harvest time would significantly affect the contents of polysaccharides and alcohol-soluble extracts. The contents of polysaccharides in families collected in May were higher than those of polysaccharides in families collected in February, but the extracts content had the opposite variation. The extents of quantitative variation of polysaccharides and alcohol-soluble extracts were different among families, and each family had its own rules. It would be significant in giving full play to their role as the excellent varieties and increasing effectiveness by studying on the quantitative accumulation regularity of polysaccharides and alcohol-soluble extracts in superior families (varieties) of D. officinale to determine the best harvesting time.
Optimization of polysaccharides extracted from Verbena officinalis L ...
African Journals Online (AJOL)
Purpose: To investigate polysaccharides (PEV) extracted from the aerial part of Verbena officinalis L. and their inhibitory effects on the invasion and metastasis of colorectal cancer (CRC) cells. Methods: PEV was extracted by water and the optimization of extraction conditions was performed using a Box-Benhnken design ...
Antidiabetic activity of aqueous extract and non polysaccharide fraction of Cynodon dactylon Pers.
Jarald, E E; Joshi, S B; Jain, D C
2008-09-01
Petroleum ether (60 degrees-80 degrees C), chloroform, acetone, ethanol, aqueous and crude hot water extracts of the whole plant of C. dactylon and the two fractions of aqueous extract were tested for antihyperglycaemic activity in glucose overloaded hyperglycemic rats and in alloxan induced diabetic model at two-dose levels, 200 and 400 mg/kg (po) respectively. The aqueous extract of C. dactylon and the non polysaccharide fraction of aqueous extract were found to exhibit significant antihyperglycaemic activity and only the non polysaccharide fraction was found to produce hypoglycemia in fasted normal rats. Treatment of diabetic rats with aqueous extract and non polysaccharide fraction of the plant decreased the elevated biochemical parameters, glucose, urea, creatinine, serum cholesterol, serum triglyceride, high density lipoprotein, low density lipoprotein, haemoglobin and glycosylated haemoglobin significantly. Comparatively, the non polysaccharide fraction of aqueous extract was found to be more effective than the aqueous extract.
Cheng, Zhenyu; Zhang, Yuewei; Song, Haiyan; Zhou, Hongli; Zhong, Fangli; Hu, Haobin; Feng, Yu
2016-12-01
In this study, optimization of smashing tissue extraction (STE), preliminary chemical characterization and antioxidant activity in vitro of crude polysaccharides (CPS) from Gentiana scabra bge (G. scabra) were investigated. The optimal extraction conditions were determined as follows: sample particle size of 80mesh, solid/liquid ratio of 1:34, extraction voltage of 157.09V and extraction time of 130.38s. Under these conditions, the extraction yield of CPS had reached 15.03±0.14% (n=3). Chemical composition analysis indicated CPS was mainly composed of mannose, rhamnose, galacturonic acid, glcose, galactose, arabinose and fucose in a molar ratio of 1.00:9.89:51.59:35.37:38.06:99.13:21.34, respectively. The average molecular weight of CPS was estimated to be 3.8×10 4 Da. In addition, the potential antioxidant activity of CPS extracted by STE were demonstrated by DPPH radical scavenging assay, superoxide anion radical scavenging assay, hydroxyl radical scavenging assay and ferric reducing power assay. Overall, this study provided an effective extraction technique for G. scabra polysaccharides which would be explored as a promising natural antioxidant agent applied in functional foods or medicines. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhu, Yang; Li, Qian; Mao, Guanghua; Zou, Ye; Feng, Weiwei; Zheng, Daheng; Wang, Wei; Zhou, Lulu; Zhang, Tianxiu; Yang, Jun; Yang, Liuqing; Wu, Xiangyang
2014-01-30
The enzyme-assisted extraction (EAE) of polysaccharides from the fruits of Hericium erinaceus was studied. In this study, response surface methodology and the Box-Behnken design based on single-factor and orthogonal experiments were applied to optimize the EAE conditions. The optimal extraction conditions were as follows: a pH of 5.71, a temperature of 52.03°C and a time of 33.79 min. The optimal extraction conditions resulted in the highest H. erinaceus polysaccharides (HEP) yield, with a value 13.46 ± 0.37%, which represented an increase of 67.72% compared to hot water extraction (HWE). The polysaccharides were characterized by FT-IR, SEM, CD, AFM, and GC. The results showed that HEP was composed of mannose, glucose, xylose, and galactose in a molar ratio of 15.16:5.55:4.21:1. The functional groups of the H. erinaceus polysaccharides extracted by HWE and EAE were fundamentally identical but had apparent conformational changes. Copyright © 2013 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Tran, Huu Vinh
1983-01-01
After some considerations on the conformational analysis of polysaccharides, this research thesis outlines the interest of molecular mechanics as a method to study these components. Technical aspects are presented. The author reports the prediction of the conformations of some specific cyclic oligomers (glucans, glucore), the use of X-ray diffraction to study glucides (and the limitations of this method). He reports the search for another investigation method: relationships between X rays and molecular mechanics, situation with respect to other crystallographic methods, presentation of principle of the 'Packing' method, and applications. He reports the study of regular conformations of polysaccharides, the study of the statistic configuration of polymer chains and the application to alpha-glucans
Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.
Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza
2008-03-20
Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).
Laar, van H.; Tamminga, S.; Williams, B.A.; Verstegen, M.W.A.; Schols, H.A.
2002-01-01
Cell walls were extracted from maize endosperm and separated into different polysaccharide fractions by sequential extraction with solutions of saturated Ba(OH)2, demineralised water and 1 and 4 M KOH. Solubilised polysaccharides were collected after each extraction. Residues were collected
Towards a more versatile alpha-glucan biosynthesis in plants
Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.
2003-01-01
Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated
Miao, Xin-Pu; Sun, Xiao-Ning; Cui, Lu-Jia; Cao, Qin-Fang; Zhuang, Gui-Feng; Deng, Tao-Zhi; Zhang, Dong-Yan
2015-02-01
To investigate the effects of pectic polysaccharides extracted from Rauwolfia verticillata (Lour.) Baill.var.hainanensis Tsiang on an experimental murine colitis model. Experimental colitis was induced by dextran sulfate sodium (DSS), and mice were divided into 4 groups: control, DSS alone, DSS plus SASP, DSS plus pectic polysaccharides. The disease activity index (DAI) and histological score were observed. The tumor necrosis factor (TNF)- α and interleukin (IL)-17 levels were measured by enzyme-linked immunosorbent assay. I κ B and NF- κ B p65 expression were assessed by western blot analysis. Myeloperoxidase (MPO) activity was determined by using MPO assay kit. Administration of pectic polysaccharides significantly reduced the severity of DSS-induced colitis as assessed by DAI and histological score, and resulted in down regulation of MPO activity and NF- κ B p65 expression and subsequent degradation of I κ B protein, strikingly reduced the production of TNF- a and IL-17. Pectic polysaccharides extracted from Rauvolfia verticillata (Lour.)Baill.var. hainanensis Tsiang exerts beneficial effects in experimental colitis and may therefore provide a useful therapeutic approach for the treatment of UC. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder
2017-07-18
Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.
DEFF Research Database (Denmark)
Munck, L.; Møller, B.; Jacobsen, Susanne
2004-01-01
-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....
Shang, Hongmei; Zhou, Haizhu; Duan, Mengying; Li, Ran; Wu, Hongxin; Lou, Yujie
2018-06-01
This study was designed to investigate the extraction conditions of polysaccharides from comfrey (Symphytum officinale L.) root (CRPs) using response surface methodology (RSM). The effects of three variables including liquid-solid ratio, extraction time and extraction temperature on the extraction yield of CRPs were taken into consideration. Moreover, the effects of drying methods including hot air drying (HD), vacuum drying (VD) and freeze drying (FD) on the physicochemical properties and antioxidant activities of CRPs were evaluated. The optimal conditions to extract the polysaccharides were as follows: liquid-solid ratio (15mL/g), extraction time (74min), and extraction temperature (95°C), allowed a maximum polysaccharides yield of 22.87%. Different drying methods had significant effects on the physicochemical properties of CRPs such as the chemical composition (contents of total polysaccharides and uronic acid), relative viscosity, solubility and molecular weight. CRPs drying with FD method showed stronger reducing power and radical scavenging capacities against DPPH and ABTS radicals compared with CRPs drying with HD and VD methods. Therefore, freeze drying served as a good method for keeping the antioxidant activities of polysaccharides from comfrey root. Copyright © 2018 Elsevier B.V. All rights reserved.
Mzoughi, Zeineb; Chakroun, Ibtissem; Hamida, Sarra Ben; Rihouey, Christophe; Mansour, Hedi Ben; Le Cerf, Didier; Majdoub, Hatem
2017-12-01
The isolation, purification and ozone depolymerization of polysaccharides from Arthrocnemum indicum as well as the evaluation of their antiproliferative capacities were investigated. The ozone treatment for various reaction times (0, 15, 30, 45 and 60min) was employed as degradation method in order to attain lower molecular weight product with stronger antiproliferative property. According to FTIR, 1 H NMR and UV-vis analysis, the main chain of ozonolytic degraded polysaccharides could be preserved. The monosaccharide composition, which was determined via GC/MS analysis, showed that extracted polysaccharides were of type of arabinan-rich pectic polysaccharides. Macromolecular characteristics as well as intrinsic viscosity of the degraded polysaccharides were performed by size exclusion chromatography before and after ozone treatment. These experiments showed that intrinsic viscosity and molecular weight (Mn and Mw) of degraded samples decreased with increase in reaction time. Furthermore, preliminary antiproliferative tests indicated that degraded polysaccharide for 1h showed even better antiproliferative capacity. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Chiraphon Chaikliang
2015-11-01
Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of
[Extraction and content determination of polysaccharides in Viscum coloratum].
Wang, Jun; Zhu, Yi-fan
2007-11-01
To establish a method for extraction and content determination of polysaccharide in Viscum coloratum. Polysaccharide was extracted by hot water, separated by ultrafiltration and ion-exchange chromatography. The content determination was performed at wavelength 490 nm with phenol-sulfuric acid as a chtomo-genic agent. The content of polyaccharide in V. coloratum, CVPS-III, and CVPS-III-C were respectively 4.93% (RSD 1.04%, n = 3), 43.28% (RSD 1.39%, n =3), 69.55% (RSD 1.62%, n = 3), and the average recovery was 96.07% (RSD 2.54%, n = 5). The method was simple, rapid, and accurate.
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas
2012-01-01
Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...
ISOLATION AND CHARACTERIZATION OF SOLUBLE POLYSACCHARIDES FROM CALAMAGROSTIS ANGUSTIFOLIA KOM
Directory of Open Access Journals (Sweden)
Xue-Fei Cao
2011-06-01
Full Text Available Sequential treatments of dewaxed Calamagrostis angustifolia Kom with water (60 ºC and 90 ºC, 70% ethanol, and 70% ethanol containing 0.2%, 1.0%, 2.0%, 4.0%, and 8.0% NaOH at a solid to liquid ratio of 1:25 (g/mL at 80 ºC for 3 h yielded 36.2% soluble polysaccharides of the dry dewaxed material. The eight polysaccharide fractions obtained were comparatively studied by sugar analysis, GPC, FT-IR, 1H and 13C-NMR, and 2D-NMR (HSQC spectroscopy. The results showed that the water-soluble polysaccharides might contain noticeable amounts of β-D-glucan, as well as some pectic substances and galactoarabinoxylan. 70% ethanol-soluble polysaccharide was mainly arabinogalactan. The five alkali-soluble hemicelluloses were mainly galactoarabinoxylans. The Ara/Xyl and Ara/Gal values of H5-H8 fractions decreased with the increment of NaOH concentration from 1.0% to 8.0%. Meanwhile, the molecular weights had a declining trend from ~60,000 to ~40,000 g/mol. The smaller sized and more branched polysaccharides tended to be extracted in the early stages under milder conditions, and the larger molecular sized and more linear hemicelluloses tended to be isolated under more highly alkaline conditions.
DEFF Research Database (Denmark)
Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun
2005-01-01
Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...
Zhao, Chengcheng; Li, Xia; Miao, Jing; Jing, Songsong; Li, Xuejiao; Huang, Luqi; Gao, Wenyuan
2017-09-01
The rhizoma of Dioscorea hemsleyi (DH) has been used as a treatment of diabetes in China for hundreds of years. Polysaccharides in DH were extracted by using ultrasonic-assisted extraction (UAE), cold water extraction (CWE), warm water extraction (WWE) and hot water extraction (HWE), separately. Then the different characterizations of four DH polysaccharide (DHP) samples were analyzed by high-performance liquid chromatography (HPLC), high-performance Gel permeation chromatography (HGPC), ultraviolet-visible spectroscopy(UV), fourier transform-infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM). Their activities in vitro of DHP were compared. Experimental results showed that HWE had the highest yield and large molecular weight. CWE had the highest uronic acid yield and little molecular weight, and its DPPH, AGI and AAI activity were the best. The molecular weight of UAE was small, and its RP and FRAP activity were the best. Four DHP samples had differences in the surface topography, while they all had the typical IR spectra characteristic of polysaccharides. According the correlation analysis, it showed that the more uronic acid and the lower molecular weight was, the higher the antioxidant activity was. The high content of monosaccharide composition of Xyl, Ara, GlcA and GalA, and little molecular weight have good effect on antidiabetic activity. Copyright © 2017 Elsevier B.V. All rights reserved.
Popov, S V; Vinter, V G; Patova, O A; Markov, P A; Nikitina, I R; Ovodova, R G; Popova, G Yu; Shashkov, A S; Ovodov, Yu S
2007-07-01
The pectic polysaccharide named rauvolfian RS was obtained from the dried callus of Rauvolfia serpentina L. by extraction with 0.7% aqueous ammonium oxalate. Crude rauvolfian RS was purified using membrane ultrafiltration to yield the purified rauvolfian RSP in addition to glucan as admixture from the callus, with molecular weights 300 and 100-300 kD, respectively. A peroral pretreatment of mice with the crude and purified samples of rauvolfian (RS and RSP) was found to decrease colonic macroscopic scores, the total area of damage, and tissue myeloperoxidase activity in colons as compared with a colitis group. RS and RSP were shown to stimulate production of mucus by colons of the colitis mice. RSP appeared to be an active constituent of the parent RS. The glucan failed to possess anti-inflammatory activity.
Extraction, purification and anti-proliferative activities of polysaccharides from Lentinus edodes.
Zhao, Yong-Ming; Wang, Jin; Wu, Zhi-Gang; Yang, Jian-Ming; Li, Wei; Shen, Li-Xia
2016-12-01
In this study, the enzyme-assisted extraction of polysaccharides from Lentinus edodes (LEPs) was optimized by response surface methodology, and a preliminary characterization of the extracted LEPs and their anti-proliferative activities were investigated. An orthogonal assay was constructed to determine the optimal amounts of cellulase, papain and pectinase, which were 15, 20 and 15g/kg, respectively. Then effects of extraction conditions were evaluated and optimized using a Box-Behnken design. The results showed that the highest polysaccharides yield of 15.65% was achieved with an extraction temperature of 54°C, pH 5.0, enzymatic treatment time of 93min and a liquid/material ratio of 29:1mL/g, which correlated well with the predicted yield of 15.58%. Subsequently, the crude LEPs were further purified by DEAE-cellulose and Sephadex-100 chromatography to obtain two fractions, which were designated as LEP-1 and LEP-2 and their monosaccharide compositions were characterized by GC. Fourier-transform infrared spectra demonstrated that LEP-1 and LEP-2 were distinct from each other regarding their chemical structures. In addition, the LEPs exhibited inhibition of cell proliferation on HCT-116 and HeLa cells in vitro. In summary, this study provides an efficient enzyme-assisted extraction for LEPs, which can be used as natural antitumor agents in the pharmaceutical and functional food industries. Copyright © 2016 Elsevier B.V. All rights reserved.
Tessari, Paolo; Lante, Anna
2017-03-17
Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.
Tessari, Paolo; Lante, Anna
2017-01-01
Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350
Qian, Zhi-Gang
2014-01-30
In this study, cellulase-assisted extraction of water soluble polysaccharides from pumpkin (Cucurbita moschata) and their antibacterial activity were investigated. The polysaccharides yield was monitored during the extraction process. The optimum extraction conditions were determined as follows: time, 40 min; temperature, 55°C; pH, 4.5; and cellulase amount, 4,000 U/g. The extracts were centrifuged, filtered, proteins removed by Sevag method, concentrated to approximately 15% (w/v), precipitated with 5 volumes of absolute ethanol, freeze-dried, and pulverized to yield a water soluble powder of pumpkin polysaccharides (PP). The sugar content of the product was 68.3%, and the yield was 17.34% (w/w), respectively. The PP had high antibacterial activity against Bacillus subtilis, Staphylococcus aureus, and Escherichia coli at the concentration of 100 mg/mL. Copyright © 2013 Elsevier Ltd. All rights reserved.
Xu, Qi-Xin; Shi, Jun-Jun; Zhang, Jian-Guo; Li, Ling; Jiang, Li; Wei, Zhao-Jun
2016-12-01
Plant polysaccharides are widely used in food industry as thickening and gelling agents and these attributes largely depend on their thermal, emulsifying and rheological properties. As known, the extraction methods always bring about the diversification of property and functions of polysaccharides. Thus, the Vaccinium bracteatum Thunb leaves polysaccharides (VBTLP) were sequentially extracted using hot buffer (HBSS), chelating agent (CHSS), dilute alkaline (DASS) and concentrated alkaline (CASS). The thermal, emulsifying and rheological properties of VBTLP were investigated in the present study. Within the range of 20-225°C, CHSS showed the highest peak temperature, whereas HBSS displayed the highest endothermic enthalpy and highest emulsifying activity, while, CASS showed the longest emulsifying stability. The VBTLP solutions exhibited non-Newtonian shear-thinning behavior within the concentrations of 0.6-2.5%. The apparent viscosity of VBTLP solution decreased under following conditions: acidic pH (4.0), alkaline pH (10.0), in the presence of Ca 2+ and at high temperature, while it increased in the presence of Na + and at freezing conditions. The modulus G' and G″ of VBTLP solutions were increased with increasing oscillation frequency, and the crossover frequency shifted to lower values when the polysaccharide content increased. The above results of thermal, emulsifying and rheological properties of VBTLPs supplied the basis for V. bracteatum leaves in potential industrial applications of foods. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
KUSMIATI
2007-04-01
Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both
Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.
Gomaa, K; Kraus, J; Franz, G; Röper, H
1991-09-18
Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.
UDP-[14C]glucose-labelable polypeptides from pea: Possible components of glucan synthase I activity
International Nuclear Information System (INIS)
Ray, P.M.; Dhugga, K.S.; Gallaghar, S.R.
1989-01-01
A membrane-bound polypeptide doublet of about 40 kD can be rapidly labeled with UDP-[ 14 C]glucose under the assay conditions for glucan synthase I (GS-I). Label seems covalently bound, and chases when unlabeled UDPG is added; it might represent a covalent intermediate in polysaccharide synthesis. Labeling and GS-I activity show several common features: they co-sediment with Golgi membranes in sucrose gradients; they depend similarly on Mg 2+ or Mn 2+ (not Ca 2+ ); they decrease dramatically from stem apex to base, and are higher in epidermis than internal tissue; they show similar sensitivities to several inhibitors. But the doublet still labels after polysaccharide-synthesizing activity has been destroyed by Triton X-100. The doublet polypeptides might be glucosyl tranferases whose ability to transfer glucose units to a glucan chain is detergent-sensitive, but to accept glucose from UDPG is not; or they might be detergent-insensitive primary glucose acceptors, from which a distinct, detergent-sensitive transferase(s) move(s) these units to glucan chains
Anti-inflammatory and angiogenic activity of polysaccharide extract obtained from Tibetan kefir.
Prado, Maria Rosa Machado; Boller, Christian; Zibetti, Rosiane Guetter Mello; de Souza, Daiany; Pedroso, Luciana Lopes; Soccol, Carlos Ricardo
2016-11-01
The search for new bioactive molecules is a driving force for research pharmaceutical industries, especially those molecules obtained from fermentation. The molecules possessing angiogenic and anti-inflammatory attributes have attracted attention and are the focus of this study. Angiogenic activity from kefir polysaccharide extract, via chorioallantoic membrane assay, exhibited a pro-angiogenic effect compared with vascular endothelial factor (pro-angiogenic) and hydrocortisone (anti-angiogenic) activity as standards with an EC50 of 192ng/mL. In terms of anti-inflammatory activity determined via hyaluronidase enzyme assay, kefir polysaccharide extract inhibited the enzyme with a minimal activity of 2.08mg/mL and a maximum activity of 2.57mg/mL. For pharmaceutical purposes, kefir polysaccharide extract is considered to be safe because it does not inhibit VERO cells in cytotoxicity assays. Copyright © 2016 Elsevier Inc. All rights reserved.
Zha, Shenghua; Zhao, Qingsheng; Chen, Jinjin; Wang, Liwei; Zhang, Guifeng; Zhang, Hong; Zhao, Bing
2014-10-13
Water-soluble polysaccharides were separated from maca (Lepidium meyenii) aqueous extract (MAE). The crude polysaccharides were deproteinized by Sevag method. During the preparation process of maca polysaccharides, amylase and glucoamylase effectively removed starch in maca polysaccharides. Four Lepidium meyenii polysaccharides (LMPs) were obtained by changing the concentration of ethanol in the process of polysaccharide precipitation. All of the LMPs were composed of rhamnose, arabinose, glucose and galactose. Antioxidant activity tests revealed that LMP-60 showed good capability of scavenging hydroxyl free radical and superoxide radical at 2.0mg/mL, the scavenging rate was 52.9% and 85.8%, respectively. Therefore, the results showed that maca polysaccharides had a high antioxidant activity and could be explored as the source of bioactive compounds. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chemical Methods for the Determination of Soluble and Insoluble Non-Starch Polysaccharides - Review
Rodica Căpriţă; Adrian Căpriţă
2011-01-01
Polysaccharides are macromolecules of monosaccharides linked by glycosidic bonds. Non-starch polysaccharides(NSP) are principally non-α-glucan polysaccharides of the plant cell wall. They are a heterogeneous group ofpolysaccharides with varying degrees of water solubility, size, and structure. The water insoluble fiber fractioninclude cellulose, galactomannans, xylans, xyloglucans, and lignin, while the water-soluble fibers are the pectins,arabinogalactans, arabinoxylans, and β-(1,3)(1,4)-D-g...
Zhao, Yong-Ming; Song, Jin-Hui; Wang, Jin; Yang, Jian-Ming; Wang, Zhi-Bao; Liu, Ying-Hui
2016-10-01
Tricholoma mongolicum Imai is a well-known edible and medicinal mushroom which in recent years has attracted increasing attention because of its bioactivities. In this study, water-soluble polysaccharides were extracted from T. mongolicum Imai by cellulase-assisted extraction and their antioxidant activities were investigated. In order to improve the yield of polysaccharides, four variables, cellulase amount (X1 ), pH (X2 ), temperature (X3 ) and extraction time (X4 ), were investigated with a Box-Behnken design. The optimal conditions were predicted to be cellulase amount of 20 g kg(-1) , pH of 4.0, temperature of 50 °C and extraction time of 127 min, with a predicted polysaccharide yield of 190.1 g kg(-1) . The actual yield of polysaccharides under these conditions was 189.6 g kg(-1) , which matched the predicted value well. The crude polysaccharides were purified to obtain four fractions, and characterization of each was carried out. In addition, antioxidant properties of four polysaccharides assessed by 1,1-diphenyl-2-picryldydrazyl (DPPH) and hydroxyl radical-scavenging assays indicated that polysaccharides from T. mongolicum Imai (TMIPs) possessed antioxidant activity in a dose-dependent manner. TMIPs show moderate antioxidant activities in vitro. Therefore it is suggested that TMIPs are potential natural antioxidants for use in functional foods. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Cantu-Jungles, Thaisa Moro; Almeida, Carolina Pierobom de; Iacomini, Marcello; Cipriani, Thales R; Cordeiro, Lucimara M C
2015-05-20
Primary cell wall polysaccharides from aqueous extract of buriti fruit pulp (Mauritia flexuosa, an exotic tropical palm) were isolated and characterized. After freeze-thaw and α-amylase treatments, extracted polysaccharides were purified by sequential ultrafiltration through membranes. Two homogeneous fractions were obtained, SBW-100R and SBW-30R (Mw of 126 kDa and 20 kDa, respectively). Monosaccharide composition, methylation and (13)C NMR analysis showed that fraction SBW-100R contained a (1 → 5)-linked arabinan, branched at O-3 and O-2 positions, linked to a type I rhamnogalacturonan. Low amounts of these polymers were also present in fraction SBW-30R according to (13)C NMR analysis and monosaccharide composition. However, a high methyl esterified homogalacturonan (HG) was present in higher proportions. These results reinforce previous findings present in literature data which indicate that pectic polysaccharides are found in high amounts in primary cell walls of palms, which are commelinid monocotyledons. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cellulase-assisted extraction and antioxidant activity of the polysaccharides from garlic.
Pan, Saikun; Wu, Shengjun
2014-10-13
In the present study, the polysaccharides were prepared from garlic by using a cellulase-assisted extraction method and the antioxidant activity of garlic polysaccharides (GPs) was evaluated. To improve the yield of GPs, the influences of the several factors such as extraction time, temperature, pH, and cellulase amount on the extraction efficiency were studied. The optimal conditions for extraction of GPs were determined as follows: time, 80 min; temperature, 45 °C; pH, 5; cellulase amount, 8000 U/g. Under the optimised extraction conditions, the yield of GPS reached up to 35.34%. The GPs product exhibited strong antioxidant activity including hydroxyl radical scavenging activity, 2,2-diphenyl-β-picrylhydrazyl radical scavenging activity, and reducing power. The results suggest that the GPs could be used as potential antioxidants. Copyright © 2014 Elsevier Ltd. All rights reserved.
Bayar, Nadia; Kriaa, Mouna; Kammoun, Radhouane
2016-11-01
The chemical extraction and the characterization of polysaccharides from mucilage (MC), pectin (PC) and total pectic mucilage fraction (TFC) of Opuntia ficus indica cladodes as well as the evaluation of their antioxidant activities was investigated. The FTIR spectroscopic analysis revealed the presence of carboxyl and hydroxyl groups corresponding to polysaccharides. Uronic acid and the total sugar contents of PC were higher than those of TFC and MC whereas ash content of MC was considerably more important. In addition, the findings showed that all the samples had little protein content and low average molecular weight compared to the results mentioned in literature. Furthermore, MC reached not only the highest water (WHC) and oil holding (OHC) capacities (7.81g/g and 1.34g/g, respectively) but also the highest antioxidant properties (DPPH and ABTS scavenging activities, β-carotene bleaching inhibition activity and reducing power). However, PC had the strongest emulsifying and foaming properties. As for TFC, it had low WHC, OHC and emulsifying properties whereas it had higher foaming properties than MC and greater antioxidant properties compared to PC. These outcomes can encourage the use of PC as a surfactant and MC and TFC as natural antioxidants in food and pharmaceutical industries. Copyright © 2016 Elsevier B.V. All rights reserved.
extraction of high quality dna from polysaccharides-secreting ...
African Journals Online (AJOL)
cistvr
A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...
Anti-tumor activity of polysaccharides extracted from Senecio ...
African Journals Online (AJOL)
Purpose: To optimize the extraction conditions of polysaccharides from the root of Senecio scandens Buch,-Ham. (PRS) and evaluate its anti-tumor effect on hepatocellular carcinoma. Methods: Response surface methodology (RSM) applied with a Box-Behnken design (BBD, three levels and three factors) was employed to ...
Liang, Tu; Fu, Qing; Xin, Huaxia; Li, Fangbing; Jin, Yu; Liang, Xinmiao
2014-12-01
Water-soluble polysaccharides from traditional Chinese medicine (TCM) have properties of broad-spectrum treatment and low toxicity, making them as important components in natural medicines and health products. In order to solve the problem of polysaccharides characterization caused by their complex structures, a "bottom-up" approach was developed to complete the characterization of polysaccharides from Astragalus. Firstly, Astragalus pieces were extracted with hot water and then were precipitated by ethanol to obtain Astragalus polysaccharides. Secondly, a partial acid hydrolysis method was carried out and the effects of time, acid concentration and temperature on hydrolysis were investigated. The degree of hydrolysis increased along with the increase of hydrolysis time and acid concentration. The temperature played a great role in the hydrolysis process. No hydrolysis of the polysaccharides occurred at low temperature, while the polysaccharides were almost hydrolyzed to monosaccharide at high temperature. Under the optimum hydrolysis conditions (4 h, 1.5 mol/L trifluoroacetic acid, and 80 °C), Astragalus polysaccharides were hydrolyzed to characteristic oligosaccharide fragments. At last, a hydrophilic liquid chromatography-mass spectrometry method was used for the separation and structural characterization of the polysaccharide hydrolysates. The results showed that the resulting polysaccharides were mainly 1--> 4 linear glucan, and gluco-oligosaccharides with the degrees of polymerization (DP) of 4 - 11 were obtained after partial acid hydrolysis. The significance of this study is that it is the guidance for the characterization of other TCM polysaccharides.
Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria
Directory of Open Access Journals (Sweden)
Mattia P. Arena
2014-02-01
Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.
Antioxidant and immunoregulatory activity of alkali-extractable polysaccharides from mung bean.
Yao, Yang; Zhu, Yingying; Ren, Guixing
2016-03-01
Alkali-extractable polysaccharides from the seeds of mung beans and two polysaccharide sub-fractions (MAP-1 and MAP-2) were isolated and purified by anion-exchange and gel filtration chromatography. The average molecular weights (Mws) of MAP-1 and MAP-2 were 94.2 kDa and 60.4 kDa, respectively. Monosaccharide component analysis indicated that MAP-1 was composed of Rha, Ara, Glu, Gal, and GalA in a molar ratio of 1.1:0.4:0.7:0.5:0.3. MAP-2 consisted of Xyl, Rha, Gal, Glu and GalA with a relative molar ratio of 0.4:1.4:1.6:0.5:0.2. Antioxidant assays indicated that both MAP-1 and MAP-2 exhibit significant antioxidant activity in a dose-dependent manner. An in vitro study further showed that MAP-1 and MAP-2 were both able to stimulate the production of secretory molecules (NO, TNF-α and IL-6) by RAW 264.7 murine macrophages in a concentration-dependent manner. These findings suggest that the polysaccharides isolated in our study have immunoregulatory effects on macrophages and can be used as a beneficial health food. Copyright © 2015. Published by Elsevier B.V.
Extraction and characterization of galactomannan extracted from Prosopis juliflora seeds
International Nuclear Information System (INIS)
Rodrigues, Delane da C.; Cunha, Arcelina P.; Oliveira, Williara Q. de; Gallao, Maria Izabel; Azeredo, Henriette M. C de
2015-01-01
Different seeds are rich in polysaccharides, which are widely used in research and in industry. The objective was to extract galactomannan from mesquite seeds (Prosopis juliflora) and evaluate their chemical properties for future application in edible films. To test the feasibility of using the polysaccharide, the yield was obtained and the material analyzed by Thermal Analysis (TGA-Thermogravimetric Analysis and Calorimetry Differential Scanning-DSC), Spectroscopy Infrared Region Fourier Transform (FTIR) and Nuclear Magnetic Resonance (NMR). According to the results, the galactomannan was equivalent with the polysaccharides extracted from other sources except for the low yield (6.6%). (author)
Jiang, Zheng; Wang, Hong; Wu, Qi-nan
2015-06-01
To optimize the processing of polysaccharide extraction from Spirodela polyrrhiza. Five factors related to extraction rate of polysaccharide were optimized by the Plackett-Burman design. Based on this study, three factors, including alcohol volume fraction, extraction temperature and ratio of material to liquid, were regarded as investigation factors by Box-Behnken response surface methodology. The effect order of three factors on the extraction rate of polysaccharide from Spirodela polyrrhiza were as follows: extraction temperature, alcohol volume fraction,ratio of material to liquid. According to Box-Behnken response, the best extraction conditions were: alcohol volume fraction of 81%, ratio of material to liquid of 1:42, extraction temperature of 100 degrees C, extraction time of 60 min for four times. Plackett-Burman design and Box-Behnken response surface methodology used to optimize the extraction process for the polysaccharide in this study is effective and stable.
Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum
2010-01-01
Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB
Yin, Chaomin; Fan, Xiuzhi; Fan, Zhe; Shi, Defang; Gao, Hong
2018-05-01
Enzymes-microwave-ultrasound assisted extraction (EMUE) method had been used to extract Lentinus edodes polysaccharides (LEPs). The enzymatic temperature, enzymatic pH, microwave power and microwave time were optimized by response surface methodology. The yields, properties and antioxidant activities of LEPs from EMUE and other extraction methods including hot-water extraction, enzymes-assisted extraction, microwave-assisted extraction and ultrasound-assisted extraction were evaluated. The results showed that the highest LEPs yield of 9.38% was achieved with enzymatic temperature of 48°C, enzymatic pH of 5.0, microwave power of 440W and microwave time of 10min, which correlated well with the predicted value of 9.79%. Additionally, LEPs from different extraction methods possessed typical absorption peak of polysaccharides, which meant different extraction methods had no significant effects on type of glycosidic bonds and sugar ring of LEPs. However, SEM images of LEPs from different extraction methods were significantly different. Moreover, the different LEPs all showed antioxidant activities, but LEPs from EMUE showed the highest reducing power when compared to other LEPs. The results indicated LEPs from EMUE can be used as natural antioxidant component in the pharmaceutical and functional food industries. Copyright © 2018 Elsevier B.V. All rights reserved.
Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.
Hu, Jian-mei; Li, Jing-ling; Feng, Peng; Zhang, Xiang-dong; Zhong, Ming
2014-01-01
To optimize the processing of enzymatic extraction of polysaccharide from Dendrobium officinale. With phenol-sulfuric acid method and the DNS determination polysaccharide, Box-Behnken response surface methodology was used to optimize different enzyme dosage, reaction temperature and reaction time by using Design-Expert 8.05 software for data analysis and processing. According to Box-Behnken response, the best extraction conditions for the polysaccharide from Dendrobium officinale were as follows: the amount of enzyme complex was 3.5 mg/mL, hydrolysis temperature was 53 degrees C, and reaction time was 70 min. In accordance with the above process, the polysaccharide yield was 16.11%. Box-Behnken response surface methodology is used to optimize the enzymatic extraction process for the polysaccharide in this study, which is effective, stable and feasible.
Wan, Peng; Yang, Xiaoman; Cai, Bingna; Chen, Hua; Sun, Huili; Chen, Deke; Pan, Jianyu
2015-08-01
In the present study, ultrasonic extraction technique (UET) is used to improve the yield of polysaccharides from Laminaria japonica (LJPs). And their antioxidative as well as glycosidase inhibitory activities are investigated. Box-Behnken design (BBD) combined with response surface methodology (RSM) is applied to optimize ultrasonic extraction for polysaccharides. The optimized conditions are obtained as extraction time at 54 min, ultrasonic power at 1050 W, extraction temperature at 80°C and ratio of material to solvent at 1:50 (g mL-1). Under these optimal ultrasonic extraction conditions, an actual experimental yield (5.75% ± 0.3%) is close to the predicted result (5.67%) with no significant difference ( P > 0.05). Vitro antioxidative and glycosidase inhibitory activities tests indicate that the crude polysaccharides (LJP) and two major ethanol precipitated fractions (LJP1 and LJP2) are in a concentration-dependent manner. LJP2 (30%-60% ethanol precipitated polysaccharides) possesses the strongest α-glucosidase inhibitory activity and moderate scavenging activity against hydroxyl radicals (66.09% ± 2.19%, 3.0 mg mL-1). Also, the inhibitory activity against α-glucosidase (59.08% ± 3.79%, 5.0 mg mL-1) is close to that of acarbose (63.99% ± 3.27%, 5.0 mg mL-1). LJP1 (30% ethanol precipitated polysaccharides) exhibits the strongest scavenging activity against hydroxyl radicals (99.80% ± 0.00%, 3.0 mg mL-1) and moderate α-glucosidase inhibitory activity (47.76% ± 1.92%, 5.0 mg mL-1). LJP shows the most remarkable DPPH scavenging activity (66.20% ± 0.11%, 5.0 mg mL-1) but weakest α-glucosidase inhibitory activity (37.77% ± 1.30%, 5.0 mg mL-1). However, all these LJPs exert weak inhibitory effects against α-amylase. These results show that UET is an effective method for extracting bioactive polysaccharides from seaweed materials. LJP1 and LJP2 can be developed as a potential ingredient in hypoglycemic agents or functional food for the management of
Cellulase-assisted extraction and antioxidant activity of polysaccharides from Rhizoma imperata.
Jiang, Long-Fa
2014-08-08
In this study, the cellulase-assisted extraction and antioxidant activity of the polysaccharides from Rhizoma imperata were investigated. To improve the yield of R. Imperata polysaccharides (RPs), the extraction conditions were optimized as follows: time, 69.48 min; temperature, 45.36°C; pH, 4.58; cellulase amount, 1,200 U/g. Under these optimum conditions, the yield of RPs reached 0.67% (w/w), and was higher than that of the traditionally aqueous extraction method. The sugar content in the RPs product reached up to 93.25% (w/w). The RPs product has high antioxidant activity including hydroxyl radical scavenging activity and 2,2-diphenyl-β-picrylhydrazyl radical scavenging activity at the concentration of 100mg/mL. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.
Directory of Open Access Journals (Sweden)
Heather T Taff
Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.
Zhang, Bing-Zhao; Inngjerdingen, Kari T; Zou, Yuan-Feng; Rise, Frode; Michaelsen, Terje E; Yan, Pei-Sheng; Paulsen, Berit S
2014-11-15
Exo-polysaccharides were purified and characterized from the fermentation broth of Hypsizigus marmoreus, a popular edible mushroom consumed in Asia. Among them, B-I-I and B-II-I exhibited potent complement fixating activity, meanwhile, B-N-I, B-I-I, B-II-I and B-II-II exhibited significant macrophage stimulating activity. Molecular weights of the four exo-polysaccharides were determined to be 6.3, 120, 150 and 11 kDa respectively. Molecular characterisation showed that B-N-I is basically an α-1→4 glucan, with branches on C6; B-I-I is a heavily branched α-mannan with 1→2 linked main chain. B-II-I and B-II-II, have a backbone of rhamno-galacturonan with 1→2 linked l-rhamnose interspersed with 1→4 linked galacturonic acid. Structure-activity relationship analysis indicated that monosaccharide compositions, molecular weight, certain structural units (rhamno-galacturonan type I and arabinogalactan type II) are the principal factors responsible for potent complement fixating and macrophage-stimulating activities. Their immunomodulating activities may, at least partly, explain the health benefits of the mushroom. Copyright © 2014 Elsevier Ltd. All rights reserved.
Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R
2018-04-03
Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which
Extraction of Opuntia dillenii Haw. Polysaccharides and Their Antioxidant Activities
Directory of Open Access Journals (Sweden)
Heng Li
2016-11-01
Full Text Available Use of natural polysaccharides in medicine and food has wide interest in research. In this study, we extracted and purified some polysaccharides from cactus Opuntia dillenii Haw. (ODP. Some preliminary functions of these products were characterized. Under the optimal purification conditions, the yield of ODP extracted from the 2–4 month-old Opuntia dillenii Haw. (T-ODP was 30.60% ± 0.40%, higher than that of ODP from the 5–10 month-old materials (O-ODP (18.97% ± 0.58%. The extracted ODP was purified by DEAE sepharose fast flow anion exchange and Sephacryl S-400 chromatography with four fractions obtained (ODP-Ia, ODP-Ib, ODP-IIa and ODP-IIb. Analysis with UV-vis chromatography indicated that ODP-Ia and ODP-IIa were relatively homogeneous molecules with a molecular weight of 339 kD and 943 kD, respectively. Results of infrared spectroscopy indicated that ODP, ODP-Ia, and ODP-IIa were acidic polysaccharides. Further, the antioxidant activity against DPPH (1,1-diphenyl-2-picrylhydrazyl radical, hydroxyl radicals, and superoxide radical in vitro demonstrated that the T-ODP exhibited higher antioxidant activity than the O-ODP, and the purified fraction (ODP-Ia was superior to the ODP. These results will offer a theoretical basis for further research on the structure-function relationship of ODP and the rational utilization of Opuntia dillenii Haw.
Yang, Xinhe; Huang, Mingjun; Qin, Caiqin; Lv, Bangyu; Mao, Qingli; Liu, Zhonghua
2017-08-01
The crude tea polysaccharides (CTPS) from Qingzhuan brick tea(QZBT) were extracted and fractionated to afford two fractions, namely TPS-1 and TPS-2. Analyses were conducted concerning the structural characterization and antioxidant activities of these samples. Component analysis revealed that the carbohydrate, uronic acid, protein and polyphenol contents of these samples differed significantly. Fourier transform infrared analysis showed that these samples showed similar characteristic absorption peaks for polysaccharides. Ultraviolet-visible spectroscopy, circular dichroism, scanning electron microscopy and thermogravimetric analyses indicated that there were considerable differences in the presence of protein, surface features, conformational characteristics and thermodynamic behaviors. For antioxidant activities in vitro, CTPS, TPS-1 and TPS-2 exhibited concentration-dependent antioxidant activities, with TPS-2 showing significantly higher antioxidant activity than CTPS and TPS-1. These results provide a scientific and strong foundation for the use of tea polysaccharides(TPS) from QZBT and further research towards the relationships between the characteristics and antioxidant activities of TPS. Copyright © 2017 Elsevier B.V. All rights reserved.
Prakash Maran, J; Manikandan, S; Thirugnanasambandham, K; Vigna Nivetha, C; Dinesh, R
2013-01-30
In this study, ultrasound assisted extraction (UAE) conditions on the yield of polysaccharide from corn silk were studied using three factors, three level Box-Behnken response surface design. Process parameters, which affect the efficiency of UAE such as extraction temperature (40-60 °C), time (10-30 min) and solid-liquid ratio (1:10-1:30 g/ml) were investigated. The results showed that, the extraction conditions have significant effects on extraction yield of polysaccharide. The obtained experimental data were fitted to a second-order polynomial equation using multiple regression analysis with high coefficient of determination value (R(2)) of 0.994. An optimization study using Derringer's desired function methodology was performed and the optimal conditions based on both individual and combinations of all independent variables (extraction temperature of 56 °C, time of 17 min and solid-liquid ratio of 1:20 g/ml) were determined with maximum polysaccharide yield of 6.06%, which was confirmed through validation experiments. Copyright © 2012 Elsevier Ltd. All rights reserved.
Cabib, Enrico; Blanco, Noelia; Arroyo, Javier
2012-04-01
Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.
Li, Changtian; Mao, Xinxin; Xu, Baojun
2013-01-01
As a Chinese herbal medicine, Jew's ear has been known for its anti-coagulant effects. Hence it is worthwhile developing an effective technique to extract active components. To find the optimal extraction condition and to identify the best strain to yield fungal polysaccharide with anti-coagulant activity. Three strains of Jew's ear from Jilin Province, named as 988, DY 18 and FS 02, and three extraction techniques, namely, high intensity pulsed electric fields (HIPEF), microwave-assisted extraction method (MAEM) and ultrasonic-assisted extraction method (UAEM), were applied to optimise the extraction conditions. The crude extracts and polysaccharides were further determined for anti-coagulant activities. All extracts prolonged blood clotting time as compared to reagent control. The HIPEF exhibited the most remarkable effect among the three extraction techniques. The anti-coagulant activities of extracts were enhanced with increasing electric field strength when the field strength reached 24 kV/cm. Current results suggest that the HIPEF technique will be an effective method in the manufacture of bioactive natural polysaccharide. Copyright © 2012 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
R.C.Shendare
2008-01-01
Full Text Available A study with 200 vencobb broilers was carried out to compare the effect of the use of Manno-Oligosaccharide and b-glucans of Saccharomyces cerevisiae cell wall or growth promoter ( AGRIMOS and reg; feed in the diet @ 1Kg /ton of feed to the broiler. Diets were based on maize meal. A completely randomized experimental design was used, and the obtained data were evaluated by analysis. The following parameters were measured: feed intake, daily weight gain, feed conversion ratio, and mortality. After 6 weeks of fattening, the average live weight of broilers in the experimental group was 1821.11g, while the average live weight of broilers in control group was 1712.22g (P<0.01. Supplementation of Manno-Oligosaccharide and b-glucans preparation influence the achievement of higher live weights of broilers from the experimental group ( 5.37% , compared to the control and enhanced feed conversion ( 8.45 % . It was concluded that the effect of the inclusion of Manno-Oligosaccharide and b-glucans in the diet shows significantly higher body weight gain and improvement in feed efficiency as compared to the control diet. [Vet World 2008; 1(1.000: 13-15
Peek, H.W.; Halkes, S.B.A.; Tomassen, M.M.M.; Mes, J.J.; Landman, W.J.M.
2013-01-01
Five phytochemicals/extracts (an extract from Echinacea purpurea, a ß-glucan-rich extract from Shiitake, betaine [Betain™], curcumin from Curcuma longa [turmeric] powder, carvacrol and also a recombinant fungal immunomodulatory protein [FIP] from Ganoderma lucidum) cloned and expressed in
Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B
2016-04-05
Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.
Rosburg, Valerie; Boylston, Terri; White, Pamela
2010-06-01
Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.
Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil
Chang, I.; Cho, G.
2012-12-01
Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.
Austin, Ceri; Stewart, Derek; Allwood, J William; McDougall, Gordon J
2018-01-24
A polyphenol-rich extract (PRE) from the edible seaweed, Ascophyllum nodosum, inhibited pancreatic lipase activity in an oil-based turbidimetric assay with an IC 50 of 200 μg gallic acid equivalents (GAE) perassay) [∼230 μg DW] whereas the known inhibitor, Orlistat, gave an IC 50 at 0.4 μg per assay. A phlorotannin-enriched fraction (TRF) purified from the PRE was more potent with an IC 50 = 60 μg GAE per assay (∼65 μg DW). When the assay was started by the addition of lipase, both Orlistat and TRF were much less effective which suggests that pre-incubation of enzyme and inhibitor improved inhibition. Based on phenol content, water extracts from Ascophyllum were more potent lipase inhibitors than PRE (IC 50 ∼ 150 μg GAE per assay). However, this was equivalent to ∼580 μg DW and these extracts contained polysaccharides (e.g. alginate content = 110 μg mL -1 ) which may also contribute to inhibition. Indeed, a polysaccharide-enriched fraction obtained by ethanol precipitation gave an IC 50 of 1000 μg DW which was equivalent to 130 μg GAE and 420 μg alginate per assay. Therefore a >3 fold increase in alginate content did not markedly improve inhibition. Re-precipitation increased alginate content and reduced polyphenol content but lipase inhibition was markedly reduced (i.e. IC 50 at ∼1100 μg DW per assay, 700 μg alginate and 25 μg GAE). Purifying the polysaccharide fraction by ion exchange removed all phenolics but the IC 50 increased to >2500 μg DW, equivalent to >1970 μg alginate per assay. In conclusion, polysaccharides and phlorotannins may inhibit lipase in an additive fashion, with phlorotannins apparently more effective in vitro. However, interactions between these components may be important when food products containing this edible seaweed are consumed.
DEFF Research Database (Denmark)
Ale, Marcel Tutor
will generate new valuable products that may help lessen coastal pollution by seaweeds and create new seaweed-based resources. Thus, utilization of these natural resources is of great importance. The objectives of this PhD study were to develop a technology to extract bioactive compounds from nuisance brown...... seaweeds, and investigate their bioactivity. To this effect, designed optimized extraction of fucose-containing sulfated polysaccharides (FCSPs) and/or crude fucoidan from brown seaweed were performed, and the bioactivity of the isolated FCSPs was investigated. Moreover, to assess the potential of seaweed...... to assimilate nitrogen-based nutrients, a technology for accurate monitoring of differential seaweed growth responses to nutrient assimilation was also developed. Fucoidan is a term used to describe a class of sulfated polysaccharides extracted from brown seaweed, which contains substantial amounts of fucose...
Zhu, Zhen-Yuan; Dong, Fengying; Liu, Xiaocui; Lv, Qian; YingYang; Liu, Fei; Chen, Ling; Wang, Tiantian; Wang, Zheng; Zhang, Yongmin
2016-04-20
This study was to investigate the effects of different extraction methods on the yield, chemical structure and antitumor activity of polysaccharides from Cordyceps gunnii (C. gunnii) mycelia. Five extraction methods were used to extract crude polysaccharides (CPS), which include room-temperature water extraction (RWE), hot-water extraction (HWE), microwave-assisted extraction (MAE), ultrasound-assisted extraction (UAE) and cellulase-assisted extraction (CAE). Then Sephadex G-100 was used for purification of CPS. As a result, the antitumor activities of CPS and PPS on S180 cells were evaluated. Five CPS and purified polysaccharides (PPS) were obtained. The yield of CPS by microwave-assisted extraction (CPSMAE) was the highest and its anti-tumor activity was the best and its macromolecular polysaccharide (3000-1000kDa) ratio was the largest. The PPS had the same monosaccharide composition, but their obvious difference was in the antitumor activity and the physicochemical characteristics, such as intrinsic viscosity, specific rotation, scanning electron microscopy and circular dichroism spectra. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Xuejing Jia
2015-11-01
Full Text Available Box-Behnken design (BBD, one of the most common response surface methodology (RSM methods, was used to optimize the experimental conditions for ultrasound-assisted extraction of polysaccharides from Rhynchosia minima root (PRM. The antioxidant abilities and anticancer activity of purified polysaccharide fractions were also measured. The results showed that optimal extraction parameters were as follows: ultrasound exposure time, 21 min; ratio of water to material, 46 mL/g; ultrasound extraction temperature, 63 °C. Under these conditions, the maximum yield of PRM was 16.95% ± 0.07%. Furthermore, the main monosaccharides of purified fractions were Ara and Gal. PRM3 and PRM5 exhibited remarkable DPPH radical scavenging activities and reducing power in vitro. PRM3 showed strong inhibitory activities on the growth of MCF-7 cells in vitro. The above results indicate that polysaccharides from R. minima root have the potential to be developed as natural antioxidants and anticancer ingredients for the food and pharmaceutical industries.
Jia, Xuejing; Zhang, Chao; Hu, Jie; He, Muxue; Bao, Jiaolin; Wang, Kai; Li, Peng; Chen, Meiwan; Wan, Jianbo; Su, Huanxing; Zhang, Qingwen; He, Chengwei
2015-11-23
Box-Behnken design (BBD), one of the most common response surface methodology (RSM) methods, was used to optimize the experimental conditions for ultrasound-assisted extraction of polysaccharides from Rhynchosia minima root (PRM). The antioxidant abilities and anticancer activity of purified polysaccharide fractions were also measured. The results showed that optimal extraction parameters were as follows: ultrasound exposure time, 21 min; ratio of water to material, 46 mL/g; ultrasound extraction temperature, 63 °C. Under these conditions, the maximum yield of PRM was 16.95%±0.07%. Furthermore, the main monosaccharides of purified fractions were Ara and Gal. PRM3 and PRM5 exhibited remarkable DPPH radical scavenging activities and reducing power in vitro. PRM3 showed strong inhibitory activities on the growth of MCF-7 cells in vitro. The above results indicate that polysaccharides from R. minima root have the potential to be developed as natural antioxidants and anticancer ingredients for the food and pharmaceutical industries.
DEFF Research Database (Denmark)
Gao, Yu; Fangel, Jonatan Ulrik; Willats, William George Tycho
2016-01-01
different combinations of purified recombinant pectinases with cell wall profiling tools to follow the deconstruction process during winemaking. Multivariate data analysis of the glycan microarray (CoMPP) and gas chromatography (GC) results revealed that pectin lyase performed almost as effectively in de......The effectiveness of enzyme-mediated-maceration in red winemaking relies on the use of an optimum combination of specific enzymes. A lack of information on the relevant enzyme activities and the corresponding polysaccharide-rich berry cell wall structure is a major limitation. This study used......-pectination as certain commercial enzyme mixtures. Surprisingly the combination of endo-polygalacturonase and pectin-methyl-esterase only unraveled the cell walls without de-pectination. Datasets from the various combinations used confirmed pectin-rich and xyloglucan-rich layers within the grape pomace. These data...
Directory of Open Access Journals (Sweden)
Xueping Song
2016-05-01
Full Text Available The optimization extraction, preliminary characterization and bioactivities of Ligularia hodgsonii polysaccharides were investigated. Based on single-factor experiments and orthogonal array test, the optimum extraction conditions were obtained as follows: extraction time 3 h, temperature 85 °C, water/raw material ratio 36. Further Sevag deproteinization and dialysis yielded the dialyzed Ligularia hodgsonii polysaccharides (DLHP, 19.2 ± 1.4 mg/g crude herb. Compositional analysis, size-exclusion chromatography connected with multi-angle laser light-scattering and refractive index (SEC-MALLS-RI, Fourier transform infrared (FT-IR and 1H nuclear magnetic resonance (NMR spectroscopy were employed for characterization of the polysaccharides. DLHP was found to have a major component with a weight-average molecular weight of 1.17 × 105 Da, mainly comprising of glucose, galactose, arabinose, mannose, rhamnose, glucuronic acid and galacturonic acid. By in vitro antioxidant activity assays, DLHP presented remarkable scavenging capacities towards 1,1-diphenyl-2-picrylhydrazyl (DPPH, 2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS and hydroxyl radicals, and ferrous ions chelating ability. Moreover, it exhibited appreciable anti-hyperglycemic activity as demonstrated by differential inhibition of α-glucosidase and α-amylase. The results indicated that DLHP could potentially be a resource for antioxidant and hypoglycemic agents.
Directory of Open Access Journals (Sweden)
Khaoula Mkadmini Hammi
2018-06-01
Full Text Available Gas chromatography coupled to mass spectrometer (GC–MS was used to identify and to quantify neutral sugars that constitute the water soluble polysaccharides from Zizyphus lotus fruit. The trimethylsilyl (TMS method was successfully used for derivatization of the monosaccharides units of extracted polysaccharides that were released by hydrolysis method. Sugars were identified based on their retention times compared with those of standards and the NIST MS Spectral Library. All sugars were quantified in TIC (Total Ion Current mode using calibration curves. Data is related to “Optimization extraction of polysaccharide from Tunisian Zizyphus lotus fruit by response surface methodology: Composition and antioxidant activity” (Mkadmini Hammi et al., 2016 [1]. Keywords: Trimethylsilyl, Derivatization, GC–MS, Neutral sugar
Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I
International Nuclear Information System (INIS)
Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.
1998-01-01
The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains
Directory of Open Access Journals (Sweden)
Faezeh Tabesh
2014-01-01
Full Text Available Introduction. Oats are high in soluble fibers and effective in reducing the risk of cardiovascular diseases (CVD. We assessed the effects of beta-glucan from oat bran on serum nitric oxide (NO endothelial function in patients with hypercholesterolemia. Method. Sixty hypercholesterolemic patients were randomly divided to receive an experimental bread rich in beta-glucan from oat bran (intervention or bread rich in wheat fiber (control for four weeks. All subjects had the same diet for two-week baseline period and hypocaloric diet for four weeks of intervention. Serum NO concentration and flow-mediated dilation (FMD were determined before and after the experiment. Results. Mean age of the participants was 51.1 ± 9.3 years and 65% (n=39 were female. After intervention, serum NO concentration increased by 50.2 ± 19.8 μmol/lit in the intervention group (P=0.017, but no change was observed in the control group (17.5 ± 27.5 μmol/lit; P=0.530. No change of FMD was observed in the intervention (0.48 ± 0.78%; P=0.546 or in the control group (0.59 ± 0.92%; P=0.533. Conclusion. Consumption of oat bread for four weeks increases serum NO concentration but has no effect on FMD. Further studies are warranted in this regard.
Extraction, characterization and antioxidant activities of Se-enriched tea polysaccharides.
Wang, Yuanfeng; Li, Yongfu; Liu, Yangyang; Chen, Xueqing; Wei, Xinlin
2015-01-01
Se-polysaccharides from Se-enriched tea leaves were purified by DEAE-sepharose fast flow gel column (2.5×60cm) and three polysaccharide fractions (Se-TPS1, Se-TPS2, and Se-TPS3) were isolated and purified with yields of 6.5, 37.14, and 8.57%, respectively. The average sizes of Se-TPS1 and Se-TPS2 were determined by HPGPC system, with molecular weights of 1.1×10(5) and 2.4×10(5)Da, respectively. Se-TPS3 was a polysaccharide polymer with two peaks with molecular weights of 9.2×10(5) and 2.5×10(5)Da. Monosaccharide components analysis by ion chromatography revealed Se-polysaccharides were acidic polysaccharoses and different from each other in monosaccharide kinds and molar ratio. Elements of Se, C, H, N, S, and 14 kinds of mineral elements were analyzed by AFS, EA, and ICP-AES, respectively. Spectral analysis (IR and UV) indicated Se-polysaccharides were typical glycoproteins. Morphological analyses of the samples were determined by SEM and AFM. In addition, the DPPH and superoxide radicals scavenging activities were also discussed to assess antioxidant activities of the samples, and Se-polysaccharides showed higher antioxidant activities compared to the ordinary polysaccharides. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Wei; Wang, Xiaoqing; Ye, Hong; Hu, Bing; Zhou, Li; Jabbar, Saqib; Zeng, Xiaoxiong; Shen, Wenbiao
2016-01-01
The root of Brassica rapa L. has been traditionally used as a Uyghur folk medicine to cure cough and asthma by Uyghur nationality in Xinjiang Uygur Autonomous Region of China. In the present study, therefore, extraction optimization, characterization and antioxidant activity in vitro of polysaccharides from the root of B. rapa L. (BRP) were investigated. The optimal extraction conditions with an extraction yield of 21.48 ± 0.41% for crude BRP were obtained as follows: extraction temperature 93°C, extraction time 4.3h and ratio of extraction solvent (water) to raw material 75 mL/g. The crude BRP was purified by chromatographic columns of DEAE-52 cellulose and Sephadex G-100, affording three purified fractions of BRP-1-1, BRP-2-1 and BRP-2-2 with average molecular weight of 1510, 1110 and 838 kDa, respectively. Monosaccharide composition analysis indicated that BRP-1-1 was composed of mannose, rhamnose, glucose, galactose and arabinose, BRP-2-1 was composed of rhamnose, galacturonic acid, galactose and arabinose, and BRP-2-2 was composed of rhamnose and galacturonic acid in a molar ratio of 1.27: 54.92. Furthermore, the crude BRP exhibited relatively higher antioxidant activity in vitro than purified fractions; hence, it could be used as a natural antioxidant in functional foods or medicines. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jun-Yi Yin
2016-09-01
Full Text Available Polysaccharide from the seeds of Plantago asiatica L. has many bioactivities, but few papers report on the structural and rheological characteristics of the alkaline extract. The alkaline extracted polysaccharide was prepared from seeds of P. asiatica L. and named herein as alkaline extracted polysaccharide from seeds of P. asiatica L. (PLAP. Its structural and rheological properties were characterized by monosaccharide composition, methylation, GC-MS and rheometry. PLAP, as an acidic arabinoxylan, was mainly composed of 1,2,4-linked Xylp and 1,3,4-linked Xylp residues. PLAP solution showed pseudoplastic behavior, and weak gelling properties at high concentration. Sodium and especially calcium ions played a significant role in increasing the apparent viscosity and gel strength.
Afshari, Kasra; Samavati, Vahid; Shahidi, Seyed-Ahmad
2015-03-01
The effects of ultrasonic power, extraction time, extraction temperature, and the water-to-raw material ratio on extraction yield of crude polysaccharide from the leaf of Hibiscus rosa-sinensis (HRLP) were optimized by statistical analysis using response surface methodology. The response surface methodology (RSM) was used to optimize HRLP extraction yield by implementing the Box-Behnken design (BBD). The experimental data obtained were fitted to a second-order polynomial equation using multiple regression analysis and also analyzed by appropriate statistical methods (ANOVA). Analysis of the results showed that the linear and quadratic terms of these four variables had significant effects. The optimal conditions for the highest extraction yield of HRLP were: ultrasonic power, 93.59 W; extraction time, 25.71 min; extraction temperature, 93.18°C; and the water to raw material ratio, 24.3 mL/g. Under these conditions, the experimental yield was 9.66±0.18%, which is well in close agreement with the value predicted by the model 9.526%. The results demonstrated that HRLP had strong scavenging activities in vitro on DPPH and hydroxyl radicals. Copyright © 2014 Elsevier B.V. All rights reserved.
Wu, Hao; Zhu, Junxiang; Diao, Wenchao; Wang, Chengrong
2014-11-26
An efficient ultrasound-assisted enzymatic extraction (UAEE) of Cucurbita moschata polysaccharides (CMCP) was established and the CMCP antioxidant activities were studied. The UAEE operating parameters (extraction temperature, ultrasonic power, pH, and liquid-to-material ratio) were optimized using the central composite design (CCD) and the mass transfer kinetic study in UAEE procedure was used to select the optimal extraction time. Enzymolysis and ultrasonication that were simultaneously conducted was selected as the UAEE synergistic model and the optimum extraction conditions with a maximum polysaccharide yield of 4.33 ± 0.15% were as follows: extraction temperature, 51.5 °C; ultrasonic power, 440 W; pH, 5.0; liquid-to-material ratio, 5.70:1 mL/g; and extraction time, 20 min. Evaluation of the antioxidant activity in vitro suggested that CMCP has good potential as a natural antioxidant used in the food or medicine industry because of their high reducing power and positive radical scavenging activity for DPPH radical. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wee, May S M; Matia-Merino, Lara; Carnachan, Susan M; Sims, Ian M; Goh, Kelvin K T
2014-09-01
A shear-thickening water-soluble polysaccharide was purified from mucilage extracted from the fronds of the New Zealand black tree fern (Cyathea medullaris or 'mamaku' in Māori) and its structure characterised. Constituent sugar analysis by three complementary methods, combined with linkage analysis (of carboxyl reduced samples) and 1H and 13C nuclear magnetic resonance spectroscopy (NMR) revealed a glucuronomannan comprising a backbone of 4-linked methylesterified glucopyranosyl uronic acid and 2-linked mannopyranosyl residues, branched at O-3 of 45% and at both O-3 and O-4 of 53% of the mannopyranosyl residues with side chains likely comprising terminal xylopyranosyl, terminal galactopyranosyl, non-methylesterified terminal glucopyranosyl uronic acid and 3-linked glucopyranosyl uronic acid residues. The weight-average molecular weight of the purified polysaccharide was ∼1.9×10(6) Da as determined by size-exclusion chromatography coupled with multi-angle laser light scattering (SEC-MALLS). The distinctive rheological properties of this polysaccharide are discussed in relation to its structure. Copyright © 2014 Elsevier B.V. All rights reserved.
Chen, Huoliang; Ju, Ying; Li, Junjie; Yu, Min
2012-01-01
The crude polysaccharide (LEP) was extracted by hot water from the fruiting bodies of Lentinus edodes, and further purified by DEAE-cellulose and Sepharose CL-6B chromatography, giving three polysaccharide fractions coded as LEPA1, LEPB1 and LEPC1. In this study, their chemical and physical characteristics of polysaccharide fractions and antioxidant capacities, including scavenging activity against hydroxyl radicals, superoxide radicals and Fe(2+)-chelating ability, were valuated. The results showed that LEPC1 exhibited significantly antioxidant activity at a concentration-dependent manner. Therefore these results indicated that the water-extractable polysaccharide fraction was a potent antioxidant and could be developed to be new health medicine for fighting against various human diseases. Copyright © 2011 Elsevier B.V. All rights reserved.
Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats
International Nuclear Information System (INIS)
Salama, S.F.
2011-01-01
1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications
International Nuclear Information System (INIS)
Kuo, J.S.; Doelling, V.W.; Graveline, J.F.; McCoy, D.W.
1985-01-01
Cells of Haemophilus influenzae type b were grown in a liquid medium containing [ 3 H]palmitate or [ 14 C]ribose or both for two generations of exponential growth. Radiolabeled type-specific capsular polysaccharide, polyribosyl ribitol phosphate (PRP), was purified from the culture supernatant by Cetavlon precipitation, ethanol fractionation, and hydroxylapatite and Sepharose 4B chromatography. The doubly labeled ( [ 3 H]palmitate and [ 14 C]ribose) PRP preparation was found to coelute in a single peak from a Sepharose 4B column, suggesting that both precursors were incorporated into the purified PRP. A singly labeled ( [ 3 H]palmitate) purified PRP preparation was found to be quantitatively immune precipitated by human serum containing antibody against PRP. Only after acid, alkaline, or phospholipase A2 treatment of PRP labeled with [ 3 H]palmitate or [ 3 H]palmitate and [ 14 C]ribose followed by chloroform-methanol extraction could most of the 3 H-radioactivity be recovered in the organic phase. The chloroform-soluble acid-hydrolyzed or phospholipase A2-treated product was identified as palmitic acid after thin-layer chromatography. These results strongly suggest that a phospholipid moiety is covalently associated with the H. influenzae type b polysaccharide PRP
Zhao, Wenzhu; Yu, Zhipeng; Liu, Jingbo; Yu, Yiding; Yin, Yongguang; Lin, Songyi; Chen, Feng
2011-09-01
Corn silk is a traditional Chinese herbal medicine, which has been widely used for treatment of some diseases. In this study the effects of pulsed electric field on the extraction of polysaccharides from corn silk were investigated. Polysaccharides in corn silk were extracted by pulsed electric field and optimized by response surface methodology (RSM), based on a Box-Behnken design (BBD). Three independent variables, including electric field intensity (kV cm(-1) ), ratio of liquid to raw material and pulse duration (µs), were investigated. The experimental data were fitted to a second-order polynomial equation and also profiled into the corresponding 3-D contour plots. Optimal extraction conditions were as follows: electric field intensity 30 kV cm(-1) , ratio of liquid to raw material 50, and pulse duration 6 µs. Under these condition, the experimental yield of extracted polysaccharides was 7.31% ± 0.15%, matching well with the predicted value. The results showed that a pulsed electric field could be applied to extract value-added products from foods and/or agricultural matrix. Copyright © 2011 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Jorge Jesús Veloz
2016-01-01
Full Text Available Tooth decay is an infectious disease, whose main causative agent identified is Streptococcus mutans (S. mutans. Diverse treatments have been used to eradicate this microorganism, including propolis. To date, it has been shown that polyphenols from Chilean propolis inhibit S. mutans growth and biofilm formation. However, the molecular mechanisms underlying this process are unclear. In the present study, we assessed the effect of Chilean propolis on the expression and activity of the glycosyltransferases enzymes and their related genes. Polyphenol-rich extract from propolis inhibited gene expression of glycosyltransferases (GtfB, GtfC, and GtfD and their related regulatory genes, for example, VicK, VicR, and CcpA. Moreover, the treatment inhibited glucosyltransferases activity measured by the formation of sucrose-derived glucans. Additionally, an inhibitory effect was observed in the expression of SpaP involved in sucrose-independent virulence of S. mutans. In summary, our results suggest that Chilean propolis has a dose-dependent effect on the inhibition of genes involved in S. mutans virulence and adherence through the inhibition of glucosyltransferases, showing an anticariogenic potential of polyphenols from propolis beyond S. mutans growth inhibition.
Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick
2012-06-01
A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.
Yan, Yajuan; Li, Xia; Wan, Mianjie; Chen, Jingping; Li, Shijie; Cao, Man; Zhang, Danyan
2015-03-06
In the present study, effect of different extraction methods on property and bioactivity of water-soluble polysaccharides (WSP) from the seeds of Amomum villosum were investigated. Firstly, four different extraction methods were used to extract WSP, which include hot water extraction (HWE), ultrasonic-assisted extraction (UAE), microwave-assisted extraction (MAE) and enzyme-assisted extraction (EAE). As a result, four WSP samples, WSP(H), WSP(U), WSP(M) and WSP(E) were acquired. Then, the difference of four WSP samples in yield, characterization and antioxidant activities in vitro were further compared. Experimental results showed that the four WSP samples had the same monosaccharide composition, but mere difference in the content; they all had typical IR spectra characteristic of polysaccharides. WSP(U) contained the highest contents of uronic acid and sulfate. The yield of WSP(U) was the highest and its antioxidant activity was the best. These results suggested that ultrasonic-assisted extraction was the best extraction method for WSP. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Donghui Wang
2018-01-01
Full Text Available Response surface methodology (RSM was employed to optimize the conditions for the ultrasonic-assisted extraction (UAE of polysaccharides from the flowers of Dendrobium devonianum. The optimal conditions for the maximum yields of DDFPs are as follows: an extraction temperature of 63.13°C, an extraction time of 53.10 min, and a water-to-raw material ratio of 22.11 mL/g. Furthermore, three fractions (DDFPs30, DDFPs50, and DDFPs70 were prepared from Dendrobium devonianum flowers polysaccharides (DDFPs by the stepwise ethanol precipitation method. The DDFPs50 exhibited the highest antioxidant activity compared to the other fractions. The molecular weight, polydispersity, and conformation of these fractions were also characterized. In particular, the monosaccharide composition analysis of the DDFPs indicates that mannose and glucose are the primary components, similar to those of the D. officinale plant. This study provides a rapid extraction technology and essential information for the production of DDFPs, which could be potentially used as healthcare food.
Extraction, purification and elicitor activities of polysaccharides from Chrysanthemum indicum.
Du, Ningning; Tian, Wei; Zheng, Dongfang; Zhang, Xinyi; Qin, Pinyan
2016-01-01
Polysaccharides isolated from Chrysanthemum indicum were studied for their pathogen-derived resistance against Sclerotium rolfsii sacc in Atractylodis maceocephalae koidz. The total sugar content and monosaccharide analysis were determined by phenol-sulfuric acid method and gas chromatography, and infrared spectroscopy performed for simple structure information. The activities of CAT and POD as protective enzymes in A. maceocephalae leaves were evaluated. The purified polysaccharides exhibited strong CAT and POD activities in inoculated with S. rolfsii in A. macrocephala leaves, attained the maximum value 568.3 Ug(-1)min(-1) and 604.4 Ug(-1)min(-1)respectively. Whereas, when compared with the control plants, 20mg/ml purified polysaccharides exhibited the strongest CAT and POD activities. Notably, the treatments of A. macepcephalae seedlings with C. indicum polysaccharides (CIP) decreased disease index development caused by S. rolfsii. The disease index after 10 days was significantly reduced when the seedlings treated with 20mg/ml CIP, 4.41 compared to the control plants 32.00. Given together, these results indicated that purified polysaccharides derived from C. indicum may be useful as a natural inducer. Copyright © 2015 Elsevier B.V. All rights reserved.
Santos, Glaciane D; Ferri, Pedro H; Santos, Suzana C; Bao, Sônia N; Soares, Célia M A; Pereira, Maristela
2007-11-01
The fungus Paracoccidioides brasiliensis is the causative agent of paracoccidioidomycosis (PCM), the most prevalent human systemic mycosis in Latin America. Drug toxicity and the appearance of resistant strains have created the need to search for new therapeutic approaches. Plants with reputed antimicrobial properties represent a rich screening source of potential antifungal compounds. In this work, the growth of P. brasiliensis yeast cells was evaluated in the presence of oenothein B extracted from Eugenia uniflora. The oenothein B dosage that most effectively inhibited the development (74%) of P. brasiliensis yeast cells in vitro was 500 microg/ml. To verify if oenothein B interferes with cell morphology, we observed oenothein B-treated yeast cells by electron microscopy. The micrographs showed characteristic cell changes noted with glucan synthesis inhibition, including squashing, rough surface, cell wall rupture and cell membrane recess. The expression of P. brasiliensis genes was evaluated in order to investigate the action of oenothein B. Here we report that oenothein B inhibits 1,3-beta-glucan synthase (PbFKS1) transcript accumulation. The results indicate that oenothein B interferes with the cell morphology of P. brasiliensis, probably by inhibiting the transcription of 1,3-beta-glucan synthase gene, which is involved in the cell wall synthesis.
Directory of Open Access Journals (Sweden)
Khanittha Chawananorasest
2016-06-01
Full Text Available Tamarind seed polysaccharide (TSP, a natural polysaccharide extracted from tamarind seeds is used in the pharmaceutical, textile and food industries as a mucoadhesive polymer. This work aimed to extract TSP from tamarind seeds from three sources with two methods and characterized its physical and chemical properties. Kernel powder of tamarind seeds was slurried into a clear solution, set aside overnight and then centrifuged at 6000 rpm for 20 min to separate all foreign matter. The supernatant was separated and poured into excess 95% ethanol with continuous stirring. The precipitate obtained was collected and dried in the oven and then the dried TSP polymer was stored in a desiccator. The dried TSP was analyzed by 1H-NMR, FT-IR and XRD. The results showed TSP from tamarind seeds taken from paddy farmland (A, a waste from the export tamarind juice industry (B and the export tamarind powder industry(C gave yields of 31.55%, 26.95% and 17.30%, respectively, using method 1 and 11.15%, 53.65% and 54.65%, with method 2, respectively, but method 2 gave purer TSP than method 1. The FT-IR spectra displayed peaks at 3351.95 cm−1, 2920.76 cm−1, 1018.85 cm−1 and 555.16 cm−1. The 1H-NMR showed polysaccharide peaks between δ 3.50–4.20 ppm and XRD diagrams indicated their amorphous nature. Future works will focus on the quantitative analysis, biological activity and possible use of TSP as a drug delivery system.
Belhaj, Dalel; Frikha, Donyez; Athmouni, Khaled; Jerbi, Bouthaina; Ahmed, Mohammad Boshir; Bouallagui, Zouhaier; Kallel, Monem; Maalej, Sami; Zhou, John; Ayadi, Habib
2017-12-01
In this study, response surface methodology (RSM) based on Box-Behnken design (BBD) was employed to optimize the aqueous extraction of crude polysaccharides from Tunisian cyanobacteria Phormidium versicolor (NCC 466). The optimal extraction conditions with an extraction yield of 21.56±0.92% were as follows: extraction temperature at 81.05°C, extraction time of 3.99h, and water to raw material ratio of 21.52mLg -1 . Crude Phormidium versicolor polysaccharides (CPv-PS) are found to be a hetero-sulfated-anionic polysaccharides that contained carbohydrate (79.37±1.58%), protein (0.45±0.11%), uronic acids (4.37±0.19%) and sulfate (6.83±0.28%). The carbohydrate fraction was composed of arabinose, xylose, ribose, rhamnose, N-acetyl glucosamine, galactose, glucose, mannose, glucuronic acid and saccharose with corresponding mole percentages of 2.41, 14.58, 2.18, 6.23, 7.04, 28.21, 26.04, 3.02, 0.86 and 5.07, respectively. Evaluation of the antioxidant activity in vitro suggested that CPv-PS strongly scavenged radicals, prevented bleaching of β-carotene and reduced activity. Furthermore, the CPv-PS exhibited effective antimicrobial properties. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Extraction and purification of pumpkin polysaccharides and their hypoglycemic effect.
Wang, Shuang; Lu, Aoxue; Zhang, Lu; Shen, Meng; Xu, Tian; Zhan, Wangyang; Jin, Hui; Zhang, Yongjun; Wang, Weimin
2017-05-01
The anti-diabetic activity of the polysaccharides (PPs) obtained from the dried pumpkin pulp was studied in this paper. The PPs were administered by intraperitoneal injection to the alloxan-induced diabetic male ICR mice. The PPs hypoglycemic effect was evaluated by testing the fast blood glucose level, fasting serum insulin and hepatic glycogen. After 7h administration, the PPs showed a significantly hypoglycemic effect (ppumpkin polysaccharides in alloxan-induced diabetic mice and for the treatment of diabetic mellitus. Copyright © 2017 Elsevier B.V. All rights reserved.
Gao, Yu; Fangel, Jonatan U; Willats, William G T; Vivier, Melané A; Moore, John P
2016-11-05
The effectiveness of enzyme-mediated-maceration in red winemaking relies on the use of an optimum combination of specific enzymes. A lack of information on the relevant enzyme activities and the corresponding polysaccharide-rich berry cell wall structure is a major limitation. This study used different combinations of purified recombinant pectinases with cell wall profiling tools to follow the deconstruction process during winemaking. Multivariate data analysis of the glycan microarray (CoMPP) and gas chromatography (GC) results revealed that pectin lyase performed almost as effectively in de-pectination as certain commercial enzyme mixtures. Surprisingly the combination of endo-polygalacturonase and pectin-methyl-esterase only unraveled the cell walls without de-pectination. Datasets from the various combinations used confirmed pectin-rich and xyloglucan-rich layers within the grape pomace. These data support a proposed grape cell wall model which can serve as a foundation to evaluate testable hypotheses in future studies aimed at developing tailor-made enzymes for winemaking scenarios. Copyright © 2016 Elsevier Ltd. All rights reserved.
Anatomy and cell wall polysaccharides of almond (Prunus dulcis D. A. Webb) seeds.
Dourado, Fernando; Barros, António; Mota, Manuel; Coimbra, Manuel A; Gama, Francisco M
2004-03-10
The anatomy of Prunus dulcis was analyzed by applying several differential staining techniques and light microscopy. Prunus dulcis seed has a thin and structurally complex seed coat, with lignified cellulosic tissue. The embryo has two voluminous cotyledons. Cotyledon cells have a high number of protein and lipid bodies, some of which have phytin. The provascular tissue, located in the cotyledons, is oriented in small bundles perpendicular to the transverse embryonic axis. Prunus dulcis cell wall material is very rich in arabinose (45 mol %). Glucose (23%), uronic acids (12%), and xylose (12%) are also major sugar components. The polymers obtained from the imidazole and Na(2)CO(3) extracts contain mainly pectic substances rich in arabinose, but the sugar content of these extracts was very low. The majority of the pectic substances (also rich in arabinose) was recovered with the KOH extracts. These extracts, with high sugar content, yielded also xyloglucans and acidic xylans. The 4 M KOH + H(3)BO(3) extracts yielded polysaccharides rich in uronic acids and xylose and very rich in arabinose, accounting for 27% of the cell wall material.
Wiater, Adrian; Pleszczyńska, Małgorzata; Szczodrak, Janusz; Janusz, Grzegorz
2012-01-01
Mutanase (α-(1→3)-glucanase) is a little-known inductive enzyme that is potentially useful in dentistry. Here, it was shown that the cell wall preparation (CWP) obtained from the fruiting body or vegetative mycelium of polypore fungus Laetiporus sulphureus is rich in α-(1→3)-glucan and can be successfully used for mutanase induction in Trichoderma harzianum. The content of this biopolymer in the CWP depended on the age of fruiting bodies and increased along with their maturation. In the case of CWP prepared from vegetative mycelia, the amount of α-(1→3)-glucan depended on the mycelium age and also on the kind of medium used for its cultivation. All CWPs prepared from the individually harvested fruiting body specimens induced high mutanase activity (0.53-0.82 U/mL) in T. harzianum after 3 days of cultivation. As for the CWPs obtained from the hyphal mycelia of L. sulpureus, the maximal enzyme productivity (0.34 U/mL after 3 days of incubation) was recorded for CWP prepared from the 3 week-old mycelium cultivated in Sabouraud medium. Statistically, a high positive correlation was found between the total percentage content of α-(1→3)-glucan in the CWP and the mutanase activity.
Cell wall polysaccharides hydrolysis of malting barley (Hordeum vulgare L.: a review
Directory of Open Access Journals (Sweden)
Jamar, C.
2011-01-01
Full Text Available Malting quality results from the different steps of the malting process. Malting uses internal changes of the seed occurring during germination, such as enzymes synthesis, to obtain a good hydrolysis process and the components required. Among the three main hydrolytic events observed, that are namely starch degradation, cell wall breakdown and protein hydrolysis, an efficient cell wall polysaccharides hydrolysis is an essential condition for a final product of quality. Indeed, because of the physical barrier of the cell wall, cell wall polysaccharides hydrolysis is one of the first steps expected from the process to gain access to the cell components. Moreover, viscosity problem and haze formation in malting industry are related to their presence during the process when inefficient degradation occurs, leading to increased production time and cost. Understanding the key elements in cell wall degradation is important for a better control. (1-3,1-4-β-glucans and arabinoxylans are the main constituents of cell wall. (1-3,1-4-β-glucans are unbranched chains of β-D-glucopyranose residues with β-(1,3 linkages and β-(1,4 linkages. Arabinoxylan consists in a backbone of D-xylanopyranosyl units linked by β-(1-4 bonds connected to single L-arabinofuranose by α-(1→2 or α-(1→3-linkages. Degradation of (1-3,1-4-β-glucans is processed by the (1-3,1-4-β-glucanases, the β-glucosidases and the β-glucane exohydrolases. It seems that the (1-3-β-glucanases are also involved. Arabinoxylans are mainly decomposed by (1-4-β-xylan endohydrolase, arabinofuranosidase and β-xylosidase.
DEFF Research Database (Denmark)
Ballesteros, Lina F.; Cerqueira, Miguel A.; Teixeira, Jose A.
2018-01-01
Extracts rich in polysaccharides were obtained by alkali pretreatment (PA) or autohydrolysis (PB) of spent coffee grounds, and incorporated into a carboxymethyl cellulose (CMC)-based film aiming at the development of bio-based films with new functionalities. Different concentrations of PA or PB (up...
Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.
Directory of Open Access Journals (Sweden)
Reshma Davidson
Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.
Meng, Xiangfeng; Dobruchowska, Justyna M; Pijning, Tjaard; Gerwig, Gerrit J; Dijkhuizen, Lubbert
2016-01-20
α-Glucans produced by glucansucrase enzymes of lactic acid bacteria attract strong attention as novel ingredients and functional biopolymers in the food industry. In the present study, α-helix 4 amino acid residues D1085, R1088, and N1089 of glucansucrase GTF180 of Lactobacillus reuteri 180 were targeted for mutagenesis both jointly and separately. Analysis of the mutational effects on enzyme function revealed that all D1085 and R1088 mutants catalyzed the synthesis of hyperbranched α-glucans with 15-22% branching (α1→3,6) linkages, compared to 13% in the wild-type GTF180. In addition, besides native (α1→6) and (α1→3) linkages, all of the mutations introduced a small amount of (α1→4) linkages (5% at most) in the polysaccharides produced. We conclude that α-helix 4 residues, especially D1085 and R1088, constituting part of the +2 acceptor binding subsite, are important determinants for the linkage specificity. The new hyperbranched α-glucans provide very interesting structural diversities and may find applications in the food industry.
Maca polysaccharides: A review of compositions, isolation, therapeutics and prospects.
Li, Yujuan; Xu, Fangxue; Zheng, Mengmeng; Xi, Xiaozhi; Cui, Xiaowei; Han, Chunchao
2018-05-01
Maca polysaccharides, some of the major bioactive substances in Lepidium meyenii (Walp.) (Maca), have various biological properties, including anti-oxidant, anti-fatigue, anti-tumor, and immunomodulatory effects, as well as hepatoprotective activity and regulation function. Although many therapeutics depend on multiple structures of maca polysaccharides in addition to providing sufficient foundations for maca polysaccharide products in industrial applications, the relationships between the pharmacological effects and structures have not been established. Therefore, this article summarizes the extraction and purification methods, compositions, pharmacological effects, prospects and industrial applications of maca polysaccharides. Copyright © 2018 Elsevier B.V. All rights reserved.
Chaouch, Mohamed Aymen; Hafsa, Jawhar; Rihouey, Christophe; Le Cerf, Didier; Majdoub, Hatem
2015-08-01
The extraction, purification and degradation of polysaccharides from Opuntia ficus indica cladodes, as well as the evaluation of their antioxidant and antiglycated activities in vitro were investigated. The optimization of the extraction showed that extraction by ultrasound at 40 °C presented the best carbohydrates yield. The degradation of the extracted polysaccharides was achieved by free radical depolymerization with H2O2 in the presence of copper(II) acetate for various reaction times. Sugar contents were determined by colorimetric assays. The macromolecular characteristics of the different isolated and degraded carbohydrates were carried by size exclusion chromatography (SEC/MALS/VD/DRI). These experiments showed that all samples are polysaccharides, which are probably pectins and that molecular weight (Mw) has decreased from 6,800,000 to 14,000 g/mol after 3 h of depolymerization without changing the structure. Preliminary antioxidant and antiglycated tests indicated that degraded polysaccharides for 2 and 3 h showed even better antioxidant and antiglycated activities. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Rodrigues, Delane da C.; Cunha, Arcelina P.; Oliveira, Williara Q. de; Gallao, Maria Izabel, E-mail: izagalao@gmail.com [Rede Nordeste de Biotecnologia (RENORBIO), Fortaleza, CE (Brazil). Centro de Ciencia; Azeredo, Henriette M.C. de [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil)
2013-07-01
Different seeds are rich in polysaccharides, which are widely used in research and in industry. The objective was to extract galactomannan from mesquite seeds (Prosopis juliflora) and evaluate their chemical properties for future application in edible films. To test the feasibility of using the polysaccharide, the yield was obtained and the material analyzed by Thermal Analysis (TGA-Thermogravimetric Analysis and Calorimetry Differential Scanning-DSC), Spectroscopy Infrared Region Fourier Transform (FTIR) and Nuclear Magnetic Resonance (NMR). According to the results, the galactomannan was equivalent with the polysaccharides extracted from other sources except for the low yield (6.6%). (author)
Energy Technology Data Exchange (ETDEWEB)
Rodrigues, Delane da C.; Cunha, Arcelina P.; Oliveira, Williara Q. de; Gallao, Maria Izabel, E-mail: izagalao@gmail.com [Rede Nordeste de Biotecnologia (RENORBIO), Forteleza, CE (Brazil). Centro de Ciencia; Universidade Federal do Ceara (UFC), Fortalea, CE (Brazil); Azeredo, Henriette M. C de [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil)
2015-07-01
Different seeds are rich in polysaccharides, which are widely used in research and in industry. The objective was to extract galactomannan from mesquite seeds (Prosopis juliflora) and evaluate their chemical properties for future application in edible films. To test the feasibility of using the polysaccharide, the yield was obtained and the material analyzed by Thermal Analysis (TGA-Thermogravimetric Analysis and Calorimetry Differential Scanning-DSC), Spectroscopy Infrared Region Fourier Transform (FTIR) and Nuclear Magnetic Resonance (NMR). According to the results, the galactomannan was equivalent with the polysaccharides extracted from other sources except for the low yield (6.6%). (author)
Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J
2009-10-14
To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.
Directory of Open Access Journals (Sweden)
Chao Liu
2016-06-01
Full Text Available Polysaccharides from Morchella esculenta have been proven to be functional and helpful for humans. The purpose of this study was to investigate the chemical structure and anti-proliferating and antitumor activities of a Morchella esculenta polysaccharide (MEP extracted by pulsed electric field (PEF in submerged fermentation. The endo-polysaccharide was separated and purified by column chromatography and Gel permeation chromatography, and analyzed by gas chromatography. The MEP with an average molecular weight of 81,835 Da consisted of xylose, glucose, mannose, rhamnose and galactose at the ratio of 5.4:5.0:6.5:7.8:72.3. Structure of MEP was further analyzed by Fourier-transform infrared spectroscopy and 1H and 13C liquid-state nuclear magnetic resonance spectroscopy. Apoptosis tests proved that MEP could inhibit the proliferation and growth of human colon cancer HT-29 cells in a time- and dose-dependent manner within 48 h. This study provides more information on chemical structure of anti-proliferating polysaccharides isolated from Morchella esculenta.
O'Connor, Daniel; Clutterbuck, Elizabeth A; Thompson, Amber J; Snape, Matthew D; Ramasamy, Maheshi N; Kelly, Dominic F; Pollard, Andrew J
2017-01-30
Neisseria meningitidis is a globally important cause of meningitis and septicaemia. Twelve capsular groups of meningococci are known, and quadrivalent vaccines against four of these (A, C, W and Y) are available as plain-polysaccharide and protein-polysaccharide conjugate vaccines. Here we apply contemporary methods to describe B-cell responses to meningococcal polysaccharide and conjugate vaccines. Twenty adults were randomly assigned to receive either a meningococcal plain-polysaccharide or conjugate vaccine; one month later all received the conjugate vaccine. Blood samples were taken pre-vaccination and 7, 21 and 28 days after vaccination; B-cell responses were assessed by ELISpot, serum bactericidal assay, flow cytometry and gene expression microarray. Seven days after an initial dose of either vaccine, a gene expression signature characteristic of plasmablasts was detectable. The frequency of newly generated plasma cells (CXCR3 + HLA-DR + ) and the expression of transcripts derived from IGKC and IGHG2 correlated with immunogenicity. Notably, using an independent dataset, the expression of glucosamine (N-acetyl)-6-sulfatase was found to reproducibly correlate with the magnitude of immune response. Transcriptomic and flow cytometric data revealed depletion of switched memory B cells following plain-polysaccharide vaccine. These data describe distinct gene signatures associated with the production of high-avidity antibody and a plain-polysaccharide-specific signature, possibly linked to polysaccharide-induced hyporesponsiveness.
Baik, Joo Hyun; Shin, Kwang-Soon; Park, Yooheon; Yu, Kwang-Won; Suh, Hyung Joo; Choi, Hyeon-Son
2015-08-30
Green tea is a dietary source of bioactive compounds for human health. Enzymatic treatments induce the bioconversion of bioactive components, which can improve biological activities. In this study, we investigated the effect of simultaneous treatment with tannase and Rapidase on biotransformation of catechins and extraction of polysaccharide from green tea extract (GTE). Tannase and pectinase treatments induced the biotransformation of catechins and altered tea polysaccharide () content. The addition of GTE to the enzyme reaction resulted in a significant increase in degallated catechins, including gallic acid, a product of the tannase reaction (314.5-4076.0 µg mL(-1)) and a reduction in epigallocatechin gallate (EGCG). Biotransformation of catechins improved the radical scavenging activity of GTE. Pectinase treatment led to change of TPS composition in GTE by hydrolyzing polysaccharides. In addition, pectinase-driven hydrolysis in polysaccharides significantly increased TPS-induced Interleukin 6 (IL-6) production in macrophages. In particular, treatment of Rapidase (TPS-Ra) led to the highest IL-6 production among TPS samples, similar to treatment of highly purified pectinase (TPS-GTE), a positive control. Simultaneous processing with tannase and Rapidase can be an efficient method for the extraction of bioactive polysaccharides and biotransformation of catechins with enhanced radical scavenging activity from green tea. © 2014 Society of Chemical Industry.
Liu, Yu-Jie; Mo, Xue-Lin; Tang, Xiao-Zhang; Li, Jiang-Hua; Hu, Mei-Bian; Yan, Dan; Peng, Wei; Wu, Chun-Jie
2017-06-09
In this study, the ultrasound-assisted extraction of polysaccharides (PSA) from Pinelliae Rhizoma Praeparatum Cum Alumine (PRPCA) was optimized by response surface methodology (RSM). The structural characteristics of PSA were analyzed by UV-vis spectroscopy, infrared spectroscopy, scanning electron microscopy, high performance gel permeation chromatography and high performance liquid chromatography, respectively. In addition, antioxidant and antimicrobial activities of PSA were studied by different in vitro assays. Results indicated that the optimal extraction conditions were as follows: the ratio of water to raw of 30 mL/g, extraction time of 46.50 min, ultrasonic temperature of 72.00 °C, and ultrasonic power of 230 W. Under these conditions, the obtained PSA yield (13.21 ± 0.37%) was closely agreed with the predicted yield by the model. The average molecular weights of the PSA were estimated to be 5.34 × 10³ and 6.27 × 10⁵ Da. Monosaccharide composition analysis indicated that PSA consisted of mannose, galactose uronic acid, glucose, galactose, arabinose with a molar ratio of 1.83:0.55:75.75:1.94:0.45. Furthermore, PSA exhibited moderate antioxidant and antibacterial activities in vitro. Collectively, this study provides a promising strategy to obtain bioactive polysaccharides from processed products of herbal medicines.
Directory of Open Access Journals (Sweden)
Chunjian Zhao
2016-01-01
Full Text Available An efficient microwave-assisted simultaneous distillation and extraction (MA-SDE method has been developed for the separation of polysaccharides and essential oil from Taxus chinensis var. mairei. The key operating parameters for MA-SDE were optimized by single factor and central composite design experiments, and the optimal conditions were found to include a particle size of 60–80 mesh, liquid/solid ratio of 22.5 mL/g, extraction time of 17.5 min, microwave power of 547 W, and dichloromethane was used as the extraction solvent of the essential oil. The yields obtained for polysaccharides and essential oil under the optimized conditions were 6.39% ± 0.12% and 0.27% ± 0.03%, respectively. The MA-SDE method was also compared with conventional heat reflux extraction (HRE and hydrodistillation extraction (HDE. The MA-SDE method not only allowed for the simultaneous extraction of polysaccharides and essential oil, but also completed the task with a much shorter extraction time of 17.5 min (HRE and HDE required 3 and 6 h, respectively. Furthermore, the MA-SDE method gave increased extraction yields for polysaccharides (1.14-fold higher than HRE and essential oil (1.23-fold higher than HDE. Based on these results, this MA-SDE method represents a rapid and efficient technique for the simultaneous extraction of polysaccharides and essential oil.
Tan, Li-Hong; Zhang, Dan; Yu, Bao; Zhao, Sheng-Ping; Wang, Jian-Wei; Yao, Ling; Cao, Wei-Guo
2015-11-01
Polysaccharide extraction from Dipsacus asperoides roots (DAP) was proved to possess strong antioxidant activities, including 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2-Azobis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS) radical scavenging activities, inhibiting β-carotene bleaching and strong reducing power. Cell assay demonstrated that the crude DAP possessed antioxidant activity and were effective against H2O2-induced L02 cells injury. Then, response surface methodology (RSM) was applied to optimize the ultrasonic extraction of DAP. The optimum variables given by central composite design (CCD) were as follows: ratio of water to raw material, 38.61mL/g; ultrasonic power, 308.68W; extraction time, 38.61min; and extraction temperature, 89°C. Under these conditions, the maximum yield of DAP obtained was 7.12±0.45%. Moreover, high performance liquid chromatography (HPLC) analysis suggested that the monosaccharide compositions of DAP contained primarily mannose, ribose, glucose, galactose, xylose and arabinose, with a molar ratio of 0.22:0.48:2.29:0.34:1.39:1.41. The results of the present study showed that DAP could be considered as potential sources of natural antioxidants. Copyright © 2015 Elsevier B.V. All rights reserved.
Lim, Sun Ha; Kim, Yaesil; Yun, Ki Na; Kim, Jin Young; Jang, Jung-Hee; Han, Mee-Jung; Lee, Jongwon
2016-12-08
Many cohort studies have shown that consumption of diets containing a higher composition of foods derived from plants reduces mortality from coronary heart disease (CHD). Here, we examined the active components of a plant-based diet and the underlying mechanisms that reduce the risk of CHD using three rat models and a quantitative proteomics approach. In a short-term myocardial infarction (MI) model, intake of wheat extract (WE), the representative cardioprotectant identified by screening approximately 4,000 samples, reduced myocardial injury by inhibiting apoptosis, enhancing ATP production, and maintaining protein homeostasis. In long-term post-MI models, this myocardial protection resulted in ameliorating adverse left-ventricular remodelling, which is a predictor of heart failure. Among the wheat components, arabinose and xylose were identified as active components responsible for the observed efficacy of WE, which was administered via ingestion and tail-vein injections. Finally, the food components of plant-based diets that contained cell wall polysaccharides rich in arabinose, xylose, and possibly fucose were found to confer protection against myocardial injury. These results show for the first time that specific monosaccharides found in the cell wall polysaccharides in plant-based diets can act as active ingredients that reduce CHD by inhibiting postocclusion steps, including MI and heart failure.
Chemical characteristics and anti-proliferation activities of Ganoderma tsugae polysaccharides.
Chien, Rao-Chi; Yen, Ming-Tsung; Tseng, Yu-Hsiu; Mau, Jeng-Leun
2015-09-05
Polysaccharides were extracted by hot-water and hot-alkali from four forms of Ganoderma tsugae including mature and baby Ling chih, mycelium and filtrate. Different profiles of proximate composition and monosaccharide constituents, and element contents were found in the extracted polysaccharides from different extractions and different forms. The molecular weight distributions of polysaccharides were 2.8×10(4)-6.5×10(5)Da and their infrared spectra were comparable. The hot-alkali extracted polysaccharides exhibited better anti-proliferation on IMR32 cells than the hot-water extracted polysaccharides, which were in turn more effective than the hot-water extracts. Besides, most hot-water extracts and both extracted polysaccharides exhibited an anti-proliferation effect on Hep G2 cells. However, the hot-water extracts showed less effective in anti-proliferation of IMR32 and Hep G2 cells. Based on the anti-tumor effects, both polysaccharides could be prepared for use in the formulation of nutraceuticals and functional foods. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Directory of Open Access Journals (Sweden)
Xiao-Qiang Han
Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.
Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe
2017-01-01
Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, Jie; Li, Wan-Chen; Gu, Xin-Li
2017-04-13
BACKGROUND This study performed optimized extraction, preliminary characterization, and in vitro antioxidant activities of polysaccharides from Glycyrrhiza uralensis Fisch. MATERIAL AND METHODS Three parameters (extraction temperature, ratio of water to raw material, and extraction time) were optimized for yields of G. uralensis polysaccharides (GUP) using response surface methodology with Box-Behnken design (BBD). The GUP was purified using DEAE cellulose 32-column chromatography. The main fraction obtained from G. uralensis Fisch was GUP-II, which was composed of rhamnose, arabinose, galactose, and glucose monosaccharide, was screened for antioxidant properties using DP Hand hydroxyl radical scavenging assays. In addition, immunological activity of GUP-II was determined by nitric oxide and lymphocyte proliferation assays. RESULTS Optimization revealed maximum GUP yields with an extraction temperature of 99°C, water: raw material ratio of 15: 1, and extraction duration of 2 h. GUP-II purified from G. uralensis Fisch had good in vitro DPPH and hydroxyl radical scavenging abilities. Immunologically, GUP-II significantly stimulated NO production in RAW 264.7 macrophages, and significantly enhanced LPS-induced lymphocyte proliferation. CONCLUSIONS Extraction of GUP from G. uralensis Fisch can be optimized with respect to temperature, extraction period, and ratio of water to material, using response surface methodology. The purified product (GUP-II) possesses excellent antioxidant and immunological activities.
Potential Use of Polysaccharides from the Brown Alga Undaria pinnatifida as Anticoagulants
Directory of Open Access Journals (Sweden)
Caterina Faggio
2015-10-01
Full Text Available Undaria pinnatifida (U. pinnatifida is a highly invasive species and has caused concern all over the world because it has invaded coastal environments, has the potential to displace native species, significantly alters habitat for associated fauna, and disturbs navigation. Any attempt to eradicate it would be futile, owing to the elusive, microscopic gametophyte, and because the alga thrives in sites rich in anthropic activities. Venice Lagoon is the largest Mediterranean transitional environment and the spot of the highest introduction of non-indigenous species, including U. pinnatifida, which is removed as a waste. We demonstrated that polysaccharide extracts from U. pinnatifida have an anticoagulant effect on human blood in vitro and are not cytotoxic. The results obtained by PT (normal values 70-120% and APTT (normal values 28-40s assays were significantly prolonged by the polysaccharide extracts of U. pinnatifida, therefore algal extracts are ideal candidates as antithrombotic agents.
Impact of new ingredients obtained from brewer's spent yeast on bread characteristics.
Martins, Z E; Pinho, O; Ferreira, I M P L V O
2018-05-01
The impact of bread fortification with β-glucans and with proteins/proteolytic enzymes from brewers' spent yeast on physical characteristics was evaluated. β-Glucans extraction from spent yeast cell wall was optimized and the extract was incorporated on bread to obtain 2.02 g β-glucans/100 g flour, in order to comply with the European Food Safety Authority guidelines. Protein/proteolytic enzymes extract from spent yeast was added to bread at 60 U proteolytic activity/100 g flour. Both β-glucans rich and proteins/proteolytic enzymes extracts favoured browning of bread crust. However, breads with proteins/proteolytic enzymes addition presented lower specific volume, whereas the incorporation of β-glucans in bread lead to uniform pores that was also noticeble in terms of higher specific volume. Overall, the improvement of nutritional/health promoting properties is highlighted with β-glucan rich extract, not only due to bread β-glucan content but also for total dietary fibre content (39% increase). The improvement was less noticeable for proteins/proteolytic enzymes extract. Only a 6% increase in bread protein content was noted with the addition of this extract and higher protein content would most likely accentuate the negative impact on bread specific volume that in turn could impair consumer acceptance. Therefore, only β-glucan rich extract is a promising bread ingredient.
Modifications of Saccharomyces pastorianus cell wall polysaccharides with brewing process.
Bastos, Rita; Coelho, Elisabete; Coimbra, Manuel A
2015-06-25
The cell wall polysaccharides of brewers spent yeast Saccharomyces pastorianus (BSY) and the inoculum yeast (IY) were studied in order to understand the changes induced by the brewing process. The hot water and alkali extractions performed solubilized mainly mannoproteins, more branched for BSY than those of IY. Also, (31)P solid state NMR showed that the BSY mannoproteins were 3 times more phosphorylated. By electron microscopy it was observed that the final residues of alkali sequential extraction until 4M KOH preserved the yeast three-dimensional structure. The final residues, composed mainly by glucans (92%), showed that the BSY, when compared with IY, contained higher amount of (1→4)-linked Glc (43% for BSY and 16% for IY) and lower (1→3)-linked Glc (17% for BSY and 42% for IY). The enzymatic treatment of final residue showed that both BSY and IY had (α1→4)-linked Glc and (β1→4)-linked Glc, in a 2:1 ratio, showing that S. pastorianus increases their cellulose-like linkages with the brewing process. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chemical studies on the polysaccharides of Salicornia brachiata.
Sanandiya, Naresh D; Siddhanta, A K
2014-11-04
A group of 12 polysaccharide extracts were prepared from the tips, stem and roots of an Indian halophyte Salicornia brachiata Roxb. obtained by sequential extractions with cold water (CW), hot water (HW), aqueous ammonium oxalate (OX) and aqueous sodium hydroxide (ALK) solutions. Monosaccharide composition analysis revealed that all the polysaccharide extract samples consisted primarily of rhamnose, arabinose, mannose, galactose, glucose, whereas ribose and xylose were present only in some of the extracts. All the extracts exhibited low apparent viscosity (1.47-2.02 cP) and sulphate and contained no prominent toxic metal ions. Fucose was detected only in OX extract of the roots. These polysaccharides were found to be heterogeneous and highly branched (glycoside linkage analysis, size-exclusion chromatography, (13)C-NMR, FT-IR, circular dichroism and optical rotation data). Physico-chemical analyses of these polysaccharides including uronic acid, sulphate and protein contents were also carried out. This constitutes the first report on the profiling of Salicornia polysaccharides. Copyright © 2014 Elsevier Ltd. All rights reserved.
Li, Bo; Dobruchowska, Justyna M.; Gerwig, Gerrit J.; Dijkhuizen, Lubbert; Kamerling, Johannis P.
2013-01-01
Water-soluble polysaccharide material, extracted from the stipes of the fruit bodies of Coprinus comatus by hot water, was fractionated by sequential weak anion-exchange and size-exclusion chromatography. The relevant fractions were subjected to structural analysis, including (D/L)
Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga
2012-01-01
The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard
Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults
DEFF Research Database (Denmark)
Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe
2013-01-01
for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...
Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.
Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A
2015-10-02
Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were
Energy Technology Data Exchange (ETDEWEB)
Vega-Sánchez, Miguel E. [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Loqué, Dominique [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Lao, Jeemeng [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Catena, Michela [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Verhertbruggen, Yves [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Herter, Thomas [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Yang, Fan [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Harholt, Jesper [Department of Plant and Environmental Sciences, University of Copenhagen, Frederiksberg C Denmark; Ebert, Berit [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Department of Plant and Environmental Sciences, University of Copenhagen, Frederiksberg C Denmark; Baidoo, Edward E. K. [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Keasling, Jay D. [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Department of Chemical and Biomolecular Engineering, and Department of Bioengineering, University of California, Berkeley CA USA; Scheller, Henrik V. [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Department of Plant and Microbial Biology, University of California, Berkeley CA USA; Heazlewood, Joshua L. [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Ronald, Pamela C. [Joint BioEnergy Institute and Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley CA USA; Department of Plant Pathology and the Genome Center, University of California, Davis CA USA
2015-01-14
Reduced cell wall recalcitrance and increased C6 monosaccharide content are desirable traits for future biofuel crops, as long as these biomass modifications do not significantly alter normal growth and development. Mixed-linkage glucan (MLG), a cell wall polysaccharide only present in grasses and related species among flowering plants, is comprised of glucose monomers linked by both β-1,3 and β-1,4 bonds. Previous data have shown that constitutive production of MLG in barley (Hordeum vulgare) severely compromises growth and development. Here, we used spatio-temporal strategies to engineer Arabidopsis thaliana plants to accumulate significant amounts of MLG in the cell wall by expressing the rice CslF6 MLG synthase using secondary cell wall and senescence-associated promoters. Results using secondary wall promoters were suboptimal. When the rice MLG synthase was expressed under the control of a senescence-associated promoter, we obtained up to four times more glucose in the matrix cell wall fraction and up to a 42% increase in saccharification compared to control lines. Importantly, these plants grew and developed normally. The induction of MLG deposition at senescence correlated with an increase of gluconic acid in cell wall extracts of transgenic plants in contrast to the other approaches presented in this study. MLG produced in Arabidopsis has an altered structure compared to the grass glucan, which likely affects its solubility, while its molecular size is unaffected. The induction of cell wall polysaccharide biosynthesis in senescing tissues offers a novel engineering alternative to enhance cell wall properties of lignocellulosic biofuel crops.
Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).
Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio
2008-01-01
Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.
Boulos, Samy; Nyström, Laura
2017-11-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO
Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin
2014-01-01
A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571
Characterization and antioxidant activities of polysaccharides from thirteen boletus mushrooms.
Zhang, Lan; Hu, Yu; Duan, Xiaoyu; Tang, Tingting; Shen, Yingbin; Hu, Bin; Liu, Aiping; Chen, Hong; Li, Cheng; Liu, Yuntao
2018-07-01
Water-soluble polysaccharides were extracted from the caps and stipes of thirteen boletus mushrooms representing five different species collected in Southwest China. Investigations of their structures and antioxidant activities allowed an evaluation of structure-function relationships. The polysaccharides were composed mainly of the monosaccharides arabinose, xylose, mannose, glucose and galactose. Most samples displayed a broad molecular weight range, with significant differences observed between the molecular weight ranges of the polysaccharides from the caps and the stipes. FT-IR spectral analysis of the polysaccharides revealed that most of polysaccharides from boletus mushrooms (except Boletus edulis) contained a pyranose ring. The antioxidant activities of the polysaccharides in stipes showed a significant correlation with their monosaccharide composition, and were also related to their molecular weight and anomeric configuration. Suillellus luridus collected in Pingwu, Mianyang, Sichuan, China had remarkably superior antioxidant activity and might be developed as a natural antioxidant. Copyright © 2018 Elsevier B.V. All rights reserved.
Zhang, Anqiang; Deng, Jiaying; Liu, Xiaoqing; He, Pengfei; He, Liang; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong
2018-07-01
Agaricus blazei Murill is an edible and medicinal mushroom favored in many countries, by virtue of both its delicious taste and its potential health benefits such as its purported anticancer activity. A neutral α-glucan (ABM40-1) with a carbohydrate content of 96% was purified from the high-speed shearing homogenization extracts of A. Blazei Murill by ethanol precipitation and column chromatography. Methylation analysis along with nuclear magnetic resonance spectroscopy revealed that ABM40-1 was an α-(1→4)-d-glucopyranan with O-6 position occasionally occupied with α-Glcp-(1→or α-Glcp-(1→6)-β-Glcp-(1→side chains. A weight-average molecular weight of 7.34×10 6 Da was determined for ABM40-1 and its chain in solution was revealed as a compact sphere by size exclusion chromatography (SEC) coupled with a laser light scattering. This spherical conformation was also further confirmed by Congo red test and using atom force microscopy. These results suggest it would be worthwhile to further study the potential bioactivities of ABM40-1. Copyright © 2018 Elsevier B.V. All rights reserved.
Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L
2014-02-07
The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.
Directory of Open Access Journals (Sweden)
Sylvia Carolina ALCÁZAR-ALAY
Full Text Available Abstract Açai is considered a functional food, and in addition to being a source of energy and fiber, it is a valuable source of bioactive compounds such as anthocyanins, minerals and fatty acids. In the present work, antioxidant-rich extracts from açai pulp were obtained using pressurized liquid extraction (PLE. The effects of the independent variables, including solvent type (pure ethanol and ethanol/water (50:50 v/v, citric acid (0 and 0.3%, w/w, pressure (20 and 80 bar and temperature (30 and 60 °C were evaluated using a full factorial design. The extraction was affected primarily by the solvent type and the citric acid percentage. The results indicate that the maximum overall yield (X0 was 64± 9 (%, d.b. when the process was performed using ethanol (99.5% and citric acid (0.3% w/w. The maximum total anthocyanin content and anthocyanin recovered from the raw material were 7 ± 1 (mg anthocyanin/g extract, d.b. and 11 ± 2 (%, d.b., respectively.
Klimaszewska, Marzenna; Górska, Sandra; Dawidowski, Maciej; Podsadni, Piotr; Szczepanska, Agnieszka; Orzechowska, Emilia; Kurpios-Piec, Dagmara; Grosicka-Maciag, Emilia; Rahden-Staroń, Iwonna; Turło, Jadwiga
2017-01-01
Numerous formulations derived from the shiitake medicinal mushroom, Lentinus edodes, demonstrate anticancer activities. We hypothesized that isolates from selenium (Se)-enriched mycelia of L. edodes would possess stronger cancer-preventive properties than current preparations. The aim of this study was to investigate whether the presence of Se-methyl-seleno-L-cysteine in mycelial extracts of L. edodes affects their cytotoxic activity (makes them stronger) or whether they are as effective as Se-containing polysaccharides. Extracts were prepared from Se-containing mycelia under various conditions and assayed for cytotoxic activity in cancer (PC3 and HeLa) and normal (HMEC-1) cell lines. The chemical composition of the extracts was examined; specifically, the amounts of potentially cytotoxic Se compounds (methylselenocysteine, selenomethionine, and Se-containing polysaccharides) were measured. The relationship between extract composition and biological activity was characterized. Mycelial cultures were cultivated in a 10-L bioreactor in medium enriched with sodium selenite. Mycelial extracts were prepared either at 100°C or at 4°C in acidic solution. Total Se content was determined using the atomic absorption spectrometry method, and methylselenocysteine and selenomethionine contents were measured using reverse-phase high-performance liquid chromatography. Protein, carbohydrate, and polyphenolic contents were determined with spectrophotometric methods, and Se-containing polysaccharides were measured with the use of precipitation. Anticancer activity of mycelial extracts was examined using the MTT cell viability assay. Extracts containing Se-methyl-seleno-L-cysteine or Se-polysaccharides prepared at 4°C and 100°C, respectively, display moderate, time-dependent, specific cytotoxic activity in HeLa and PC3 cell lines. The effect in HeLa cells is more pronounced in the extract prepared at 4°C than at 100°C. The effect is almost equal for the PC3 cell line. However
Directory of Open Access Journals (Sweden)
Ľubomír Mikuš
2013-02-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too. At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258
Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide
Directory of Open Access Journals (Sweden)
E. Y. Choi
2016-11-01
Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.
Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan
2017-04-01
Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable
Antibiofilm activity of Actinobacillus pleuropneumoniae serotype 5 capsular polysaccharide.
Directory of Open Access Journals (Sweden)
Michael T Karwacki
Full Text Available Cell-free extracts isolated from colony biofilms of Actinobacillus pleuropneumoniae serotype 5 were found to inhibit biofilm formation by Staphylococcus aureus, S. epidermidis and Aggregatibacter actinomycetemcomitans, but not by A. pleuropneumoniae serotype 5 itself, in a 96-well microtiter plate assay. Physical and chemical analyses indicated that the antibiofilm activity in the extract was due to high-molecular-weight polysaccharide. Extracts isolated from a mutant strain deficient in the production of serotype 5 capsular polysaccharide did not exhibit antibiofilm activity. A plasmid harboring the serotype 5 capsule genes restored the antibiofilm activity in the mutant extract. Purified serotype 5 capsular polysaccharide also exhibited antibiofilm activity against S. aureus. A. pleuropneumoniae wild-type extracts did not inhibit S. aureus growth, but did inhibit S. aureus intercellular adhesion and binding of S. aureus cells to stainless steel surfaces. Furthermore, polystyrene surfaces coated with A. pleuropneumoniae wild-type extracts, but not with capsule-mutant extracts, resisted S. aureus biofilm formation. Our findings suggest that the A. pleuropneumoniae serotype 5 capsule inhibits cell-to-cell and cell-to-surface interactions of other bacteria. A. pleuropneumoniae serotype 5 capsular polysaccharide is one of a growing number of bacterial polysaccharides that exhibit broad-spectrum, nonbiocidal antibiofilm activity. Future studies on these antibiofilm polysaccharides may uncover novel functions for bacterial polysaccharides in nature, and may lead to the development of new classes of antibiofilm agents for industrial and clinical applications.
Study on the immuno stimulation of radiation degraded β-glucan in swiss mice
International Nuclear Information System (INIS)
Nguyen Thanh Long; Le Quang Luan
2015-01-01
The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)
An exocellular polysaccharide and its interactions with proteins
Tuinier, R.
1999-01-01
In the food industry polysaccharides are used as thickening or gelling agents. Polysaccharides are usually extracted from plants. Micro-organisms are also capable of excreting polysaccharides: exocellular polysaccharides (EPSs). In some cases EPSs are produced in-situ in food products,
Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.
Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui
2016-12-01
β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Resistant-hemicelluloses toward successive chemical treatment during cellulose fibre extraction
Naqiya, F. M. Z.; Ahmad, I.; Airianah, O. B.
2018-04-01
Lignocellulosic materials have high demand bio-polymers industries as it is rich in cellulose but other residues that still remain in the extracted cellulose might influence the ability of cellulose-rich material to interact with other polymers. In this study, cellulose fibre was extracted from oil palm frond (OPF) using alkali and bleaching treatment. The morphological changes of each sample after every treatment was observed using Scanning Electron Microscope (SEM) and was further chemically extracted and quantitatively evaluated via spectrophotometric method. The non-cellulosic component was found predominantly contained hemicelluloses and these remaining hemicelluloses were hydrolysed and the monosaccharides of hemicelluloses were visualised by Thin Layer Chromatography (TLC). Xylose, arabinose, mannose and glucose were detected and therefore, it is suggested that the plausible type of resistant-hemicelluloses in OPF extracted fibre are arabinoxylan, glucomannan and/or glucan.
The role of wine polysaccharides on salivary protein-tannin interaction: A molecular approach.
Brandão, Elsa; Silva, Mafalda Santos; García-Estévez, Ignacio; Williams, Pascale; Mateus, Nuno; Doco, Thierry; de Freitas, Victor; Soares, Susana
2017-12-01
Polysaccharides are described to inhibit aggregation between food polyphenols and salivary proteins (SP) and may hence lead to astringency modulation. In this work, the effect of two wine polysaccharides (arabinogalactan proteins-AGPs and rhamnogalacturonan II- RGII) on SP-polyphenol interaction was evaluated. In general, both polysaccharides were effective to inhibit or reduce SP-polyphenol interaction and aggregation. They can act by two different mechanisms (ternary or competitive) depending on the SP-tannin pair. In the case of salivary P-B peptide, AGPs and RGII seem to act by a ternary mechanism, in which they surround this complex, enhancing its solubility. Concerning acidic proline-rich proteins (aPRPs), it was possible to observe both mechanisms, depending on the tannin and the polysaccharide involved. Overall, this work point out for a specific property of wine polysaccharides important to modulate this and other beverages and food astringency perception. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wang, Xiaoqin; Li, Guizhen; Row, Kyung Ho
2017-08-01
Magnetic graphene oxide was modified by four imidazole-based ionic liquids to synthesize materials for the extraction of polysaccharides by magnetic solid-phase extraction. Fucoidan and laminarin were chosen as the representative polysaccharides owing to their excellent pharmaceutical value and availability. Fourier transform infrared spectroscopy, field-emission scanning electron microscopy, and thermogravimetric analysis were applied to characterize the synthesized materials. Single-factor experiments showed that the extraction efficiency of polysaccharides was affected by the amount of ionic liquids for modification, solid-liquid ratio of brown alga and ethanol, the stirring time of brown alga and ionic liquid-modified magnetic graphene oxide materials, and amount of 1-(3-aminopropyl)imidazole chloride modified magnetic graphene oxide materials added to the brown alga sample solution. The results indicated that 1-(3-aminopropyl)imidazole chloride modified magnetic graphene oxide possessed better extraction ability than graphene oxide, magnetic graphene oxide, and other three ionic-liquid-modified magnetic graphene oxide materials. The highest extraction recoveries of fucoidan and laminarin extracted by 1-(3-aminopropyl)imidazole chloride modified magnetic graphene oxide were 93.3 and 87.2%, respectively. In addition, solid materials could be separated and reused easily owing to their magnetic properties. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Theuwissen, Elke; Mensink, Ronald P
2007-03-01
Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.
Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter
2017-07-20
Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).
Oliveira-Garcia, Ely; Deising, Holger B.
2013-01-01
β-1,3-Glucan and chitin are the most prominent polysaccharides of the fungal cell wall. Covalently linked, these polymers form a scaffold that determines the form and properties of vegetative and pathogenic hyphae. While the role of chitin in plant infection is well understood, the role of β-1,3-glucan is unknown. We functionally characterized the β-1,3-glucan synthase gene GLS1 of the maize (Zea mays) pathogen Colletotrichum graminicola, employing RNA interference (RNAi), GLS1 overexpression, live-cell imaging, and aniline blue fluorochrome staining. This hemibiotroph sequentially differentiates a melanized appressorium on the cuticle and biotrophic and necrotrophic hyphae in its host. Massive β-1,3-glucan contents were detected in cell walls of appressoria and necrotrophic hyphae. Unexpectedly, GLS1 expression and β-1,3-glucan contents were drastically reduced during biotrophic development. In appressoria of RNAi strains, downregulation of β-1,3-glucan synthesis increased cell wall elasticity, and the appressoria exploded. While the shape of biotrophic hyphae was unaffected in RNAi strains, necrotrophic hyphae showed severe distortions. Constitutive expression of GLS1 led to exposure of β-1,3-glucan on biotrophic hyphae, massive induction of broad-spectrum defense responses, and significantly reduced disease symptom severity. Thus, while β-1,3-glucan synthesis is required for cell wall rigidity in appressoria and fast-growing necrotrophic hyphae, its rigorous downregulation during biotrophic development represents a strategy for evading β-glucan–triggered immunity. PMID:23898035
Lactobacillus plantarum CIDCA 8327: An α-glucan producing-strain isolated from kefir grains.
Gangoiti, M V; Puertas, A I; Hamet, M F; Peruzzo, P J; Llamas, M G; Medrano, M; Prieto, A; Dueñas, M T; Abraham, A G
2017-08-15
Lactobacillus plantarum CIDCA 8327 is an exopolysaccharide (EPS)-producer strain isolated from kefir with promising properties for the development of functional foods. The aim of the present study was to characterize the structure of the EPS synthesized by this strain grown in skim milk or semidefined medium (SDM). Additionally, genes involved in EPS synthesis were detected by PCR. L. plantarum produces an EPS with a molecular weight of 10 4 Da in both media. When grown in SDM produce an heteropolysaccharide composed mainly of glucose, glucosamine and rhamnose meanwhile the EPS produced in milk was composed exclusively of glucose indicating the influence of the sugar source. FTIR spectra of this EPS showed signals attributable to an α-glucan. Both by 1 H NMR and methylation analysis it was possible to determine that this polysaccharide is a branched α-(1→4)-d-glucan composed of 80% linear α-(1→4)-d-glucopyranosyl units and 19% (1→4)-d-glucopyranosyl units substituted at O-3 by single α-d-glucopyranosil residues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Velusami, Chandrasekaran Chinampudur; Boddapati, Srinivasa Rao; Hongasandra Srinivasa, Srikanth; Richard, Edwin Jothie; Balasubramanian, Murali
2013-01-01
Curcuma longa Linn. (Zingiberaceae) commonly known as turmeric has long been used for centuries as a spice and household remedy. The present study was carried out to assess the possible mutagenic potential and acute oral toxicity of polysaccharide extract of turmeric rhizome (NR-INF-02) using standard tests. The standard battery of in vitro genotoxicity tests, bacterial reverse mutation test (BRMT), chromosome aberration (CA), and micronucleus (MN) tests were employed to assess the possible mutagenic activity of NR-INF-02 (Turmacin). The results showed no mutagenic effect with NR-INF-02 up to a dose of 5000 µg/mL in BRMT. The results on CA and MN tests revealed the non clastogenic activity of NR-INF-02 in a dose range of 250.36 to 2500 µg/mL with and without metabolic activation (S9). In acute oral toxicity study, NR-INF-02 was found to be safe up to 5 g/kg body weight in Wistar rats. Overall, results indicated that polysaccharide extract of C. longa was found to be genotoxically safe and also exhibited maximum tolerable dose of more than 5 g/kg rat body weight. PMID:24455673
DEFF Research Database (Denmark)
Wismar, René; Pedersen, Susanne Brix; Lærke, Helle Nygaard
2011-01-01
-regulate LPS-induced IL-12p70 production. The most potent NSP induced up-regulation of CD86 on DC independently of LPS stimulation. Cereal-based β-glucans showed less potency than β-glucans of microbial origin, but proper molecular weight composition and preparation may improve effectiveness......Scope: Structural-based recognition of foreign molecules is essential for activation of dendritic cells (DCs) that play a key role in regulation of gut mucosal immunity. Orally ingested non-starch polysaccharides (NSP) are ascribed many health-promoting properties, but currently we lack insight...... into the impact of structure and size for their capacity to affect immune responses.Methods and results: This study addresses the importance of chemical structure, size, origin and presence of contaminants for the capacity of both dietary and non-food NSP to modulate DC. Of 28 NSP products, β-glucans of microbial...
Anti-glycated and antiradical activities in vitro of polysaccharides from Ganoderma capense.
Yan, Chunyan; Kong, Fansheng; Zhang, Dezhi; Cui, Jiangxia
2013-01-01
Ganoderma capense is a Ganoderma species and is widely used, especially in Asia, as a well-known medicinal mushroom for health-promoting effect and for treatment of chronic diseases, such as diabetes, aging, etc. G. capense is rich of polysaccharide. To isolate the polysaccharides from G. capense and evaluate their anti-glycated and antiradical activities in vitro. The dried powder of submerged fermentation culturing mycelium of G. capense was defatted, extracted with water/alkaline water followed by ethanol precipitation and deproteinated. And four crude polysaccharides, named as GC50, GC70, GC90 and GCB, were obtained. For the first time, the in vitro anti-glycated activities of the four samples were studied by non-enzymatic glycation reaction. Then, the DPPH radical and hydroxyl radical assays were established to estimate the antiradical capacity of the four samples. Meanwhile the contents of polysaccharides were determined by phenol-sulphuric acid colorimetry. Preliminary antiradical in vitro studies indicated that the four crude polysaccharides showed concentration-dependent scavenging abilities on DPPH and hydroxyl radicals. The evaluation of anti-glycation activity suggested that GC70 had good potential for inhibiting the formation of advanced glycation end products. Time- and dose-dependent effects were also observed for all GC70 samples.
Synthesis of cell wall xylans and glucans by golgi membranes
International Nuclear Information System (INIS)
Gibeaut, D.M.; Carpita, N.C.
1989-01-01
We investigated the biosynthesis of mixed-linkage β-D-glucan and glucuronoarabinoxylans which make up the hemicellulosic matrix of the primary cell walls of maize and other cereal grasses. The Golgi apparatus was enriched from plasma membrane and other organelles by flotation density gradient centrifugation. Glucan synthase I and II, which are established markers for Golgi and plasma membrane, respectively, displayed considerable overlap in conventional separations with sucrose density gradients. Flotation gradients improved separation of the membranes substantially, but the different synthases themselves also incorporated radioactivity from either 10 μM or 1 mM UDP-[ 14 C]-glucose into polymer. Relative incorporation of radioactivity into polymers from UDP-[ 14 C]-xylose by the various membrane fractions was nearly identical to relative IDPase activities, indicating that combined xylosyl transferase-xylan synthase represents a new, unequivocal marker for the Golgi apparatus. We also have developed techniques of gas-liquid chromatography and radiogas proportional counting to achieve capillary quality separation of partially methylated alditol acetates with simultaneous determination of radioactivity in the derivatives. Digestion of polymeric products by specific endo-glycanohydrolases to diagnostic oligosaccharides also reveal specific kinds of polysaccharides synthesized by the Golgi membranes. A combination of these techniques provides unequivocal determination of the linkage structure of specific polymers synthesized by the purified Golgi apparatus
Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.
2010-01-01
An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.
Directory of Open Access Journals (Sweden)
Hiroyuki Kono
2017-12-01
Full Text Available This article contains two-dimensional (2D NMR experimental data, obtained by the Bruker BioSpin 500 MHz NMR spectrometer (Germany which can used for the determination of primary structures of schizophyllan from Schizophyllum commune (SPG and a water-soluble β-(1â3, 1â6-glucan from Aureobasidium pullulans. Data include analyzed the 2D NMR spectra of these β-glucans, which are related to the subject of an article in Carbohydrate Polymers, entitled âNMR spectroscopic structural characterization of a water-soluble β-(1â3, 1â6-glucan from A. pullulansâ (Kono et al., 2017 [1]. Data can help to assign the 1H and 13C chemical shifts of the structurally complex polysaccharides. Keywords: NMR, β-(1â3, 1â6-glucan, Aureobasidium pullulans, Schizophyllan, Spectral data
Kiho, T; Hui, J; Yamane, A; Ukai, S
1993-12-01
Crude polysaccharides were obtained from a hot-water extract and alkaline extracts of the cultural mycelium of Cordyceps sinensis. They showed significant activity in normal mice and streptozotocin-induced diabetic mice as a result of intraperitoneal (i.p.) injection. A crude polysaccharide (CS-OHEP) obtained from 5% sodium hydroxide extract slightly lowered the plasma glucose level in normal mice by oral (p.o.) administration. A neutral polysaccharide (CS-F30) exhibited higher hypoglycemic activity than its crude polysaccharide (CS-OHEP), exhibited by i.p. injection, and it significantly lowered the glucose level by p.o. administration (50 mg/kg). However, it hardly affected the plasma insulin level in normal mice. CS-F30 ([alpha]D + 21 degrees in water) is composed of galactose, glucose and mannose (molar percent, 62:28:10), and its molecular weight is about 45000.
Fruiting bodies of Hericium erinaceus (Bull. Pers. – a new source of water-insoluble (1→3-α-d-glucan
Directory of Open Access Journals (Sweden)
Adrian Wiater
2016-09-01
Full Text Available A water-insoluble polysaccharide (WIP was isolated from the fruiting bodies of Hericium erinaceus HE01 by an alkaline solution with the yield of 5%. Structural and compositional analyses by total acid hydrolysis, methylation analysis, FT-IR, FT-Raman, and 1H NMR spectroscopy as well as other instrumental techniques showed predominantly glucose linked by α-glycosidic bonds and small amounts of mannose, xylose, rhamnose, galactose, and ribose. The methylation analysis showed that (1→3-linked Glcp is the major constituent (70.8% of the polymer, while the 3,4 substituted d-Glcp represents the main branching residue of the glucan. The presence of (1→3-α-d-glucan in the hyphae of H. erinaceus was additionally confirmed by the use of specific fluorophore-labeled antibodies.
Liu, Zi-Jun; Wang, Ya-Lan; Li, Qi-Ling; Yang, Liu
2018-01-01
Cuscuta chinensis polysaccharide (CPS) was extracted using hot water and enzymatically hydrolyzed C. chinensis polysaccharide (ECPS) was produced by the mannase enzymatic hydrolysis process. The purpose of this research was to investigate the antimelanogenic activity of ECPS and CPS in B16F10 melanoma cells. The in vitro antioxidant activity was assessed by their ferric iron reducing power and DPPH free radical scavenging activities. The molecular mass distribution of polysaccharides was determined using SEC-MALLS-RI. CPS was successfully enzymatically degraded using mannase and the weighted average molecular weights of CPS and ECPS were 434.6 kDa and 211.7 kDa. The results of biological activity assays suggested that the enzymatically hydrolyzed polysaccharide had superior antimelanogenic activity and antioxidant effect than the original polysaccharide. ECPS exhibited antimelanogenic activity by down-regulating the expression of tyrosinase, MITF, and TRP-1 without cytotoxic effects in B16F10 melanoma cells. In conclusion, ECPS have the potential to become a skin whitening product.
Shao, Ping; Chen, Meng; Pei, Yaping; Sun, Peilong
2013-08-01
Four different molecular weight sulfated polysaccharides (UFP1, UFP2, UFP3 and UFP4) were extracted and separated from Ulva fasciata by hot water extraction and ultrafiltration. Their chemical and physical characteristics were determined and antioxidant activities were investigated on the basis of superoxide radical assay, hydroxyl radical assay, ABTS radical assay, and reducing power assay. The results showed that four polysaccharides exhibited antioxidant properties, and UFP2 and UFP3, which have lower content of sulfate showed higher antioxidant activities than UFP1 and UFP4, which have higher content of sulfate. Besides, the content of protein, uronic acid and molecular weights of polysaccharides also influence their antioxidant activities. The antioxidant activities of UFP were not a function of a single factor but a combination of several factors. Copyright © 2013 Elsevier B.V. All rights reserved.
Nakamura, Yukiko; Wakabayashi, Kazuyuki; Hoson, Takayuki
2003-01-01
The present study was conducted to investigate the mechanism inducing the difference in the cell wall extensibility of rice (Oryza sativa L. cv. Koshihikari) coleoptiles grown under various temperature (10-50 degrees C) conditions. The growth rate and the cell wall extensibility of rice coleoptiles exhibited the maximum value at 30-40 degrees C, and became smaller as the growth temperature rose or dropped from this temperature range. The amounts of cell wall polysaccharides per unit length of coleoptile increased in coleoptiles grown at 40 degrees C, but not at other temperature conditions. On the other hand, the molecular size of hemicellulosic polysaccharides was small at temperatures where the cell wall extensibility was high (30-40 degrees C). The autolytic activities of cell walls obtained from coleoptiles grown at 30 and 40 degrees C were substantially higher than those grown at 10, 20 and 50 degrees C. Furthermore, the activities of (1-->3),(1-->4)-beta-glucanases extracted from coleoptile cell walls showed a similar tendency. When oat (1-->3),(1-->4)-beta-glucans with high molecular mass were incubated with the cell wall enzyme preparations from coleoptiles grown at various temperature conditions, the extensive molecular mass downshifts were brought about only by the cell wall enzymes obtained from coleoptiles grown at 30-40 degrees C. There were close correlations between the cell wall extensibility and the molecular mass of hemicellulosic polysaccharides or the activity of beta -glucanases. These results suggest that the environmental temperature regulates the cell wall extensibility of rice coleoptiles by modifying mainly the molecular mass of hemicellulosic polysaccharides. Modulation of the activity of beta-glucanases under various temperature conditions may be involved in the alteration of the molecular size of hemicellulosic polysaccharides.
Stephen-Victor, Emmanuel; Karnam, Anupama; Fontaine, Thierry; Beauvais, Anne; Das, Mrinmoy; Hegde, Pushpa; Prakhar, Praveen; Holla, Sahana; Balaji, Kithiganahalli N; Kaveri, Srini V; Latgé, Jean-Paul; Aimanianda, Vishukumar; Bayry, Jagadeesh
2017-12-05
Human dendritic cell (DC) response to α-(1,3)-glucan polysaccharide of Aspergillus fumigatus and ensuing CD4+ T-cell polarization are poorly characterized. α-(1,3)-Glucan was isolated from A. fumigatus conidia and mycelia cell wall. For the analysis of polarization, DCs and autologous naive CD4+ T cells were cocultured. Phenotype of immune cells was analyzed by flow cytometry, and cytokines by enzyme-linked immunosorbent assay (ELISA). Blocking antibodies were used to dissect the role of Toll-like receptor 2 (TLR2) and programmed death-ligand 1 (PD-L1) in regulating α-(1,3)-glucan-mediated DC activation and T-cell responses. DCs from TLR2-deficient mice were additionally used to consolidate the findings. α-(1,3)-Glucan induced the maturation of DCs and was dependent in part on TLR2. "α-(1,3)-Glucan-educated" DCs stimulated the activation of naive T cells and polarized a subset of these cells into CD4+CD25+FoxP3+ regulatory T cells (Tregs). Mechanistically, Treg stimulation by α-(1,3)-glucan was dependent on the PD-L1 pathway that negatively regulated interferon-gamma (IFN-γ) secretion. Short α-(1,3)-oligosaccharides lacked the capacity to induce maturation of DCs but significantly blocked α-(1,3)-glucan-induced Treg polarization. PD-L1 dictates the balance between Treg and IFN-γ responses induced by α-(1,3)-glucan. Our data provide a rationale for the exploitation of immunotherapeutic approaches that target PD-1-PD-L1 to enhance protective immune responses to A. fumigatus infections. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Nammunayathuputhenkotta Krishnankartha Praveen
2013-08-01
Full Text Available Objective: To evaluate the antioxidant and anti-inflammatory potential of the aqueous extract and polysaccharide fraction from two brown marine macroalga, Padina gymnospora (P. gymnospora and Padina tetrastomatica (P. tetrastomatica harvested from Gulf of Mannar of peninsular India. Methods: The antioxidant activity was evaluated using different in vitro systems, viz., 1,1- diphenyl-2-picrylhydrazyl (DPPH, 2, 2′-azino-bis-3ethylbenzothiozoline-6-sulfonic acid diammonium salt (ABTS, H2O2/ HO. radical scavenging, Fe2+ ion chelating ability, and reducing potential. Folin–Ciocalteu method was used to determine the total phenolic content, and the results were expressed as mg of gallic acid equivalents (GE. Thiobarbituric acid-reactive substance formation inhibition assay was employed to assess the ability of the samples to inhibit lipid oxidation in a model system. COXII and LOXV inhibition assays were employed to assess the anti-inflammatory potential of aqueous extract and polysaccharide fraction. Results: The aqueous extract fraction of P. tetrastomatica realized high total phenolic content (288 mg GE/g, and its activity towards scavenging short-lived radicals (OH. and H2O2 (27.8% and 68.3%, respectively; 0.6 mg/mL are higher than those registered for Padina gymnospora. Aqueous extract and polysaccharide fractions of P. gymnospora showed higher anti-inflammatory activities against LOXV (56% and 53%, respectively and COXII (30% and 35%, respectively; 1 mg/mL enzymes. The correlation studies confirmed that polysaccharides present with the Padina sp. are responsible for their anti-inflammatory potential. IR spectral data of polysaccharide fraction revealed the presence of polysaccharide in alginate form and also confirmed the presence of sulphated polysaccharides as principle bioactive constituents. Conclusions: The study revealed that these seaweeds possess beneficial value as human food or health additives and can be used as a natural green
Zhu, Dan-Ye; Ma, Yi-Long; Wang, Cai-Hong; Wang, Hao; Ren, Ya-Fei; Zhang, Jian-Guo; Thakur, Kiran; Wei, Zhao-Jun
2017-12-01
Onion polysaccharides (ACLP) were sequentially extracted with four different solvents (hot buffer, chelating agent, dilute alkaline and concentrated alkaline) and obtained four fractions, named as HBSS, CHSS, DASS and CASS, respectively. The present studies characterized the ACLP concerning its physicochemical and functional properties. Monosaccharides analysis revealed that mannose (81.68%) was the dominant sugar in HBSS and galactose (67.59%) was the most in CASS. Similarly, CHSS and DASS possessed mannose and galactose as major sugar, which were 25.80% and 31.37%, 20.33% and 33.96%, respectively. The obtained molecular weight of ACLPs were 7.702×10 3 (HBSS), 4.690×10 3 (CHSS), 4.943×10 3 (DASS) and 1.390×10 3 kDa (CASS). CASS resulted in the strongest solubility, fat-binding capacity, foam capacity and foam stability whereas, HBSS showed the highest thermal stability. DASS showed the best hygroscopicity and the best moisture retention was obtained by CHSS. Subsequently, the emulsifying activity and emulsifying stability were the highest for HBSS and the longest for of CASS, respectively. The rheological properties of CHSS exhibited the largest viscosity. Our results indicated that all factions could be considered as functional polysaccharides according to their respective characteristics, which have vast potential in food production. Copyright © 2017 Elsevier B.V. All rights reserved.
Deters, Alexandra; Zippel, Janina; Hellenbrand, Nils; Pappai, Dirk; Possemeyer, Cathleen; Hensel, Andreas
2010-01-08
Aqueous extracts from the roots of Althea officinalis L. (Malvaceae) are widely used for treatment of irritated mucosa. The clinical proven effects are related to the presence of bioadhesive and mucilaginous polysaccharides from the rhamnogalacturonan type, leading to the physical formation of mucin-like on top of the irritated tissues. No data are available if the extracts or the polysaccharides from these extract exert an active influence on mucosal or connective tissue cells, in order to initiated changes in cell physiology, useful for better tissue regeneration. In vitro investigations of aqueous A. officinalis extract AE and raw polysaccharides (RPS) on epithelial KB cells and primary dermal human fibroblasts (pNHF) using WST1 vitality test and BrdU proliferation ELISA. Gene expression analysis by microarray from KB cells. Internalisation studies of polysaccharides were performed by laser scanning microscopy. AE (1, 10 microg/mL) had stimulating effect on cell viability and proliferation of epithelial KB cells. RPS (1, 10 microg/mL) stimulated cell vitality of epithelial cells significantly without triggering the cells into higher proliferation status. Neither AE nor RPS had any effect on fibroblasts. FITC-labeled RPS was shown to be internalised into epithelial cells, but not into fibroblasts. FITC-RPS was shown to form bioadhesive layers on the cell surface of dermal fibroblasts. Microarray analysis indicated an up-regulation of genes related to cell adhesion proteins, growth regulators, extracellular matrix, cytokine release and apoptosis. Aqueous extracts and polysaccharides from the roots of A. officinalis are effective stimulators of cell physiology of epithelial cells which can prove the traditional use of Marshmallow preparations for treatment of irritated mucous membranes within tissue regeneration. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
Yang, Pengjie; Zhou, Mingda; Zhou, Chengyun; Wang, Qian; Zhang, Fangfang; Chen, Jian
2015-02-01
A novel method to separate and purify tea seed polysaccharide and tea seed saponin from camellia cake extract by macroporous resin was developed. Among four kinds of resins (AB-8, NKA-9, XDA-6, and D4020) tested, AB-8 macroporous resin possessed optimal separating capacity for the two substances and thus was selected for the separation, in which deionized water was used to elute tea seed polysaccharide, 0.25% NaOH solution to remove the undesired pigments, and 90% ethanol to elute tea seed saponin. Further dynamic adsorption/desorption experiments on AB-8 resin-based column chromatography were conducted to obtain the optimal parameters. Under optimal dynamic adsorption and desorption conditions, 18.7 and 11.8% yield of tea seed polysaccharide and tea seed saponin were obtained with purities of 89.2 and 96.0%, respectively. The developed method provides a potential approach for the large-scale production of tea seed polysaccharide and tea seed saponin from camellia cake. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pawar, Harshal Ashok; Gavasane, Amit Jagannath; Choudhary, Pritam Dinesh
2018-08-01
The objective of the present work was to isolate and characterize polysaccharide from fruits of Cordia dichotoma G. Forst. (Family Boraginaceae). Polysaccharide was isolated by using 1% Hydrochloric acid solution. The isolated polysaccharide was tested for physicochemical characteristics such as solubility, pH (1% w/w in water), swelling capacity, loss on drying, ash value, bulk and tapped density, Carr's capacity, Hausner's ratio and angle of repose. Also isolated polysaccharide was characterized by Differential scanning colorimeter (DSC), Estimation of total sugar content, Rheological study and infrared spectroscopy (FT-IR). The isolated mucilage showed positive results for Molisch's test and negative for Ruthenium red test which indicated presence of carbohydrate and gum. The result of physicochemical characteristics reveals that isolated Cordia dichotoma polysaccharide possesses good flow properties. The total polysaccharide content of Cordia dichotoma polymer isolate was found to be 86.24% (w/w). From this study it can be concluded that the polysaccharide isolated from Cordia dichotoma fruits has the required properties and could be used as an excipient for pharmaceutical dosage forms. Copyright © 2018 Elsevier B.V. All rights reserved.
Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A
2016-01-01
Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Ghai, Jyotsna; Ghai, S.K.; Kalra, M.S.
1983-01-01
Rhizobium trifolii 11B, which formed effective nodules on its host. Trifolium alexanderinum L. was UV-irradiated to isolate mutants. Out of the 9 variants isolated only 1 strain, viz. 21M11B produced more water soluble polysaccharide [752 mg (100 ml -1 )] than the parent 15 different antibiotics was similar only in two (22M11B and 26M11B) of the 9 UV-mutants. Compositional studies revealed that the water soluble polysaccharides from all strains contained glucose and galactose in the molar ratio of 7:1. Glucuronic acid which was present (2.33 per cent) in the water soluble polysaccharide from strain 11B was absent in all but 2UV-mutants (4.22per cent in 6M11B and 4.04per cent in26M11B). Five of the UB-mutants (1M11B, 17M11B, 20N11B, 22M11B and 26M11B) were Nod - . The organisms which produced more water soluble polysaccharide upon infection of the plants induced the formation of more number of nodules. (author)
Prospecting for Energy-Rich Renewable Raw Materials: Agave Leaf Case Study.
Corbin, Kendall R; Byrt, Caitlin S; Bauer, Stefan; DeBolt, Seth; Chambers, Don; Holtum, Joseph A M; Karem, Ghazwan; Henderson, Marilyn; Lahnstein, Jelle; Beahan, Cherie T; Bacic, Antony; Fincher, Geoffrey B; Betts, Natalie S; Burton, Rachel A
2015-01-01
Plant biomass from different species is heterogeneous, and this diversity in composition can be mined to identify materials of value to fuel and chemical industries. Agave produces high yields of energy-rich biomass, and the sugar-rich stem tissue has traditionally been used to make alcoholic beverages. Here, the compositions of Agave americana and Agave tequilana leaves are determined, particularly in the context of bioethanol production. Agave leaf cell wall polysaccharide content was characterized by linkage analysis, non-cellulosic polysaccharides such as pectins were observed by immuno-microscopy, and leaf juice composition was determined by liquid chromatography. Agave leaves are fruit-like--rich in moisture, soluble sugars and pectin. The dry leaf fiber was composed of crystalline cellulose (47-50% w/w) and non-cellulosic polysaccharides (16-22% w/w), and whole leaves were low in lignin (9-13% w/w). Of the dry mass of whole Agave leaves, 85-95% consisted of soluble sugars, cellulose, non-cellulosic polysaccharides, lignin, acetate, protein and minerals. Juice pressed from the Agave leaves accounted for 69% of the fresh weight and was rich in glucose and fructose. Hydrolysis of the fructan oligosaccharides doubled the amount of fermentable fructose in A. tequilana leaf juice samples and the concentration of fermentable hexose sugars was 41-48 g/L. In agricultural production systems such as the tequila making, Agave leaves are discarded as waste. Theoretically, up to 4000 L/ha/yr of bioethanol could be produced from juice extracted from waste Agave leaves. Using standard Saccharomyces cerevisiae strains to ferment Agave juice, we observed ethanol yields that were 66% of the theoretical yields. These data indicate that Agave could rival currently used bioethanol feedstocks, particularly if the fermentation organisms and conditions were adapted to suit Agave leaf composition.
Prospecting for Energy-Rich Renewable Raw Materials: Agave Leaf Case Study.
Directory of Open Access Journals (Sweden)
Kendall R Corbin
Full Text Available Plant biomass from different species is heterogeneous, and this diversity in composition can be mined to identify materials of value to fuel and chemical industries. Agave produces high yields of energy-rich biomass, and the sugar-rich stem tissue has traditionally been used to make alcoholic beverages. Here, the compositions of Agave americana and Agave tequilana leaves are determined, particularly in the context of bioethanol production. Agave leaf cell wall polysaccharide content was characterized by linkage analysis, non-cellulosic polysaccharides such as pectins were observed by immuno-microscopy, and leaf juice composition was determined by liquid chromatography. Agave leaves are fruit-like--rich in moisture, soluble sugars and pectin. The dry leaf fiber was composed of crystalline cellulose (47-50% w/w and non-cellulosic polysaccharides (16-22% w/w, and whole leaves were low in lignin (9-13% w/w. Of the dry mass of whole Agave leaves, 85-95% consisted of soluble sugars, cellulose, non-cellulosic polysaccharides, lignin, acetate, protein and minerals. Juice pressed from the Agave leaves accounted for 69% of the fresh weight and was rich in glucose and fructose. Hydrolysis of the fructan oligosaccharides doubled the amount of fermentable fructose in A. tequilana leaf juice samples and the concentration of fermentable hexose sugars was 41-48 g/L. In agricultural production systems such as the tequila making, Agave leaves are discarded as waste. Theoretically, up to 4000 L/ha/yr of bioethanol could be produced from juice extracted from waste Agave leaves. Using standard Saccharomyces cerevisiae strains to ferment Agave juice, we observed ethanol yields that were 66% of the theoretical yields. These data indicate that Agave could rival currently used bioethanol feedstocks, particularly if the fermentation organisms and conditions were adapted to suit Agave leaf composition.
International Nuclear Information System (INIS)
Liu, S.; Tian, Z.; Li, X.; He, P.; Xu, C.
2015-01-01
Ultrasound-assisted extraction (UAE) of pectic Polysaccharide from oriental tobacco leaves was studied by orthogonal matrix method (L9(3)4). Furthermore, the crude Polysaccharide was purified and two components (Fr-I and Fr-II) were obtained. FT-IR spectral analysis of the purified EPS revealed prominent characteristic groups. The monosaccharide composition analysis indicated the main composition between Fr-I and Fr-II was different. Furthermore, thermo gravimetric analysis (TGA) indicated the degradation temperature (Td) of the Fr-I (215 degree C) was higher than those of Fr-II (162 degree C). Detected by the pyrolysis GC/MS, though the main kinds of pyrolysis products from both Fr-I and Fr-II were similar, the larger amount of heterocycle and aromatic compounds liberated after hydrolysis of Fr-II. Finally, On the basis of the antioxidant activity test in vitro, Fr-II has stronger antioxidant activities than Fr-I. The thermal behavior and antioxidant activity might be attributed to the configuration of the sugar units and chemical compositions. (author)
Defining Starch Binding by Glucan Phosphatases
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2015-01-01
Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...
Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long
2015-01-01
In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.
He, Chunmei; Wu, Kunlin; Zhang, Jianxia; Liu, Xuncheng; Zeng, Songjun; Yu, Zhenming; Zhang, Xinghua; Teixeira da Silva, Jaime A.; Deng, Rufang; Tan, Jianwen; Luo, Jianping; Duan, Jun
2017-01-01
Dendrobium officinale is a precious traditional Chinese medicinal plant because of its abundant polysaccharides found in stems. We determined the composition of water-soluble polysaccharides and starch content in D. officinale stems. The extracted water-soluble polysaccharide content was as high as 35% (w/w). Analysis of the composition of monosaccharides showed that the water-soluble polysaccharides were dominated by mannose, to a lesser extent glucose, and a small amount of galactose, in a ...
Haemolytic and Antimicrobial Activites of Saponin-Rich Extracts from Guar Meal
Saponin-rich GM extract was prepared by refluxing 25 g of GM with 250 ml of EtOH/H2O (1:1, v/v) for 3 h then filtering and distilling EtOH at 50oC. The refluxed extract was partitioned with equal volume of BuOH obtaining crude saponin-rich GM extract with 4.8 ± 0.6% DM of GM that was purified by RP...
Antunes, Sílvia; Freitas, Filomena; Alves, Vítor D; Grandfils, Christian; Reis, Maria A M
2015-09-20
Cheese whey was used as the sole substrate for the production of extracellular polysaccharides (EPS) by Enterobacter A47. An EPS concentration of 6.40 g L(-1) was reached within 3.2 days of cultivation, corresponding to a volumetric productivity of 2.00 g L(-1) d(-1). The produced EPS was mainly composed of glucuronic acid (29 mol%) and fucose (29 mol%), with lower contents of glucose and galactose (21 mol% each) and a total acyl groups content of 32 wt.%. The polymer had an average molecular weight of 1.8×10(6) Da, with a polydispersity index of 1.2, and an intrinsic viscosity of 8.0 dL g(-1). EPS aqueous solutions (1.0 wt.% in 0.01 M NaCl, at pH 8.0) presented a shear thinning behavior with a viscosity of the first Newtonian plateau approaching 0.1 Pas. This novel glucuronic acid-rich polymer possesses interesting rheological properties, which, together with its high content of glucuronic acid and fucose, two bioactive sugar monomers, confers it a great potential for use in high-value applications, such as cosmetics and pharmaceuticals. Copyright © 2015 Elsevier B.V. All rights reserved.
Nguyen, An Thi-Binh; Nigen, Michaël; Jimenez, Luciana; Ait-Abderrahim, Hassina; Marchesseau, Sylvie; Picart-Palmade, Laetitia
2018-01-15
Dextran or xanthan were used as model exocellular polysaccharides (EPS) to compare the extraction efficiency of EPS from skim milk acid gels using three different protocols. Extraction yields, residual protein concentrations and the macromolecular properties of extracted EPS were determined. For both model EPS, the highest extraction yield (∼80%) was obtained when samples were heated in acidic conditions at the first step of extraction (Protocol 1). Protocols that contained steps of acid/ethanol precipitation without heating (Protocols 2 and 3) show lower extraction yields (∼55%) but allow a better preservation of the EPS macromolecular properties. Changing the pH of acid gels up to 7 before extraction (Protocol 3) improved the extraction yield of anionic EPS without effect on the macromolecular properties of EPS. Protocol 1 was then applied for the quantification of EPS produced during the yogurt fermentation, while Protocol 3 was dedicated to their macromolecular characterization. Copyright © 2017 Elsevier Ltd. All rights reserved.
β-1,3-glucan in developing cotton fibers
International Nuclear Information System (INIS)
Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.
1979-01-01
Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis
Characterization of active polysaccharides of HemoHIM
Energy Technology Data Exchange (ETDEWEB)
Shin, Kwang Sun; Shin, Myeong Suk; Bae, Beom Seon; Hwang, Yong Cheol [Kyonggi University, Suwon (Korea, Republic of); Ryu, Kwang Won [Chungju University, Chungju (Korea, Republic of)
2007-07-15
In this study, we aimed to elucidate the detailed structure and active moiety of polysaccharide, one of the active constituents of immune and hematopoietic modulating activities of HemoHIM. We first isolated the polysaccharide fractions from the hot water extracts of the each ingredient herbs (A. gigas, P. janonica, C. officinale) of HemoHIM and their mixture. These polysaccharides were composed of neutral (85.32-92.73%) and acidic (4.25-7.88%) saccharides, proteins (0.16-4.02%), and polyphenols (2.09-5.37%). The hydrolytic analysis of polysaccharide fractions showed that they commonly showed higher arabinose, galactose, and galacturonic acid contents. These result suggested that these polysaccharides may have higher contents of rhamnogalacturonan among pectic substances and the main active moiety is composed of polysaccharides. The anion exchange chromatography of HemoHIM and each ingredient herb extract using DEAE-Sepharose FF (Cl- form) column resulted in 1 non-adsorption and 8 adsorption fractions. The analysis of immune activity (lymphocyte proliferation) on these fractions showed that the fractions obtained by higher salt concentration carried the higher activity, but all fractions showed considerable immune activity
Characterization of active polysaccharides of HemoHIM
International Nuclear Information System (INIS)
Shin, Kwang Sun; Shin, Myeong Suk; Bae, Beom Seon; Hwang, Yong Cheol; Ryu, Kwang Won
2007-07-01
In this study, we aimed to elucidate the detailed structure and active moiety of polysaccharide, one of the active constituents of immune and hematopoietic modulating activities of HemoHIM. We first isolated the polysaccharide fractions from the hot water extracts of the each ingredient herbs (A. gigas, P. janonica, C. officinale) of HemoHIM and their mixture. These polysaccharides were composed of neutral (85.32-92.73%) and acidic (4.25-7.88%) saccharides, proteins (0.16-4.02%), and polyphenols (2.09-5.37%). The hydrolytic analysis of polysaccharide fractions showed that they commonly showed higher arabinose, galactose, and galacturonic acid contents. These result suggested that these polysaccharides may have higher contents of rhamnogalacturonan among pectic substances and the main active moiety is composed of polysaccharides. The anion exchange chromatography of HemoHIM and each ingredient herb extract using DEAE-Sepharose FF (Cl- form) column resulted in 1 non-adsorption and 8 adsorption fractions. The analysis of immune activity (lymphocyte proliferation) on these fractions showed that the fractions obtained by higher salt concentration carried the higher activity, but all fractions showed considerable immune activity
The anti-inflammatory effects of flavanol-rich lychee fruit extract in rat hepatocytes.
Directory of Open Access Journals (Sweden)
Ryota Yamanishi
Full Text Available Flavanol (flavan-3-ol-rich lychee fruit extract (FRLFE is a mixture of oligomerized polyphenols primarily derived from lychee fruit and is rich in flavanol monomers, dimers, and trimers. Supplementation with this functional food has been shown to suppress inflammation and tissue damage caused by high-intensity exercise training. However, it is unclear whether FRLFE has in vitro anti-inflammatory effects, such as suppressing the production of the proinflammatory cytokine tumor necrosis factor α (TNF-α and the proinflammatory mediator nitric oxide (NO, which is synthesized by inducible nitric oxide synthase (iNOS. Here, we analyzed the effects of FRLFE and its constituents on the expression of inflammatory genes in interleukin 1β (IL-1β-treated rat hepatocytes. FRLFE decreased the mRNA and protein expression of the iNOS gene, leading to the suppression of IL-1β-induced NO production. FRLFE also decreased the levels of the iNOS antisense transcript, which stabilizes iNOS mRNA. By contrast, unprocessed lychee fruit extract, which is rich in flavanol polymers, and flavanol monomers had little effect on NO production. When a construct harboring the iNOS promoter fused to the firefly luciferase gene was used, FRLFE decreased the luciferase activity in the presence of IL-1β, suggesting that FRLFE suppresses the promoter activity of the iNOS gene at the transcriptional level. Electrophoretic mobility shift assays indicated that FRLFE reduced the nuclear transport of a key regulator, nuclear factor κB (NF-κB. Furthermore, FRLFE inhibited the phosphorylation of NF-κB inhibitor α (IκB-α. FRLFE also reduced the mRNA levels of NF-κB target genes encoding cytokines and chemokines, such as TNF-α. Therefore, FRLFE inhibited NF-κB activation and nuclear translocation to suppress the expression of these inflammatory genes. Our results suggest that flavanols may be responsible for the anti-inflammatory and hepatoprotective effects of FRLFE and may be
Directory of Open Access Journals (Sweden)
Vicente Arturo Lara-Valencia
Full Text Available This paper reports the use of polysaccharides extracted from seed of Persea americana var. Hass in the synthesis of acrylic hydrogels. The effects of the chemical composition (acrylamide/acrylic acid, the concentration of crosslinking agent (glycerol diacrylate and the type of initiation (redox, photoinitiation of the hydrogels were evaluated with and without polysaccharides. Xerogels were characterized by FTIR spectroscopy, differential scanning calorimetry (DSC and scanning electron microscopy (SEM, while for the swollen hydrogels the swelling kinetic and mechanical properties were evaluated. The kinetic parameters were obtained using the second order equation proposed by Schott, where it is reported that by increasing the concentration of the crosslinking agent, the degree of swelling is reduced because of the greater structural level. The increase of the amount of acrylamide and the amount of polysaccharides causes also a decrease in the swelling degree. The type of initiation also affected the hydrogels swelling kinetic, the photoinitiated hydrogels were the ones that captured less water. Moreover, the increasing of the glass transition temperature and the compression modulus with the crosslinking agent concentration and molar ratio AAm/AAc are observed for hydrogels with and without polysaccharides. The results demonstrate a successful incorporation of polysaccharides into the polymeric network.
Energy Technology Data Exchange (ETDEWEB)
Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.
2017-08-15
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Thompson, David N; Apel, William A; Thompson, Vicki S; Ward, Thomas E
2013-07-23
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Energy Technology Data Exchange (ETDEWEB)
Thompson, David N.; Apel, William A.; Thompson, Vicki S.; Ward, Thomas E.
2016-03-22
A genetically modified organism comprising: at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, xylan-, glucan-, galactan-, or mannan-decorating groups; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Ma, Huiying; Zhang, Keke; Jiang, Qing; Dai, Diya; Li, Hongli; Bi, Wentao; Chen, David Da Yong
2018-04-27
Plant polysaccharides have numerous medicinal functions. Due to the differences in their origins, regions of production, and cultivation conditions, the quality and the functions of polysaccharides can vary significantly. They are macromolecules with large molecular weight (MW) and complex structure, and pose great challenge for the analytical technology used. Taking Dendrobium officinale (DO) from various origins and locations as model samples. In this investigation, mechanochemical extraction method was used to successfully extract polysaccharides from DO using water as solvent, the process is simple, fast (40 s) and with high yield. The MWs of the intact saccharides from calibration curve and light scattering measurement were determined and compared after separation with size exclusion chromatography (SEC). The large polysaccharide was acid hydrolyzed to oligosaccharides and the products were efficiently separated and identified using liquid chromatography coupled to a high resolution tandem mass spectrometry (LC-MS 2 ). Obvious differences were observed among LC-MS 2 chromatograms of digested products, and the chemical structures for the products were proposed based on accurate mass values. More importantly, isomeric digested carbohydrate compounds were explored and characterized. All the chromatographic and mass spectrometric results in this study provided a multi-dimensional characterization, fingerprint analysis, and molecular structure level assessment of plant polysaccharides. Copyright © 2018 Elsevier B.V. All rights reserved.
Liu, Jun; Bai, Ruyu; Liu, Yunpeng; Zhang, Xin; Kan, Juan; Jin, Changhai
2018-02-01
In recent years, several medicinal plants have been demonstrated as valuable resources of naturally occurring polysaccharide-polyphenolic conjugates. For the first time, this article introduces recent advances of polysaccharide-polyphenolic conjugates isolated from different medicinal plants. The isolation, purification, structural characterization and biological activities of polysaccharide-polyphenolic conjugates are introduced in details. In general, polysaccharide-polyphenolic conjugates can be isolated by hot water or alkaline extraction followed by purification through anion exchange chromatography or gel filtration chromatography. The structures of conjugates are usually characterized by chemical composition analysis, UV-vis, Fourier-transform infrared and nuclear magnetic resonance spectroscopy. Moreover, polysaccharide-polyphenolic conjugates exhibit several biological activities including anticoagulant, antioxidant, radioprotective, anti-platelet, antitussive and bronchodilatory effects. Therefore, polysaccharide-polyphenolic conjugates isolated from medicinal plants are certain to have a bright prospect in the field of food and pharmaceutics. Copyright © 2017 Elsevier B.V. All rights reserved.
Kozarski, M.; Klaus, A.; Niksic, M.; Vrvic, M.M.; Todorovic, N.; Jakovljevic, D.; Griensven, van L.J.L.D.
2012-01-01
Antioxidant activities of polysaccharide extracts of four of the most widely known mushrooms often used in medicinal applications as well as in tea and food, namely Ganoderma applanatum, Ganoderma lucidum, Lentinus edodes and Trametes versicolor, were studied. G. applanatum and L edodes extracts
Directory of Open Access Journals (Sweden)
Mostafa Mohamed El-Sheekh
2012-11-01
Full Text Available This is an investigation concerned with studying the possible adaptive response of four different unicellular algae, Anabaena PCC 7120, Oscillatoria angustissima, Scendesmus obliquus and Chlorella vulgaris, to the toxin of Microcystis aeruginosa (Kützing. Theeffects of four different concentrations, 25, 50, 100 and 200 μg mL-1 of microcystins crude extract of M. aeruginosa, on both intra and extra-cellular polysaccharide levels, in log phase,of the four tested algae were studied. The obtained results showed differential increase in the production levels for both intra and extra-cellular polysaccharides by the tested algae,compared with the control. S. obliquus and C. vulgaris showed a resistance to crude toxinhigher than Anabaena PCC 7120 and O. angustissima. The highly production of polysaccharides by green algal species under this toxic stress indicated the involvement of these polysaccharides in protecting the algal cells against toxic species and, reflect thebiological behavior of particular algal species to the environmental stresses.
Zhang, Zhongshan; Wang, Xiaomei; Li, Jingfen; Wang, Guozhi; Mao, Genxiang
2016-03-01
In this study, the optimization of the extraction conditions of polysaccharide from 'Anji Baicha' (Camellia sinensis (L.) O. Kuntze) (AP) was investigated by response surface methodology (RSM). Three main independent variables (extraction temperature, time, ratio of water to raw material) were taken into consideration. And then the free radical scavenging activities of the sample were investigated including scavenging effects of superoxide and hydroxyl radicals. The RSM analysis showed good correspondence between experimental and predicted values.. The optimal condition to obtain the highest yield of AP was determined as follows: temperature 76.79 °C, time 2.48 h, ratio of water to material 22.53 mL/g. For the free radical scavenging activity, the IC50 values of Vc and AP were 7.78 and 83.25 μg/mL. And for the scavenging effect on hydroxyl radical, that of AP and Vc were 1.80 and 1.69 mg/mL. AP showed excellent antioxidant activity. This exhibited AP had a good potential for antioxidant. The purification and structure needs to be study in further. Copyright © 2015 Elsevier B.V. All rights reserved.
Plants with elevated levels of glucan
Energy Technology Data Exchange (ETDEWEB)
Pauly, Markus; Kraemer, Florian J.; Hake, Sarah
2018-03-20
The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.
Raish, Mohammad
2017-04-01
The polysaccharide extract of Momordica charantia has various biological activities; however, its effect on endothelial dysfunction in myocardial infarction remains unclear. To elucidate this, myocardial infarction was induced in rats using isoproterenol (ISP). Pretreatment with M. charantia polysaccharides (MCP; 150 or 300mg/kg) for 25days significantly inhibited increases in heart weight, the heart-weight-to-body-weight ratio, and infarction size, and ameliorated the increased serum levels of aspartate transaminase, creatine kinase, lactate dehydrogenase, total cholesterol, triglycerides, very-low-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol. In addition, MCP enhanced the activity of superoxide dismutase, catalase, and non-protein sulfhydryls, and decreased the level of lipid peroxidation. Moreover, MCP pretreatment downregulated the expression of proinflammatory cytokines (tumor necrosis factor alpha, interleukin (IL)-6, and IL-10), inflammatory markers (nitric oxide, myeloperoxidase, and inducible nitric oxide synthase), and apoptotic markers (caspase-3 and BAX), and upregulated Bcl-2 expression. Pretreatment with MCP reduced myonecrosis, edema, and inflammatory cell infiltration, and restored cardiomyocytes architecture. This myocardial protective effect could be related to the enhancement of the antioxidant defense system through the nuclear factor kappa B (NF-kB) pathways, and to anti-apoptosis through regulation of Bax, caspase-3, and Bcl-2. Copyright © 2017 Elsevier B.V. All rights reserved.
A mini-review of chemical and biological properties of polysaccharides from Momordica charantia.
Zhang, Fan; Lin, Lihua; Xie, Jianhua
2016-11-01
Recently, isolation and characterization of bioactive polysaccharides from natural resources have attracted increasing interest. Momordica charantia L. (M. charantia), belongs to the Curcubitaceae family, which is widely distributed in the tropical and subtropical regions of the world, and has been used as herbal medicine and a vegetable for thousands of years. M. charantia polysaccharides, as major active ingredients of M. charantia, have attracted a great deal of attention because of their various biological activities, such as antitumor, immunomodulation, antioxidant, anti-diabetes, radioprotection, and hepatoprotection. The present review provides the most complete summary of the research progress on the polysaccharides isolated from M. charantia, including the extraction, separation, physical-chemical properties, structural characteristics, and bioactivities during the last ten years. This review also provides a foundation for the further development and application in the field of M. charantia polysaccharides. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Gabriela Paun
Full Text Available ABSTRACT This study evaluated the anti-inflammatory and antioxidant activities of Impatiens noli-tangere L., Balsaminaceae, and of Stachys officinalis L., Lamiaceae, polyphenolic-rich extracts obtained by nanofiltration process. Results showed the great potential and efficiency of the nanofiltration process to concentrate the herbal extract's main polyphenolic compounds (over 91% phenolic acids and flavonoids retention. S. officinalis polyphenolic-rich extracts had high antioxidant activities (IC50 2.5 µg/ml compared to I. noli-tangere polyphenolic-rich extracts (IC50 19.3 µg/ml and similar with that of ascorbic acid. Polyphenolic-rich extracts were investigated to determine the pro-inflammatory enzymes lipoxygenase, cyclooxygenase-1 and cyclooxygenase-2 and their inhibitory activity. Furthermore, high inhibitory activity of the examined extracts was reported for the first time, for both lipoxygenase (IC50 2.46 and 1.22 µg/ml for I. noli-tangere and S. officinalis polyphenolic-rich extracts, respectively, cyclooxygenase-1 (IC50 18.4 and 10.1 µg/ml for I. noli-tangere and S. officinalis polyphenolic-rich extracts, respectively and cyclooxygenase-2 (IC50 = 1.9 and 1.2 mg/ml for I. noli-tangere and S. officinalis polyphenolic-rich extracts, respectively. Additionally, the in vivo studies showed that S. officinalis polyphenolic-rich extract has a higher anti-inflammatory effect, the hind-paw volume employed for both models determined that I. noli-tangere polyphenolic-rich extract and is also higher than that of diclofenac. It was noticed that their anti-inflammatory effect persists for more than 24 h. The I. noli-tangere and S. officinalis polyphenolic-rich extracts exert anti-inflammatory and antioxidant activities and these properties can be at least partly assigned to the presence of ursolic acid, caffeic acid, rosmarinic acid, quercetin and also anthocyanidins (genistin. The obtained results indicate the anti-inflammatory potential of the
Glucan: mechanisms involved in its radioprotective effect
International Nuclear Information System (INIS)
Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.
1987-01-01
It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested
International Nuclear Information System (INIS)
Choi, Jong Il; Lee, Ju Won; Kim, Jae Hun; Yoon, Yo Han; Song, Beom Seok; Yoon, Min Chul; Sung, Nak Yun; Lee, Hak Jyung
2010-06-01
By reason of Undaria pinnatifida growth is temperature dependent, U. pinnatifida produced in April and May are obtained as the main byproducts and it is normally wasted. The objective of the this study was investigated to the improvement of extraction process and physiological activities of polysaccharides from U. pinnatifida by gamma irradiation. The extraction yield of fucoidan and laminarrin was increased by gamma irradiation, and the molecular weight of extracted polysaccharides was decreased by irradiation. The effect of gamma irradiation on storage of U. pinnatifida was investigated. No viable cells were observed in samples irradiated at 3 and 5 kGy. Finally, fucoidan and laminarin were applied in the pork patty, and it was shown that lower lipid oxidation and positive effect on microbial stability and quality of the pork patty. These results will suggest that radiation technology can be applied for the extraction of functional materials and storages safe of the seaweeds
Allergens and β-Glucans in Dutch Homes and Schools: Characterizing Airborne Levels
Krop, Esmeralda J. M.; Jacobs, José H.; Sander, Ingrid; Raulf-Heimsoth, Monika; Heederik, Dick J. J.
2014-01-01
Background Indoor air quality has an effect on respiratory health. Children are more vulnerable to a decreased indoor air quality as their lungs are still developing. We measured levels of allergens and β-(1,3)-glucans in 19 school buildings and determined whether measured levels could be reproduced. School levels were compared to those in 169 homes and the effect of building characteristics on both home and school exposure was explored. Methods Electrostatic Dust fall Collectors were placed in school buildings for 8 weeks and in homes for 2 weeks to collect settled airborne dust. Cat, dog, and mouse allergen levels, domestic mite antigen levels and β-(1,3)-glucans were measured in the extracts from the collectors. Results were corrected for sampling duration. Using questionnaire data, relations between measured levels and building and classroom characteristics were explored. Results In schools, exposure levels were highest in classrooms and were influenced by the socioeconomic status of the children, the season measurements were performed, moisture status of the building and pet ownership. Repeated measurements in different seasons and over the years showed significantly different levels. Home exposure was influenced by socioeconomic status, occupancy and pet ownership. Domestic mite antigen was found in higher levels in extracts from homes compared to schools while pet allergen levels were 13 times higher in schools compared to homes without pets. For mouse allergen overall levels of exposure were low but still two times higher in schools compared to homes. Levels of β-(1,3)-glucans were also approximately two times higher in schools than in homes. Conclusion Exposure levels of several allergens and β-(1,3)-glucans in schools differ over time and are higher than in homes. For children, exposure levels measured at school could contribute to their total exposure as especially animal allergen levels can be much higher in schools compared to homes. PMID:24551183
Directory of Open Access Journals (Sweden)
RISHIKESH SHUKLA
2012-01-01
Full Text Available The present investigation focuses on screening and optimization of media components to enhance glucansucrase and glucan production by Pediococcus pentosaceus CRAG3 at shake-flask and bioreactor level using Taguchi orthogonal array design. A three-level Taguchi orthogonal array layout of L27 (33 was employed, in which six variables were studied for their influence on glucansucrase and glucan production. The results showed that sucrose, K2HPO4 and Tween-80 were the most significant factors to improve glucansucrase production while the glucan production was mostly affected by sucrose, peptone and K2HPO4. The optimized medium composition for maximum glucansucrase and glucan production were: sucrose 3.5% and 5%; yeast extract 0.2% and 2.0%; beef extract 0.5% and 0.5%; peptone 3.0% and 1.0%; K2HPO4 0.2% and 0.2%, and Tween-80 1.0 and 0.1%, respectively. The optimized medium gave 10.1 U/ml and 10.2 U/ml glucansucrase activity while glucan concentrations were 56 mg/ml and 80 mg/ml in shake flask and bioreactor level, respectively which were in good agreement with predicted values (10.1 U/ml and 54.5 mg/ml. The optimized medium gave 2 fold enhancement in enzyme activity and 4 fold increase in glucan concentration as compared to non-optimized medium (4.5 U/ml and 15 mg/ml, respectively at shake flask level.
Directory of Open Access Journals (Sweden)
Rodrigo Juliano Oliveira
2013-01-01
Full Text Available Ample evidence suggests that cancer is triggered by mutagenic damage and diets or supplements capable of reducing such incidences can be related to the prevention of neoplasy development or to an improvement in life quality of patients who undergo chemotherapy. This research aimed to evaluate the antimutagenic and antigenotoxic activity of β-glucan. We set up 8 experimental groups: control (Group 1, cyclophosphamide (Group 2, Groups 3-5 to assess the effect of β-glucan administration, and Groups 6-8 to evaluate the association between cyclophosphamide and β-glucan. The intraperitonial concentrations of β-glucan used were 100, 150 and 200 mg/kg. Micronucleus and comet assays showed that within the first week of treatment β-glucan presented a damage reduction rate between 100-62.04% and 94.34-59.52% for mutagenic and genotoxic damages, respectively. This activity decreased as the treatment was extended. During the sixth week of treatment antimutagenicity rates were reduced to 59.51-39.83% and antigenotoxicity was not effective. This leads to the conclusion that the efficacy of β-glucan in preventing DNA damage is limited when treatment is extended, and that its use as a chemotherapeutic adjuvant need to be better clarified.
Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H
1990-04-01
Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.
Afolabi, Olakunle Bamikole; Oloyede, Omotade Ibidun; Agunbiade, Shadrack Oludare
2018-05-01
The current study was designed to evaluate the various antioxidant potentials and inhibitory effects of phenolic-rich leaf extracts of Bridelia ferruginea (BF) on the in vitro activities of some key enzymes involved in the metabolism of carbohydrates. In this study, BF leaf free and bound phenolic-rich extracts were used. We quantified total phenolic and flavonoid contents, and evaluated several antioxidant activities using assays for ferric reducing antioxidant power, total antioxidant activity (phosphomolybdenum reducing ability), 1,1-diphenyl-2-picrylhydrazyl and thiobarbituric acid reactive species. Also, extracts were tested for their ability to inhibit α-amylase and α-glucosidase activity. The total phenolic and total flavonoid contents in the free phenolic extract of BF were significantly greater than in the bound phenolic extract. Also, all the antioxidant activities considered were significantly greater in the free phenolic extract than in the bound phenolic extract. In the same vein, the free phenolic-rich extract had a significantly higher percentage inhibition against α-glucosidase activity (IC 50 = 28.5 µg/mL) than the bound phenolic extract (IC 50 = 340.0 µg/mL). On the contrary, the free phenolic extract (IC 50 = 210.0 µg/mL) had significantly lower inhibition against α-amylase than the bound phenolic-rich extract (IC 50 = 190.0 µg/mL). The phenolic-rich extracts of BF leaves showed antioxidant potentials and inhibited two key carbohydrate-metabolizing enzymes in vitro. Copyright © 2018 Shanghai Changhai Hospital. Published by Elsevier B.V. All rights reserved.
Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.
2018-03-01
Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.
de O Moreira, Isabela; Passos, Thaís S; Chiapinni, Claudete; Silveira, Gabrielle K; Souza, Joana C M; Coca-Vellarde, Luis Guillermo; Deliza, Rosires; de Lima Araújo, Kátia G
2012-02-01
Phycobiliproteins are coloured proteins produced by cyanobacteria, which have several applications because of their colour properties. However, there is no available information about the colour stability of phycobiliproteins from Nostoc sp. in food systems. The aim of this work was to study the colour stability of a purple-coloured phycobiliprotein-rich extract from the cyanobacterium Nostoc PCC9205 in acidic solutions and yogurt. Variations of pH for Nostoc PCC9205 extract have shown stability for the L* (lightness) and a* (redness) indexes in the range 1.0-7.0. The b* index (blueness), however, increased at pH values below 4.0, indicating loss of the blue colour. The Nostoc PCC9205 extract was used as colorant in yogurt (pH 4.17) stored for 60 days. Instrumental colour analysis showed no changes for the L* and a* indexes during storage, whereas the b* index changed after 20 days of storage. A multiple comparison test showed colour instability after 20 days of storage. A hedonic scale test performed on the 60th day of storage showed acceptability of the product. The red component of the phycobiliprotein-rich extract from Nostoc PCC9205 presented an improved stability in acidic media and yogurt compared with the blue component of this extract. Copyright © 2011 Society of Chemical Industry.
Liu, Peize; Chen, Zhen; Yang, Lijie; Li, Qingbiao; He, Ning
2017-09-26
Polysaccharides and poly-γ-glutamic acid (γ-PGA) are biomacromolecules that have been reported as bioflocculants, and they exhibit high flocculating activity in many industrial applications. Bacillus licheniformis CGMCC 2876 can produce polysaccharide and γ-PGA bioflocculants under different culture conditions. Several key genes are involved in the metabolic pathway of polysaccharides in B. licheniformis, but the impacts of the regulation of these genes on the production of polysaccharide bioflocculants have not been illustrated completely. To increase the bioflocculant production and identify the correlation between the synthesis of polysaccharides and γ-PGA in B. licheniformis, a few key genes were investigated to explore their influence on the synthesis of the bioflocculants. Overexpressing epsB from the eps gene cluster not only improved the bioflocculant crude yield by 13.98% but also enhanced the flocculating activity by 117.92%. The composition of the bioflocculant from the epsB recombinant strain was 28.95% total sugar, 3.464% protein and 44.03% γ-PGA, while in the original strain, these components represented 53.67%, 3.246% and 34.13%, respectively. In combination with an analysis of the transcriptional levels of several key genes involved in γ-PGA synthesis in B. licheniformis, we inferred that epsB played a key role in the synthesis of both polysaccharide and γ-PGA. The bioflocculant production of the epsB recombinant strain was further evaluated during batch fermentation in a 2 L fermenter; the flocculating activity reached 9612.75 U/mL, and the bioflocculant yield reached 10.26 g/L after 72 h, representing increases of 224% and 36.62%, respectively, compared with the original strain. Moreover, we found that the tandem expression of phosphoglucomutase (pgcA) and UTP-glucose-1-phosphate uridylyltransferase (gtaB1) could enhance the crude yield of the bioflocculant by 20.77% and that the overexpression of epsA could enhance the bioflocculant
Antioxidant properties of cell wall polysaccharides of Stevia rebaudiana leaves
Directory of Open Access Journals (Sweden)
Mediesse Kengne Francine
2014-12-01
Full Text Available Objective: To examine the total phenolic and protein contents, and the antioxidant activities of cell wall polysaccharide fractions of Stevia rebaudiana leaves. Methods: Three different polysaccharide-enriched fractions, namely FPE (extract with 50 mmol/ L ethylene diamine tetra acetic acid, FPK (extract with 0.05 mol/L KOH and FH (extract with 4 mol/L KOH were extracted from Stevia rebaudiana leaves. The antioxidant activity of these fractions was evaluated based on their ability to scavenge DPPH (1, 1-diphenyl-2-picryl hydrazyl free radical, to reduce ferric power, to chelate ferrous ion and to protect human DNA. Results: The results indicated that protein content was found to be higher in FPK polysaccharide enriched fraction (47.48 µg per mg of FPK. Furthermore, the phenolic compound analysis according to the Folin-Ciocalteu method was higher in FPK (17.71 µg ferulic acid. The DPPH maximal inhibition percentage of the three polysaccharide-enriched fractions at 400 µg/mL was 27.66%, 59.90% and 23.21% respectively for FPE, FPK and FH. All the polysaccharide fractions exhibited a ferric reducing power except the FH one. The three fractions also exhibited lipid peroxidation inhibition, and they completely reverted the DNA damage induced by H2O2/FeCl2. FPK showed the strongest scavenging activity against the DPPH radical, the best chelating ability and lipid peroxidation inhibition. Conclusions: Stevia cell wall polysaccharide fractions are potent protective agents against oxidative stress. The analysis revealed major differences in the antioxidant activity in the three polysaccharides fractions. However, the 0.05 mol/L KOH pectin fraction (FPK showed better antioxidant activity.
Akram, Kashif; Shahbaz, Hafiz Muhammad; Kim, Gui-Ran; Farooq, Umar; Kwon, Joong-Ho
2017-02-01
Gamma irradiation was applied to the improved extraction of water-soluble polysaccharides (WSPs) from dried Lentinus edodes. Irradiation provided a dose-dependent increase in extraction yield (0 kGy, 2.01%; 7.5 kGy, 4.03%; 15 kGy, 7.17%) and purity (0 kGy, 78.8%; 7.5 kGy, 83.1%; 15 kGy, 85.6%) of the WSPs from hot-water extraction. The effect of irradiation was evident in the degraded microstructures and reduced molecular weights of the WSPs. However, nuclear magnetic resonance, Fourier-transform infrared, and X-ray diffraction spectroscopic analyses provided comparable structures of WSPs from nonirradiated and irradiated samples. UV-visible spectra showed a dose-dependent decline in intensity, but an improvement in thermal properties of the WSPs from the irradiated mushroom samples was observed. © 2017 Institute of Food Technologists®.
Therapeutic role of glucogalactan polysaccharide extracted from ...
African Journals Online (AJOL)
RACHEL
2015-06-17
Jun 17, 2015 ... Neurotransmitters and nitric oxide were significantly increased in the group given GA treatment compared to TMT .... Fractionation was performed by precipitating with ammonium sulfate. ..... deleterious effects of nitrogen reactive species accumula- .... Studies on the production of sulfated polysaccharide by.
DEFF Research Database (Denmark)
Pedersen, Morten Løbner; Walsted, Anette; Larsen, Rune
2008-01-01
The effect of consumption of Immulina, a high-molecular-weight polysaccharide extract from the cyanobacterium Arthrospira platensis, on adaptive immune responses was investigated by evaluation of changes in leukocyte responsiveness to two foreign recall antigens, Candida albicans (CA) and tetanus...
DEFF Research Database (Denmark)
Salmeán, Armando A.; Duffieux, Delphine; Harholt, Jesper
2017-01-01
-rich cell-wall. Brown algal cell walls are composed predominantly of the polyanionic polysaccharides alginates and fucose-containing sulfated polysaccharides. These polymers are prevalent over neutral and crystalline components, which are believed to be mostly, if not exclusively, cellulose. In an attempt...... to better understand brown algal cell walls, we performed an extensive glycan array analysis of a wide range of brown algal species. Here we provide the first demonstration that mixed-linkage (1 → 3), (1 → 4)-β-d-glucan (MLG) is common in brown algal cell walls. Ultra-Performance Liquid Chromatography...
Directory of Open Access Journals (Sweden)
Yong Li
2012-06-01
Full Text Available We investigated the effects of Astragalus polysaccharide (APS on palmitate-induced insulin resistance in C2C12 skeletal muscle myotubes. Palmitate-reduced glucose uptake was restored by APS. APS prevented palmitate-induced C2C12 myotubes from impaired insulin signaling by inhibiting Ser307 phosphorylation of insulin receptor substrate-1 (IRS-1 and increasing Ser473 phosphorylation of Akt. Moreover, the increases in protein-tyrosine phosphatase-1B (PTP1B protein level and NF-κB activation associated with palmitate treatment were also prevented by APS. However the treatment with APS didn’t change AMP-activated protein kinase (AMPK activation in palmitate-induced myotubes. The results of the present study suggest that Astragalus polysaccharide inhibits palmitate-induced insulin resistance in C2C12 myotubes by inhibiting expression of PTP1B and regulating NF-κB but not AMPK pathway.
A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.
Das, Deeplina; Baruah, Rwivoo; Goyal, Arun
2014-08-01
An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.
Recent Advances in Marine Algae Polysaccharides: Isolation, Structure, and Activities.
Xu, Shu-Ying; Huang, Xuesong; Cheong, Kit-Leong
2017-12-13
Marine algae have attracted a great deal of interest as excellent sources of nutrients. Polysaccharides are the main components in marine algae, hence a great deal of attention has been directed at isolation and characterization of marine algae polysaccharides because of their numerous health benefits. In this review, extraction and purification approaches and chemico-physical properties of marine algae polysaccharides (MAPs) are summarized. The biological activities, which include immunomodulatory, antitumor, antiviral, antioxidant, and hypolipidemic, are also discussed. Additionally, structure-function relationships are analyzed and summarized. MAPs' biological activities are closely correlated with their monosaccharide composition, molecular weights, linkage types, and chain conformation. In order to promote further exploitation and utilization of polysaccharides from marine algae for functional food and pharmaceutical areas, high efficiency, and low-cost polysaccharide extraction and purification methods, quality control, structure-function activity relationships, and specific mechanisms of MAPs activation need to be extensively investigated.
Directory of Open Access Journals (Sweden)
Bin Jia
Full Text Available The efficacy of protein-conjugated pneumococcal polysaccharide vaccines has been well characterized for children. The level of protection conferred by unconjugated polysaccharide vaccines remains less clear, particularly for elderly individuals who have had prior antigenic experience through immunization with unconjugated polysaccharide vaccines or natural exposure to Streptococcus pneumoniae.We compared the magnitude, diversity and genetic biases of antigen-specific memory B cells in two groups of adult cynomolgus macaques that were immunized with a 7-valent conjugated vaccine and boosted after five years with either a 13-valent pneumococcal polysaccharide conjugate vaccine (13vPnC or a 23-valent unconjugated pneumococcal polysaccharide vaccine (23vPS using microengraving (a single-cell analysis method and single-cell RT-PCR.Seven days after boosting, the mean frequency of antigen-specific memory B cells was significantly increased in macaques vaccinated with 13vPnC compared to those receiving 23vPS. The 13vPnC-vaccinated macaques also exhibited a more even distribution of antibody specificities to four polysaccharides in the vaccine (PS4, 6B, 14, 23F that were examined. However, single-cell analysis of the antibody variable region sequences from antigen-specific B cells elicited by unconjugated and conjugated vaccines indicated that both the germline gene segments forming the heavy chains and the average lengths of the Complementary Determining Region 3 (CDR3 were similar.Our results confirm that distinctive differences can manifest between antigen-specific memory B cell repertoires in nonhuman primates immunized with conjugated and unconjugated pneumococcal polysaccharide vaccines. The study also supports the notion that the conjugated vaccines have a favorable profile in terms of both the frequency and breadth of the anamnestic response among antigen-specific memory B cells.
Preparation and antidiabetic activity of polysaccharide from ...
African Journals Online (AJOL)
Extraction parameters of polysaccharide from Portulaca oleracea L. (POP) and antidiabetic activity of POP on alloxan induced diabetic mice were studied. Better extraction parameters of POP were obtained by the single factor test, as follows: extraction temperature 95°C, extraction time 5 h, and ratio of solvent to raw ...
Pu, Jin-Bao; Xia, Bo-Hou; Hu, Yi-Juan; Zhang, Hong-Jian; Chen, Jing; Zhou, Jie; Liang, Wei-Qing; Xu, Pan
2015-12-11
Rhizoma Atractylodes macrocephala polysaccharides (RAMP) have been reported to have a variety of important biological activities. In this study, an ultrasonic-assisted enzymatic extraction (UAEE) was employed to obtain the highest extraction yield and strongest antioxidant activity of RAMP and optimized by a multi-response optimization process. A three-level four-factor Box-Behnken design (BBD) was performed as response surface methodology (RSM) with desirability function (DF) to attain the optimal extraction parameters. The DPPH scavenging percentage was used to represent the antioxidant ability of RAMP. The maximum D value (0.328), along with the maximum yield (59.92%) and DPPH scavenging percentage (13.28%) were achieved at 90.54 min, 57.99 °C, 1.95% cellulase and 225.29 W. These values were further validated and found to be in good agreement with the predicted values. Compared to the other extraction methods, both the yield and scavenging percentage of RAMP obtained by UAEE was favorable and the method appeared to be time-saving and of high efficiency. These results demostrated that UAEE is an appropriate and effective extraction technique. Moreover, RSM with DF approach has been proved to be adequate for the design and optimization of the extraction parameters for RAMP. This work has a wide range of implications for the design and operation of polysaccharide extraction processes.
Khawas, Sadhana; Sivová, Veronika; Anand, Namrata; Bera, Kaushik; Ray, Bimalendu; Nosáľová, Gabriela; Ray, Sayani
2018-04-01
Decoction of Psidium guajava leaves has been used as medication for chronic coughs and breathlessness for ages. Despite demonstration of antitussive activity, the specific molecule responsible for this remains unidentified. Herein, we report chemical profile and antitussive activity of its water extract (WE) and a polysaccharide (F1) present therein. This polysaccharide (F1), purified from WE by precipitation with ethanol and then through Cu(II)acetate, contains Ara, Gal, Rha, Glc and GalA residues, and has a molecular mass of 156 kDa. It comprises of terminal-, (1,5)- and (1,3,5)-linked Araf; (1,3)-, (1,6)- and (1,3,6)-linked Galp alongside (1,2)- and (1,2,4)-linked Rhap residues. Oligosaccharides indicating polysaccharide structure have been generated by Smith degradation and characterized. The WE fraction suppressed citric acid induced cough efforts in guinea pigs in the dose of 50 mg kg -1 . Assessment of antitussive activity of fractions prepared from WE namely F1 (polysaccharide) and F2 (ethanol soluble fraction) revealed that polysaccharide is the active component. Remarkably, tested samples do not alter the specific airway smooth muscle reactivity in animals significantly. The simple extraction method, prominent activity and favorable reactions profile suggest that this macromolecule could be an antitussive drug candidate. Copyright © 2017 Elsevier B.V. All rights reserved.
Wang, Xiao-Yin; Yin, Jun-Yi; Nie, Shao-Ping; Xie, Ming-Yong
2018-02-01
Hericium erinaceus was extracted with boiling water to obtain the crude polysaccharide (HECP) and refined polysaccharide (HERP). HERP was further purified using gradual ethanol precipitation to obtain five sub-fractions. Their physicochemical properties were evaluated, including chemical components, monosaccharide composition and molecular weight. Meanwhile, the effect of HERP on colonic health of mice was investigated by oral administration at dosages of 100, 200 and 400mg/kg of body weight (mg/kgbw), comparing with that of HECP. Results showed that the gradual ethanol precipitation could remarkably increase polysaccharide purity. HERP, HECP and the five purified fractions had different monosaccharide compositions, while the main monosaccharides were Glc and Gal. They all showed similar structure with amorphous appearance. Short-chain fatty acids productions in colonic and cecum contents, and feces of mice were increased in polysaccharide treated groups. Mice administrated with HERP at 400mg/kgbw showed significant reductions in pH values while obvious increases in moisture amounts. This study suggests that gradual ethanol precipitation is available for purification of polysaccharide from Hericium erinaceus and the extracted polysaccharide could improve colonic health. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Boual, Z.; Kemassi, A.; Oudjana, A.H.; Michaud, P.; Didi, O.H.M.
2013-01-01
Malva parviflora L. (Malvaceae), a spontaneous plant used in traditional medicine is found inGhardaia (Septentrional EastAlgerian Sahara). This paper reports on the extraction and partial characterization of water-soluble polysaccharides from M. parviflorleaves. These polysaccharides were obtained by elimination of the ethanol extract and sequential extraction in distilled water, followed by precipitation in 75% ethanol. The yield of extract is of 1.46%. The crude water soluble polysaccharide extract was further characterized and revealed the average values:15 ± 2,64% total ashes, 17,14 ± 1,43% proteins and 68,18 ± 0,94% carbohydrates, among them 44,96 ± 0,42% are acidic monosaccharides and the rest 55 ± 0,62% are neutral monosaccharides. The considered optimum conditions of hydrolysis by trifluoroacetic acid were: 4 M during 5 hours at 80°C. Anion exchange high performance chromatography of hydrosoluble polysaccharides of Malva leaves indicates the presence of galactose (56.86%), glucuronic acid (20.57%), arabinose (9.04%), rhamnose (8.46%) and mannose (5.05%). The oligosaccharides resulting from the partial hydrolys is of the hydrosoluble polysaccharides stimulate significantly (concentration of 0,333 mg/mL) for 0,1 DO after 24 hours, the growth of Bifido bacterium longum. Their prebiotic effect is notable. (author)
Aguilar-Uscanga, Blanca; Arrizon, Javier; Ramirez, Jesús; Solis-Pacheco, Josué
2007-02-01
In this study, a characterization of cell wall polysaccharide composition of three yeasts involved in the production of agave distilled beverages was performed. The three yeast strains were isolated from different media (tequila, mezcal and bakery) and were evaluated for the beta(1,3)-glucanase lytic activity and the beta-glucan/ mannan ratio during the fermentation of Agave tequilana juice and in YPD media (control). Fermentations were performed in shake flasks with 30 g l(-1) sugar concentration of A. tequilana juice and with the control YPD using 30 g l(-1) of glucose. The three yeasts strains showed different levels of beta-glucan and mannan when they were grown in A. tequilana juice in comparison to the YPD media. The maximum rate of cell wall lyses was 50% lower in fermentations with A. tequilana juice for yeasts isolated from tequila and mezcal than compared to the bakery yeast.
International Nuclear Information System (INIS)
Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo
2015-01-01
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber
Energy Technology Data Exchange (ETDEWEB)
Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)
2015-02-27
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.
Visualization of bacterial polysaccharides by scanning transmission electron microscopy.
Wolanski, B S; McAleer, W J; Hilleman, M R
1983-04-01
Highly purified capsular polysaccharides of Neisseria meningitidis groups A, B, and C have been visualized by high resolution Scanning Transmission Electron Microscopy (STEM). Spheroidal macromolecules approximately 200 A in diameter are characteristic of the Meningococcus A and C polysaccharides whereas filaments that are 400-600 A in length are found in Meningococcus B polysaccharide preparations. Filaments are occasionally found associated with the spheroidal Meningococcus A and C polysaccharides and it is proposed that these structures are composed of a long (1-4 microns) filament or filaments that are arranged in spheroidal molecules or micelles of high molecular weight. The Meningococcus B polysaccharide, by contrast, is a short flexuous filament or strand of relatively low molecular weight. A relationship between morphology and antigenicity is proposed.
International Nuclear Information System (INIS)
Boloor, K.K.; Kamat, J.P.; Devasagayam, T.P.A.; Venkatachalam, S.R.
2000-01-01
The possible antioxidant effect of the extracts of Asparagus racemosus against membrane damage induced by free radicals generated during γ-radiation was examined in rat liver/brain mitochondria. These extracts displayed significant antioxidant properties in mitochondria against oxidation of both lipids and proteins as assessed by lipid peroxidation, protein oxidation and depletion of thiols. The inhibitory effect of the extracts, rich in polysaccharides like galactose, was more than that of the established antioxidants glutathione and ascorbic acid. (author)
Liposome-Based Delivery Systems in Plant Polysaccharides
International Nuclear Information System (INIS)
Meiwan, C.; Yitao, W.; Yanfang, Z.; Xinsheng, P.; Jingjing, H.; Ping, Z.
2012-01-01
Plant polysaccharides consist of many monosaccharide by α or β glycosidic bond which can be extracted by the water, alcohol, lipophile liquid from a variety of plants including Cordyceps sinensis, astragalus, and mushrooms. Recently, many evidences illustrate that natural plant polysaccharides possess various biological activities including strengthening immunity, lowering blood sugar, regulating lipid metabolism, anti oxidation, anti aging, and antitumour. Plant polysaccharides have been widely used in the medical field due to their special features and low toxicity. As an important drug delivery system, liposomes can not only encapsulate small-molecule compound but also big-molecule drug; therefore, they present great promise for the application of plant polysaccharides with unique physical and chemical properties and make remarkable successes. This paper summarized the current progress in plant polysaccharides liposomes, gave an overview on their experiment design method, preparation, and formulation, characterization and quality control, as well as in vivo and in vitro studies. Moreover, the potential application of plant polysaccharides liposomes was prospected as well.
Anti-cariogenic properties of a water-soluble extract from cacao.
Ito, Kyoko; Nakamura, Yuko; Tokunaga, Takahisa; Iijima, Daisuke; Fukushima, Kazuo
2003-12-01
The addition of a water-soluble extract from cacao-extracted powder (CEPWS) to a cariogenic model food, a white chocolate-like diet that contains 35% sucrose, significantly reduced caries scores in SPF rats infected with Streptococcus sobrinus 6715, compared to control rats fed a white chocolate-like diet. CEPWS markedly inhibited water-insoluble glucan (WIG) synthesis through crude glucosyltransferases (GTFs) from Streptococcus sobrinus B13N in vitro. GTF-inhibitor(s) in CEPWS was prepared through three-step fractionation, and was termed CEPWS-BT, which is a high molecular weight (>10 kDa) heat-stable matrix of sugar, protein, and polyphenol. When the inhibitory effect of CEPWS-BT on glucan synthesis was examined using the purified GTF-I, GTF-T, and GTF-U enzymes from S. sobrinus B13N, significant reduction in GTF-I and GTF-T activity as a result of adding CEPWS-BT at low concentrations was observed. These results suggest that the addition of CEPWS to cariogenic food could be useful in controlling dental caries.
Optimization of polysaccharides extracted from Verbena officinalis L ...
African Journals Online (AJOL)
Keywords: Polysaccharides, Colorectal cancer, Verbena officinalis, SW480 cell lines, Cell invasion,. Metastasis ..... receptor tyrosine kinase (RTK) family, is found to be abnormal in many ... invasion of human prostate cancer cells via Caveolin-.
Phase behavior of casein micelles/exocellular polysaccharide mixtures: Experiment and theory
Tuinier, R.; de Kruif, C. G.
1999-05-01
Dispersions of casein micelles and an exocellular polysaccharide (EPS), obtained from Lactococcus lactis subsp. cremoris NIZO B40 EPS, show a phase separation. The phase separation is of the colloidal gas-liquid type. We have determined a phase diagram that describes the separation of skim milk with EPS into a casein-micelle rich phase and an EPS rich phase. We compare the phase diagram with those calculated from theories developed by Vrij, and by Lekkerkerker and co-workers, showing that the experimental phase boundary can be predicted quite well. From dynamic light scattering measurements of the self-diffusion of the casein micelles in the presence of EPS the spinodal could be located and it corresponds with the experimental phase boundary.
6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.
Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu
2016-02-12
With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.
International Nuclear Information System (INIS)
Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.
2013-01-01
Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)
Kuo, Mei-Chun; Chang, Chien-Yu; Cheng, Tso-Lin; Wu, Ming-Jiuan
2007-06-01
Cordyceps sinensis is widely used as a traditional medicine for treatment of a wide variety of diseases or to maintain health. The immunomodulatory activity of polysaccharides prepared from submerged cultured C. sinensis BCRC36421 was investigated in human peripheral blood. Results demonstrated that Fr. A (exo-polysaccharides, 0.025 approximately 0.1 mg/ml) induced the production of tumor necrosis factor alpha (TNF-alpha), interleukin (IL)-6, and IL-10 dose-dependently. Fr. A, as low as 0.025 mg/ml, could significantly augment surface expression of CD11b in monocytes and polymorphonuclear neutrophils. Functional assay revealed that Fr. A (0.05 mg/ml) also elevated phagocytosis in monocytes and PMN. On the other hand, Fr. B (intracellular polysaccharides) only moderately induced TNF-alpha release, CD11b expression, and phagocytosis at the same concentrations. Our results indicate that the immunomodulatory components of submerged cultured C. sinensis mainly reside in the culture filtrate.
The extraction and determination of free lithium in Li-B alloys
International Nuclear Information System (INIS)
Kilroy, W.P.; Angres, I.
1979-01-01
Extraction of the lithium phase from lithium-rich Li-B alloys was achieved by reaction of the alloy with dry naphthalene dissolved in anhydrous tetrahydrofuran. The resulting radical anion was hydrolyzed and the lithium was determined by potentiometric titration from the moles of hydroxide formed. The composition of the Lisub(x)Bsub(y) residue was determined by difference. (Auth.)
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Biodegradation of bacterial polysaccharides adsorbed on montmorillonite
International Nuclear Information System (INIS)
Guckert, A.; Tok, H.H.; Jacquin, F.
1977-01-01
In this research, by means of a model, a study was made of the biodegradation of microbial organic compounds adsorbed on clays, with a parallel experiment on Fontainebleau sand serving as the control. During incubation the three classes of organic matter ( 14 C-labelled glucose, 14 C-labelled polysaccharides and 14 C-labelled microbial cells) mineralize more actively in the presence of sand than in the presence of clay, since the latter provides protection against biodegradation. Mineralization of the adsorbed organic compounds, however, is marked by clear-cut differences after three weeks - glucose (55%)>polysaccharides (43%)>microbial organisms (7.3%). After incubation, chemical extraction of the organo-mineral complexes by alkaline solvents shows only water-soluble and alkali-soluble products in the case of sand; conversely, in that of montmorillonite the bulk of the 14 C was found in the non-extractable fraction or humin (18.1% of the initial 14 C for glucose, 27.3% for the polysaccharides, and 67.6% for the microbial organisms). A second incubation carried out after a phase in which there was drying and remoistening of the organo-mineral complexes, brings to light the important part played by climatic alternations during the biodegradation process. A new mineralization phase is observed, affecting more the bacterial organisms (14.1%) than the polysaccharides (6.3%), with the glucose-base complexes occupying an intermediate position (11.2%). The chemical fractioning of the organo-mineral complexes following re-incubation shows the stability of 14 C in humin very clearly, especially in the case of polysaccharides, where the mineralization phase relates primarily to the products extractable with alkalis. (author)
Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets
DEFF Research Database (Denmark)
Knudsen, Knud Erik Bach
2014-01-01
The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β...... AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are different from that of cereals. The main CW polymers are pectic substances (homogalacturonan, rhamnogalacturonan type I and II, xylogalacturonan...
Directory of Open Access Journals (Sweden)
Samir Jawhara
Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun
2016-01-01
An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.
Hepatoprotective Effects of Mushrooms
Directory of Open Access Journals (Sweden)
Rosane Marina Peralta
2013-07-01
Full Text Available The particular characteristics of growth and development of mushrooms in nature result in the accumulation of a variety of secondary metabolites such as phenolic compounds, terpenes and steroids and essential cell wall components such as polysaccharides, b-glucans and proteins, several of them with biological activities. The present article outlines and discusses the available information about the protective effects of mushroom extracts against liver damage induced by exogenous compounds. Among mushrooms, Ganoderma lucidum is indubitably the most widely studied species. In this review, however, emphasis was given to studies using other mushrooms, especially those presenting efforts of attributing hepatoprotective activities to specific chemical components usually present in the mushroom extracts.
Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.
Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish
2012-09-04
Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.
Biochemical evaluation of antioxidant activity and polysaccharides fractions in seaweeds
Directory of Open Access Journals (Sweden)
A. Tariq
2015-01-01
Full Text Available In the present study ethanol and water extracts of 15 seaweeds, Dictyota dichotoma var. velutricata, Dictyota indica, Iyengaria stellata, Padina pavonia, Sargassum swartzii, Sargassum variegatum, Stoechospermum marginatum, Stokeyia indica, Jolyna laminarioides, Caulerpa taxifolia, Halimeda tuna, Ulva fasciata, Ulva lactuca, Solieria robusta, and Melanothamnus afaqhusainii, were evaluated for their antioxidant potential by ABTS or 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid, superoxide and total antioxidant capacity (TAC assays. The activity was concentration dependent and the variation in antioxidant potential was also observed by different assays in both extracts. Ethanol extract of D. dichotoma var. velutricata, D. indica and S. marginatum demonstrated highest activity by TAC assay. The antioxidant potential in organic solvent fractions of seaweeds namely P. pavonia, S. swartzii, S. marginatum and M. afaqhusainii was also determined and chloroform fraction of all the four seaweeds showed highest activity by superoxide assay. Antioxidant activity of extracted fractions of polysaccharides from S. indica, C. taxifolia and D. dichotoma var. velutricata was also evaluated by superoxide method. Polysaccharide fractions of S. indica obtained from HCl (at 700C and room temperature and water extract demonstrated highest activity respectively. All the polysaccharide fractions of C. taxifolia showed excellent activity except CaClF70°C. Polysaccharide fractions of D. dichotoma var. velutricata also exhibited very good activity.
Anti-Inflammatory Activity of Polysaccharide Fraction of Curcuma longa Extract (NR-INF-02).
Illuri, Ramanaiah; Bethapudi, Bharathi; Anandakumar, Senthilkumar; Murugan, Sasikumar; Joseph, Joshua A; Mundkinajeddu, Deepak; Agarwal, Amit; Chandrasekaran, C V
2015-01-01
The aim of the study was to investigate the safety and anti-inflammatory effects of polysaccharide fraction (F1) of Curcuma longa extract (NR-INF-02) in classical rodent models of inflammation. F1 was evaluated for its acute oral toxicity and found to be safe upto 5000 mg/kg body weight in rats. The anti-inflammatory activity of F1 was evaluated in acute (carrageenan - induced paw edema; xylene - induced ear edema) and chronic (cotton pellet - induced granuloma) models of inflammation. The results of the study demonstrated that F1 significantly (p ≤ 0.05) inhibited carrageenan-induced paw edema at 1 h and 3 h at doses of 11.25, 22.5 and 45 mg/kg body weight in rats. Also, F1 at doses of 15.75, 31.5 and 63 mg/kg significantly inhibited the xylene induced ear edema in mice. In a chronic model, F1 at 11.25, 22.5 and 45 mg/kg doses produced significant reduction of wet and dry weights of cotton pellets in rats. Overall results indicated that F1 of NR-INF-02 significantly attenuated acute and chronic inflammation in rodent models. This study emphasizes on the importance of Curcuma longa polysaccharide's role in acute and chronic inflammation.
Directory of Open Access Journals (Sweden)
I. S. Pretorius
1994-07-01
Full Text Available The world’s problem with overpopulation and environmental pollution has created an urgent demand for alternative protein and energy sources. One way of addressing these burning issues is to produce single-cell protein (for food and animal feed supplements and fuel ethanol from polysaccharide-rich agricultural crops and industrial waste by using baker’s yeast.
Nagar, Shipra; Hensel, Andreas; Mischnick, Petra; Kumar, Vineet
2018-08-01
Tinospora sinensis (Lour.) Merrill is of great therapeutic significance in Indian traditional medicine. Crude polysaccharides were isolated from methanol pre-extracted stems of dried material by successive extractions with cold water, hot water and NaOH (0.25 mol/L) in 0.98, 0.55 and 0.70 % yields respectively. Cold water soluble polysaccharides (CWSP) were purified and fractionated by ion exchange chromatography on DEAE-Sephacel. Neutral polysaccharides were further fractionated on Sepharose CL6B to yield three fractions TW1, TW2, TW3. The study further focuses on structural elucidation of TW1. TW1 was obtained in 0.8 % yield relative to CWSP, with MW of 1.6 × 10 5 Da. It was composed of 3-O-methyl-arabinose, 3-O-methyl-galactose and galactose in molar ratio of 1.0:6.3:0.9 respectively. Based on per-deuteromethylation, NMR and ESI-MS analyses, TW1 was composed of 1,4-linked 3-O-methyl-β-d-galactopyranose and β-d-galactopyranose backbone with branching at O-6 of 3-O-methyl-β-d-galactosyl residues by 1,5-linked 3-O-methyl-α-l-arabinofuranoside chains. 3-O-methyl-arabinose and 3-O-methyl-galactose have first ever been reported in any polysaccharide and Tinospora genus, respectively. Copyright © 2018 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Chu Fang; Luo Houliang; Luo Gui; Chen Shunle; Liu Zhifang
1988-01-01
This paper describes the influence of polysaccharides extracted from 'Zi Zhi' (Ganoderma Sinese Zhao, Xu et Zhang) on the frequency of micronucleated cells induced by 60 Co gamma irradiation at different doses in bone marrow of mice. These polysaccharides of 'Zi Zhi' were shown to be of ability to protect nucleated bone marrow cells from micronucleus formation in irradiated mice. For Swiss mice, a dose reduction factor (DRF) was found to be 1.72 in the range of 0 to 4.728 Gy and for LACA mice, to be 1.73 in the range of 0 to 3.152 Gy. Such findings indicate that these polysaccharides are comparable to L-cysteine in their effeciency of protection
Directory of Open Access Journals (Sweden)
Ni LEI
2016-12-01
Full Text Available The extraction parameters of water-soluble polysaccharides (WPs from white hyacinth bean were optimized using single-factor and orthogonal experiment. The antioxidant activities of WPs were presented by assaying three different radicals, 2,2-diphenyl-1-picrylhydrazy radical (DPPH radical, hydroxyl radical and superoxide radical scavenging ability. In addition, the effects of WPs obtained on the growth of three probiotic strains (Lactobacillus acidophilus LA5, Bifidobacterium bifidum BB01 and Lactobacillus bulgaricus LB6 were also determined by measuring the OD and pH value of culture medium. According to the results, the optimum extraction parameters were as follows: the ratio of water to material was 50, extraction time was 2h and the extraction temperature was 95°C. The yield of WPs reached 1.15±0.07% under this condition. In addition, the WPs had different scavenging ability on three radicals (hydroxyl > DPPH > superoxide. And the WPs could promote the growth of LA5, BB01 and LB6.
Chen, Shuhan; Chen, Haixia; Tian, Jingge; Wang, Jia; Wang, Yanwei; Xing, Lisha
2014-01-30
An enzymolysis-ultrasonic assisted extraction (EUAE) procedure of corn silk polysaccharides (CSPS) was established and the physicochemical properties, antioxidant and anticancer activities of CSPS were studied. Orthogonal test and response surface methodology were applied to optimize the extraction parameters. The optimum enzymolysis and ultrasonic conditions were cellulase content of 7.5% for 150 min at 55 °C and liquid-solid ratio of 31.8 for 34.2 min at 66.3 °C, respectively. Under these conditions, the yield of CSPS increased from 4.56% to 7.10%. CSPS obtained by hot water and EUAE were composed of rhamnose, arabinose, xylose, mannose, galactose and glucose with molecular ratios of 4.17:17.33:5.59:18.65:19.11:35.14 and 8.83:15.77:7.92:12.39:11.15:43.94, respectively. Their molecular weight distributions were 10.52 × 10(4) and 6.88 × 10(4)Da, respectively. CSPS obtained by EUAE showed morphological and conformation changes and higher antioxidant and anticancer activities compared with CSPS extracted by hot water. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Suparada Surapanthanakorn
2017-10-01
Full Text Available A methanolic extract from Senna garrettiana (S. garrettiana heartwood was prepared and then a fractionation process was performed to obtain hexane, dichloromethane, ethyl acetate, and aqueous fractions. An antinociceptive screening of each fraction was carried out using the acetic acid-induced writhing in mice. Among all the fractions, the ethyl acetate fraction showed the highest activity on the writhing test. The ethyl acetate fraction was separated to obtain a piceatannol-rich extract. The S. garrettiana extract contains 11.70 % w/w and 39.16 % w/w piceatannol in the ethyl acetate fraction and the piceatannol-rich extract, respectively. The analgesic activities of the ethyl acetate fraction (50, 100 and 200 mg/kg and the piceatannol-rich extract (10, 20 and 40 mg/kg were evaluated by the acetic acid-induced writhing test, hot-plate test and formalin test. The antipyretic activity of these extracts was assessed on yeast’s-induced pyrexia in rats. The acute toxicity was also investigated. In the acute toxicity study, no lethality was observed after the oral administration of methanolic extract of S. garrettiana heartwood even at a high dose of 5 g/kg in mice. The oral administration of the ethyl acetate fraction decreased the number of writhings in a dose dependent manner with 54.9 %, 68.5 %, and 71.0 % inhibition, respectively. A similar result was also observed after the oral administration of the piceatannol-rich extract with 53.1%, 69.2% and 80.3% inhibition, respectively. In the formalin test, either the ethyl acetate fraction or the piceatannol-rich extract significantly diminished the licking time in both the early and late phases. Neither the ethyl acetate nor the piceatannol-rich extract had any effect on heat-induced pain. The ethyl acetate fraction at the same dosage range significantly decreased the rat rectal temperature at 2, 3 and 4 hrs. The piceatannol-rich extract at a dose of 20 and 40 mg/kg suppressed the rectal temperature
Energy Technology Data Exchange (ETDEWEB)
Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)
2010-08-01
In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.
Directory of Open Access Journals (Sweden)
Xin Liu
2014-09-01
Full Text Available This study describes the extraction, preliminary characterization and evaluation of the in vitro antitumor and antioxidant activities of polysaccharides extracted from Mentha piperita (MPP. The optimal parameters for the extraction of MPP were obtained by Box-Behnken experimental design and response surface methodology (RSM at the ratio of water to raw material of 20, extraction time of 1.5 h and extraction temperature at 80 °C. Chemical composition analysis showed that MPP was mainly composed of glucuronic acid, galacturonic acid, glucose, galactose and arabinose, and the molecular weight of its two major fractions were estimated to be about 2.843 and 1.139 kDa, respectively. In vitro bioactivity experiments showed that MPP not only inhibited the growth of A549 cells but possessed potent inhibitory action against DNA topoisomerase I (topo I, and an appreciative antioxidant action as well. These results indicate that MPP may be useful for developing safe natural health products.
Directory of Open Access Journals (Sweden)
Ligang Zhou
2012-05-01
Full Text Available Water-extracted mycelial polysaccharide (WPS from the endophytic fungus Fusarium oxysporum Dzf17 isolated from Dioscorea zingiberensis was found to be an efficient elicitor to enhance diosgenin accumulation in D. zingigerensis cultures, and also demonstrated antioxidant activity. In this study, response surface methodology (RSM was employed to optimize the extraction process of WPS from F. oxysporum Dzf17 using Box-Behnken design (BBD. The ranges of the factors investigated were 1–3 h for extraction time (X1, 80–100 °C for extraction temperature (X2, and 20–40 (v/w for ratio of water volume (mL to raw material weight (g (X3. The experimental data obtained were fitted to a second-order polynomial equation using multiple regression analysis. Statistical analysis showed that the polynomial regression model was in good agreement with the experimental results with the determination coefficient (R2 of 0.9978. By solving the regression equation and analyzing the response surface contour plots, the extraction parameters were optimized as 1.7 h for extraction time, 95 °C for extraction temperature, 39 (v/w for ratio of water volume (mL to raw material weight (g, and with 2 extractions. The maximum value (10.862% of WPS yield was obtained when the WPS extraction process was conducted under the optimal conditions.
Directory of Open Access Journals (Sweden)
Zenia Pardo Ruiz
2012-03-01
Full Text Available Se realizó una búsqueda bibliográfica utilizando la base de datos Pubmed con énfasis en los artículos publicados en la última década. Como descriptores se utilizaron los siguientes: glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. Con la información disponible se realizó un análisis de los principales aspectos relacionados con el tema, que se exponen en el presente trabajo. Las b-(1®3-glucanas son polímeros de glucosa que se encuentran mayoritariamente en la pared celular de hongos, levaduras y plantas. Se consideran patrones moleculares asociados a patógenos y son reconocidas por varios receptores, siendo la dectina-1 el principal receptor de reconocimiento de estas estructuras. Sus propiedades inmunomoduladoras han sido informadas por varios autores. Se ha demostrado que potencian y sinergizan la acción de ligandos de Toll like receptors sobre la liberación de citoquinas proinflamatorias, aunque también han mostrado un perfil antiinflamatorio, cuestión que depende en gran medida de sus características estructurales. Las b-(1®3-glucanas son contaminantes importantes provenientes de los filtros de acetato de celulosa que se utilizan en la clarificación de parenterales hemoderivados, por tanto, es necesario estudiar las consecuencias de la presencia de estas moléculas inmunomoduladoras en inyectables. En esta revisión se resumen aspectos relacionados con el reconocimiento y actividad biológica de las b-(1®3-glucanas y se profundiza en estudios relacionados con su presencia en hemoderivados como principal contaminante. Finalmente se destaca la utilidad de la Prueba de Activación de Monocitos en la detección de las b-(1®3-glucanas en parenterales.A literature review was made in Pubmed database, making emphasis on papers published in the last decade. The subject headings for this search were glucans, glucans recognition, glucans biological activitiy, glucans pharmaceuticals. On the basis
Ekeanyanwu, Raphael Chukwuma; Njoku, Obioma Uzoma
2015-03-01
The antidepressant effects of the flavonoid-rich fraction of Monodora tenuifolia seed extract were examined by assessing the extent of attenuation of behavioural alterations and oxidative damage in the rats that were stressed by forced swim test. Compared with the model control group, the altered behavioural parameters were attenuated significantly (P fluoxetine (10 mg·kg(-1)). The flavonoid-rich fraction and fluoxetine improved significantly (P < 0.05) the activities of the antioxidant enzymes such as superoxide dismutase and catalase as well as other biochemical parameters such as reduced glutathione, protein, and nitrite in the brain of the stressed rats. These results suggested that the flavonoid-rich fraction of Monodora tenuifolia seed extract exerted the antidepressant-like effects which could be useful in the management of stress induced disease. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Line Edwige Mengome
2014-11-01
Full Text Available Polysaccharides were extracted from seven plants endemic to Gabon to study their potential immunological activities. Peripheral blood mononuclear cell (PBMC (5 × 105 cells/mL proliferation, cytokine and immunoglobulin G (IgG assays were performed after stimulation with different concentrations of polysaccharide fractions compared with lipopolysaccharides (LPS and concanavalin A (ConA from healthy volunteers. The culture supernatants were used for cytokine and IgG detection by enzyme-linked immunosorbent assay (ELISA. The results show that pectin and hemicellulose extracts from Uvaria klainei, Petersianthus macrocarpus, Trichoscypha addonii, Aphanocalyx microphyllus, Librevillea klaineana, Neochevalierodendron stephanii and Scorodophloeus zenkeri induced production levels that were variable from one individual to another for IL-12 (3–40 pg/mL, IL-10 (6–443 pg/mL, IL-6 (7–370 pg/mL, GM-CSF (3–170 pg/mL and IFN-γ (5–80 pg/mL. Only hemicelluloses from Aphanocalyx microphyllus produce a small amount of IgG (OD = 0.034, while the proliferation of cells stimulated with these polysaccharides increased up to 318% above the proliferation of unstimulated cells. However, this proliferation of PBMCs was abolished when the pectin of some of these plants was treated with endopolygalacturonase (p < 0.05, but the trend of cytokine synthesis remained the same, both before and after enzymatic treatment or saponification. This study suggests that these polysaccharides stimulate cells in a structure-dependent manner. The rhamnogalacturonan-I (RGI fragment alone was not able to induce the proliferation of PBMC.
Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya
2017-07-01
We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Miceli, Natalizia; Buongiorno, Luigina Pasqualina; Celi, Maria Grazia; Cacciola, Francesco; Dugo, Paola; Donato, Paola; Mondello, Luigi; Bonaccorsi, Irene; Taviano, Maria Fernanda
2016-06-01
Bauhinia forficata Link. is utilised as an antidiabetic in Brazilian folk-medicine; furthermore, its antioxidant properties suggest a potential usefulness in the prevention of diabetes complications associated with oxidative stress. The contribution of a flavonoid-rich fraction (FRF), HPLC-PDA-ESI-MS characterised, to the antioxidant and cytotoxic properties of B. forficata hydro-alcoholic leaves extract was evaluated for the first time. Both extract and FRF showed radical-scavenging activity and reducing power with a strong relationship with the flavonoid content found; hence, flavonoids are mainly responsible for the primary antioxidant activity of B. forficata extract. The extract significantly decreased FO-1 cell viability at the higher concentrations. FRF did not exert any effect; thus, flavonoids do not appear to be responsible for the cytotoxicity of the extract. The extract resulted virtually non-toxic against both Artemia salina and normal human lymphocytes, demonstrating potential selectivity in inhibiting cancer cell growth. Finally, no antimicrobial activity was observed against the bacteria and yeasts tested.
Jesus, de Liana Inara; Smiderle, Fhernanda R.; Ruthes, Andrea C.; Vilaplana, Francisco; Lin, Dal' Fernando Tonholi; Maria-Ferreira, Daniele; Werner, Maria Fernanda; Griensven, Van Leo J.L.D.; Iacomini, Marcello
2017-01-01
A water-soluble β-D-glucan was obtained from fruiting bodies of Piptoporus betulinus, by hot aqueous extraction followed by freeze-thawing procedure and dialysis. Its molar mass distribution and conformational behavior in solution was assessed by size-exclusion chromatography coupled with multiangle
Inhibition of α-glucosidase by polysaccharides from the fruit hull of Camellia oleifera Abel.
Zhang, Sheng; Li, Xiang-Zhou
2015-01-22
We isolated and purified polysaccharides from the Camellia oleifera Abel. fruit hull and studied its hypoglycemic potential. Our results revealed six polysaccharides (CFPA-1-5 & CFPB) from the aqueous extract from the defatted C. oleifera fruit hull. Purified polysaccharides (purity >90%) were investigated for the inhibition of α-glucosidase activity in vitro. Two polysaccharides, CFPB and CFPA-3 were present in high concentration in the fruit hull and showed a dose-dependent inhibition of α-glucosidase activity, with IC50 concentrations of 11.80 and 10.95 μg/mL, respectively. This result suggests that polysaccharides (CFP) extracted from the fruit hull of C. oleifera may have potential as functional foods with featuring a hypoglycemic effect. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ganoderma lingzhi (G. lingzhi), G. sinense, G. applanatum, and other Ganoderma species are rich in specific polysaccharides. These mushrooms have long been used as a popular nutrition food and Chinese medicine. Non-destructive evaluation of polysaccharide content in Ganoderma mycelia during fermenta...
Modulation of Porphyridium aerugineum polysaccharide rheology ...
African Journals Online (AJOL)
A stock (0.5% w/v) aqueous solution of the polysaccharide of the microalga Porphyridium aerugineum was further diluted using (i) deionized water and (ii) an aqueous (0.2% w/v) solution of a new, garden soil extract. The viscosity of the resultant solution was higher by about 23% (5 samples) where the soil extract was used ...
Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen
2004-10-01
Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.
Directory of Open Access Journals (Sweden)
An-jun Liu
2017-12-01
Full Text Available The polysaccharides of Astragalus membranaceus have received extensive study and attention, but there have been few reports on the extraction of these polysaccharides using cold water (4 °C. In this study, we fractionated a novel cold-water-soluble polysaccharide (cAMPs-1A from Astragalus membranaceus with a 92.00% carbohydrate content using a DEAE-cellulose 52 anion exchange column and a Sephadex G-100 column. Our UV, Fourier-transform infrared spectroscopy (FTIR, high-performance gel permeation chromatography, and ion chromatography analysis results indicated the monosaccharide composition of cAMPs-1A with 1.23 × 104 Da molecular weight to be fucose, arabinose, galactose, glucose, and xylose, with molar ratios of 0.01:0.06:0.20:1.00:0.06, respectively. The UV spectroscopy detected no protein and nucleic acid in cAMPs-1A. We used FTIR analysis to characterize the α-d-pyranoid configuration in cAMPs-1A. In addition, we performed animal experiments in vivo to evaluate the antitumor and immunomodulatory effects of cAMPs-1A. The results suggested that cAMPs-1A oral administration could significantly inhibit tumor growth with the inhibitory rate of 20.53%, 36.50% and 44.49%, respectively, at the dosage of 75,150, and 300 mg/kg. Moreover, cAMPs-1A treatment could also effectively protect the immune organs, promote macrophage pinocytosis, and improve the percentages of lymphocyte subsets in the peripheral blood of tumor-bearing mice. These findings demonstrate that the polysaccharide cAMPs-1A has an underlying application as natural antitumor agents.
International Nuclear Information System (INIS)
Yoshimura, Akinobu; Hasegawa, Takeo; Monzen, Hajime; Takahashi, Tohru
2003-01-01
Various natural extracts are manufactured and on sale as health food products, which are raising popular consciousness of being fit, because they are considered effective or suppressible for cancer. In the current experiment, we measured the immunological activity, antitumor effects, and radioprotective effects of β-1,3-D-glucan (Macroglucan) extracted from bread yeast. Macroglucan of 0, 200, 400, and 800 mg/kg were administered intraperitoneally to C3H/HeJ mice, respectively. The antitumor effects of Macroglucan were examined by measuring natural killer (NK) and lymphokine activated killer (LAK) cell activity and tumor volume. Change in weight, survival, and microscopic manifestation of the intestine were evaluated in the C3H/HeJ mice received total body irradiation to measure radioprotective effect of Macroglucan. According to measurements of cellular cytotoxicity, levels of NK and LAK cell activity were significantly higher in the group administered Macroglucan than in the control group. Macroglucan's role in immunological activity was suggested by the observed suppression of tumor growth in the Macroglucan-administered group. That group also experienced suppression of weight loss after irradiation in the experiment for radioprotection, and a consequent increase in the survival rate compared with the control group. Protective effects appeared in photomicrographs of the intestinal cells. These results confirmed Macroglucan's radioprotective effects. These effects may be related to the suppression of infection accompanying immunological activation due to Macroglucan administration, antioxidant activity, and radical scavenging capacity. (author)
Bacillus subtilis biofilm induction by plant polysaccharides.
Beauregard, Pascale B; Chai, Yunrong; Vlamakis, Hera; Losick, Richard; Kolter, Roberto
2013-04-23
Bacillus subtilis is a plant-beneficial Gram-positive bacterium widely used as a biofertilizer. However, relatively little is known regarding the molecular processes underlying this bacterium's ability to colonize roots. In contrast, much is known about how this bacterium forms matrix-enclosed multicellular communities (biofilms) in vitro. Here, we show that, when B. subtilis colonizes Arabidopsis thaliana roots it forms biofilms that depend on the same matrix genes required in vitro. B. subtilis biofilm formation was triggered by certain plant polysaccharides. These polysaccharides served as a signal for biofilm formation transduced via the kinases controlling the phosphorylation state of the master regulator Spo0A. In addition, plant polysaccharides are used as a source of sugars for the synthesis of the matrix exopolysaccharide. The bacterium's response to plant polysaccharides was observed across several different strains of the species, some of which are known to have beneficial effects on plants. These observations provide evidence that biofilm genes are crucial for Arabidopsis root colonization by B. subtilis and provide insights into how matrix synthesis may be triggered by this plant.
Formation and ecotoxicity of N-heterocyclic compounds on ammoxidation of mono- and polysaccharides.
Klinger, Karl Michael; Liebner, Falk; Fritz, Ines; Potthast, Antje; Rosenau, Thomas
2013-09-25
Ammoxidation of technical lignins under mild conditions is a suitable approach to artificial humic substances. However, carbohydrates as common minor constituents of technical lignins have been demonstrated to be a potential source of N-heterocyclic ecotoxic compounds. Ethyl acetate extracts of ammoxidation mixtures of the monosaccharides glucose and xylose exhibited considerable growth inhibiting activity in the OECD 201 test, with 4-methyl-1H-imidazole, 4-(hydroxymethyl)-1H-imidazole, and 3-hydroxypyridine being the most active compounds. The amount of N-heterocyclic compounds formed at moderate ammoxidation conditions (70 °C, 0.2 MPa O2, 3 h) was significantly lower for the polysaccharides cellulose and xylan (16-30 μg/g of educt) compared to glucose (15.4 mg). Ammoxidation at higher temperature is not recommendable for carbohydrate-rich materials as much higher amounts of N-heterocyclic compounds were formed from both monosaccharides (100 °C: 122.4-160.5 mg/g of educt) and polysaccharides (140 °C: 5.52-16.03 mg/g of educt).
An optimized DNA extraction protocol for benthic Didymosphenia geminata.
Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto
2014-09-01
Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
DEFF Research Database (Denmark)
Kristensen, Kim; Gyhrs, A; Lausen, B
1996-01-01
OBJECTIVE: To evaluate the antibody response to a Haemophilus influenzae type b capsular polysaccharide (HibCP) tetanus toxoid (TT) conjugate vaccine (HibCP-TT) in preterm infants. SUBJECTS: Thirty-five healthy preterm infants with gestational ages (GA) from 27 to 36 weeks and birth weights from...
Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome
Directory of Open Access Journals (Sweden)
D. El Khoury
2012-01-01
Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.
Sigida, Elena N; Fedonenko, Yuliya P; Shashkov, Alexander S; Zdorovenko, Evelina L; Konnova, Svetlana A; Ignatov, Vladimir V; Knirel, Yuriy A
2013-10-18
Lipopolysaccharide was obtained by phenol-water extraction from dried bacterial cells of Azospirillum brasilense type strain Sp7. Mild acid hydrolysis of the lipopolysaccharide followed by GPC on Sephadex G-50 resulted in a polysaccharide mixture, which was studied by composition and methylation analyses, Smith degradation and (1)H and (13)C NMR spectroscopy. The following polysaccharide structures were established, where italics indicate a non-stoichiometric (∼40%) 2-O-methylation of l-rhamnose. Copyright © 2013 Elsevier Ltd. All rights reserved.
Zhao, Rui; Gao, Xu; Cai, Yaping; Shao, Xingyue; Jia, Guiyan; Huang, Yulan; Qin, Xuegong; Wang, Jingwei; Zheng, Xiaoliang
2013-07-25
Portulaca oleracea L. has been used as folk medicine in different countries to treat different ailments in humans. P. oleracea L. polysaccharide (POL-P), extracted from P. oleracea L., is found to have bioactivities such as hypoglycemic and hypolipidemic activities, antioxidant and antitumor activities. In our study, a water-soluble polysaccharide (POL-P3b) was successfully purified from Galium verum L. by DEAE cellulose and Sephadex G-200 column chromatography. To evaluate the anticancer efficacy and associated mechanisms of POL-P3b on cervical cancer in vitro and in vivo, we showed that treatment of HeLa cell with POL-P3b inhibited cell proliferation. In addition, POL-P3b significantly inhibited tumor growth in U14-bearing mice. Further analysis indicated that POL-P3b possesses the activity of inhibiting cervical cancer cell growth in vitro and in vivo at a concentration- and time-dependent manner, and the mechanisms were associated with Sub-G1 phase cell cycle arrest, triggering DNA damage and inducing apoptosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Liao, Ying; Yuan, Wen-yu; Zheng, Wen-ke; Luo, Ao-xue; Fan, Yi-jun
2015-11-01
To compare the radical scavenging activity of five different acidic polysaccharides, and to find the correlation with the functional groups. Alkali extraction method and Stepwise ethanol precipitation method were used to extract and concentrate the five Dendrobium polysaccharides, and to determine the contents of sulfuric acid and uronic acid of each kind of acidic polysaccharides, and the scavenging activity to ABTS+ radical and hydroxyl radical. Functional group structures were examined by FTIR Spectrometer. Five kinds of Dendrobium polysaccharides had different ability of scavenging ABTS+ free radical and hydroxyl free radical. Moreover, the study had shown that five kinds of antioxidant activity of acidic polysaccharides had obvious correlation withuronic acid and sulfuric acid. The antioxidant activity of each sample was positively correlated with the content of uronic acid, and negatively correlated with the content of sulfuric acid. Sulfuric acid can inhibit the antioxidant activity of acidic polysaccharide but uronic acid can enhance the free radical scavenging activity. By analyzing the structure characteristics of five acidic polysaccharides, all samples have similar structures, however, Dendrobium denneanum, Dendrobium devonianum and Dendrobium officinale which had β configuration have higher antioxidant activity than Dendrobium nobile and Dendrobium fimbriatum which had a configuration.
Rakha, Allah; Aman, Per; Andersson, Roger
2011-01-01
Extractable dietary fiber (DF) plays an important role in nutrition. This study on porridge making with whole grain rye investigated the effect of rest time of flour slurries at room temperature before cooking and amount of flour and salt in the recipe on the content of DF components and molecular weight distribution of extractable fructan, mixed linkage (1→3)(1→4)-β-d-glucan (β-glucan) and arabinoxylan (AX) in the porridge. The content of total DF was increased (from about 20% to 23% of dry matter) during porridge making due to formation of insoluble resistant starch. A small but significant increase in the extractability of β-glucan (P = 0.016) and AX (P = 0.002) due to rest time was also noted. The molecular weight of extractable fructan and AX remained stable during porridge making. However, incubation of the rye flour slurries at increased temperature resulted in a significant decrease in extractable AX molecular weight. The molecular weight of extractable β-glucan decreased greatly during a rest time before cooking, most likely by the action of endogenous enzymes. The amount of salt and flour used in the recipe had small but significant effects on the molecular weight of β-glucan. These results show that whole grain rye porridge made without a rest time before cooking contains extractable DF components maintaining high molecular weights. High molecular weight is most likely of nutritional importance.
Directory of Open Access Journals (Sweden)
Roger Andersson
2011-05-01
Full Text Available Extractable dietary fiber (DF plays an important role in nutrition. This study on porridge making with whole grain rye investigated the effect of rest time of flour slurries at room temperature before cooking and amount of flour and salt in the recipe on the content of DF components and molecular weight distribution of extractable fructan, mixed linkage (1→3(1→4-β-D-glucan (β-glucan and arabinoxylan (AX in the porridge. The content of total DF was increased (from about 20% to 23% of dry matter during porridge making due to formation of insoluble resistant starch. A small but significant increase in the extractability of β-glucan (P = 0.016 and AX (P = 0.002 due to rest time was also noted. The molecular weight of extractable fructan and AX remained stable during porridge making. However, incubation of the rye flour slurries at increased temperature resulted in a significant decrease in extractable AX molecular weight. The molecular weight of extractable β-glucan decreased greatly during a rest time before cooking, most likely by the action of endogenous enzymes. The amount of salt and flour used in the recipe had small but significant effects on the molecular weight of β-glucan. These results show that whole grain rye porridge made without a rest time before cooking contains extractable DF components maintaining high molecular weights. High molecular weight is most likely of nutritional importance.
Qin, Tao; Ren, Zhe; Huang, Yifan; Song, Yulong; Lin, Dandan; Li, Jian; Ma, Yufang; Wu, Xiuqin; Qiu, Fuan; Xiao, Qi
2017-04-01
In this study, polysaccharides extracted from Hericium erinaceus were modified to obtain its nine selenium derivatives, sHEP 1 -sHEP 9 . Their structures were identified, yields and selenium contents were determined, the phenotypic and functional maturation of murine bone marrow-derived dendritic cells (DCs) and relevant mechanisms were compared taking unmodified HEP as control. The results revealed that the selenylation were successful. sHEP 1 , sHEP 2 and sHEP 8 treatment of DCs increased their surface expression of MHC-II and CD86 and indicated that sHEP 1 , sHEP 2 and sHEP 8 induced DC maturation. Furthermore, sHEP 2 and sHEP 8 also significantly decreased DCs endocytosis and significantly enhanced cytokine (IL-12 and IFN-γ) production. In line with TLR4 activation, sHEP 2 increased the phosphorylation of ERK, p38, and JNK, and the nuclear translocation of p-c-Jun, p-CREB, and c-Fos. sHEP 2 also activated NF-κB signaling, as evidenced by degradation of IκBα/β and nuclear translocation of p65 and p50. Together, these results suggest that sHEP is a strong immunostimulant. Copyright © 2017 Elsevier B.V. All rights reserved.
In vitro antioxidant activity of polysaccharide from Gardenia jasminoides ellis
Fan, Y.; Ge, Z.; Luo, A.
2011-01-01
A water-soluble polysaccharide, GP, was isolated from Gardenia jasminoides Ellis through hot water extraction followed by ethanol precipitation. The in vitro free radicals scavenging tests exhibited that GP has significant scavenging abilities especially for ABTS, DPPH, and hydroxyl radicals, which suggests that the polysaccharide GP is a novel antioxidant. ?? 2011 Academic Journals.
Effects of water extract of Curcuma longa (L.) roots on immunity and telomerase function.
Pan, Min-Hsiung; Wu, Jia-Ching; Ho, Chi-Tang; Badmaev, Vladimir
2017-05-12
Background Immunity and Longevity Methods A water extract of Curcuma longa (L.) [vern. Turmeric] roots (TurmericImmune™) standardized for a minimum 20 % of turmeric polysaccharides ukonan A, B, C and D was evaluated for its biological properties in in vitro tissue culture studies. Results The water extract of turmeric (TurP) exhibited induced-nitric oxide (NO) production in RAW264.7 macrophages. These results suggested the immunomodulatory effects of TurP. In addition, the polysaccharides up-regulated function of telomerase reverse transcriptase (TERT) equally to the phenolic compound from turmeric, curcumin. Conclusions The ukonan family of polysaccharides may assist in promoting cellular immune responses, tissue repair and lifespan by enhancing immune response and telomere function.
Shao, Ping; Pei, Yaping; Fang, Zhongxian; Sun, Peilong
2014-04-01
Ulva fasciata belonging to the family Ulvaceae, commonly known as 'sea lettuce', is an abundantly growing green seaweed in coastal seashore of South China. Three different molecular weight sulfated polysaccharides (UFP1, UFP2 and UFP3) were extracted and separated from U. fasciata by hot water extraction and ultrafiltration. The three native UFP fractions had partial desulfurization by solvolytic desulfation respectively and the effect of sulfate content on the exhibition of the antioxidant and anti-tumor capacities had been evaluated and compared. The results showed that each native polysaccharide (UFP1, UFP2, UFP3) with high sulfate content exhibited better antioxidant activities compared with the partial desulfated polysaccharides (DS-UFP1, DS-UFP2, DS-UFP3). Specifically, UFP2 with relatively high sulfate content, molecular weight and uronic acid content had consistently excellent antioxidant performances. However, UFP2 demonstrated the minimal inhibitory effects on growth of DLD intestinal cancer cells. Instead, DS-UFP3 with the lowest sulfate content but highest uronic acid content and molecular weight exhibited the best antitumor activity. Copyright © 2014 Elsevier B.V. All rights reserved.
Hou, Ningning; Zhang, Meng; Xu, Yingjie; Sun, Zhongmin; Wang, Jing; Zhang, Lijuan; Zhang, Quanbin
2017-12-01
Crude polysaccharides from Costaria costata were extracted by hot water and further fractionated by anion exchange chromatography into three polysaccharide fractions. Three low molecular weight fragments were then prepared by degradation of the polysaccharides with hydrogen peroxide and ascorbic acid. The structural features of the polysaccharides and their low molecular weight fragments were elucidated for the first time based on the HGPC, FT-IR, NMR, MS, monosaccharide composition, and other chemical analyses. Their anticoagulant and FGF-1, -2, -7, -8, -9, -10/FGFR1c signaling activation activities in BaF3 cells were also examined. Our studies showed that the polysaccharides were sulfated at different positions of galactose and fucose residues. The APTT-, PT- and TT-based anticoagulant assay results indicated that a high molecular weight and a higher degree of sulfation were essential for their anticoagulant activities. In contrast, not only the polysaccharides but also the depolymerized fragments showed significant FGF/FGFR signal activating activities in a FGF-, molecular weight-, and sulfation-dependent manner. The results presented in current study demonstrated the potential use of the polysaccharides and their fragments as anticoagulants and FGF signal regulators. Copyright © 2017 Elsevier B.V. All rights reserved.
Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan
Directory of Open Access Journals (Sweden)
JD Biller-Takahashi
Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.
Luo, Aoxue; Luo, Aoshuang; Huang, Jiandong; Fan, Yijun
2012-07-05
A water-soluble polysaccharide (BEBP) was extracted from Boletus edulis Bull using hot water extraction followed by ethanol precipitation. The polysaccharide BEBP was further purified by chromatography on a DEAE-cellulose column, giving three major polysaccharide fractions termed BEBP-1, BEBP-2 and BEBP-3. In the next experiment, the average molecular weight (Mw), IR and monosaccharide compositional analysis of the three polysaccharide fractions were determined. The evaluation of antioxidant activities both in vitro and in vivo suggested that BEBP-3 had good potential antioxidant activity, and should be explored as a novel potential antioxidant.
Directory of Open Access Journals (Sweden)
Chun-Hung Chiu
2013-12-01
Full Text Available Antrodia cinnamomea (AC is a unique fungus found inhabiting the rotten wood of Cinnamomum kanehirai. A submerged liquid culture of AC has been developed and its bioproducts have been used to meet the market demand for natural fruiting bodies. AC exhibits anti-inflammatory, antitumor, antioxidant, and immunomodulatory effects. Previously, we isolated polysaccharide AC-2 from AC mycelia by means of alkali extraction with subsequent acid precipitation and found it had a pronounced anti-inflammatory effect. In this study, a novel polysaccharide named “antrodan” was obtained by further purification of AC-2 using Sepharose CL-6B column chromatography. Antrodan exhibited a molecular weight of 442 kD and contained a particularly high content of uronic acid (152.6 ± 0.8 mg/g. The protein content was 71.0%, apparently, higher than the carbohydrate content (14.1%, and thus antrodan was characterized as a glycoprotein. Its total glucan content was 15.65%, in which β-glucan (14.20% was prominently higher than α-glucan (1.45%. Its FTIR confirmed the presence of β-linkages between sugars, and intramolecular amide bonds between sugars and amino acids. Its 1H-NMR spectrum showed that antrodan was a complex union of α- and β-glucans, which had (1→ 4-linked α-Glcp and (1→ 3-linked β-Glcp linkages to the carbohydrate chains via asparagine linked to protein site. Biologically, antrodan was confirmed to be totally non-detrimental to RAW 264.7 cell line even at dose as high as 400 μg/mL. It showed potent suppressing effect on the lipopolysaccharide-induced inflammatory responses in RAW 264.7 cell line. Moreover, antrodan significantly reduced the nitrogen oxide production at doses as low as 18.75 μg/mL.
Suppressing effects of glucan on micronuclei induced by Co60 in mice
International Nuclear Information System (INIS)
Chorvatovicova, D.
1991-01-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de
Yao, Yang; Shi, Zhenxing; Ren, Guixing
2014-10-23
The water-extractable (QWP) and the alkali-extractable (QAP) polysaccharides from quinoa (named QWP and QAP, respectively) and their four polysaccharide sub-fractions (QWP-1, QWP-2, QAP-1 and QAP-2), were isolated and purified by anion-exchange and gel filtration chromatography. QWP-1 and QWP-2 were composed of Rha, Ara, Gal and GalA. QAP-1 and QAP-2 were composed of Rha, Ara, Man, Gal and GalA. Antioxidant and immunoregulatory activities of the polysaccharides were evaluated. The results showed that QWP-1, QWP-2, QAP-1 and QAP-2 had significant antioxidant and immunoregulatory activities. The results suggest that QWP-1, QWP-2, QAP-1 and QAP-2 could be used as potential antioxidants and immunomodulators.
Antioxidant and Immunoregulatory Activity of Polysaccharides from Quinoa (Chenopodium quinoa Willd.
Directory of Open Access Journals (Sweden)
Yang Yao
2014-10-01
Full Text Available The water-extractable (QWP and the alkali-extractable (QAP polysaccharides from quinoa (named QWP and QAP, respectively and their four polysaccharide sub-fractions (QWP-1, QWP-2, QAP-1 and QAP-2, were isolated and purified by anion-exchange and gel filtration chromatography. QWP-1 and QWP-2 were composed of Rha, Ara, Gal and GalA. QAP-1 and QAP-2 were composed of Rha, Ara, Man, Gal and GalA. Antioxidant and immunoregulatory activities of the polysaccharides were evaluated. The results showed that QWP-1, QWP-2, QAP-1 and QAP-2 had significant antioxidant and immunoregulatory activities. The results suggest that QWP-1, QWP-2, QAP-1 and QAP-2 could be used as potential antioxidants and immunomodulators.
Marine Origin Polysaccharides in Drug Delivery Systems.
Cardoso, Matias J; Costa, Rui R; Mano, João F
2016-02-05
Oceans are a vast source of natural substances. In them, we find various compounds with wide biotechnological and biomedical applicabilities. The exploitation of the sea as a renewable source of biocompounds can have a positive impact on the development of new systems and devices for biomedical applications. Marine polysaccharides are among the most abundant materials in the seas, which contributes to a decrease of the extraction costs, besides their solubility behavior in aqueous solvents and extraction media, and their interaction with other biocompounds. Polysaccharides such as alginate, carrageenan and fucoidan can be extracted from algae, whereas chitosan and hyaluronan can be obtained from animal sources. Most marine polysaccharides have important biological properties such as biocompatibility, biodegradability, and anti-inflammatory activity, as well as adhesive and antimicrobial actions. Moreover, they can be modified in order to allow processing them into various shapes and sizes and may exhibit response dependence to external stimuli, such as pH and temperature. Due to these properties, these biomaterials have been studied as raw material for the construction of carrier devices for drugs, including particles, capsules and hydrogels. The devices are designed to achieve a controlled release of therapeutic agents in an attempt to fight against serious diseases, and to be used in advanced therapies, such as gene delivery or regenerative medicine.
Marine Origin Polysaccharides in Drug Delivery Systems
Cardoso, Matias J.; Costa, Rui R.; Mano, João F.
2016-01-01
Oceans are a vast source of natural substances. In them, we find various compounds with wide biotechnological and biomedical applicabilities. The exploitation of the sea as a renewable source of biocompounds can have a positive impact on the development of new systems and devices for biomedical applications. Marine polysaccharides are among the most abundant materials in the seas, which contributes to a decrease of the extraction costs, besides their solubility behavior in aqueous solvents and extraction media, and their interaction with other biocompounds. Polysaccharides such as alginate, carrageenan and fucoidan can be extracted from algae, whereas chitosan and hyaluronan can be obtained from animal sources. Most marine polysaccharides have important biological properties such as biocompatibility, biodegradability, and anti-inflammatory activity, as well as adhesive and antimicrobial actions. Moreover, they can be modified in order to allow processing them into various shapes and sizes and may exhibit response dependence to external stimuli, such as pH and temperature. Due to these properties, these biomaterials have been studied as raw material for the construction of carrier devices for drugs, including particles, capsules and hydrogels. The devices are designed to achieve a controlled release of therapeutic agents in an attempt to fight against serious diseases, and to be used in advanced therapies, such as gene delivery or regenerative medicine. PMID:26861358
Marine Origin Polysaccharides in Drug Delivery Systems
Directory of Open Access Journals (Sweden)
Matias J. Cardoso
2016-02-01
Full Text Available Oceans are a vast source of natural substances. In them, we find various compounds with wide biotechnological and biomedical applicabilities. The exploitation of the sea as a renewable source of biocompounds can have a positive impact on the development of new systems and devices for biomedical applications. Marine polysaccharides are among the most abundant materials in the seas, which contributes to a decrease of the extraction costs, besides their solubility behavior in aqueous solvents and extraction media, and their interaction with other biocompounds. Polysaccharides such as alginate, carrageenan and fucoidan can be extracted from algae, whereas chitosan and hyaluronan can be obtained from animal sources. Most marine polysaccharides have important biological properties such as biocompatibility, biodegradability, and anti-inflammatory activity, as well as adhesive and antimicrobial actions. Moreover, they can be modified in order to allow processing them into various shapes and sizes and may exhibit response dependence to external stimuli, such as pH and temperature. Due to these properties, these biomaterials have been studied as raw material for the construction of carrier devices for drugs, including particles, capsules and hydrogels. The devices are designed to achieve a controlled release of therapeutic agents in an attempt to fight against serious diseases, and to be used in advanced therapies, such as gene delivery or regenerative medicine.
Zhu, Hongji; Tian, Li; Zhang, Lei; Bi, Jingxiu; Song, Qianqian; Yang, Hui; Qiao, Jianjun
2018-06-01
This study explored the potential of spent Lentinus edodes substrate, a by-product of mushroom industries causing environmental pollution, serving as materials to produce antioxidant polysaccharide. The extraction process of spent Lentinus edodes substrate polysaccharide (SLSP) was optimized and the effects of drying methods on chemical composition, morphological property and antioxidant activity were investigated. Results showed that freeze-dried SLSP (SLSP-F) exhibited the best quality in terms of the polysaccharide yield (13.00%) and antioxidant activity. The EC 50 values of SLSP-F on DPPH, ABTS and superoxide anion radicals was 0.051mg/mL, 0.379mg/mL, 0.719mg/mL, respectively, which was significantly lower than that of freeze-dried Lentinus edodes polysaccharide (LP-F). After purification by Sephadex G-150, the purified SLSP-F (PSP) has a molecular weight of 16.77kDa. Compared with LP-F, PSP has more reducing sugars and uronic acids in chemical composition and higher contents of xylose, glucose and galactose in monosaccharide composition. FT-IR and NMR spectroscopy analysis revealed that PSP has both α and β glycosidic bonds and massive acetyl groups, which is different from LP-F mainly composed of 1, 3 linked α-D-Manp residue with some acetyl groups. The findings provided a reliable approach for the development of antioxidant polysaccharide from spent Lentinus edodes substrate. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Dickinson, D.B.
1975-01-01
Enzymes and metabolic pathways, by which starch and cell wall polysaccharides are formed, were investigated in order to learn how these processes are regulated and to identify the enzymatic regulatory mechanisms involved. Germinating lily pollen was used for studies of cell wall formation, and pollen and maize endosperm for studies of starch biosynthesis. Hexokinase being the first step in conversion of hexoses to starch, wall polysaccharides and respiratory substrates, maize endosperm enzyme was assayed by its conversion of 14 C-hexose to 14 C-hexose-6-P, and rapid separation of the two labelled compounds on anion-exchange paper. This enzyme did not appear to be under tight regulation by feed-back inhibition or activation, nor to be severely inhibited by glucose-6-P or activated by citrate. ADP-glucose pyrophosphorylase and other pyrophosphorylases were assayed radiochemically with 14 C-glucose-1-P (forward direction) or 32-PPsub(i) (reverse direction). They showed that the maize endosperm enzyme was activated by the glycolytic intermediates fructose-6-P and 3-phosphoglycerate, and that low levels of the enzyme were present in the high sucrose-low starch mutant named shrunken-2. Under optimal in-vitro assay conditions, the pollen enzyme reacted four times faster than the observed in-vivo rate of starch accumulation. Biogenesis of plant cell wall polysaccharides requires the conversion of hexose phosphates to various sugar nucleotides and utilization of the latter by the appropriate polysaccharide synthetases. Lily pollen possesses a β-1,3-glucan synthetase which is activated up to six-fold by β-linked oligosaccharides. Hence, the in-vivo activity of this enzyme may be modulated by such effector molecules
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-07-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
International Nuclear Information System (INIS)
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-01-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Recombinant Plants Provide a New Approach to the Production of Bacterial Polysaccharide for Vaccines
Smith, Claire M.; Fry, Stephen C.; Gough, Kevin C.; Patel, Alexandra J. F.; Glenn, Sarah; Goldrick, Marie; Roberts, Ian S.; Andrew, Peter W.
2014-01-01
Bacterial polysaccharides have numerous clinical or industrial uses. Recombinant plants could offer the possibility of producing bacterial polysaccharides on a large scale and free of contaminating bacterial toxins and antigens. We investigated the feasibility of this proposal by cloning and expressing the gene for the type 3 synthase (cps3S) of Streptococcus pneumoniae in Nicotinia tabacum, using the pCambia2301 vector and Agrobacterium tumefaciens-mediated gene transfer. In planta the recombinant synthase polymerised plant-derived UDP-glucose and UDP-glucuronic acid to form type 3 polysaccharide. Expression of the cps3S gene was detected by RT-PCR and production of the pneumococcal polysaccharide was detected in tobacco leaf extracts by double immunodiffusion, Western blotting and high-voltage paper electrophoresis. Because it is used a component of anti-pneumococcal vaccines, the immunogenicity of the plant-derived type 3 polysaccharide was tested. Mice immunised with extracts from recombinant plants were protected from challenge with a lethal dose of pneumococci in a model of pneumonia and the immunised mice had significantly elevated levels of serum anti-pneumococcal polysaccharide antibodies. This study provides the proof of the principle that bacterial polysaccharide can be successfully synthesised in plants and that these recombinant polysaccharides could be used as vaccines to protect against life-threatening infections. PMID:24498433
Directory of Open Access Journals (Sweden)
Henky Manoppo
2010-06-01
Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.
He, Xirui; Wang, Xiaoxiao; Fang, Jiacheng; Chang, Yu; Ning, Ning; Guo, Hao; Huang, Linhong; Huang, Xiaoqiang; Zhao, Zefeng
2017-04-01
Hericium erinaceus (Bull.) Pers., also known as Yamabushitake, Houtou and Lion's Mane, is capable of fortifying the spleen and nourishing the stomach, tranquilizing the mind, and fighting cancer. Over the past decade, it has been demonstrated that H. erinaceus polysaccharides possess various promising bioactivities, including antitumor and immunomodulation, anti-gastric ulcer, neuroprotection and neuroregeneration, anti-oxidation and hepatoprotection, anti-hyperlipidemia, anti-hyperglycemia, anti-fatigue and anti-aging. The purpose of the present review is to provide systematically reorganized information on extraction and purification, structure characteristics, biological activities, and industrial applications of H. erinaceus polysaccharides to support their therapeutic potentials and sanitarian functions. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Borkowski, Leszek, E-mail: leszek.borkowski@umlub.pl [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek [Department of Animal Physiology, University of Life Sciences in Lublin, Akademicka 12, 20-033 Lublin (Poland); Polkowska, Izabela [Department and Clinic of Animal Surgery, University of Life Sciences in Lublin, Głęboka 30, 20-612 Lublin (Poland); Belcarz, Anna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland); Karpiński, Mirosław [Department of Companion and Wildlife Animals, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin (Poland); Słowik, Tymoteusz [Independent Radiology Unit at Lublin Small Animals Medical Centre, Stefczyka 11, 20-151 Lublin (Poland); Matuszewski, Łukasz [Children' s Orthopaedic Clinic and Rehabilitation Department, Medical University of Lublin, Chodzki 2, 20-093 Lublin (Poland); Ślósarczyk, Anna [Faculty of Materials Science and Ceramics, AGH-University of Science and Technology, Mickiewicza 30, 30-059 Krakow (Poland); Ginalska, Grażyna [Department of Biochemistry and Biotechnology, Medical University of Lublin, Chodźki 1, 20-093 Lublin (Poland)
2015-08-01
A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration.
International Nuclear Information System (INIS)
Borkowski, Leszek; Pawłowska, Marta; Radzki, Radosław P.; Bieńko, Marek; Polkowska, Izabela; Belcarz, Anna; Karpiński, Mirosław; Słowik, Tymoteusz; Matuszewski, Łukasz; Ślósarczyk, Anna; Ginalska, Grażyna
2015-01-01
A novel elastic hydroxyapatite-based composite of high surgical handiness has been developed. Its potential application in orthopedics as a filler of bone defects has been studied. The biomaterial was composed of carbonated hydroxyapatite (CHAP) granules and polysaccharide polymer (β-1,3-glucan). Cylinders of 4 mm in diameter and 6 mm in length were implanted into bone cavities created in the proximal metaphysis of tibiae of 24 New Zealand white rabbits. 18 sham-operated animals were used as controls. After 1, 3 or 6 months, the rabbits were euthanized, the bones were harvested and subjected to analysis. Radiological images and histological sections revealed integration of implants with bone tissue with no signs of graft rejection. Peripheral quantitative computed tomography (pQCT) indicated the stimulating effect of the biomaterial on bone formation and mineralization. Densitometry (DXA) analysis suggested that biomineralization of bones was preceded by bioresorption and gradual disappearance of porous ceramic granules. The findings suggest that the CHAP–glucan composite material enables regeneration of bone tissue and could serve as a bone defect filler. - Highlights: • Highly porous carbonate HAP granules and β-1,3-glucan were used to fill bone voids. • Critical size defects of rabbit tibiae were filled with the composite scaffolds. • Biocompatibility, mineralization and osseointegration of implants were examined. • Histological analysis indicated a high biocompatibility of composite grafts. • We report penetration of bony tissue into implants and advanced osseointegration
Anti-glycated and antiradical activities in vitro of polysaccharides from Ganoderma capense
Yan, Chunyan; Kong, Fansheng; Zhang, Dezhi; Cui, Jiangxia
2013-01-01
Background : Ganoderma capense is a Ganoderma species and is widely used, especially in Asia, as a well-known medicinal mushroom for health-promoting effect and for treatment of chronic diseases, such as diabetes, aging, etc. G. capense is rich of polysaccharide. Objective: To isolate the polysaccharides from G. capense and evaluate their anti-glycated and antiradical activities in vitro. Materials and Methods : The dried powder of submerged fermentation culturing mycelium of G. capense was d...
Jiao, Guangling; Yu, Guangli; Wang, Wei; Zhao, Xiaoliang; Zhang, Junzeng; Ewart, Stephen H.
2012-06-01
To explore the polysaccharides from selected seaweeds of Atlantic Canada and to evaluate their potential anti-influenza virus activities, polysaccharides were isolated from several Atlantic Canadian seaweeds, including three red algae ( Polysiphonia lanosa, Furcellaria lumbricalis, and Palmaria palmata), two brown algae ( Ascophyllum nodosum and Fucus vesiculosus), and one green alga ( Ulva lactuca) by sequential extraction with cold water, hot water, and alkali solutions. These polysaccharides were analyzed for monosaccharide composition and other general chemical properties, and they were evaluated for anti-influenza virus activities. Total sugar contents in these polysaccharides ranged from 15.4% (in U. lactuca) to 91.4% (in F. lumbricalis); sulfation level was as high as 17.6% in a polysaccharide from U. lactuca, whereas it could not be detected in an alikali-extract from P. palmaria. For polysaccharides from red seaweeds, the main sugar units were sulfated galactans (agar or carrageenan) for P. lanosa, F. lumbricalis, and xylans for P. palmata. In brown seaweeds, the polysaccharides largely contained sulfated fucans, whereas the polysaccharides in green seaweed were mainly composed of heteroglycuronans. Screening for antiviral activity against influenza A/PR/8/34 (H1N1) virus revealed that brown algal polysaccharides were particularly effective. Seaweeds from Atlantic Canada are a good source of marine polysaccharides with potential antiviral properties.
Parthasarathy, Narayanan; DeShazer, David; England, Marilyn; Waag, David M
2006-11-01
A polysaccharide microarray platform was prepared by immobilizing Burkholderia pseudomallei and Burkholderia mallei polysaccharides. This polysaccharide array was tested with success for detecting B. pseudomallei and B. mallei serum (human and animal) antibodies. The advantages of this microarray technology over the current serodiagnosis of the above bacterial infections were discussed.
Understanding the role of oat ß-glucan in oat-based dough systems
Londono, D.M.; Gilissen, L.J.W.J.; Visser, R.G.F.; Smulders, M.J.M.; Hamer, R.J.
2015-01-01
B-glucan is one of the components that differentiate oats from other cereals and that contribute to the health-related value of oats. However, so far oats cannot easily be applied in bread-like products without loss of product quality. Here we have studied how the content and viscosity of oat
Czech Academy of Sciences Publication Activity Database
Šíma, Petr; Vannucci, Luca; Větvička, V.
2017-01-01
Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016
Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae
Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.
1999-01-01
β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are
Hydrolysis of maize starch using amylolytic enzymes extracted from ...
African Journals Online (AJOL)
Amylases, a-amylase (EC 3.2.1.1, α-1, 4-glucan-4-glucanohydrolase) and glucoamylase (EC 3.2.1.3, α-1, 4; α-1, 6-glucan glucohydrolase; amyloglucosidase), extracted and partially purified from sorghum malt were used to hydrolyze maize starch. The process and products of the enzymatic hydrolysis were also compared ...
Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice
Energy Technology Data Exchange (ETDEWEB)
Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)
1991-10-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).
Wessels, M R; Paoletti, L C; Rodewald, A K; Michon, F; DiFabio, J; Jennings, H J; Kasper, D L
1993-01-01
Antisera elicited by type Ia group B streptococci (GBS) contain antibodies that react with both type Ia and type Ib strains. Previous studies suggested that antibodies elicited by type Ia organisms recognized a carbohydrate antigen or epitope common to Ia and Ib strains. We now report the synthesis and immunogenicity testing of a type Ia polysaccharide-tetanus toxoid (Ia-TT) conjugate vaccine. Ia-TT elicited type Ia polysaccharide-specific immunoglobulin G antibodies in all three of the rabbi...
Pionnier, Nicolas; Falco, Alberto; Miest, Joanna J.; Shrive, Annette K.; Hoole, Dave
2014-01-01
The effect of β-glucan as a feed additive on the serum and gene profile of C-reactive protein (CRP) and complement acute phase responses was ascertained in common carp Cyprinus carpio. In addition effects of subsequent intraperitoneal injections of pathogen-associated molecular patterns (PAMPs), i.e. LPS or poly(I:C), to mimic bacterial or viral infection respectively, were studied. Carp were first orally fed with β-glucan (MacroGard®) with a daily β-glucan intake of 6 mg per kg body weight o...
International Nuclear Information System (INIS)
Le Quang Luan; Nguyen Thanh Long
2015-01-01
The insoluble β-glucan extracted from the cell wall of brewer’s yeast was dispersed in deionized water for swelling, then irradiated in order to degrade into water-soluble β-glucan. The results revealed that the water-soluble β-glucan contents in the irradiated samples were increased with radiation dose to 25.89, 49.07 and 66.71%; whereas their molecular weight (Mw) decreased to 48.1, 23.0 and 10.8 kDa by gamma irradiation at 100, 200 and 300 kGy, respectively. The supplementation of poultry feed with the radiation degraded β-glucan enhanced both non-specific (total white blood cells, lymphocytes, neutrocytes) and specific immune components (anti-Newcastle disease, antiGumboro disease virus and anti-infectious bronchitis virus antibodies) in the broilers. In comparison with the control, broiler fed normal poultry foodstuff without β-glucan, the supplementation of radiation degraded β-glucan not only increased the survival rate of the testing broiler about 33.3% and their average body weight of about 24.4%, but also reduced the feed conversion rate from 4.8 to 3.1 kg. The β-glucan oligosaccharides that having Mw of about 25 kDa produced by gamma irradiation at 200 kGy showed the highest effect on the growth performance and immunomodulatory capability in the immune system of the testing broilers. This product is promising to be applied for production of the safe stimulator of immunity for broiler chickens. (author)
Ayeka, Peter Amwoga; Bian, YuHong; Githaiga, Peter Mwitari; Zhao, Ying
2017-12-15
The increasing use of complementary and alternative medicine (CAM) has kindled the need for scientific evaluation of the mechanism of action of CAMs. Although, licorice, a common ingredient in many Traditional Chinese medicine (TCM) has attracted great attention for its antitumor and immunomodulatory activities, the mechanism of action of its polysaccharides is still unclear. Here we report the immunomodulatory activity of licorice polysaccharides in vivo. The differential anticancer activities of licorice polysaccharides by tumorigenesis and immunomodulation was evaluated in vivo. Six weeks old, 120 CT-26 tumor bearing BALB/c mice, weighing 20 ± 2 g were used. They were randomly divided into six groups, three groups receiving high molecular weight (fraction A), low molecular weight (fraction B) polysaccharides and crude extract (fraction C); positive, negative and normal groups receiving cytoxin, saline and normal diet respectively. Weight of mice and tumors was determined and tumorigenicity assay calculated to determine the anticancer effects. Immunomodulatory potential was determined by immune organ indices, immune cell population and serum cytokine levels using immune organ weight and index, flow cytometry and cytokine/chemokine bead panel kit respectively. Licorice polysaccharides exhibited immunomodulatory activities in CT 26 tumor bearing BALB/c mice. The polysaccharides significantly suppressed tumor growth and increased immune organ index. Furthermore, the immunomodulatory effect was evident with activation of CD4 + and CD8 + immune cells population. The polysaccharides also affected the production of various cytokines, by increasing IL 2, IL 6, IL 7 levels and a decreasing TNFα levels. In summary, licorice polysaccharide especially of low molecular weight exhibit anticancer and immunomodulatory activities by suppressing tumor growth and improving general health of mice. They also augment the thymus/spleen index and population of T lymphocytes
Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation
Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.
2015-01-01
β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the
Directory of Open Access Journals (Sweden)
Harry J. Wichers
2010-08-01
Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.
Chemical analysis of a polysaccharide of unripe (green) tomato (Lycopersicon esculentum).
Chandra, Krishnendu; Ghosh, Kaushik; Ojha, Arnab K; Islam, Syed S
2009-11-02
A polysaccharide (PS-I) isolated from the aqueous extract of the unripe (green) tomatoes (Lycopersicon esculentum) consists of D-galactose, D-methyl galacturonate, D-arabinose, L-arabinose, and L-rhamnose. Structural investigation of the polysaccharide was carried out using total acid hydrolysis, methylation analysis, periodate oxidation study, and NMR studies ((1)H, (13)C, DQF-COSY, TOCSY, NOESY, ROESY, HMQC, and HMBC). On the basis of above-mentioned experiments the structure of the repeating unit of the polysaccharide (PS-I) was established as: [structure: see text].
Gillet, Sébastien; Richel, Aurore
2014-01-01
Polysaccharides are usually composed of various monosaccharides linked with different glucosidic bonds. Some polysaccharides have hyperbranched structures. Moreover, polysaccharides often have high molecular weights, and tend to form aggregates in solution that can mask the behavior of individual macromolecules. In consequence, to characterize the chemical structures, chain conformations and physical properties of polysaccharides is not an easy task.
Wong, Ka-Hing; Cheung, Peter C K
2005-11-30
Preparation of three novel dietary fibers (DFs) from mushroom sclerotia, namely, Pleurotus tuberregium, Polyporous rhinocerus, and Wolfiporia cocos, by a scale-up modified AOAC procedure using industrial enzymes was investigated. A remarkably high level of total dietary fiber (TDF) ranging from 81.7 to 96.3% sample dry matter (DM), in which a content of nonstarch polysaccharide (NSP) ranging from 86.6 to 94.3% sclerotial TDF DM, was obtained from the three sclerotia. All sclerotial DFs were rich in beta-glucan (the glucose residue ranged from 89.7 to 94.5% NSP DM) with a very low level of resistant glycogen (ranged from 3.77 to 3.94% sclerotial TDF DM). All three novel sclerotial DFs also exhibited similar, if not better, physicochemical and functional properties (pH, color, water binding capacity, oil holding capacity, and emulsifying properties) as those of barely DF control and commercial DF-rich ingredients. The potential use of the three mushroom sclerotial DFs as a new beta-glucan type DF-rich ingredient in the food industry was discussed.
Directory of Open Access Journals (Sweden)
Lisa M. Yerke
2017-05-01
Full Text Available Rapid and complete soft tissue healing after tooth extraction minimizes surgical complications and facilitates subsequent implant placement. We used four treatment methods and assessed changes in soft tissue socket closure following tooth extraction in humans. The effects of platelet-rich fibrin-calcium sulfate hemihydrate (PRF-CSH, platelet-rich plasma-calcium sulfate hemihydrate (PRP-CSH, a resorbable collagen dressing (RCD, and no grafting material were compared in a randomized, controlled pilot study with a blinded parallel design (N = 23. Patients with a hopeless tooth scheduled for extraction were randomly assigned to one of the four treatment groups. Socket measurements were obtained immediately after extraction and treatment, as well as after 21 days. There was a significant decrease in the total epithelialized external surface area of the extraction sockets in each group at all time points. However, there were no significant differences in soft tissue closure (p > 0.05 at any time point and PRF-CSH or PRP-CSH did not provide any additional benefit to enhance the soft tissue closure of extraction sockets compared with either RCD or sites without graft.
Immune receptors for polysaccharides from Ganoderma lucidum
International Nuclear Information System (INIS)
Shao Baomei; Dai Hui; Xu Wen; Lin Zhibin; Gao Xiaoming
2004-01-01
This study was designed to identify and characterize the immune receptors for polysaccharides from Ganoderma lucidum, a Chinese medicinal fungus that exhibits anti-tumor activities via enhancing host immunity. We herein demonstrate that G. lucidum polysaccharides (GLPS) activated BALB/c mouse B cells and macrophages, but not T cells, in vitro. However, GLPS was unable to activate splenic B cells from C3H/HeJ mice that have a mutated TLR4 molecule (incapable of signal transduction) in proliferation assays. Rat anti-mouse TLR4 monoclonal antibody (Ab) inhibited the proliferation of BALB/c mouse B cells under GLPS stimulation. Combination of Abs against mouse TLR4 and immunoglobulin (Ig) achieved almost complete inhibition of GLPS-induced B cell proliferation, implying that both membrane Ig and TLR4 are required for GLPS-mediated B cell activation. In addition, GLPS significantly inhibited the binding of mouse peritoneal macrophages with polysaccharides from Astragalus membranaceus, which is known to bind directly with TLR4 on macrophage surface. Moreover, GLPS induced IL-1β production by peritoneal macrophages from BALB/c, but not C3H/HeJ, mice, suggesting that TLR4 is also involved in GLPS-mediated macrophage activation. We Further identified a unique 31 kDa serum protein and two intracellular proteins (ribosomal protein S7 and a transcriptional coactivator) capable of binding with GLPS in co-precipitation experiments. Our results may have important implications for our understanding on the molecular mechanisms of immunopotentiating polysaccharides from traditional Chinese medicine
Effects of gamma irradiation on the physical and structural properties of β-glucan
International Nuclear Information System (INIS)
Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon
2008-01-01
This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility
β-Glucan and Dark Chocolate: A Randomized Crossover Study on Short-Term Satiety and Energy Intake
Directory of Open Access Journals (Sweden)
Asli Akyol
2014-09-01
Full Text Available Aim: The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Materials and Methods: Study subjects (n = 25 were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON, oat β-glucan (B-GLU, dark chocolate (DARK or oat β-glucan and dark chocolate (B-GLU + DARK were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. Results: VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014. Conclusion: The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.
β-Glucan and dark chocolate: a randomized crossover study on short-term satiety and energy intake.
Akyol, Asli; Dasgin, Halil; Ayaz, Aylin; Buyuktuncer, Zehra; Besler, H Tanju
2014-09-23
The aims of this study were to adapt a traditional recipe into a healthier form by adding 3 g of oat β-glucan, substituting milk chocolate to dark chocolate with 70% cocoa, and to examine the effect of these alterations on short-term satiety and energy intake. Study subjects (n = 25) were tested in a randomized, crossover design with four products closely matched for energy content. Four different versions of a traditional recipe including milk chocolate-control (CON), oat β-glucan (B-GLU), dark chocolate (DARK) or oat β-glucan and dark chocolate (B-GLU + DARK) were given to subjects on different test days. After subjects were asked to report visual analog scale (VAS) scores on sensory outcomes and related satiety for four hours ad libitum, lunch was served and energy intake of individuals was measured. VAS scores indicated that none of the test foods exerted an improved effect on satiety feelings. However, energy intake of individuals during ad libitum lunch was significantly lower in dark chocolate groups (CON: 849.46 ± 47.45 kcal versus DARK: 677.69 ± 48.45 kcal and B-GLU + DARK: 691.08 ± 47.45 kcal, p = 0.014). The study demonstrated that substituting dark chocolate for milk chocolate is more effective in inducing satiety during subsequent food intake in healthy subjects.
Mendonça-Filho, Ricardo R; Rodrigues, Igor A; Alviano, Daniela S; Santos, André L S; Soares, Rosangela M A; Alviano, Celuta S; Lopes, Angela H C S; Rosa, Maria do Socorro S
2004-04-01
The available therapy for leishmaniasis, which affects 2 million people per annum, still causes serious side effects. The polyphenolic-rich extract from the husk fiber of Cocos nucifera Linn. (Palmae) presents antibacterial and antiviral activities, also inhibiting lymphocyte proliferation, as shown by our group in previous works. In the present study, the in vitro leishmanicidal effects of C. nucifera on Leishmania amazonensis were evaluated. The minimal inhibitory concentration of the polyphenolic-rich extract from C. nucifera to completely abrogate parasite growth was 10 microg/ml. Pretreatment of peritoneal mouse macrophages with 10 microg/ml of C. nucifera polyphenolic-rich extract reduced approximately 44% the association index between these macrophages and L. amazonensis promastigotes, with a concomitant increase of 182% in nitric oxide production by the infected macrophage in comparison to nontreated macrophages. These results provide new perspectives on drug development against leishmaniasis, since the extract of C. nucifera at 10 microg/ml is a strikingly potent leishmanicidal substance which inhibited the growth of both promastigote and amastigote developmental stages of L. amazonensis after 60 min, presenting no in vivo allergenic reactions or in vitro cytotoxic effects in mammalian systems.
Directory of Open Access Journals (Sweden)
Maneewan Suksomtip
2005-03-01
Full Text Available Lipid entrapment property of polysaccharide gel (PG extracted from fruit-hulls of durian (Durio zibethinus Murr. Cv. Mon-Thong was investigated in vitro by semi- permeable membrane dialysis technique using both cellulose membrane and gut sacs of disected jejunum of rat. Lipids (cholesterol, oleic acid and stearic acid were mixed with 0-2%W/V PG in the presence of bile salt as a surface active agent in dialysis membrane. Lipids inside and outside dialysis membrane were analyzed by HPLC method after 4-16 hours of dialysis in Ringer lactate buffer pH7. Increasing PG concentration resulted in increasing lipids trapped inside membrane and decreasing lipids released outside membrane. Two percent PG trapped about 80-90%cholesterol. The result of PG trapping cholesterol in egg york showed that egg york cholesterol released outside membrane was decreased with increasing PG concentration. A significant relationship was found between the decreasing of absorbed cholesterol into everted rat jejunum with respect to increasing concen- tration of PG. These results suggested that durian polysaccharide gel is able to entrap lipids and it seems to have potential use as medicinal dietary food for lipid controlling patient. Furthermore, in vitro study using cellulose semi- permeable membrane dialysis method may be applied for preliminary evaluation of polysaccharide effecting lipids absorption.
Topical Benefits of Two Fucoidan-Rich Extracts from Marine Macroalgae
Directory of Open Access Journals (Sweden)
J. Helen Fitton
2015-04-01
Full Text Available Two concentrated and well-characterized fucoidan-rich extracts were investigated to determine their benefits in topical applications. An Undaria pinnatifida extract, containing 85% fucoidan, and a Fucus vesiculosus co-extract, containing 60% fucoidan and 30% polyphenol, were assessed in a number of in vitro assays to measure the effect of the extracts on enzyme inhibition, glycation, antioxidant activity and Sirtuin 1 (SIRT1 protein expression. Double-blind, placebo-controlled clinical studies were also conducted to measure soothing, protection, wrinkle depth, brightness and skin spot intensity. Both extracts demonstrated marked inhibitory effects on processes linked to skin aging, including the increased expression of SIRT1 in vitro. Clinical testing established the efficacy of the extracts in a range of the tested applications, relative to placebo. The Fucus vesiculosus extract with high polyphenol content demonstrated additional in vitro antioxidant activity, as well as improved efficacy in skin brightening applications, relative to placebo. The major effects of the Undaria pinnatifida extract aided skin immunity, soothing and protection, while the Fucus vesiculosus extract most significantly affected age spot reduction and increased brightness, soothing and protection.
Directory of Open Access Journals (Sweden)
Ben Hafsa Mhammed
2017-01-01
Full Text Available The present work is carried out to evaluate potential applications of aqueous extracts of two microalgae Isochrysis galbana (PEA and Nannochloropsis oculata (PEB containing mainly polysaccharides. The monosaccharide composition of microalgal extracts was determined. GC–MS analyses after derivatization show that glucose is the major compound in both microalgae PEA (56.88 % and PEB (68.23 %. Mannitol (38.8 % and inositol (20.32 % are respectively the second major compounds in PEA and PEB. Silylation of monosaccharides allows the determination of sorbitol that attained 3.38 % in PEB. The determination of antioxidant, antimicrobial and cytotoxic properties were also analyzed. Antioxidant activity was evaluated from the DPPH scavenging activity. PEA and PEB show a concentration dependent DPPH·radical scavenging activity. At concentration of 10 mg/mL, both PEA and PEB exhibit an antioxidant activity of 41.45 and 59.07 %, respectively. PEB and PEA are able to inhibit the growth of Gram-negative bacteria, Grampositive bacteria and three Candida species. Cytotoxic activity was evaluated on human HeLa cervical cancer cells. HeLa cell proliferation was totally inhibited after treatment with PEA and PEB (1 mg/mL and the inhibition was dose dependent (from 0.031 to 1 mg/mL. Their anticholinesterase activity was also investigated against butyrylcholinesterase enzymes. These polysaccharides possess interesting antimicrobial, anticancer and anticholinesterase activities that could represent an additional value for these microalgal products.
O-sulfated bacterial polysaccharides with low anticoagulant activity inhibit metastasis.
Borgenström, Marjut; Wärri, Anni; Hiilesvuo, Katri; Käkönen, Rami; Käkönen, Sanna; Nissinen, Liisa; Pihlavisto, Marjo; Marjamäki, Anne; Vlodavsky, Israel; Naggi, Annamaria; Torri, Giangiacomo; Casu, Benito; Veromaa, Timo; Salmivirta, Markku; Elenius, Klaus
2007-07-01
Heparin-like polysaccharides possess the capacity to inhibit cancer cell proliferation, angiogenesis, heparanase-mediated cancer cell invasion, and cancer cell adhesion to vascular endothelia via adhesion receptors, such as selectins. The clinical applicability of the antitumor effect of such polysaccharides, however, is compromised by their anticoagulant activity. We have compared the potential of chemically O-sulfated and N,O-sulfated bacterial polysaccharide (capsular polysaccharide from E. COLI K5 [K5PS]) species to inhibit metastasis of mouse B16-BL6 melanoma cells and human MDA-MB-231 breast cancer cells in two in vivo models. We demonstrate that in both settings, O-sulfated K5PS was a potent inhibitor of metastasis. Reducing the molecular weight of the polysaccharide, however, resulted in lower antimetastatic capacity. Furthermore, we show that O-sulfated K5PS efficiently inhibited the invasion of B16-BL6 cells through Matrigel and also inhibited the in vitro activity of heparanase. Moreover, treatment with O-sulfated K5PS lowered the ability of B16-BL6 cells to adhere to endothelial cells, intercellular adhesion molecule-1, and P-selectin, but not to E-selectin. Importantly, O-sulfated K5PSs were largely devoid of anticoagulant activity. These findings indicate that O-sulfated K5PS polysaccharide should be considered as a potential antimetastatic agent.
Han, Lijuan; Suo, Yourui; Yang, Yongjing; Meng, Jing; Hu, Na
2016-04-01
In this study, the extraction of water-soluble polysaccharides (BDPs) from Berberis dasystachya Maxim using dynamic microwave-assisted extraction (DMAE) was discussed. A Box-Behnken design combined with response surface methodology has been employed to optimize extraction parameters of DMAE. The BDPs have been analyzed in order to identify a variety of chemical properties. Antioxidant and anti-tumor activities in vitro have been studied by DPPH, ABTS, reducing power assay, and MTT assay, respectively. The results obtained showed that the optimal extraction conditions were as follows: ratio of water to raw material (X1) 25.84 mg/L, extraction power (X2) 433.13W, extraction time (X3) 35.18 min, and the maximum yield of extraction was 6.472 ± 0.384%, which was in good agreement with the predicted value. The physicochemical tests demonstrated that the BDPs mainly consist of rhamnose, arabinose, xylose, mannose, glucose and lactose in a molar ratio of 1:17.3:1.33:7:2.33:1.78; the average molecular weight of the BDPs was estimated to be from 2.95×10(5) and 1.52×10(3)Da, respectively. Furthermore, the BDPs exhibited effective antioxidant and anti-proliferative properties in vitro. Such pharmaceutical activities could prove useful for potential future applications involving the berries of B. dasystachya Maxim. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Xin Yang
2013-08-01
Full Text Available Pinus koraiensis polysaccharides (PKP were extracted by hot water from P. koraiensis pine cones. Five polysaccharide fractions named PKP-A, PKP-B, PKP-C, PKP-D and PKP-E were successfully separated at final ethanol concentrations of 30%, 50%, 60%, 70% and 80%, respectively. HPLC, FT-IR, GC-MS and automatic amino-acid analysis were applied to investigate their chemical characteristics. Monosaccharide component analysis indicated that the five fractions were all composed of d-ribose, l-rhamnose, l-arabinose, d-xylose, d-mannose, d-glucose and d-galactose, but their molar ratios were quite different. HPLC results revealed that the polysaccharides precipitated by higher concentrations of ethanol solution had lower molecular masses. Moreover, the antioxidant activities of the five fractions were studied on the basis of hydroxyl radical and ABTS radical scavenging tests. The five graded polysaccharide fractions exhibited good inhibitory power, and MTT tests in vitro showed the IC50 of PKP-A and PKP-E were 1,072.5 and 2,070.0 μg·mL−1, respectively. These results demonstrated that the PKP could be a potential source of natural antioxidants or dietary supplements.
DEFF Research Database (Denmark)
Amofa-Diatuo, Tracy; Anang, Daniel M.; Barba Orellana, Francisco Jose
2017-01-01
The objective of this study was to develop a new apple juice beverage enriched with isothiocyanates (ITC) - rich extracts obtained from cauliflower by-products. Ultrasound-assisted extraction (UAE) at different amplitudes (20-100%) and extraction times (0-10. min) at a frequency of 24. kHz was em......The objective of this study was to develop a new apple juice beverage enriched with isothiocyanates (ITC) - rich extracts obtained from cauliflower by-products. Ultrasound-assisted extraction (UAE) at different amplitudes (20-100%) and extraction times (0-10. min) at a frequency of 24. k......) and UAE (20%, 3. min), respectively. Moreover, the highest recovery of total phenolic compounds (TPC) (≈105. mg gallic acid equivalent (GAE)/L) μM) was found after UAE (100% amplitude, 3. min) of TPC from stems. ITC-rich extracts obtained from caulifower by-products at the optimum UAE conditions were...
Ye, Zipeng; Wang, Wei; Yuan, Qingxia; Ye, Hong; Sun, Yi; Zhang, Hongcheng; Zeng, Xiaoxiong
2016-08-20
The optimal extraction conditions with a yield of 5.37±0.15% for extraction of polysaccharides from chickpea (Cicer arietinum L.) hull (CHPS) were determined as extraction temperature 99°C, extraction time 2.8h and ratio of water to raw material 24mL/g. Three fractions of CHPS-1, CHPS-2 and CHPS-3, with average molecular weight of 3.1×10(6), 1.5×10(6) and 7.8×10(5)Da, respectively, were obtained from crude CHPS by chromatography of DEAE Fast Flow and Sephadex G-100. CHPS-1 was composed of mannose, rhamnose, galactose, galacturonic acid, glucose and arabinose, CHPS-2 was composed of mannose, rhamnose, galacturonic acid, galactose, xylose and arabinose, CHPS-3 was composed of galacturonic acid, galactose and rhamnose. CHPS-3 showed the strongest reducing power and protective effect on H2O2-induced oxidative injury in PC12 cells and highest scavenging activities against DPPH and ABTS radicals, while CHPS-2 showed the highest scavenging activity against superoxide anion radical. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bo-Hye Nam
2016-12-01
Full Text Available Antimicrobial peptides are a pivotal component of the invertebrate innate immune system. In this study, we identified a lipopolysaccharide- and β-1,3-glucan-binding protein (LGBP gene from the pacific abalone Haliotis discus hannai (HDH, which is involved in the pattern recognition mechanism and plays avital role in the defense mechanism of invertebrates immune system. The HDH-LGBP cDNA consisted of a 1263-bp open reading frame (ORF encoding a polypeptide of 420 amino acids, with a 20-amino-acid signal sequence. The molecular mass of the protein portion was 45.5 kDa, and the predicted isoelectric point of the mature protein was 4.93. Characteristic potential polysaccharide binding motif, glucanase motif, and β-glucan recognition motif were identified in the LGBP of HDH. We used its polysaccharide-binding motif sequence to design two novel antimicrobial peptide analogs (HDH-LGBP-A1 and HDH-LGBP-A2. By substituting a positively charged amino acid and amidation at the C-terminus, the pI and net charge of the HDH-LGBP increased, and the proteins formed an α-helical structure. The HDH-LGBP analogs exhibited antibacterial and antifungal activity, with minimal effective concentrations ranging from 0.008 to 2.2 μg/mL. Additionally, both were toxic against human cervix (HeLa, lung (A549, and colon (HCT 116 carcinoma cell lines but not much on human umbilical vein cell (HUVEC. Fluorescence-activated cell sorter (FACS analysis showed that HDH-LGBP analogs disturb the cancer cell membrane and cause apoptotic cell death. These results suggest the use of HDH-LGBP analogs as multifunctional drugs.
Hu, Yichen; Zhang, Jinming; Zou, Liang; Fu, Chaomei; Li, Peng; Zhao, Gang
2017-06-01
Chenopodium quinoa, a promising nutraceutical cereal, has attracted increasing research interest, yet its polysaccharides remains to get few systematic studies. In this study, we employed orthogonal experimental design to optimize the ultrasound-assisted extraction process for highest yield of C. quinoa polysaccharides. A novel C. quinoa polysaccharide (CQP) fraction with high content and low molecular weight (8852Da) was subsequently purified by column chromatography, constituted by galacturonic acid and glucose monosaccharides. The purified CQP exhibited significantly antioxidant effect against DPPH + and ABTS + , with even higher efficiency than some other reported polysaccharides. Moreover, CQP could promote the RAW264.7 macrophage proliferation, while suppress the nitri oxide production on inflammatory RAW264.7 macrophage in a dose- and time-dependent manner. In view of the pathological correlation of free radical, inflammation and carcinogenesis, the anticancer effect of CQP was further investigated on human liver cancer SMMC 7721 and breast cancer MCF-7 cells. Interestingly, CQP displayed cytotoxicity against cancer cells, while none proliferation inhibition on normal cells. These results suggest that the bioactive polysaccharide from C. quinoa provided the promising potential as a natural antioxidant, immune-regulating and anticancer candidate for food and even drug application. Copyright © 2017 Elsevier B.V. All rights reserved.
Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia
International Nuclear Information System (INIS)
Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu
2013-01-01
Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Pandit, Santosh; Song, Kwang-Yeob; Jeon, Jae-Gyu
2014-01-01
Withania somnifera (Ashwagandha) is a plant of the Solanaceae family. It has been widely used as a remedy for a variety of ailments in India and Nepal. The plant has also been used as a controlling agent for dental diseases. The aim of the present study was to evaluate the activity of the methanol extract of W. somnifera against the physiological ability of cariogenic biofilms and to identify the components of the extract. To determine the activity of the extract, assays for sucrose-dependent bacterial adherence, glycolytic acid production, acid tolerance, and extracellular polysaccharide formation were performed using Streptococcus mutans biofilms. The viability change of S. mutans biofilms cells was also determined. A phytochemical analysis of the extract was performed using TLC and LC/MS/MS. The extract showed inhibitory effects on sucrose-dependent bacterial adherence (≥ 100 μg/ml), glycolytic acid production (≥ 300 μg/ml), acid tolerance (≥ 300 μg/ml), and extracellular polysaccharide formation (≥ 300 μg/ml) of S. mutans biofilms. However, the extract did not alter the viability of S. mutans biofilms cells in all concentrations tested. Based on the phytochemical analysis, the activity of the extract may be related to the presence of alkaloids, anthrones, coumarines, anthraquinones, terpenoids, flavonoids, and steroid lactones (withanolide A, withaferin A, withanolide B, withanoside IV, and 12-deoxy withastramonolide). These data indicate that W. somnifera may be a potential agent for restraining the physiological ability of cariogenic biofilms.
Li, Weiwei; Wang, Jingya; Chen, Zhongqin; Gao, Xudong; Chen, Yue; Xue, Zihan; Guo, Qingwen; Ma, Qiqi; Chen, Haixia
2018-04-22
This study was to investigate the physicochemical properties and anticancer effects of polysaccharides from Lentinus edodes extracted under high pressure cooking treatment (HPLPS) in vitro and in vivo. The extraction efficiency was improved. The main molecular weight of HPLPS was about 540 and about 227 kDa. And the inhibitory effects on HepG2 and HeLa cells of HPLPS were significantly increased (p Lentinus edodes might be effectively used for the treatment of hepatocellular carcinoma through its antioxidant and immunomodulatory effects. Copyright © 2018 Elsevier B.V. All rights reserved.
Tong, Haibin; Mao, Dirui; Zhai, Mingyue; Zhang, Zhuorui; Sun, Guangren; Jiang, Guiquan
2015-01-01
Macrophage, involved at all stages of immune response, is an important component of the host defense system. Polysaccharides exist almost ubiquitously in medical plants and most of them possess immunomodulation and macrophage activation properties. This study elucidates the effects on macrophage activation and molecular mechanism induced by the polysaccharides (SOPs) from the roots of Sanguisorba officinalis Linne (Rosaceae). Polysaccharides (SOPs) from the roots of S. officinalis were obtained by water extraction and ethanol precipitation. Physicochemical characterization of SOPs was analyzed by phenol-sulfuric acid, m-hydroxydiphenyl, Bradford method, and gas chromatography. Phagocytic capacity of RAW 264.7 macrophages incubated with SOPs (25 and 100 μg/ml) was determined by the aseptic neutral red method. Macrophages were incubated with SOPs (25 and 100 μg/ml), and the TNF-α and NO the secretion were measured using ELISA kit and Griess reagent, respectively. In addition, TNF-α and iNOS transcripts were evaluated by semi-quantitative RT-PCR, and NF-κB signaling activation was detected by Western blot assay. SOPs enhanced the phagocytosis capacity of macrophages to aseptic neutral red solution and increased TNF-α and NO secretion. The amounts of TNF-α and iNOS transcript were increased significantly at the mRNA level when macrophages were exposed to SOPs. Meanwhile, the stimulation of macrophages by SOPs induced phosphorylation of p65 at serine 536 and a marked decrease of IκB expression. These results suggested that SOPs exhibited significant macrophage activation properties through NF-κB signaling pathway and could be considered as a new immunopotentiator.
Structure and function of α-glucan debranching enzymes
DEFF Research Database (Denmark)
Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte
2016-01-01
α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....
Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S
2015-08-01
A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.
Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang
2018-07-15
A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
White, A.R.; Xin, Yi
1990-01-01
Xyloglucan is a major hemicellulose polysaccharide in plant cell walls. Biosynthesis of such cell wall polysaccharides is closely linked to the process of plant cell growth and development. Xyloglucan polysaccharides consist of a β-1,4 glucan backbone synthesized by xyloglucan synthase and sidechains of xylose, galactose, and fucose added by other transferase enzymes. Most plant Golgi and plasma membranes also contain glucan synthases I ampersand II, which make β-1,4 and β-1,3 glucans, respectively. All of these enzymes have very similar activities. Cell walls on suspension-cultured cells from Acer pseudoplatanus (sycamore maple) were enzymatically softened prior to cell disruption by passing through a 30 μm nylon screen. Cell membranes from homogenates were separated by ultracentrifugation on top-loaded or flotation sucrose density gradients. Samples were collected by gradient fractionation and assayed for membrane markers and xyloglucan and glucan synthase activities. Standard marker assays (cyt. c reductase for eR, IDPase ampersand UDPase for Golgi, and eosin 5'-malelmide binding for plasma membrane) showed partial separation of these three membrane types. Golgi and plasma membrane markers overlapped in most gradients. Incorporation of 14 C-labeled sugars from UDP-glucose and UDP-xylose was used to detect xyloglucan synthase, glucan synthases I ampersand II, and xylosyl transferase in Golgi membrane fractions. These activities overlapped, although distinct peaks of xyloglucan synthase and xylosyl transferase were found. Ca ++ had a stimulatory effect on glucan synthases I ampersand II, while Mn ++ had an inhibitory effect on glucan synthase I in the presence of Ca ++ . The similarity of these various synthase activities demonstrates the need for careful structural characterization of newly synthesized polysaccharides
Ionizing radiation damage in Micrococcus radiodurans cell wall: release of polysaccharide
International Nuclear Information System (INIS)
Mitchel, R.E.J.
1976-01-01
Sublethal 60 Co γ-irradiation of the bacterium Micrococcus radiodurans in aqueous suspension results in a loss of up to 6 percent of its cellular dry weight and 30 percent of its wet weight. In the process some specific cell wall polysaccharides, including a polymer of glucose and N-acylated glucosamine, are released into the surrounding medium. These polysaccharides appear to originate from a hydrophobic site in the middle, lipid-rich, cell wall layer. The damage to this layer which results in the release of these and other polymers may be due to a disruption of this hydrophobic site. The polysaccharide containing glucose and N-acylated glucosamine exists as a high molecular weight polymer in unirradiated cells, but irradiation causes some degradation prior to release. In a free state this polysaccharide is considerably less sensitive to radiolytic degradation than in a bound state. Free radicals generated from surrounding water by ionizing radiation initiate the release, hydroxyl radicals being the most important species. Oxygen protects the cell wall against loss of the polysaccharides, apparently by a mechanism which does not depend on the ability of O 2 to scavenge hydrogen atoms and aqueous electrons
Effect of purified oat β-glucan on fermentation of set-style yogurt mix.
Singh, Mukti; Kim, Sanghoon; Liu, Sean X
2012-08-01
Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.
Luo, Qiu-Lian; Tang, Zhuan-Hui; Zhang, Xue-Feng; Zhong, Yong-Hong; Yao, Su-Zhi; Wang, Li-Sheng; Lin, Cui-Wu; Luo, Xuan
2016-08-01
In this report, a water-soluble polysaccharide was obtained from the dried stems of Dendrobium officinale Kimura et Migo by hot-water (70-75°C) extraction and 85% ethanol precipitation, and successively purification by DEAE-cellulose anion-exchange chromatography and gel-permeation chromatography. The D. officinale polysaccharide (DOP) has a molecular weight of 8500Da. Monosaccharide composition analysis reveals that DOP is composed of mannose, glucose, and arabinose with a trace of galacturonic acid in a molar ratio of 6.2:2.3:2.1:0.1. Periodate oxidation-smith degradation and 1D and 2D NMR spectroscopy analysis suggest the predominance of mannose and glucose, and it contains a 2-O-acetylglucomannan and (1→4)-linked-β-d-mannopyranosyl and (1→4)-linked-β-d-glucopyranosyl residues. Atomic force microscope shows that DOP mainly exists as rod-shaped chains, supporting high degrees of polymerization. The antioxidant activities of the polysaccharide in vitro assay indicate that DOP has good scavenging activity of 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical, higher scavenging activity of hydroxyl radical, and metal chelating activities. Copyright © 2016 Elsevier B.V. All rights reserved.
New composites of polyaniline and polysaccharides with applications as biomaterials: one review
Directory of Open Access Journals (Sweden)
Eliana França
2007-03-01
Full Text Available In this revision we will show some results involving composites made with polyaniline and polysaccharides and their properties as promising biomaterials. Studies about the biomedical application of conducting polymers have being considered due the electric stimulation, decrease citotoxicity, good biocompatibility, and others. Polyaniline and polymers derived from the aniline has received attention in the last years by chemical stability in environmental conditions, processibility, facility of polymerization and doping, short cost and particular properties. The botryospheran is an exopolysaccharide (EPS classified in the group of the beta-(1 -3 glucans, produced by the fungus botryosphaeria sp.. EPS has being investigated in parallel about the variability of biological answers of defense. The potential of interaction between conducting polymers with biological environment has been considered, once the application possibilities like development of artificial muscles, nerves regeneration stimulation and medicines delivery control.
Polysaccharides from Arctium lappa L.: Chemical structure and biological activity.
Carlotto, Juliane; de Souza, Lauro M; Baggio, Cristiane H; Werner, Maria Fernanda de P; Maria-Ferreira, Daniele; Sassaki, Guilherme L; Iacomini, Marcello; Cipriani, Thales R
2016-10-01
The plant Arctium lappa L. is popularly used to relieve symptoms of inflammatory disorders. A crude polysaccharide fraction (SAA) resulting of aqueous extraction of A. lappa leaves showed a dose dependent anti-edematogenic activity on carrageenan-induced paw edema, which persisted for up to 48h. Sequential fractionation by ultrafiltration at 50kDa and 30kDa cut-off membranes yielded three fractions, namely RF50, RF30, and EF30. All these maintained the anti-edematogenic effect, but RF30 showed a more potent action, inhibiting 57% of the paw edema at a dose of 4.9mg/kg. The polysaccharide RF30 contained galacturonic acid, galactose, arabinose, rhamnose, glucose, and mannose in a 7:4:2:1:2:1 ratio and had a Mw of 91,000g/mol. Methylation analysis and NMR spectroscopy indicated that RF30 is mainly constituted by a type I rhamnogalacturonan branched by side chains of types I and II arabinogalactans, and arabinan. Copyright © 2016 Elsevier B.V. All rights reserved.
Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2016-01-01
was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...
Edner, Christoph; Li, Jing; Albrecht, Tanja; Mahlow, Sebastian; Hejazi, Mahdi; Hussain, Hasnain; Kaplan, Fatma; Guy, Charles; Smith, Steven M.; Steup, Martin; Ritte, Gerhard
2007-01-01
Glucan phosphorylating enzymes are required for normal mobilization of starch in leaves of Arabidopsis (Arabidopsis thaliana) and potato (Solanum tuberosum), but mechanisms underlying this dependency are unknown. Using two different activity assays, we aimed to identify starch degrading enzymes from Arabidopsis, whose activity is affected by glucan phosphorylation. Breakdown of granular starch by a protein fraction purified from leaf extracts increased approximately 2-fold if the granules were simultaneously phosphorylated by recombinant potato glucan, water dikinase (GWD). Using matrix-assisted laser-desorption ionization mass spectrometry several putative starch-related enzymes were identified in this fraction, among them β-AMYLASE1 (BAM1; At3g23920) and ISOAMYLASE3 (ISA3; At4g09020). Experiments using purified recombinant enzymes showed that BAM1 activity with granules similarly increased under conditions of simultaneous starch phosphorylation. Purified recombinant potato ISA3 (StISA3) did not attack the granular starch significantly with or without glucan phosphorylation. However, starch breakdown by a mixture of BAM1 and StISA3 was 2 times higher than that by BAM1 alone and was further enhanced in the presence of GWD and ATP. Similar to BAM1, maltose release from granular starch by purified recombinant BAM3 (At4g17090), another plastid-localized β-amylase isoform, increased 2- to 3-fold if the granules were simultaneously phosphorylated by GWD. BAM activity in turn strongly stimulated the GWD-catalyzed phosphorylation. The interdependence between the activities of GWD and BAMs offers an explanation for the severe starch excess phenotype of GWD-deficient mutants. PMID:17631522
Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.
Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan
2013-05-01
The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.
Shuyi Li; Qian Wu; Fangfang Yin; Zhenzhou Zhu; Jingren He; Francisco J. Barba
2018-01-01
Over the last years, inulin, a fructan mixture consisting of oligosaccharides and polysaccharides, has attracted more and more attention from both food industry and researchers, due to its unique functional properties as a natural resource. Therefore, there is an increased interest in the extraction and quantification of inulin for its valorization from inulin rich plants, wastes and by-products. In this work, ultrasonic treatment was applied for inulin extraction, observing a great impact of...
Kang, Min-Cheol; Kim, Seo Young; Kim, Yoon Taek; Kim, Eun-A; Lee, Seung-Hong; Ko, Seok-Chun; Wijesinghe, W A J P; Samarakoon, Kalpa W; Kim, Young-Sun; Cho, Jin Hun; Jang, Hyeang-Su; Jeon, You-Jin
2014-01-01
The in vitro and in vivo antioxidant potentials of a polysaccharide isolated from aloe vera gel were investigated. Enzymatic extracts were prepared from aloe vera gel by using ten digestive enzymes including five carbohydrases and five proteases. Among them, the highest yield was obtained with the Viscozyme extract and the same extract showed the best radical scavenging activity. An active polysaccharide was purified from the Viscozyme extract using ethanol-added separation and anion exchange chromatography. Purified aloe vera polysaccharide (APS) strongly scavenged radicals including DPPH, hydroxyl and alkyl radicals. In addition, APS showed a protective effect against AAPH-induced oxidative stress and cell death in Vero cells as well as in the in vivo zebrafish model. In this study, it is proved that both the in vitro and in vivo antioxidant potentials of APS could be further utilized in relevant industrial applications. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Taiki Kobayashi
Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.
Directory of Open Access Journals (Sweden)
Su Chern Foo
2015-10-01
Conclusions: Methanol was the recommended solvent for the production of antioxidant rich extract from C. calcitrans. Both carotenoids and phenolic acids were found to be positively correlated to the antioxidant capacities of C. calcitrans. Lead bioactives confirmed by subsequent high performance liquid chromatography studies were fucoxanthin, gallic acid and protocatechuic acid.
Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang
2014-01-01
Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.
Vahid-Dastjerdi, Elahe; Monadi, Elham; Khalighi, Hamid Reza; Torshabi, Maryam
2016-01-01
In our previous studies, we showed the inhibitory effects of Punica granatum L. flower and Rhus coriaria L. fruit water extracts on dental plaque accumulation by several bacteria, especially Streptococcus mutans (S. mutans), on orthodontic wire by in-vitro assays. In this study, the anti-cariogenic properties of the extracts were evaluated by assessing their effects on expression of glycosyltransferase (gtf) genes, which are responsible for initial biofilm formation by S. mutans. In this study, the effect of herbal extracts on expression of gtfB, C (encoding enzymes that produce water-insoluble glucans) and D (encoding enzymes that produce water-soluble glucans) genes in S. mutans growing in planktonic state was evaluated quantitatively by real-time polymerase chain reaction (PCR) method. The minimum biofilm inhibitory concentration (MBIC) of understudied herbal water extracts significantly suppressed gtfB, C and D gene expression by 85.3 ± 7.5%, 33.3 ± 6.4% and 25 ± 14%, respectively for Punica granatum L. extract and 73.4 ± 7.3%, 93.8 ± 2.7% and 59.3 ± 9.8%, respectively for Rhus coriaria L. extract compared to the non-treated control group (P Punica granatum L. extract. These findings suggest that Punica granatum L. and especially Rhus coriaria L. maybe used as novel, natural antiplaque agents since they inhibit specific genes associated with bacterial biofilm formation without necessarily affecting the growth of oral bacteria.
B-Glucan exacerbates allergic asthma independent of fungal ...
BackgroundAllergic sensitization to fungi has been associated with asthma severity. As a result, it has been largely assumed that the contribution of fungi to allergic disease is mediated through their potent antigenicity.ObjectiveWe sought to determine the mechanism by which fungi affect asthma development and severity.MethodsWe integrated epidemiologic and experimental asthma models to explore the effect of fungal exposure on asthma development and severity.ResultsWe report that fungal exposure enhances allergen-driven TH2 responses, promoting severe allergic asthma. This effect is independent of fungal sensitization and can be reconstituted with β-glucan and abrogated by neutralization of IL-17A. Furthermore, this severe asthma is resistant to steroids and characterized by mixed TH2 and TH17 responses, including IL-13+IL-17+CD4+ double-producing effector T cells. Steroid resistance is dependent on fungus-induced TH17 responses because steroid sensitivity was restored in IL-17rc−/− mice. Similarly, in children with asthma, fungal exposure was associated with increased serum IL-17A levels and asthma severity.ConclusionOur data demonstrate that fungi are potent immunomodulators and have powerful effects on asthma independent of their potential to act as antigens. Furthermore, our results provide a strong rationale for combination treatment strategies targeting IL-17A for this subgroup of fungus-exposed patients with difficult-to-treat asthma. To describe th
Jung, Tae-Dong; Shin, Gi-Hae; Kim, Jae-Min; Choi, Sun-Il; Lee, Jin-Ha; Lee, Sang Jong; Park, Seon Ju; Woo, Koan Sik; Oh, Sea Kwan; Lee, Ok-Hawn
2017-01-01
Rice bran, a by-product derived from processing rice, is a rich source of bioactive compounds. Recent studies have suggested that the fermentation can improve their biological activities. This study aimed to determined the level of γ-oryzanol, β-glucan and total phenol contents of fermented rice bran from 21 Korean varieties, as well as to evaluate their antioxidant activities. We also assessed the validation of the analytical method for determining γ-oryzanol content in fermented rice brans....
Calibration of the mirror system in the HERA-B RICH
Starič, Marko; Križan, Peter
2007-01-01
The mirror system of the HERA-B RICH consists of two spherical and two planar mirrors, composed of altogether 116 mirror segments. Analysis of displacements of the \\v{C}erenkov ring center relative to the charged particle track, for given spherical-planar segment pairs, leads to accurate information regarding the orientation of individual mirror segments. The method is described and the effect of applying the required corrections on the \\v{C}erenkov angle resolution of the HERA-B RICH is disc...
Brucella cyclic β-1,2-glucan plays a critical role in the induction of splenomegaly in mice.
Directory of Open Access Journals (Sweden)
Mara S Roset
Full Text Available Brucella, the etiological agent of animal and human brucellosis, is a bacterium with the capacity to modulate the inflammatory response. Cyclic β-1,2-glucan (CβG is a virulence factor key for the pathogenesis of Brucella as it is involved in the intracellular life cycle of the bacteria. Using comparative studies with different CβG mutants of Brucella, cgs (CβG synthase, cgt (CβG transporter and cgm (CβG modifier, we have identified different roles for this polysaccharide in Brucella. While anionic CβG is required for bacterial growth in low osmolarity conditions, the sole requirement for a successful Brucella interaction with mammalian host is its transport to periplasmic space. Our results uncover a new role for CβG in promoting splenomegaly in mice. We showed that CβG-dependent spleen inflammation is the consequence of massive cell recruitment (monocytes, dendritics cells and neutrophils due to the induction of pro-inflammatory cytokines such as IL-12 and TNF-α and also that the reduced splenomegaly response observed with the cgs mutant is not the consequence of changes in expression levels of the characterized Brucella PAMPs LPS, flagellin or OMP16/19. Complementation of cgs mutant with purified CβG increased significantly spleen inflammation response suggesting a direct role for this polysaccharide.
Pluvinage, Benjamin; Fillo, Alexander; Massel, Patricia; Boraston, Alisdair B
2017-09-05
Family 81 glycoside hydrolases (GHs), which are known to cleave β-1,3-glucans, are found in archaea, bacteria, eukaryotes, and viruses. Here we examine the structural and functional features of the GH81 catalytic module, BhGH81, from the Bacillus halodurans protein BH0236 to probe the molecular basis of β-1,3-glucan recognition and cleavage. BhGH81 displayed activity on laminarin, curdlan, and pachyman, but not scleroglucan; the enzyme also cleaved β-1,3-glucooligosaccharides as small as β-1,3-glucotriose. The crystal structures of BhGH81 in complex with various β-1,3-glucooligosaccharides revealed distorted sugars in the -1 catalytic subsite and an arrangement consistent with an inverting catalytic mechanism having a proposed conformational itinerary of 2 S 0 → 2,5 B ‡ → 5 S 1 . Notably, the architecture of the catalytic site, location of an adjacent ancillary β-1,3-glucan binding site, and the surface properties of the enzyme indicate the likely ability to recognize the double and/or triple-helical quaternary structures adopted by β-1,3-glucans. Copyright © 2017 Elsevier Ltd. All rights reserved.
Antitumor effect and mechanism of action of polysaccharides ...
African Journals Online (AJOL)
Purpose: To optimize the extraction conditions of polysaccharides from ... surface plots and variance analysis, it predicted that the optimum conditions for PSDP ..... Mean. C.V.%. Press. R2. R2. Adj. R2. Pred. Adequate precision. 0.15. 4.69.
International Nuclear Information System (INIS)
Le Quang Luan; Nguyen Huynh Phuong Uyen; Nguyen Thanh Vu; Nguyen Quoc Hien; Dang Van Phu; Vo Thi Thu Ha; To Van Loi; Le Dinh Don; Truong Phuoc Thien Hoang; Do Thi Phuong Linh
2015-01-01
The process for production of insoluble β-glucan product from brewer’s yeast cell wall collected from the discard waste of beer production was successfully established. Radiation was improved as a useful tool for preparation of low Mw β-glucan. The water soluble oligo-β-glucans with Mw ~ 18 - 25 kDa were found to have novel features for application as plant growth promoter, growth and immune stimulator additive for animals and functional food for prevention and therapy of diabetic, dyslipidemia, cancer, etc. The processes for large scale production of oligo-β-glucan as plant growth promoter. chicken additive and functional food by gamma Co-60 irradiation method have been set up for application. In addition, gold nanoparticles (AuNPs) with size of 10 - 50 nm stabilized in sericin and water soluble chitosan and silver nanoparticles (AgNPs) with size of 5-20 nm stabilized PVA, PVP, sericin and alginate were also successfully synthesized by gamma Co-60 irradiation method. While AuNPs product was found to be not toxic and can be used for bio-medicine and cosmetics, AgNPs exhibited highly antimicrobial activity for potentially use as new and safety antimicrobial agent. The processes for large scale production of AuNPs, AgNPs, cream/AgNPs and hand-wash solution/AgNPs products were also successfully developed within this project. (author)
Carrageenan: a natural seaweed polysaccharide and its applications.
Prajapati, Vipul D; Maheriya, Pankaj M; Jani, Girish K; Solanki, Himanshu K
2014-05-25
Polysaccharides have been gaining interesting and valuable applications in the food and pharmaceutical fields. As they are derived from the natural source, they are easily available, non-toxic, cheap, biodegradable and biocompatible. Carrageenan is one among them, which fulfills the criteria of polysaccharide; it is a natural carbohydrate (polysaccharide) obtained from edible red seaweeds. The name Carrageenan is derived from the Chondrus crispus species of seaweed (Rhodophyceace) known as Carrageen Moss or Irish Moss, and Carraigin. A demand based on its application has been widely increasing in food and pharmaceutical sectors. Carrageenan has gained wide applications in experimental medicine, pharmaceutical formulations, cosmetics, and food industries. Through keen references of the reported literature on carrageenan, in this review, we have described about carrageenan, its properties, extraction and refining, and its food and pharmaceutical applications. Copyright © 2014 Elsevier Ltd. All rights reserved.
Analyses of Aloe polysaccharides using carbohydrate microarray profiling
DEFF Research Database (Denmark)
Isager Ahl, Louise; Grace, Olwen M; Pedersen, Henriette Lodberg
2018-01-01
As the popularity of Aloe vera extracts continues to rise, a desire to fully understand the individual polymer components of the leaf mesophyll, their relation to one another and the effects they have on the human body are increasing. Polysaccharides present in the leaf mesophyll have been...... identified as the components responsible for the biological activities of Aloe vera, and they have been widely studied in the past decades. However, the commonly used methods do not provide the desired platform to conduct large comparative studies of polysaccharide compositions as most of them require...... a complete or near-complete fractionation of the polymers. The objective for this study was to assess whether carbohydrate microarrays could be used for the high-throughput analysis of cell wall polysaccharides in Aloe leaf mesophyll. The method we chose is known as Comprehensive Microarray Polymer Profiling...
Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning
2017-03-01
The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R.; Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N.
2015-01-01
The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with 99m Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with 32 P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with 99m Tc by the direct labeling method. The stability of the 99m Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with 99m Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The 32 P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with 99m Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals infected with C. albicans presented a
Zheng, Xueling; Li, Limin; Wang, Qi
2011-01-01
Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.
Xu, Xiaofei; Yan, Huidan; Tang, Jian; Chen, Jian; Zhang, Xuewu
2014-01-01
Lentinus edodes has been valued as edible and medical resources. Polysaccharides have been known to be the most potent antitumor and immunomodulating substance in Lentinus edodes. In this review, we summarize the current knowledge of the polysaccharides isolated from Lentinus edodes, including extraction and purification methods, chemical structure and chain conformation, the effects on innate and adaptive immunity and their mechanism, relationship between structure and function, and the future prospects.
Calibration of the mirror system in the HERA-B RICH
International Nuclear Information System (INIS)
Staric, Marko; Krizan, Peter
2008-01-01
The mirror system of the HERA-B ring imaging Cherenkov (RICH) counter consists of two spherical and two planar mirrors, composed of altogether 116 mirror segments. Analysis of displacements of the Cherenkov ring center relative to the charged particle track, for given spherical-planar segment pairs, leads to accurate information regarding the orientation of individual mirror segments. The method for mirror calibration is described and the effect of applying the required corrections on the Cherenkov angle resolution of the HERA-B RICH is discussed
International Nuclear Information System (INIS)
Shaiful Azuar Mohamad; Mat Rasol Awang
2006-01-01
Numerous polysaccharides and polysaccharides-protein complexes have been isolated from mushrooms and used as a source of therapeutic agents. The mycelium of Pleurotus sajor caju, Pleurotus tuber-regium, black ganoderma, and the fruiting bodies of Pleurotus sajor caju and Pleurotus florida were used to determine the percentage of polysaccharides obtained from the mushroom raw material. Hot water extraction method was used followed by refrigerated centrifuge and lyophilization. The yield from the various species will be compared. (Author)
Kšonžeková, Petra; Mariychuk, Ruslan; Eliašová, Adriana; Mudroňová, Dagmar; Csank, Tomáš; Király, Ján; Marcinčáková, Dana; Pistl, Juraj; Tkáčiková, L'udmila
2016-03-15
Anthocyanins, compounds that represent the major group of flavonoids in berries, are one of the most powerful natural antioxidants. The aim of this study was to evaluate biological activities and comparison of anthocyanin-rich extracts prepared from chokeberry (Aronia melanocarpa), elderberry (Sambucus nigra), bilberry (Vaccinium myrtillus) and blueberry (V. corymbosum) on the porcine intestinal epithelial IPEC-1 cell line. The IC50 values calculated in the antioxidant cell-based dichlorofluorescein assay (DCF assay) were 1.129 mg L(-1) for chokeberry, 1.081 mg L(-1) for elderberry, 2.561 mg L(-1) for bilberry and 2.965 mg L(-1) for blueberry, respectively. We found a significant negative correlation (P < 0.001) between cyanidin glycosides content and IC50 values. Moreover, extracts rich in cyanidin glycosides stimulated proliferation of IPEC-1 cells and did not have cytotoxic effect on cells at an equivalent in vivo concentration. We found that the chokeberry and elderberry extracts rich in cyanidin glycosides possess better antioxidant and anticytotoxic activities in comparison to blueberry or bilberry extracts with complex anthocyanin profiles. © 2015 Society of Chemical Industry.
The role of RICH particle identification in B physics. Recent results and perspectives
International Nuclear Information System (INIS)
Battaglia, M.
1999-01-01
The use of RICH detectors for hadron identification at collider experiments has played a major role in a wide range of studies of production and decays of the b quark. These include the characterisation of the strange beauty meson B s 0 and beauty baryons, spectroscopy, analysis of neutral B meson oscillations and of rare decays. A selection of these results is presented and the analysis techniques developed are discussed. In addition to the contribution of these data to the understanding of the mechanisms of weak decays of the b quark, the experience gained in the use of RICH detectors in B physics is also relevant for the next generation of dedicated experiments relying on RICH detectors for the study of CP violation in the B system and of rare B decays
Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.
Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa
2014-06-01
Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.
Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.
Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G
1992-01-01
The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Jiménez, Natalia Ivonne Vera
2013-01-01
of production of radical oxygen species. PAMPs/DAMPs stimulation caused by the wounding and or β-glucans resulted in an inflammatory response by activating IL-1b, IL-6 family member M17 and IL-8 and differences in the expression pattern were seen depending on stimuli. IL-1b, IL-6 family member M17 and IL-8 were...
Directory of Open Access Journals (Sweden)
Yong K. Park
2003-12-01
Full Text Available Cogumelos comestíveis contêm importantes propriedades funcionais. Em particular, beta-glucanos, homo- e hetero-glucanos com ligações glicosídicas beta(1->3, beta(1->4 e beta(1->6, supostamente responsáveis por algumas propriedades benéficas à saúde humana, como atividade imunomodulatória, antioxidante, antiinflamatória e anticancerígena. Neste trabalho, a quantidade de beta-glucano presente em cogumelo Agaricus blazei Murill, coletados de três diferentes locais, foi analisada utilizando-se método enzimático. As amostras (em base seca foram tratadas com alfa-amilase, protease bacteriana e com glicoamilase fúngica. beta-glucano foi quantificado após hidrólise ácida e determinação da glicose liberada. Foi verificado que amostras de A. blazei Murill cultivadas em estufas apresentaram menor concentração de b-glucano (8,4±0,9 e 7,6±2,8g/100g quando comparado com amostras cultivadas em campo aberto (10,1±2,1g/100g. Observou-se ainda que, mesmo sendo cultivado em condições semelhantes, porém em locais diferentes, as amostras apresentaram diferenças significativas (7,6±2,8 e 8,4±0,9g/100g.Edible mushrooms contains a very interesting functional properties. Among them, the beta-glucans, polysaccharides with beta-1,3; b-1,4 and beta-1,6glucosidic linkages, they are responsible to a series of properties to human health, such as immunomodulatory, antioxidant, antiinflammatory and, antitumoral activities. In the present work, the Agaricus blazei Murill beta-glucan concentrations from three locations, were determined through the enzymatic method. Samples were treated with alpha-amylase, bacterial protease and fungal glucoamylase. beta-glucans were quantified after acid hydrolysis and, the glucose determined for spectrophotometric method. It was verified that samples cultivated inside stoves presented smaller beta-glucan concentration (8.4±0.9 and 7.6±2.8g/100g, when compared with samples cultivated in open field (10.1±2.1g/100
Schultz-Johansen, Mikkel; Bech, Pernille K; Hennessy, Rosanna C; Glaring, Mikkel A; Barbeyron, Tristan; Czjzek, Mirjam; Stougaard, Peter
2018-01-01
Marine microbes are a rich source of enzymes for the degradation of diverse polysaccharides. Paraglaciecola hydrolytica S66 T is a marine bacterium capable of hydrolyzing polysaccharides found in the cell wall of red macroalgae. In this study, we applied an approach combining genomic mining with functional analysis to uncover the potential of this bacterium to produce enzymes for the hydrolysis of complex marine polysaccharides. A special feature of P. hydrolytica S66 T is the presence of a large genomic region harboring an array of carbohydrate-active enzymes (CAZymes) notably agarases and carrageenases. Based on a first functional characterization combined with a comparative sequence analysis, we confirmed the enzymatic activities of several enzymes required for red algal polysaccharide degradation by the bacterium. In particular, we report for the first time, the discovery of novel enzyme activities targeting furcellaran, a hybrid carrageenan containing both β-carrageenan and κ/β-carrageenan motifs. Some of these enzymes represent a new subfamily within the CAZy classification. From the combined analyses, we propose models for the complete degradation of agar and κ/β-type carrageenan by P. hydrolytica S66 T . The novel enzymes described here may find value in new bio-based industries and advance our understanding of the mechanisms responsible for recycling of red algal polysaccharides in marine ecosystems.
Directory of Open Access Journals (Sweden)
Mikkel Schultz-Johansen
2018-05-01
Full Text Available Marine microbes are a rich source of enzymes for the degradation of diverse polysaccharides. Paraglaciecola hydrolytica S66T is a marine bacterium capable of hydrolyzing polysaccharides found in the cell wall of red macroalgae. In this study, we applied an approach combining genomic mining with functional analysis to uncover the potential of this bacterium to produce enzymes for the hydrolysis of complex marine polysaccharides. A special feature of P. hydrolytica S66T is the presence of a large genomic region harboring an array of carbohydrate-active enzymes (CAZymes notably agarases and carrageenases. Based on a first functional characterization combined with a comparative sequence analysis, we confirmed the enzymatic activities of several enzymes required for red algal polysaccharide degradation by the bacterium. In particular, we report for the first time, the discovery of novel enzyme activities targeting furcellaran, a hybrid carrageenan containing both β-carrageenan and κ/β-carrageenan motifs. Some of these enzymes represent a new subfamily within the CAZy classification. From the combined analyses, we propose models for the complete degradation of agar and κ/β-type carrageenan by P. hydrolytica S66T. The novel enzymes described here may find value in new bio-based industries and advance our understanding of the mechanisms responsible for recycling of red algal polysaccharides in marine ecosystems.
Wang, Xiao-Yu; Luo, Jian-Ping; Chen, Rui; Zha, Xue-Qiang; Pan, Li-Hua
2015-01-01
The prevalence of alcohol consumption has increased in modern dietary life and alcoholic liver injury can follow. Dendrobium huoshanense polysaccharide (DHP) is a homogeneous polysaccharide isolated from Dendrobium huoshanense, which possesses hepatoprotection function. In this study, we investigated the metabolic profiles of serum and liver tissues extracts from control, ethanol-treated and DHP\\ethanol-treated mice using a UHPLC/LTQ Orbitrap XL MS-based metabolomics approach. Our results indicated that DHP alleviated early steatosis and inflammation in liver histology and the metabolomic analysis of serum and hepatic tissue revealed that first, ethanol treatment mainly altered phosphatidylcholines (PCs) including PC (13:0) and phosphocholine, arachidonic acid metabolites including 20-ethyl PGF2α and amino acids including L-Proline; Second, DHP supplementation ameliorated the altered metabolic levels particularly involved in phosphocholine and L-Proline. These data suggested that DHP might restore the perturbed metabolism pathways by ethanol exposure to prevent the progression of alcoholic liver injury. Copyright © 2015 Elsevier B.V. All rights reserved.
Saluk-Juszczak, Joanna; Pawlaczyk, Izabela; Olas, Beata; Kołodziejczyk, Joanna; Ponczek, Michal; Nowak, Pawel; Tsirigotis-Wołoszczak, Marta; Wachowicz, Barbara; Gancarz, Roman
2010-12-01
Lots of plants belonging to Asteraceae family are very popular in folk medicine in Poland. These plants are also known as being rich in acidic polysaccharides, due to the presence of hexuronic acids or its derivatives. Our preliminary experiments have shown that the extract from Conyza canadensis L. possesses various biological activity, including antiplatelet, antiocoagulant and antioxidant properties. The aim of our study was to assess if macromolecular glycoconjugates from selected herbal plants of Asteraceae family: Achillea millefolium L., Arnica montana L., Echinacea purpurea L., Solidago virgaurea L., Chamomilla recutita (L.) Rauschert., and Conyza canadensis L. protect platelet proteins against nitrative and oxidative damage induced by peroxynitrite, which is responsible for oxidative/nitrative modifications of platelet proteins: the formation of 3-nitrotyrosine and carbonyl groups. These modifications may lead to changes of blood platelet functions and can have pathological consequences. The role of these different medicinal plants in the defence against oxidative/nitrative stress in human platelets is still unknown, therefore the oxidative damage to platelet proteins induced by peroxynitrite and protectory effects of tested conjugates by the estimation of carbonyl group level and nitrotyrosine formation (a marker of protein nitration) were studied in vitro. The antioxidative properties of the polyphenolic-polysaccharide conjugates from selected tested medicinal plants were also compared with the action of a well characterized antioxidative commercial polyphenol - resveratrol (3,4',5-trihydroxystilbene). The obtained results demonstrate that the compounds from herbal plants: A. millefolium, A. montana, E. purpurea, C. recutita, S. virgaurea, possess antioxidative properties and protect platelet proteins against peroxynitrite toxicity in vitro, similar to the glycoconjugates from C. canadensis. However, in the comparative studies, the polyphenolic-polysaccharide
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila M.S.; Ferreira, Ieda M.; Andrade, S.R., E-mail: cmslacerda@gmail.com.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Barros, Andre L.B.; Fernandes, Simone O.A.; Cardoso, Valbert N., E-mail: valbertcardoso@yahoo.com.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Faculdade de Farmacia. Departamento de Analises Clinicas e Toxicologicas
2015-07-01
The difficulty in the early diagnosis of infectious foci, whether caused by fungus or bacteria has raised the need to research new methods for this purpose. The distinction between inflammation and infection as well as the pathogen identification in cases of infection are of great relevance to decision-making in therapy and follow-up treatments. The aim of this study was to evaluate the anti (1→3) – β - D - glucans aptamer Seq6, labeled with {sup 99m}Tc , to distinguish between infection and inflammation. Firstly, in vitro studies were carried out by labeling the aptamer with {sup 32}P to evaluate its binding capacity for (1→3) – β - D - glucans (main fungal cell wall polysaccharide), peptidoglycan (polysaccharide of bacterial cell wall) and also for Candida albicans and Staphylococcus aureus cells. The aptamers were labeled with {sup 99m}Tc by the direct labeling method. The stability of the {sup 99m}Tc -labeled aptamer was evaluated in saline, plasma, and cysteine excess. The biodistribution studies were approved by the Ethics Committee for Animal Experimentation of the Federal University of Minas Gerais (CETEA/UFMG), protocol. 143/2013. The aptamer labeled with {sup 99m}Tc was intravenously administered in three groups (n=6) of male Swiss mice (weight: 25-30g): infected with S. aureus or C. albicans, or with experimental inflammation induced by zymosan. The {sup 32}P aptamer showed high binding affinity for beta-glucan and peptidoglycan. Binding to C. albicans and S. aureus cells also occurred. The radiolabel yield for the aptamer labeling with {sup 99m}Tc was higher than 90%. Stability tests in saline, plasma and excess of cysteine provided satisfactory results, since no significant variation in the radiolabel yield percentage was verified up to 24 hours, even increasing the cysteine concentration. In the biodistribution studies was analyzed the radiolabeled aptamer uptake by the animal infected thigh relative to the uninfected one. The animals
An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.
Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.
2004-01-01
(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method
Wang, Mingxing; Gao, Yang; Xu, Duoduo; Gao, Qipin
2015-11-01
A polysaccharide named EP-1 was found by screening cultured mycelium of Hericium erinaceus, which was extracted and subjected to precipitation with ethanol, hollow-fiber ultrafiltration and ion-exchange chromatography. The polysaccharide has a molecular weight of approximately 3100Da and is composed of glucose, mannose and galactose, thus being a heteroglycan. EP-1 has a backbone of α-d-Glc(1→3) and β-d-Glc(1→3). The β-d-Glc(1→3) and α-d-Gal-(1→3) were regarded as branches attached to the C-4 position. The α-d-Man was regarded as a terminal residue. The anti-CAG activity was evaluated in experimental systems using a cell model for identification. The polysaccharide significantly inhibited the growth of MC cells obtained from human gastric mucosa epithelium (GES-1) cells transformed by MNNG, which were used as a chronic atrophic gastritis cell model. It also interfered with the MC cells by inducing cell cycle arrest. Thus, EP-1 shows potential for the development of new functional foods and drugs. Copyright © 2015. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Robert T Wheeler
2008-12-01
Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.
Directory of Open Access Journals (Sweden)
Eliyas Nurmamat
2018-04-01
Full Text Available The effects of different extraction temperatures (4 and 80 °C on the physicochemical properties and antitumor activity of water soluble polysaccharides (CMPs-4 and CMPs-80 from Cordyceps militaris (C. militaris were evaluated in this study. The results of gas chromatography (GC and high-performance gel permeation chromatography (HPGPC showed that a higher extraction temperature could degrade the polysaccharides with 188 kDa, mainly composed of glucose, and increase the dissolution rate of polysaccharides about 308 kDa, mainly consisting of rhamnose and galactose. In addition, the CMPs displayed the same sugar ring and category of glycosidic linkage based on Fourier-transform infrared spectroscopy (FTIR analysis, however, their invisible structural difference occurred in the specific rotation and conformational characteristics according to the results of specific optical rotation measurement and Congo red test. In vitro antitumor experiments indicated that CMPs-4 possessed stronger inhibitory effects on human esophagus cancer Eca-109 cells by inducing cell apoptosis more than CMPs-80 did. These findings demonstrated that the polysaccharides extracted with cold water (4 °C could be applied as a novel alternative chemotherapeutic agent or dietary supplement with its underlying antitumor property.
Thompson, Vicki S.; Thompson, David N.; Reed, David W.; Lacey, Jeffrey A.; Apel, William A.
2018-01-09
A genetically modified organism comprising at least one nucleic acid sequence and/or at least one recombinant nucleic acid isolated from Alicyclobacillus acidocaldarius and encoding a polypeptide involved in at least partially degrading, cleaving, transporting, metabolizing, or removing polysaccharide, lignocellulose, hemicellulose, lignin, chitin, heteroxylan, and/or xylan-decorating group; and at least one nucleic acid sequence and/or at least one recombinant nucleic acid encoding a polypeptide involved in fermenting sugar molecules to a product. Additionally, enzymatic and/or proteinaceous extracts may be isolated from one or more genetically modified organisms. The extracts are utilized to convert biomass into a product. Further provided are methods of converting biomass into products comprising: placing the genetically modified organism and/or enzymatic extracts thereof in fluid contact with polysaccharides, cellulose, lignocellulose, hemicellulose, lignin, starch, sugars, sugar oligomers, carbohydrates, complex carbohydrates, chitin, heteroxylans, glycosides, and/or xylan-, glucan-, galactan-, or mannan-decorating groups.
Crosslinked ionic polysaccharides for stimuli-sensitive drug delivery.
Alvarez-Lorenzo, Carmen; Blanco-Fernandez, Barbara; Puga, Ana M; Concheiro, Angel
2013-08-01
Polysaccharides are gaining increasing attention as components of stimuli-responsive drug delivery systems, particularly since they can be obtained in a well characterized and reproducible way from the natural sources. Ionic polysaccharides can be readily crosslinked to render hydrogel networks sensitive to a variety of internal and external variables, and thus suitable for switching drug release on-off through diverse mechanisms. Hybrids, composites and grafted polymers can reinforce the responsiveness and widen the range of stimuli to which polysaccharide-based systems can respond. This review analyzes the state of the art of crosslinked ionic polysaccharides as components of delivery systems that can regulate drug release as a function of changes in pH, ion nature and concentration, electric and magnetic field intensity, light wavelength, temperature, redox potential, and certain molecules (enzymes, illness markers, and so on). Examples of specific applications are provided. The information compiled demonstrates that crosslinked networks of ionic polysaccharides are suitable building blocks for developing advanced externally activated and feed-back modulated drug delivery systems. Copyright © 2013 Elsevier B.V. All rights reserved.
$b$-Tagging and Large Radius Jet Modelling in a $g\\rightarrow b\\bar{b}$ rich sample at ATLAS
Jiang, Zihao; The ATLAS collaboration
2016-01-01
Studies of b-tagging performance and jet properties in double b-tagged, large radius jets from sqrt(s)=8 TeV pp collisions recorded by the ATLAS detector at the LHC are presented. The double b-tag requirement yields a sample rich in high pT jets originating from the g->bb process. Using this sample, the performance of b-tagging and modelling of jet substructure variables at small b-quark angular separation is probed.
Anti-fatigue effects of polysaccharides extracted from Portulaca oleracea L. in mice.
Xu, Zhongxin; Shan, Ying
2014-08-01
Portulaca oleracea L. has been used as a food and medicinal plant for thousands of years in China. Polysaccharides extracted from P. oleracea L. (POP) are its main bioactive compound and have multiple pharmacological activities. However, anti-fatigue effects of POP have not yet been tested. This study was designed to investigate the anti-fatigue effects of POP in mice using the rotarod and forced swimming tests. The mice were randomly divided into four groups, namely normal control group, low-dose POP supplementation group, medium-dose POP supplementation group and high-dose POP supplementation group. The normal control group received distilled water and the supplementation groups received different doses of POP (75, 150 and 300 mg/kg, respectively). The POP or distilled water was administered orally and daily for 30 day. After 30 days, the rotarod and forced swimming tests were performed and then several biochemical parameters related to fatigue were determined. The data showed that POP prolonged the riding times and exhaustive swimming times of mice, decreasing blood lactic acid and serum urea nitrogen levels, as well as increasing the liver and muscle glycogen contents. These results indicated that POP had the anti-fatigue effects.
Irving, Peter M; Iqbal, Tariq; Nwokolo, Chuka; Subramanian, Sreedhar; Bloom, Stuart; Prasad, Neeraj; Hart, Ailsa; Murray, Charles; Lindsay, James O; Taylor, Adam; Barron, Rachel; Wright, Stephen
2018-03-19
Cannabidiol (CBD) exhibits anti-inflammatory properties that could improve disease activity in inflammatory bowel disease. This proof-of-concept study assessed efficacy, safety and tolerability of CBD-rich botanical extract in ulcerative colitis (UC) patients. Patients aged 18 years or older, with left-sided or extensive UC, Mayo scores of 4-10 (endoscopy scores ≥1), and on stable 5-aminosalicylic acid dosing, were randomized to 10-weeks' CBD-rich botanical extract or placebo capsules. The primary endpoint was the percentage of patients in remission after treatment. Statistical testing was 2-sided, using a 10% significance level. Patients were less tolerant of CBD-rich botanical extract compared with placebo, taking on average one-third fewer capsules, and having more compliance-related protocol deviations (principally insufficient exposure), prompting identification of a per protocol (PP) analysis set. The primary endpoint was negative; end of treatment remission rates were similar for CBD-rich botanical extract (28%) and placebo (26%). However, PP analysis of total and partial Mayo scores favoured CBD-rich botanical extract (P = 0.068 and P = 0.038, respectively). Additionally, PP analyses of the more subjective physician's global assessment of illness severity, subject global impression of change, and patient-reported quality-of-life outcomes were improved for patients taking CBD-rich botanical extract (P = 0.069, P = 0.003, and P = 0.065, respectively). Adverse events (AEs) were predominantly mild/moderate with many in the CBD-rich botanical extract group potentially attributable to the ∆9-tetrahydrocannabinol content. A greater proportion of gastrointestinal-related AEs, indicative of UC worsening, was seen on placebo. Although the primary endpoint was not reached, several signals suggest CBD-rich botanical extract may be beneficial for symptomatic treatment of UC.
Wan, Jin-Yi; Fan, Yong; Yu, Qing-Tao; Ge, Ya-Zhong; Yan, Chen-Pu; Alolga, Raphael N; Li, Ping; Ma, Zhong-Hua; Qi, Lian-Wen
2015-03-25
Many analytical methods have been developed to characterize ginsenosides in ginseng. Relatively less attention has been paid to the malonyl ginsenosides, amino acids and polysaccharides in various processing ginsengs. In this study, malonyl ginsenosides were characterized by LC-Q-TOF/MS. In positive mode, the most abundant ions at m/z 425.38 were observed corresponding to the protopanoxadiol-type ginsenosides. A rich diagnostic ion at 835.48 was shown representing the malonyl ginsenosides with at least two glucosides. Twelve malonyl ginsenosides were rapidly screened using 835.48-835.49 to restructure ion chromatograms. In negative mode, besides the high deprotonated ion, a neutral loss of 44 Da (CO2) was found. High-energy collision-induced dissociation at 50 V produced the most abundant product ion [M-H-malonyl](-) by a neutral loss of 86 Da. Determination of 17 common amino acids was performed on an automatic amino acid analyzer. Arginine, glutamic acid, and aspartic acid were abundant. The contents of amino acids were 9.1% in fresh ginseng and 3.1% in black ginseng. Phenol-sulfuric acid method was applied to analysis of polysaccharides. The contents of polysaccharides were 29.1% in fresh ginseng and 11.1% in black ginseng. The optimal growth age for the accumulation of constituents was supposed to be 5-6 years. In conclusion, the contents of malonyl ginsenosides, amino acids, and polysaccharides, based on decreasing order, ranked as follows: fresh ginseng>frozen ginseng>white ginseng>stoved ginseng>red ginseng>black ginseng. Processing should be paid more attention for the quality control of ginseng products. Copyright © 2014 Elsevier B.V. All rights reserved.
Chen, Lulu; Ren, Zhi; Zhou, Xuedong; Zeng, Jumei; Zou, Jing; Li, Yuqing
2016-01-01
Dental caries, a biofilm-related oral disease, is a result of disruption of the microbial ecological balance in the oral environment. Streptococcus mutans, which is one of the primary cariogenic bacteria, produces glucosyltransferases (Gtfs) that synthesize extracellular polysaccharides (EPSs). The EPSs, especially water-insoluble glucans, contribute to the formation of dental plaque, biofilm stability, and structural integrity, by allowing bacteria to adhere to tooth surfaces and supplying the bacteria with protection against noxious stimuli and other environmental attacks. The identification of novel alternatives that selectively inhibit cariogenic organisms without suppressing oral microbial residents is required. The goal of the current study is to investigate the influence of an oxazole derivative on S. mutans biofilm formation and the development of dental caries in rats, given that oxazole and its derivatives often exhibit extensive and pharmacologically important biological activities. Our data shows that one particular oxazole derivative, named 5H6, inhibited the formation of S. mutans biofilms and prevented synthesis of extracellular polysaccharides by antagonizing Gtfs in vitro, without affecting the growth of the bacteria. In addition, topical applications with the inhibitor resulted in diminished incidence and severity of both smooth and sulcal surface caries in vivo with a lower percentage of S. mutans in the animals' dental plaque compared to the control group (P mutans.
Marine Derived Polysaccharides for Biomedical Applications: Chemical Modification Approaches
Directory of Open Access Journals (Sweden)
Paola Laurienzo
2008-09-01
Full Text Available Polysaccharide-based biomaterials are an emerging class in several biomedical fields such as tissue regeneration, particularly for cartilage, drug delivery devices and gelentrapment systems for the immobilization of cells. Important properties of the polysaccharides include controllable biological activity, biodegradability, and their ability to form hydrogels. Most of the polysaccharides used derive from natural sources; particularly, alginate and chitin, two polysaccharides which have an extensive history of use in medicine, pharmacy and basic sciences, and can be easily extracted from marine plants (algae kelp and crab shells, respectively. The recent rediscovery of poly-saccharidebased materials is also attributable to new synthetic routes for their chemical modification, with the aim of promoting new biological activities and/or to modify the final properties of the biomaterials for specific purposes. These synthetic strategies also involve the combination of polysaccharides with other polymers. A review of the more recent research in the field of chemical modification of alginate, chitin and its derivative chitosan is presented. Moreover, we report as case studies the results of our recent work concerning various different approaches and applications of polysaccharide-based biomaterials, such as the realization of novel composites based on calcium sulphate blended with alginate and with a chemically modified chitosan, the synthesis of novel alginate-poly(ethylene glycol copolymers and the development of a family of materials based on alginate and acrylic polymers of potential interest as drug delivery systems.
Kolodziejczyk, Joanna; Olas, Beata; Wachowicz, Barbara; Szajwaj, Barbara; Stochmal, Anna; Oleszek, Wieslaw
2011-09-01
Numerous plants (including clovers) have been widely used in folk medicine for the treatment of different disorders. This in vitro study was designed to examine the antioxidative effects of the clovamide-rich fraction, obtained from aerial parts of Trifolium pallidum, in the protection of blood platelets and plasma against the nitrative and oxidative damage, caused by peroxynitrite (ONOO(-)). Carbonyl groups and 3-nitrotyrosine in blood platelet and plasma proteins were determined by ELISA tests. Thiol groups level was estimated by using 5,5'-dithio-bis(2-nitro-benzoic acid, DTNB). Plasma lipid peroxidation was measured spectrophotometrically as the production of thiobarbituric acid reactive substances. The results from our work indicate that clovamide-rich T. pallidum extract may reveal the protective properties in the prevention against oxidative stress. The presence of clovamide-rich T. pallidum extract (12.5-100 μg/ml) partly inhibited ONOO(-)-mediated protein carbonylation and nitration. All the used concentrations of T. pallidum extract reduced lipid peroxidation in plasma. The antioxidative action of the tested extract in the protection of blood platelet lipids was less effective; the extract at the lowest final concentration (12.5 μg/ml) had no protective effect against lipid peroxidation. The present results indicate that the extract from T. pallidum is likely to be a source of compounds with the antioxidative properties, useful in the prevention against the oxidative stress-related diseases.
Directory of Open Access Journals (Sweden)
R.V.S. Araújo
2011-04-01
Full Text Available The antischistosomal activity of the sulfated polysaccharide α-D-glucan (Glu.SO4 extracted from Ramalina celastri was evaluated after encapsulation into liposomes (Glu.SO4-LIPO in Schistosoma mansoni-infected mice. The effect of treatment with Glu.SO4 and Glu.SO4-LIPO (10 mg/kg on egg elimination, worm burden and hepatic granuloma formation was assessed using female albino Swiss mice, 35-40 days of age, weighing 25 ± 2 g, infected with 150 cercariae/animal (Biomphalaria glabrata, BH strain. Four groups (N = 10 were studied, two controls (empty liposomes and NaCl and two treated groups (Glu.SO4-LIPO and Glu.SO4 using a single dose. Parasitological analysis revealed that Glu.SO4-LIPO was as efficient as Glu.SO4 in reducing egg elimination and worm burden. Treatment with free Glu.SO4 and Glu.SO4-LIPO induced a statistically significant reduction in the number of granulomas (62 and 63%, respectively. Lectin histochemistry showed that wheat germ agglutinin intensely stained the egg-granuloma system in all treated groups. On the other hand, peanut agglutinin stained cells in the control groups, but not in the treated groups. The present results suggest a correlation between the decreasing number of hepatic egg-granulomas and the glycosylation profile of the egg-granuloma system in animals treated with free Glu.SO4 or Glu.SO4-LIPO.
Immunoregulatory activities of polysaccharides from mung bean.
Yao, Yang; Zhu, Yingying; Ren, Guixing
2016-03-30
Ultrasonic treatment was performed on water-extractable polysaccharides from the seed of mung beans. Purified by anion-exchange and gel filtration chromatography, MWP-1' and MWP-2' were obtained. Average molecular weights (Mws) of MWP-1' and MWP-2' were 68.4 kDa, and 52.4 kDa, respectively. Monosaccharides components analysis indicated that MWP-1' was composed of Rha, Ara, Man and Gal in a molar percent of 0.4:2.6:5.3:0.7. MWP-2' was composed of Ara, Man, Gal and Glc in a molar percent of 0.5:1.4:2.1:0.4. In vitro study showed that both polysaccharides samples were able to stimulate the production of secretory molecules (NO, TNF-α and IL-6) of RAW264.7 murine macrophages in a dosage dependent manner. MWP-2' seemed to be the most potent and induced significantly higher the NO production. These findings suggest that the ultrasonic treatment polysaccharides isolated in our study have immune potentiation effects on macrophages. Copyright © 2015 Elsevier Ltd. All rights reserved.