WorldWideScience

Sample records for b-globin gene fragments

  1. Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies

    OpenAIRE

    Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias

    2003-01-01

    The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...

  2. Pollen and gene flow in fragmented habitats

    NARCIS (Netherlands)

    Kwak, Manja M.; Velterop, Odilia; van Andel, Jelte

    . Habitat fragmentation affects both plants and pollinators. Habitat fragmentation leads to changes in species richness, population number and size, density, and shape, thus to changes in the spatial arrangement of flowers. These changes influence the amount of food for flower-visiting insects and

  3. Gene Prediction in Metagenomic Fragments with Deep Learning

    Directory of Open Access Journals (Sweden)

    Shao-Wu Zhang

    2017-01-01

    Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

  4. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  5. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  6. Predicting Hydrologic Function With Aquatic Gene Fragments

    Science.gov (United States)

    Good, S. P.; URycki, D. R.; Crump, B. C.

    2018-03-01

    Recent advances in microbiology techniques, such as genetic sequencing, allow for rapid and cost-effective collection of large quantities of genetic information carried within water samples. Here we posit that the unique composition of aquatic DNA material within a water sample contains relevant information about hydrologic function at multiple temporal scales. In this study, machine learning was used to develop discharge prediction models trained on the relative abundance of bacterial taxa classified into operational taxonomic units (OTUs) based on 16S rRNA gene sequences from six large arctic rivers. We term this approach "genohydrology," and show that OTU relative abundances can be used to predict river discharge at monthly and longer timescales. Based on a single DNA sample from each river, the average Nash-Sutcliffe efficiency (NSE) for predicted mean monthly discharge values throughout the year was 0.84, while the NSE for predicted discharge values across different return intervals was 0.67. These are considerable improvements over predictions based only on the area-scaled mean specific discharge of five similar rivers, which had average NSE values of 0.64 and -0.32 for seasonal and recurrence interval discharge values, respectively. The genohydrology approach demonstrates that genetic diversity within the aquatic microbiome is a large and underutilized data resource with benefits for prediction of hydrologic function.

  7. Identification of genes affecting vacuole membrane fragmentation in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Lydie Michaillat

    Full Text Available The equilibrium of membrane fusion and fission influences the volume and copy number of organelles. Fusion of yeast vacuoles has been well characterized but their fission and the mechanisms determining vacuole size and abundance remain poorly understood. We therefore attempted to systematically characterize factors necessary for vacuole fission. Here, we present results of an in vivo screening for deficiencies in vacuolar fragmentation activity of an ordered collection deletion mutants, representing 4881 non-essential genes of the yeast Saccharomyces cerevisiae. The screen identified 133 mutants with strong defects in vacuole fragmentation. These comprise numerous known fragmentation factors, such as the Fab1p complex, Tor1p, Sit4p and the V-ATPase, thus validating the approach. The screen identified many novel factors promoting vacuole fragmentation. Among those are 22 open reading frames of unknown function and three conspicuous clusters of proteins with known function. The clusters concern the ESCRT machinery, adaptins, and lipases, which influence the production of diacylglycerol and phosphatidic acid. A common feature of these factors of known function is their capacity to change membrane curvature, suggesting that they might promote vacuole fragmentation via this property.

  8. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  9. GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots

    International Nuclear Information System (INIS)

    Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko

    2008-01-01

    Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.

  10. Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...

    African Journals Online (AJOL)

    Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.

  11. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  12. Designer genes. Recombinant antibody fragments for biological imaging

    Energy Technology Data Exchange (ETDEWEB)

    Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

    2000-09-01

    Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

  13. Designer genes. Recombinant antibody fragments for biological imaging

    International Nuclear Information System (INIS)

    Wu, A.M.; Yazaki, P.J.

    2000-01-01

    Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

  14. Gene prediction in metagenomic fragments: A large scale machine learning approach

    Directory of Open Access Journals (Sweden)

    Morgenstern Burkhard

    2008-04-01

    Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

  15. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  16. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    ONOS

    2010-01-25

    Jan 25, 2010 ... intron. It had a high homology to previously cloned cell wall acid invertase genes in other plants by sequence .... Japan) in a final volume of 50 µl. The programs for ... The first strand of cDNA was synthesized by using SYBR ...

  17. Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

    International Nuclear Information System (INIS)

    Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

    1998-01-01

    Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

  18. Efficient production of antibody Fab fragment by transient gene expression in insect cells.

    Science.gov (United States)

    Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

    2017-08-01

    Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

    Science.gov (United States)

    Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

    2018-04-01

    Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

  20. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  1. Use of a fragment of the tuf gene for phytoplasma 16Sr group/subgroup differentiation

    DEFF Research Database (Denmark)

    Contaldo, Nicoletta; Canel, Alessandro; Makarova, Olga

    2011-01-01

    The usefulness of RFLP analyses on a 435 bp fragment of the tuf gene for preliminary identification of phytoplasmas from a number of phytoplasma ribosomal groups and/or 'Candidatus. Phytoplasma' was verified. The strains employed belong to thirteen 16Sr DNA groups and 22 different subgroups...

  2. Atrial cardiomyocyte-specific expression of Cre recombinase driven by an Nppa gene fragment

    NARCIS (Netherlands)

    de Lange, Frederik J.; Moorman, Antoon F. M.; Christoffels, Vincent M.

    2003-01-01

    To study the development of the atria, we produced a transgenic mouse line that expresses Cre under the regulatory control of a 7 kbp fragment of the Natriuretic peptide precursor type A gene (Nppa), from -3 kbp to +4 kbp relative to the transcription start site. Crossing this line with the R26R and

  3. Gene flow and pathogen transmission among bobcats (Lynx rufus) in a fragmented urban landscape

    Science.gov (United States)

    Lee, Justin S.; Ruell, Emily W.; Boydston, Erin E.; Lyren, Lisa M.; Alonso, Robert S.; Troyer, Jennifer L.; Crooks, Kevin R.; VandeWoude, Sue

    2012-01-01

    Urbanization can result in the fragmentation of once contiguous natural landscapes into a patchy habitat interspersed within a growing urban matrix. Animals living in fragmented landscapes often have reduced movement among habitat patches because of avoidance of intervening human development, which potentially leads to both reduced gene flow and pathogen transmission between patches. Mammalian carnivores with large home ranges, such as bobcats (Lynx rufus), may be particularly sensitive to habitat fragmentation. We performed genetic analyses on bobcats and their directly transmitted viral pathogen, feline immunodeficiency virus (FIV), to investigate the effects of urbanization on bobcat movement. We predicted that urban development, including major freeways, would limit bobcat movement and result in genetically structured host and pathogen populations. We analysed molecular markers from 106 bobcats and 19 FIV isolates from seropositive animals in urban southern California. Our findings indicate that reduced gene flow between two primary habitat patches has resulted in genetically distinct bobcat subpopulations separated by urban development including a major highway. However, the distribution of genetic diversity among FIV isolates determined through phylogenetic analyses indicates that pathogen genotypes are less spatially structured--exhibiting a more even distribution between habitat fragments. We conclude that the types of movement and contact sufficient for disease transmission occur with enough frequency to preclude structuring among the viral population, but that the bobcat population is structured owing to low levels of effective bobcat migration resulting in gene flow. We illustrate the utility in using multiple molecular markers that differentially detect movement and gene flow between subpopulations when assessing connectivity.

  4. Mapping of the antigenic and allergenic epitopes of Lol p VB using gene fragmentation.

    Science.gov (United States)

    Ong, E K; Knox, R B; Singh, M B

    1995-03-01

    The recombinant proteins of Lol p VA and Lol p VB expressed in E. coli reacted with IgE antibodies from sera of allergic patients and mAbs FMC A7 and PpV1. Cross-absorption analyses using these recombinant proteins showed that Lol p VA and Lol p VB possess both similar and unique IgE binding determinants. Gene fragmentation was utilized to localize the antigenic and allergenic determinants of Lol p VB. When full-length cDNA of Lol p VB was digested into three fragments and expressed as the fusions from the glutathione transferase of pGEX vectors, fragments Met1-Val196 and Asp197-Val339 bound IgE while fragment Met1-Pro96 did not. The data suggest that there are at least two IgE binding determinants in Lol p VB. In addition, only fragment Met1-Val196 reacted with mAb PpV1. The localization of these determinants was further resolved using random fragment expression libraries. The mAb PpV1 determinant was near the N-terminal region of Lol p VB molecule. The IgE binding determinants were distributed in the central region: region I (amino acids 111-195) and II (199-254). These IgE binding determinants are conserved in Lol p VA.

  5. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  6. A family of selfish minicircular chromosomes with jumbled chloroplast gene fragments from a dinoflagellate.

    Science.gov (United States)

    Zhang, Z; Cavalier-Smith, T; Green, B R

    2001-08-01

    Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.

  7. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  8. Protective vaccination with a recombinant fragment of Clostridium botulinum neurotoxin serotype A expressed from a synthetic gene in Escherichia coli.

    OpenAIRE

    Clayton, M A; Clayton, J M; Brown, D R; Middlebrook, J L

    1995-01-01

    A completely synthetic gene encoding fragment C, a approximately 50-kDa fragment, of botulinum neurotoxin serotype A was constructed from oligonucleotides. The gene was expressed in Escherichia coli, and full-sized product was produced as judged by Western blot (immunoblot) analysis. Crude extracts of E. coli expressing the gene were used to vaccinate mice and evaluate their survival against challenge with active toxin. Mice given three subcutaneous vaccinations were protected against an intr...

  9. High gene flow in epiphytic ferns despite habitat loss and fragmentation

    OpenAIRE

    Winkler, Manuela; Koch, Marcus; Hietz, Peter

    2011-01-01

    Tropical montane forests suffer from increasing fragmentation and replacement by other types of land-use such as coffee plantations. These processes are known to affect gene flow and genetic structure of plant populations. Epiphytes are particularly vulnerable because they depend on their supporting trees for their entire life-cycle. We compared population genetic structure and genetic diversity derived from AFLP markers of two epiphytic fern species differing in their ability to colonize sec...

  10. Does fragmentation of wetlands affect gene flow in sympatric Acrocephalus warblers with different migration strategies?

    OpenAIRE

    Ceresa, Francesco; Belda, E.J.; Kvist, Laura; Rguibi-Idrissi, Hamid; Monrós González, Juan Salvador

    2015-01-01

    Wetlands are naturally patchy habitats, but patchiness has been accentuated by the extensive wetlands loss due to human activities. In such a fragmented habitat, dispersal ability is especially important to maintain gene flow between populations. Here we studied population structure, genetic diversity and demographic history of Iberian and North African populations of two wetland passerines, the Eurasian reed warbler Acrocephalus scirpaceus and the moustached warbler Acrocephalus melanopogon....

  11. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  12. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. The heterothallic sugarbeet pathogen Cercospora beticola contains exon fragments of both MAT genes that are homogenized by concerted evolution.

    Science.gov (United States)

    Bolton, Melvin D; de Jonge, Ronnie; Inderbitzin, Patrik; Liu, Zhaohui; Birla, Keshav; Van de Peer, Yves; Subbarao, Krishna V; Thomma, Bart P H J; Secor, Gary A

    2014-01-01

    Dothideomycetes is one of the most ecologically diverse and economically important classes of fungi. Sexual reproduction in this group is governed by mating type (MAT) genes at the MAT1 locus. Self-sterile (heterothallic) species contain one of two genes at MAT1 (MAT1-1-1 or MAT1-2-1) and only isolates of opposite mating type are sexually compatible. In contrast, self-fertile (homothallic) species contain both MAT genes at MAT1. Knowledge of the reproductive capacities of plant pathogens are of particular interest because recombining populations tend to be more difficult to manage in agricultural settings. In this study, we sequenced MAT1 in the heterothallic Dothideomycete fungus Cercospora beticola to gain insight into the reproductive capabilities of this important plant pathogen. In addition to the expected MAT gene at MAT1, each isolate contained fragments of both MAT1-1-1 and MAT1-2-1 at ostensibly random loci across the genome. When MAT fragments from each locus were manually assembled, they reconstituted MAT1-1-1 and MAT1-2-1 exons with high identity, suggesting a retroposition event occurred in a homothallic ancestor in which both MAT genes were fused. The genome sequences of related taxa revealed that MAT gene fragment pattern of Cercospora zeae-maydis was analogous to C. beticola. In contrast, the genome of more distantly related Mycosphaerella graminicola did not contain MAT fragments. Although fragments occurred in syntenic regions of the C. beticola and C. zeae-maydis genomes, each MAT fragment was more closely related to the intact MAT gene of the same species. Taken together, these data suggest MAT genes fragmented after divergence of M. graminicola from the remaining taxa, and concerted evolution functioned to homogenize MAT fragments and MAT genes in each species. Published by Elsevier Inc.

  15. Gene Flow of a Forest-Dependent Bird across a Fragmented Landscape.

    Directory of Open Access Journals (Sweden)

    Rachael V Adams

    Full Text Available Habitat loss and fragmentation can affect the persistence of populations by reducing connectivity and restricting the ability of individuals to disperse across landscapes. Dispersal corridors promote population connectivity and therefore play important roles in maintaining gene flow in natural populations inhabiting fragmented landscapes. In the prairies, forests are restricted to riparian areas along river systems which act as important dispersal corridors for forest dependent species across large expanses of unsuitable grassland habitat. However, natural and anthropogenic barriers within riparian systems have fragmented these forested habitats. In this study, we used microsatellite markers to assess the fine-scale genetic structure of a forest-dependent species, the black-capped chickadee (Poecile atricapillus, along 10 different river systems in Southern Alberta. Using a landscape genetic approach, landscape features (e.g., land cover were found to have a significant effect on patterns of genetic differentiation. Populations are genetically structured as a result of natural breaks in continuous habitat at small spatial scales, but the artificial barriers we tested do not appear to restrict gene flow. Dispersal between rivers is impeded by grasslands, evident from isolation of nearby populations (~ 50 km apart, but also within river systems by large treeless canyons (>100 km. Significant population genetic differentiation within some rivers corresponded with zones of different cottonwood (riparian poplar tree species and their hybrids. This study illustrates the importance of considering the impacts of habitat fragmentation at small spatial scales as well as other ecological processes to gain a better understanding of how organisms respond to their environmental connectivity. Here, even in a common and widespread songbird with high dispersal potential, small breaks in continuous habitats strongly influenced the spatial patterns of genetic

  16. Gene flow of common ash (Fraxinus excelsior L.) in a fragmented landscape.

    Science.gov (United States)

    Semizer-Cuming, Devrim; Kjær, Erik Dahl; Finkeldey, Reiner

    2017-01-01

    Gene flow dynamics of common ash (Fraxinus excelsior L.) is affected by several human activities in Central Europe, including habitat fragmentation, agroforestry expansion, controlled and uncontrolled transfer of reproductive material, and a recently introduced emerging infectious disease, ash dieback, caused by Hymenoscyphus fraxineus. Habitat fragmentation may alter genetic connectivity and effective population size, leading to loss of genetic diversity and increased inbreeding in ash populations. Gene flow from cultivated trees in landscapes close to their native counterparts may also influence the adaptability of future generations. The devastating effects of ash dieback have already been observed in both natural and managed populations in continental Europe. However, potential long-term effects of genetic bottlenecks depend on gene flow across fragmented landscapes. For this reason, we studied the genetic connectivity of ash trees in an isolated forest patch of a fragmented landscape in Rösenbeck, Germany. We applied two approaches to parentage analysis to estimate gene flow patterns at the study site. We specifically investigated the presence of background pollination at the landscape level and the degree of genetic isolation between native and cultivated trees. Local meteorological data was utilized to understand the effect of wind on the pollen and seed dispersal patterns. Gender information of the adult trees was considered for calculating the dispersal distances. We found that the majority of the studied seeds (55-64%) and seedlings (75-98%) in the forest patch were fathered and mothered by the trees within the same patch. However, we determined a considerable amount of pollen flow (26-45%) from outside of the study site, representing background pollination at the landscape level. Limited pollen flow was observed from neighbouring cultivated trees (2%). Both pollen and seeds were dispersed in all directions in accordance with the local wind directions

  17. Gene flow of common ash (Fraxinus excelsior L. in a fragmented landscape.

    Directory of Open Access Journals (Sweden)

    Devrim Semizer-Cuming

    Full Text Available Gene flow dynamics of common ash (Fraxinus excelsior L. is affected by several human activities in Central Europe, including habitat fragmentation, agroforestry expansion, controlled and uncontrolled transfer of reproductive material, and a recently introduced emerging infectious disease, ash dieback, caused by Hymenoscyphus fraxineus. Habitat fragmentation may alter genetic connectivity and effective population size, leading to loss of genetic diversity and increased inbreeding in ash populations. Gene flow from cultivated trees in landscapes close to their native counterparts may also influence the adaptability of future generations. The devastating effects of ash dieback have already been observed in both natural and managed populations in continental Europe. However, potential long-term effects of genetic bottlenecks depend on gene flow across fragmented landscapes. For this reason, we studied the genetic connectivity of ash trees in an isolated forest patch of a fragmented landscape in Rösenbeck, Germany. We applied two approaches to parentage analysis to estimate gene flow patterns at the study site. We specifically investigated the presence of background pollination at the landscape level and the degree of genetic isolation between native and cultivated trees. Local meteorological data was utilized to understand the effect of wind on the pollen and seed dispersal patterns. Gender information of the adult trees was considered for calculating the dispersal distances. We found that the majority of the studied seeds (55-64% and seedlings (75-98% in the forest patch were fathered and mothered by the trees within the same patch. However, we determined a considerable amount of pollen flow (26-45% from outside of the study site, representing background pollination at the landscape level. Limited pollen flow was observed from neighbouring cultivated trees (2%. Both pollen and seeds were dispersed in all directions in accordance with the local

  18. High gene flow in epiphytic ferns despite habitat loss and fragmentation.

    Science.gov (United States)

    Winkler, Manuela; Koch, Marcus; Hietz, Peter

    2011-01-01

    Tropical montane forests suffer from increasing fragmentation and replacement by other types of land-use such as coffee plantations. These processes are known to affect gene flow and genetic structure of plant populations. Epiphytes are particularly vulnerable because they depend on their supporting trees for their entire life-cycle. We compared population genetic structure and genetic diversity derived from AFLP markers of two epiphytic fern species differing in their ability to colonize secondary habitats. One species, Pleopeltis crassinervata , is a successful colonizer of shade trees and isolated trees whereas the other species, Polypodium rhodopleuron , is restricted to forests with anthropogenic separation leading to significant isolation between populations. By far most genetic variation was distributed within rather than among populations in both species, and a genetic admixture analysis did not reveal any clustering. Gene flow exceeded by far the benchmark of one migrant per generation to prevent genetic divergence between populations in both species. Though populations are threatened by habitat loss, long-distance dispersal is likely to support gene flow even between distant populations, which efficiently delays genetic isolation. Consequently, populations may rather be threatened by ecological consequences of habitat loss and fragmentation.

  19. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  20. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  1. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  2. Distant homology between yeast photoreactivating gene fragment and human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1985-01-01

    Hybridization of DNA coding for the yeast DNA photolyase to human genomic DNA appears to allow one to determine whether a conserved enzyme is coded for in human cells. Under stringent conditions (68 0 C), hybridization is not found between the cloned yeast fragment (YEp13-phr1) and human or chick genomic digests. At less stringent conditions (60 0 C), hybridization is observed with chick digests, indicating evolutionary divergence even among organisms capable of photo-reactivation. At 50 0 C, weak hybridization with human digests was observed, indicating further divergence from the cloned gene. Data concerning the precise extent of homology and methods to clone the chick gene for use as another probe are discussed

  3. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  4. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  5. Pharmacologic study of C-terminal fragments of frog skin calcitonin gene-related peptide.

    Science.gov (United States)

    Ladram, Ali; Besné, Isabelle; Breton, Lionel; de Lacharrière, Olivier; Nicolas, Pierre; Amiche, Mohamed

    2008-07-01

    The calcitonin gene-related peptide from the skin of the frog Phyllomedusa bicolor (pbCGRP) is a 37-residue neuropeptide that differs from human alpha CGRP (halphaCGRP) at 16 positions. The affinities of the C-terminal fragments of pbCGRP and halphaCGRP were evaluated in SK-N-MC cells: pbCGRP(8-37) (K(i)=0.2nM) and pbCGRP(27-37) (K(i)=95nM) were, respectively, 3 times and 20 times more potent than the human fragments halphaCGRP(8-37) and halphaCGRP(27-37). Their antagonistic potencies were measured in SK-N-MC and Col 29 cells, and the rat vas deferens. pbCGRP(8-37) inhibited the halphaCGRP-stimulated production of cAMP by SK-N-MC and Col 29 cells 3 to 4 times more strongly than halphaCGRP(8-37). Thus pbCGRP(8-37) is the most potent CGRP-1 competitive antagonist of all the natural sequences reported to date. pbCGRP(27-37) was also as potent as [D(31), A(34), F(35)] halphaCGRP(27-37), a prototypic antagonist analog derived from structure-activity relationship studies of halphaCGRP(8-37).

  6. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...

  7. Gene flow rise with habitat fragmentation in the bog fritillary butterfly (Lepidoptera: Nymphalidae).

    Science.gov (United States)

    Nève, Gabriel; Barascud, Bernard; Descimon, Henri; Baguette, Michel

    2008-03-17

    The main components of the spatial genetic structure of the populations are neighbourhood size and isolation by distance. These may be inferred from the allele frequencies across a series of populations within a region. Here, the spatial population structure of Proclossiana eunomia was investigated in two mountainous areas of southern Europe (Asturias, Spain and Pyrenees, France) and in two areas of intermediate elevation (Morvan, France and Ardennes, Belgium). A total of eight polymorphic loci were scored by allozyme electrophoresis, revealing a higher polymorphism in the populations of southern Europe than in those of central Europe. Isolation by distance effect was much stronger in the two mountain ranges (Pyrenees and Asturias) than in the two areas of lower elevation (Ardennes and Morvan). By contrast, the neighbourhood size estimates were smaller in the Ardennes and in the Morvan than in the two high mountain areas, indicating more common movements between neighbouring patches in the mountains than in plains. Short and long dispersal events are two phenomena with distinct consequences in the population genetics of natural populations. The differences in level of population differentiation within each the four regions may be explained by change in dispersal in lowland recently fragmented landscapes: on average, butterflies disperse to a shorter distance but the few ones which disperse long distance do so more efficiently. Habitat fragmentation has evolutionary consequences exceeding by far the selection of dispersal related traits: the balance between local specialisation and gene flow would be perturbed, which would modify the extent to which populations are adapted to heterogeneous environments.

  8. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  9. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  10. Gene flow rise with habitat fragmentation in the bog fritillary butterfly (Lepidoptera: Nymphalidae

    Directory of Open Access Journals (Sweden)

    Descimon Henri

    2008-03-01

    Full Text Available Abstract Background The main components of the spatial genetic structure of the populations are neighbourhood size and isolation by distance. These may be inferred from the allele frequencies across a series of populations within a region. Here, the spatial population structure of Proclossiana eunomia was investigated in two mountainous areas of southern Europe (Asturias, Spain and Pyrenees, France and in two areas of intermediate elevation (Morvan, France and Ardennes, Belgium. Results A total of eight polymorphic loci were scored by allozyme electrophoresis, revealing a higher polymorphism in the populations of southern Europe than in those of central Europe. Isolation by distance effect was much stronger in the two mountain ranges (Pyrenees and Asturias than in the two areas of lower elevation (Ardennes and Morvan. By contrast, the neighbourhood size estimates were smaller in the Ardennes and in the Morvan than in the two high mountain areas, indicating more common movements between neighbouring patches in the mountains than in plains. Conclusion Short and long dispersal events are two phenomena with distinct consequences in the population genetics of natural populations. The differences in level of population differentiation within each the four regions may be explained by change in dispersal in lowland recently fragmented landscapes: on average, butterflies disperse to a shorter distance but the few ones which disperse long distance do so more efficiently. Habitat fragmentation has evolutionary consequences exceeding by far the selection of dispersal related traits: the balance between local specialisation and gene flow would be perturbed, which would modify the extent to which populations are adapted to heterogeneous environments.

  11. PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates

    Directory of Open Access Journals (Sweden)

    Zohreh Ebrahimvandi

    2014-07-01

    Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.

  12. Usage of U7 snRNA in gene therapy of hemoglobin C disorder ...

    African Journals Online (AJOL)

    Here, a bioinformatic analysis was performed to study the effect of co-expression between human Hb C b-globin chain gene and U7.623. The gene ontological results show that full recovery of hemoglobin function and biological process can be derived. This confirms that U7 snRNA can be a good tool for gene therapy in Hb ...

  13. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  14. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  15. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  16. Putative in vitro expressed gene fragments unique to Mycobacterium avium subspecies para tuberculosis

    DEFF Research Database (Denmark)

    Nielsen, Kirstine Klitgaard; Ahrens, Peter

    2002-01-01

    By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria. The uniquen......By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria....... The uniqueness and diagnostic potential of seven of these fragments in relation to M. paratuberculosis closest relative Mycobacterium avium subsp. avium (M. avium) was confirmed by species-specific PCR and Southern blot. Furthermore, RT-PCR indicated that eight of the nine fragments originate from areas...

  17. Urban landscapes can change virus gene flow and evolution in a fragmentation-sensitive carnivore

    Science.gov (United States)

    Fountain-Jones, Nicholas M.; Craft, Meggan E.; Funk, W. Chris; Kozakiewicz, Chris; Trumbo, Daryl; Boydston, Erin E.; Lyren, Lisa M.; Crooks, Kevin R.; Lee, Justin S.; VandeWoude, Sue; Carver, Scott

    2017-01-01

    Urban expansion has widespread impacts on wildlife species globally, including the transmission and emergence of infectious diseases. However, there is almost no information about how urban landscapes shape transmission dynamics in wildlife. Using an innovative phylodynamic approach combining host and pathogen molecular data with landscape characteristics and host traits, we untangle the complex factors that drive transmission networks of Feline Immunodeficiency Virus (FIV) in bobcats (Lynx rufus). We found that the urban landscape played a significant role in shaping FIV transmission. Even though bobcats were often trapped within the urban matrix, FIV transmission events were more likely to occur in areas with more natural habitat elements. Urban fragmentation also resulted in lower rates of pathogen evolution, possibly owing to a narrower range of host genotypes in the fragmented area. Combined, our findings show that urban landscapes can have impacts on a pathogen and its evolution in a carnivore living in one of the most fragmented and urban systems in North America. The analytical approach used here can be broadly applied to other host-pathogen systems, including humans.

  18. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  19. Identification of a seed coat-specific promoter fragment from the Arabidopsis MUCILAGE-MODIFIED4 gene.

    Science.gov (United States)

    Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W

    2017-09-01

    The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.

  20. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  1. Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi

    DEFF Research Database (Denmark)

    Frandsen, Rasmus John Normand; Andersson, Jens A.; Kristensen, Matilde Bylov

    2008-01-01

    Background: The rapid increase in whole genome fungal sequence information allows large scale functional analyses of target genes. Efficient transformation methods to obtain site-directed gene replacement, targeted over-expression by promoter replacement, in-frame epitope tagging or fusion...... of coding sequences with fluorescent markers such as GFP are essential for this process. Construction of vectors for these experiments depends on the directional cloning of two homologous recombination sequences on each side of a selection marker gene. Results: Here, we present a USER Friendly cloning based...

  2. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  3. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  4. Assembly of Highly Standardized Gene Fragments for High-Level Production of Porphyrins in E. coli

    DEFF Research Database (Denmark)

    Nielsen, Morten Thrane; Madsen, Karina Marie; Seppala, Susanna

    2015-01-01

    to formulate a molecular cloning pipeline and iteratively assemble and optimize a six-gene pathway for protoporphyrin IX synthesis in Escherichia coli. State of the art production levels were achieved through two simple cycles of engineering and screening. The principles defined here are generally applicable...

  5. Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

    NARCIS (Netherlands)

    Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

    We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

  6. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  7. Gene flow and effective population sizes of the butterfly Maculinea alcon in a highly fragmented, anthropogenic landscape

    DEFF Research Database (Denmark)

    Vanden Broeck, An; Maes, Dirk; Kelager, Andreas

    2017-01-01

    fragmentation as they occupy narrow niches or restricted habitat ranges. Here, we assess contemporary interpopulation connectedness of the threatened, myrmecophilous butterfly,Maculinea alcon, in a highly fragmented landscape.Weinferred dispersal, effective population sizes, genetic diversity and structure...

  8. Genetic diversity of nifH gene sequences in Paenibacillus azotofixans strains and soil samples analyzed by denaturing gradiënt gel electrophoresis of PCR-amplified gene fragments

    NARCIS (Netherlands)

    Rosado, A.S.; Duarte, G.F.; Seldin, L.; Elsas, van J.D.

    1998-01-01

    The diversity of dinitrogenase reductase gene (nifH) fragments in Paenibacillus azotofixans strains was investigated by using molecular methods. The partial nifH gene sequences of eight P. azotofixans strains, as well as one strain each of the close relatives Paenibacillus durum, Paenibacillus

  9. Distribution of a Nocardia brasiliensis Catalase Gene Fragment in Members of the Genera Nocardia, Gordona, and Rhodococcus

    Science.gov (United States)

    Vera-Cabrera, Lucio; Johnson, Wendy M.; Welsh, Oliverio; Resendiz-Uresti, Francisco L.; Salinas-Carmona, Mario C.

    1999-01-01

    An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3′-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria. PMID:10325357

  10. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

    NARCIS (Netherlands)

    Coolen, MJL; Post, E; Davis, CC; Forney, LJ

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

  11. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  12. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  13. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

  14. Vaccination with Gag, Vif, and Nef gene fragments affords partial control of viral replication after mucosal challenge with SIVmac239.

    Science.gov (United States)

    Martins, Mauricio A; Wilson, Nancy A; Piaskowski, Shari M; Weisgrau, Kim L; Furlott, Jessica R; Bonaldo, Myrna C; Veloso de Santana, Marlon G; Rudersdorf, Richard A; Rakasz, Eva G; Keating, Karen D; Chiuchiolo, Maria J; Piatak, Michael; Allison, David B; Parks, Christopher L; Galler, Ricardo; Lifson, Jeffrey D; Watkins, David I

    2014-07-01

    vaccinating rhesus macaques with minigenes encoding fragments of Gag, Vif, and Nef. In contrast to previous mouse studies, this strategy appeared to minimally affect monkey CD8(+) T-cell immundominance hierarchies, as seen by the detection of only one subdominant epitope in Mamu-A*01(+) vaccinees. This finding underscores the difficulty of inducing subdominant CD8(+) T cells by vaccination and demonstrates that strategies other than gene fragmentation may be required to significantly alter immunodominance in primates. Although some of the regimens tested here were extremely immunogenic, vaccine efficacy was limited to a modest reduction in set point viremia after challenge with SIVmac239. No correlates of protection were identified. These results reinforce the notion that vaccine immunogenicity does not predict control of AIDS virus replication. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Recent habitat fragmentation caused by major roads leads to reduction of gene flow and loss of genetic variability in ground beetles.

    Science.gov (United States)

    Keller, Irene; Largiadèr, Carlo R

    2003-02-22

    Although habitat fragmentation is suspected to jeopardize the long-term survival of many species, few data are available on its impact on the genetic variability of invertebrates. We assess the genetic population structure of the flightless ground beetle Carabus violaceus L., 1758 in a Swiss forest, which is divided into several fragments by a highway and two main roads. Eight samples were collected from different forest fragments and analysed at six microsatellite loci. The largest genetic differentiation was observed between samples separated by roads and in particular by the highway. The number of roads between sites explained 44% of the variance in pairwise F(ST) estimates, whereas the age of the road and the geographical distance between locations were not significant factors. Furthermore, a comparison of allelic richness showed that the genetic variability in a small forest fragment isolated by the highway was significantly lower than in the rest of the study area. These findings strongly support the hypothesis that large roads are absolute barriers to gene flow in C. violaceus, which may lead to a loss of genetic variability in fragmented populations.

  16. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  17. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  18. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  19. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  20. Phylogenetic similarity of the canine parvovirus wild-type isolates on the basis of VP1/VP2 gene fragment sequence analysis.

    Science.gov (United States)

    Rypul, K; Chmielewski, R; Smielewska-Loś, E; Klimentowski, S

    2002-04-01

    Biological material was taken from dogs with diarrhoea. Faecal samples were taken from within live animals and intestinal tract fragments (i.e. small intestine, and stomach) were taken from dead animals. In total, 18 specimens were investigated from dogs housed alone or in large groups. To test for the presence of the virus, latex (On Site Biotech, Uppsala, Sweden) and direct immunofluorescence tests were performed. At the same time, polymerase chain reaction (PCR) with primers complementary to a conservative region of VP1/VP2 was carried out. The products of amplification were analysed on 2% agarose gel. The purified products were cloned with the Template Generation System (Finnzymes, Espoo, Finland) using a transposition reaction and positive clones were searched using the 'colony screening by PCR' method. The sequencing gave 12 sequences of VP1/VP2 gene fragments that were of high similarity. Among the 12 analysed sequences, six exhibited 88% similarity, four exhibited 100% similarity and two exhibited 71% similarity.

  1. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  2. Genetic analyses of historic and modern marbled murrelets suggest decoupling of migration and gene flow after habitat fragmentation

    Science.gov (United States)

    M. Zachariah Peery; Laurie A. Hall; Sellas. Anna; Steven R. Beissinger; Craig Moritz; Martine Berube; Martin G. Raphael; S. Kim Nelson; Richard T. Golightly; Laura McFarlane-Tranquilla; Scott H. Newman; Per J. Palsboll

    2009-01-01

    The dispersal of individuals among fragmented populations is generally thought to prevent genetic and demographic isolation, and ultimately reduce extinction risk. In this study, we show that a century of reduction in coastal old-growth forests, as well as a number of other environmental factors, has probably resulted in the genetic divergence of marbled murrelets (...

  3. Gene flow and effective population sizes of the butterfly Maculinea alcon in a highly fragmented, anthropogenic landscape

    NARCIS (Netherlands)

    Vanden Broeck, An; Maes, Dirk; Kelager, Andreas; Wynhoff, Irma; Wallis de Vries, Michiel; Nash, David R.; Oostermeijer, J.G.B.; Dyck, van Hans; Mergeay, Joachim

    2017-01-01

    Understanding connectivity among populations in fragmented landscapes is of paramount importance in species conservation because it determines their long-term viability and helps to identify and prioritize populations to conserve. Rare and sedentary species are particularly vulnerable to habitat

  4. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  5. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  6. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  7. Nuclease-mediated double-strand break (DSB) enhancement of small fragment homologous recombination (SFHR) gene modification in human-induced pluripotent stem cells (hiPSCs).

    Science.gov (United States)

    Sargent, R Geoffrey; Suzuki, Shingo; Gruenert, Dieter C

    2014-01-01

    Recent developments in methods to specifically modify genomic DNA using sequence-specific endonucleases and donor DNA have opened the door to a new therapeutic paradigm for cell and gene therapy of inherited diseases. Sequence-specific endonucleases, in particular transcription activator-like (TAL) effector nucleases (TALENs), have been coupled with polynucleotide small/short DNA fragments (SDFs) to correct the most common mutation in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene, a 3-base-pair deletion at codon 508 (delF508), in induced pluripotent stem (iPS) cells. The studies presented here describe the generation of candidate TALENs and their co-transfection with wild-type (wt) CFTR-SDFs into CF-iPS cells homozygous for the delF508 mutation. Using an allele-specific PCR (AS-PCR)-based cyclic enrichment protocol, clonal populations of corrected CF-iPS cells were isolated and expanded.

  8. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  9. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  10. The heterothallic sugarbeet pathogen Cercospora beticola contains exon fragments of both MAT genes that are homogenized by concerted evolution

    NARCIS (Netherlands)

    Bolton, M.D.; Jonge, de R.; Inderbitzin, P.; Liu, Z.; Birla, K.; Peer, Van de Y.; Subbarao, K.; Thomma, B.P.H.J.; Secor, G.

    2014-01-01

    Dothideomycetes is one of the most ecologically diverse and economically important classes of fungi. Sexual reproduction in this group is governed by mating type (MAT) genes at the MAT1 locus. Self-sterile (heterothallic) species contain one of two genes at MAT1 (MAT1-1-1 or MAT1-2-1) and only

  11. Diversification in continental island archipelagos: new evidence on the roles of fragmentation, colonization and gene flow on the genetic divergence of Aegean Nigella (Ranunculaceae).

    Science.gov (United States)

    Jaros, Ursula; Tribsch, Andreas; Comes, Hans Peter

    2018-02-12

    Disentangling the relative roles of past fragmentation (vicariance), colonization (dispersal) and post-divergence gene flow in the genetic divergence of continental island organisms remains a formidable challenge. Amplified fragment length polymorphisms (AFLPs) were used to (1) gain further insights into the biogeographical processes underlying the Pleistocene diversification of the Aegean Nigella arvensis complex; (2) evaluate the role of potential key factors driving patterns of population genetic variability (mating system, geographical isolation and historical contingencies); and (3) test the robustness of conclusions previously drawn from chloroplast (cp) DNA. Genetic diversity was analysed for 235 AFLP markers from 48 populations (497 individuals) representing 11 taxa of the complex using population genetic methods and Bayesian assignment tests. Most designated taxa are identifiable as genetically distinct units. Both fragmentation and dispersal-driven diversification processes occurred at different geological time scales, from Early to Late Pleistocene, specifically (1) sea barrier-induced vicariant speciation in the Cyclades, the Western Cretan Strait and Ikaria; and (2) bi-regional colonizations of the 'Southern Aegean Island Arc' from the Western vs. Eastern Aegean mainland, followed by allopatric divergences in Crete vs. Rhodos and Karpathos/Kasos. Outcrossing island taxa experienced drift-related demographic processes that are magnified in the two insular selfing species. Population genetic differentiation on the mainland seems largely driven by dispersal limitation, while in the Central Aegean it may still be influenced by historical events (island fragmentation and sporadic long-distance colonization). The biogeographical history of Aegean Nigella is more complex than expected for a strictly allopatric vicariant model of divergence. Nonetheless, the major phylogeographical boundaries of this radiation are largely congruent with the geography and

  12. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  13. Paternity analysis of pollen-mediated gene flow for Fraxinus excelsior L. in a chronically fragmented landscape.

    Science.gov (United States)

    Bacles, C F E; Ennos, R A

    2008-10-01

    Paternity analysis based on microsatellite marker genotyping was used to infer contemporary genetic connectivity by pollen of three population remnants of the wind-pollinated, wind-dispersed tree Fraxinus excelsior, in a deforested Scottish landscape. By deterministically accounting for genotyping error and comparing a range of assignment methods, individual-based paternity assignments were used to derive population-level estimates of gene flow. Pollen immigration into a 300 ha landscape represents between 43 and 68% of effective pollination, mostly depending on assignment method. Individual male reproductive success is unequal, with 31 of 48 trees fertilizing one seed or more, but only three trees fertilizing more than ten seeds. Spatial analysis suggests a fat-tailed pollen dispersal curve with 85% of detected pollination occurring within 100 m, and 15% spreading between 300 and 1900 m from the source. Identification of immigrating pollen sourced from two neighbouring remnants indicates further effective dispersal at 2900 m. Pollen exchange among remnants is driven by population size rather than geographic distance, with larger remnants acting predominantly as pollen donors, and smaller remnants as pollen recipients. Enhanced wind dispersal of pollen in a barren landscape ensures that the seed produced within the catchment includes genetic material from a wide geographic area. However, gene flow estimates based on analysis of non-dispersed seeds were shown to underestimate realized gene immigration into the remnants by a factor of two suggesting that predictive landscape conservation requires integrated estimates of post-recruitment gene flow occurring via both pollen and seed.

  14. Use of a Short Fragment of the C-Terminal E Gene for Detection and Characterization of Two New Lineages of Dengue Virus 1 in India

    Science.gov (United States)

    Domingo, C.; Palacios, G.; Jabado, O.; Reyes, N.; Niedrig, M.; Gascón, J.; Cabrerizo, M.; Lipkin, W. I.; Tenorio, A.

    2006-01-01

    Here we propose the use of a 216-nucleotide fragment located in the carboxyl terminus of the E gene (E-COOH) and a pairwise-based comparison method for genotyping of dengue virus 1 (DENV-1) strains. We have applied this method to the detection and characterization of DENV-1 in serum samples from travelers returning from the tropics. The results obtained with the typing system correlate with the results obtained by comparison of the sequences of the entire E gene of the strains. The approach demonstrates utility in plotting the distribution and circulation of different genotypes of DENV-1 and also suggests the presence of two new clades of Indian strains. The integration of the method with an online database and a typing characterization tool enhances its strength. Additionally, the analysis of the complete E gene of DENV-1 strains suggested the occurrence of a nondescribed recombination event in the China GD23-95 strain. We propose the use of this methodology as a tool for real-time epidemiological surveillance of dengue virus infections and their pathogenesis. PMID:16597885

  15. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  16. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  17. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  18. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  19. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  20. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  1. A small molecule for a big transformation: Topical application of a 20-nucleotide-long antisense fragment of the DIAP-2 gene inhibits the development of Drosophila melanogaster female imagos

    Directory of Open Access Journals (Sweden)

    Nyadar Palmah M.

    2018-01-01

    Full Text Available Several genes have been identified to play important roles associated with sex selection in Drosophila melanogaster. An essential part is attributed to the sex-lethal gene that depends on the expression of the X:A (number of chromosomes to autosomes ratio signal controlling both sex selection and dosage compensation processes in D. melanogaster. Interestingly, for sex selection in D. melanogaster there are no documented data addressing the role of the inhibitor of apoptosis (IAP genes and their signaling influence on this biological process. In this study, we found that topical application of a 20-nucleotide-long antisense DNA fragment (oligoDIAP-2 from the death-associated inhibitor of apoptosis (DIAP-2 gene interferes with D. melanogaster development and significantly decreases the number of female imagos and their biomass. We show that the applied antisense oligoDIAP-2 fragment downregulates the target DIAP-2 gene whose normal concentration is necessary for the development of female D. melanogaster. These data correspond to the results on downregulation of the target host IAP-Z gene of Lymantria dispar L. female imagos after topical treatment with an 18-nucleotide-long antisense DNA fragment from the L. dispar multicapsid nuclear polyhedrosis virus IAP-3 gene at the larval stage. The observed novel phenomenon linking the downregulation of insect IAP genes and the low rate of female imago development could have practical application, especially in insect pest control and molecular pathology.

  2. Phylogenetic analysis of members of the Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene.

    Science.gov (United States)

    Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A

    2008-05-01

    Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this

  3. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  4. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  5. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  6. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Science.gov (United States)

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  7. Neuroprotective effect of non-viral gene therapy treatment based on tetanus toxin C-fragment in a severe mouse model of Spinal Muscular Atrophy.

    Directory of Open Access Journals (Sweden)

    Sara Olivan Garcia

    2016-08-01

    Full Text Available Spinal muscular atrophy (SMA is a hereditary childhood disease that causes paralysis and progressive degeneration of skeletal muscles and spinal motor neurons. SMA is associated with reduced levels of full-length Survival of Motor Neuron (SMN protein, due to mutations in the Survival of Motor Neuron 1 gene. Nowadays there are no effective therapies available to treat patients with SMA, so our aim was to test whether the non-toxic carboxy-terminal fragment of tetanus toxin heavy chain (TTC, which exhibits neurotrophic properties, might have a therapeutic role or benefit in SMA. In this manuscript, we have demonstrated that TTC enhance the SMN expression in motor neurons in vitro and evaluated the effect of intramuscular injection of TTC-encoding plasmid in the spinal cord and the skeletal muscle of SMNdelta7 mice. For this purpose, we studied the weight and the survival time, as well as, the survival and cell death pathways and muscular atrophy. Our results showed that TTC treatment reduced the expression of autophagy markers (Becn1, Atg5, Lc3 and p62 and pro-apoptotic genes such as Bax and Casp3 in spinal cord. In skeletal muscle, TTC was able to downregulate the expression of the main marker of autophagy, Lc3, to wild type levels and the expression of the apoptosis effector protein, Casp3. Regarding the genes related to muscular atrophy (Ankrd1, Calm1, Col19a1, Fbox32, Mt2, Myod1, NogoA, Pax7, Rrad, and Sln, TTC suggest a compensatory effect for muscle damage response, diminished oxidative stress and modulated calcium homeostasis. These preliminary findings suggest the need for further experiments to depth study the effect of TTC in SMA disease.

  8. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  9. Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

    Science.gov (United States)

    Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

    2015-12-14

    Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

  10. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  11. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  12. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  13. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

  14. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  15. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  16. EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

    Directory of Open Access Journals (Sweden)

    Anita Nadkarni

    2013-02-01

    Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

  17. Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes.

    Science.gov (United States)

    Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A

    2016-04-01

    Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences

  18. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  19. Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Lu, Fengmin

    2017-01-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis‐activate the expression of proto‐oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV‐integrated haplotype, and a long‐range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long‐range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence‐associated acidic β‐gal activity in HeLa cells. These data indicate a long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. PMID:28470669

  20. Long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele-specific MYC expression in HeLa cells.

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Chen, Xiangmei; Lu, Fengmin

    2017-08-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis-activate the expression of proto-oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV-integrated haplotype, and a long-range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long-range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence-associated acidic β-gal activity in HeLa cells. These data indicate a long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  1. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  2. Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies

    Directory of Open Access Journals (Sweden)

    Rita de Cassia Mousinho-Ribeiro

    2003-01-01

    Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.

  3. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  4. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  5. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  6. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  7. Enhancement of flowering and branching phenotype in chrysanthemum by expression of ipt under the control of a 0.821 kb fragment of the LEACO1 gene promoter

    Czech Academy of Sciences Publication Activity Database

    Khodakovskaya, M.; Vaňková, Radomíra; Malbeck, Jiří; Li, A.; Li, Y.; McAvoy, R.

    2009-01-01

    Roč. 28, č. 9 (2009), s. 1351-1362 ISSN 0721-7714 Institutional research plan: CEZ:AV0Z50380511 Keywords : ipt Gene * Cytokinins * Transgenic chrysanthemum Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.301, year: 2009

  8. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

    Science.gov (United States)

    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

    2012-08-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  9. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  10. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  11. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  12. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    Energy Technology Data Exchange (ETDEWEB)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-11-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

  13. Enhancement of antitumor activity by using a fully human gene encoding a single-chain fragmented antibody specific for carcinoembryonic antigen

    Directory of Open Access Journals (Sweden)

    Shibaguchi H

    2017-08-01

    Full Text Available Hirotomo Shibaguchi,1,* Naixiang Luo,1,* Naoto Shirasu,1,* Motomu Kuroki,2 Masahide Kuroki1 1Department of Biochemistry, Faculty of Medicine, Fukuoka University, Fukuoka, Japan; 2School of Nursing, Faculty of Medicine, Fukuoka University, Fukuoka, Japan *These authors equally contributed to this work Abstract: Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. Keywords: chimeric antigen receptor, fusion protein, human scFv, CEA, combination therapy

  14. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    International Nuclear Information System (INIS)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-01-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

  15. Analysis of dissimilatory sulfite reductase and 16S rRNA gene fragments from deep-sea hydrothermal sites of the Suiyo Seamount, Izu-Bonin Arc, Western Pacific.

    Science.gov (United States)

    Nakagawa, Tatsunori; Ishibashi, Jun-Ichiro; Maruyama, Akihiko; Yamanaka, Toshiro; Morimoto, Yusuke; Kimura, Hiroyuki; Urabe, Tetsuro; Fukui, Manabu

    2004-01-01

    This study describes the occurrence of unique dissimilatory sulfite reductase (DSR) genes at a depth of 1,380 m from the deep-sea hydrothermal vent field at the Suiyo Seamount, Izu-Bonin Arc, Western Pacific, Japan. The DSR genes were obtained from microbes that grew in a catheter-type in situ growth chamber deployed for 3 days on a vent and from the effluent water of drilled holes at 5 degrees C and natural vent fluids at 7 degrees C. DSR clones SUIYOdsr-A and SUIYOdsr-B were not closely related to cultivated species or environmental clones. Moreover, samples of microbial communities were examined by PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene. The sequence analysis of 16S rRNA gene fragments obtained from the vent catheter after a 3-day incubation revealed the occurrence of bacterial DGGE bands affiliated with the Aquificae and gamma- and epsilon-Proteobacteria as well as the occurrence of archaeal phylotypes affiliated with the Thermococcales and of a unique archaeon sequence that clustered with "Nanoarchaeota." The DGGE bands obtained from drilled holes and natural vent fluids from 7 to 300 degrees C were affiliated with the delta-Proteobacteria, genus Thiomicrospira, and Pelodictyon. The dominant DGGE bands retrieved from the effluent water of casing pipes at 3 and 4 degrees C were closely related to phylotypes obtained from the Arctic Ocean. Our results suggest the presence of microorganisms corresponding to a unique DSR lineage not detected previously from other geothermal environments.

  16. Cloning and sequencing of wsp encoding gene fragments reveals a diversity of co-infecting Wolbachia strains in Acromyrmex leafcutter ants

    DEFF Research Database (Denmark)

    van Borm, S.; Wenseleers, T.; Billen, J.

    2003-01-01

    Acromyrmex insinuator hosted two additional infections. The multiple Wolbachia strains may influence the expression of reproductive conflicts in leafcutter ants, but the expected turnover of infections may make the cumulative effects on host ant reproduction complex. The additional Wolbachia infections......By sequencing part of the wsp gene of a series of clones, we detected an unusually high diversity of nine Wolbachia strains in queens of three species of leafcutter ants. Up to four strains co-occurred in a single ant. Most strains occurred in two clusters (InvA and InvB), but the social parasite...

  17. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  18. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  19. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  20. Co-expression of the Thermotoga neapolitana aglB gene with an upstream 3'-coding fragment of the malG gene improves enzymatic characteristics of recombinant AglB cyclomaltodextrinase.

    Science.gov (United States)

    Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A

    2007-07-01

    A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.

  1. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  2. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  3. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  4. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  5. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  6. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  7. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  8. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  9. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  10. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  11. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  12. Differentiation of Mycobacterium tuberculosis complex from non-tubercular mycobacteria by nested multiplex PCR targeting IS6110, MTP40 and 32kD alpha antigen encoding gene fragments.

    Science.gov (United States)

    Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N

    2016-03-12

    Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex

  13. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  14. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  15. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  16. PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.; Hinsberg, N.P. van; Abadjieva, E.

    2013-01-01

    An analytical model that describes the PELE fragmentation dynamics is presented and compared with experimental results from literature. The model accounts for strong shock effects and detailed interactions taking place between the filling – the inner core of the ammunition – and the target

  17. Cryobiology of coral fragments.

    Science.gov (United States)

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  19. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  20. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  1. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  2. Identification of expressed genes in cDNA library of hemocytes from the RLO-challenged oyster, Crassostrea ariakensis Gould with special functional implication of three complement-related fragments (CaC1q1, CaC1q2 and CaC3).

    Science.gov (United States)

    Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong

    2012-06-01

    A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...... made almost completely of still images, recounting the end of the world. These stills can be viewed as fragments that have survived the end of the world and now provide the only access to the events that occured. Shane Carruth's Primer has a different approach to time travel, the narrative diegesis...... that is presented; how do we understand such films and to what extent is it even possible to make sense of a film that has no real beginning, middle or end?...

  4. Fragmentation of atomic systems

    International Nuclear Information System (INIS)

    Bohn, J.L.; Fano, U.

    1996-01-01

    We report recent progress toward a nonperturbative formulation of many-body quantum dynamics that treats all constituent particles on an equal footing. This formulation is capable of detailing the evolution of a system toward the diverse fragments into which it can break up. We illustrate the general concept with the simple example of the simultaneous excitation of both electrons in a helium atom. copyright 1996 The American Physical Society

  5. Modelling the fragmentation mechanisms

    International Nuclear Information System (INIS)

    Bougault, R.; Durand, D.; Gulminelli, F.

    1998-01-01

    We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way

  6. Hot nuclei and fragmentation

    International Nuclear Information System (INIS)

    Guerreau, D.

    1993-01-01

    A review is made of the present status concerning the production of nuclei above 5 MeV temperature. Considerable progress has been made recently on the understanding of the formation and the fate of such hot nuclei. It appears that the nucleus seems more stable against temperature than predicted by static calculations. However, the occurrence of multifragment production at high excitation energies is now well established. The various experimental features of the fragmentation process are discussed. (author) 59 refs., 12 figs

  7. Excited nuclei fragmentation

    International Nuclear Information System (INIS)

    Ngo, C.

    1986-11-01

    Experimental indications leading to the thought of a very excited nucleus fragmentation are resumed. Theoretical approaches are briefly described; they are used to explain the phenomenon in showing off they are based on a minimum information principle. This model is based on time dependent Thomas-Fermi calculation which allows the mean field effect description, and with a site-bound percolation model which allows the fluctuation description [fr

  8. Expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori

    NARCIS (Netherlands)

    Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.

    2005-01-01

    We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA

  9. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  10. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  11. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  12. An Archeology of Fragments

    Directory of Open Access Journals (Sweden)

    Gerald L. Bruns

    2014-10-01

    Full Text Available This is a short (fragmentary history of fragmentary writing from the German Romantics (F. W. Schlegel, Friedrich Hölderlin to modern and contemporary concrete or visual poetry. Such writing is (often deliberately a critique of the logic of subsumption that tries to assimilate whatever is singular and irreducible into totalities of various categorical or systematic sorts. Arguably, the fragment (parataxis is the distinctive feature of literary Modernism, which is a rejection, not of what precedes it, but of what Max Weber called “the rationalization of the world” (or Modernity whose aim is to keep everything, including all that is written, under surveillance and control.

  13. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  14. Fragmentation of random trees

    International Nuclear Information System (INIS)

    Kalay, Z; Ben-Naim, E

    2015-01-01

    We study fragmentation of a random recursive tree into a forest by repeated removal of nodes. The initial tree consists of N nodes and it is generated by sequential addition of nodes with each new node attaching to a randomly-selected existing node. As nodes are removed from the tree, one at a time, the tree dissolves into an ensemble of separate trees, namely, a forest. We study statistical properties of trees and nodes in this heterogeneous forest, and find that the fraction of remaining nodes m characterizes the system in the limit N→∞. We obtain analytically the size density ϕ s of trees of size s. The size density has power-law tail ϕ s ∼s −α with exponent α=1+(1/m). Therefore, the tail becomes steeper as further nodes are removed, and the fragmentation process is unusual in that exponent α increases continuously with time. We also extend our analysis to the case where nodes are added as well as removed, and obtain the asymptotic size density for growing trees. (paper)

  15. Metagenome Fragment Classification Using -Mer Frequency Profiles

    Directory of Open Access Journals (Sweden)

    Gail Rosen

    2008-01-01

    Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

  16. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  17. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  18. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  19. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  20. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  1. MRI of displaced meniscal fragments

    Energy Technology Data Exchange (ETDEWEB)

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  2. Thermodynamical string fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Nadine [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden); School of Physics and Astronomy, Monash University,Wellington Road, Clayton, VIC-3800 (Australia); Sjöstrand, Torbjörn [Theoretical Particle Physics, Department of Astronomy and Theoretical Physics, Lund University,Sölvegatan 14A, Lund, SE-223 62 (Sweden)

    2017-01-31

    The observation of heavy-ion-like behaviour in pp collisions at the LHC suggests that more physics mechanisms are at play than traditionally assumed. The introduction e.g. of quark-gluon plasma or colour rope formation can describe several of the observations, but as of yet there is no established paradigm. In this article we study a few possible modifications to the Pythia event generator, which describes a wealth of data but fails for a number of recent observations. Firstly, we present a new model for generating the transverse momentum of hadrons during the string fragmentation process, inspired by thermodynamics, where heavier hadrons naturally are suppressed in rate but obtain a higher average transverse momentum. Secondly, close-packing of strings is taken into account by making the temperature or string tension environment-dependent. Thirdly, a simple model for hadron rescattering is added. The effect of these modifications is studied, individually and taken together, and compared with data mainly from the LHC. While some improvements can be noted, it turns out to be nontrivial to obtain effects as big as required, and further work is called for.

  3. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  4. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

  5. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  6. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  7. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  8. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  9. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  10. Fragmentation functions approach in pQCD fragmentation phenomena

    International Nuclear Information System (INIS)

    Rolli, S.

    1996-07-01

    Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

  11. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  12. Gamma Radiation from Fission Fragments

    International Nuclear Information System (INIS)

    Higbie, Jack

    1969-10-01

    The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

  13. Gamma Radiation from Fission Fragments

    Energy Technology Data Exchange (ETDEWEB)

    Higbie, Jack

    1969-10-15

    The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

  14. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  15. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  16. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.

    2001-01-01

    We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

  17. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  18. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  19. QGP and Modified Jet Fragmentation

    International Nuclear Information System (INIS)

    Wang, Xin-Nian

    2005-01-01

    Recent progresses in the study of jet modification in hotmedium and their consequences in high-energy heavy-ion collisions are reviewed. In particular, I will discuss energy loss for propagating heavy quarks and the resulting modified fragmentation function. Medium modification of the parton fragmentation function due to quark recombination are formulated within finite temperature field theory and their implication on the search for deconfined quark-gluon plasma is also discussed

  20. Robust Object Tracking Using Valid Fragments Selection.

    Science.gov (United States)

    Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

    Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

  1. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  2. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  3. Fragmentation of rotating protostellar clouds

    International Nuclear Information System (INIS)

    Tohline, J.E.

    1980-01-01

    We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

  4. Memory effects in nuclear fragmentation?

    International Nuclear Information System (INIS)

    Colonna, M.; Di Toro, M.; Guarnera, A.

    1994-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

  5. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  6. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  7. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Baur, G.; Roesel, F.; Trautmann, D.; Shyam, R.

    1983-10-01

    Fragmentation processes in nuclear collisions are reviewed. The main emphasis is put on light ion breakup at nonrelativistic energies. The post- and prior-form DWBA theories are discussed. The post-form DWBA, appropriate for the ''spectator breakup'' describes elastic as well as inelastic breakup modes. This theory can also account for the stripping to unbound states. The theoretical models are compared to typical experimental results to illustrate the various possible mechanisms. It is discussed, how breakup reactions can be used to study high-lying single particle strength in the continuum; how it can yield information about momentum distributions of fragments in the nucleus. (orig.)

  8. Refolding Technologies for Antibody Fragments

    Directory of Open Access Journals (Sweden)

    Tsutomu Arakawa

    2014-05-01

    Full Text Available Refolding is one of the production technologies for pharmaceutical grade antibody fragments. Detergents and denaturants are primarily used to solubilize the insoluble proteins. The solubilized and denatured proteins are refolded by reducing the concentration of the denaturants or detergents. Several refolding technologies have been used for antibody fragments, comprising dilution, dialysis, solid phase solvent exchange and size exclusion chromatography, as reviewed here. Aggregation suppressor or folding-assisting agents, including arginine hydrochloride, ionic liquids and detergents or denaturants at low concentrations, are included in the refolding solvent to enhance refolding yield.

  9. Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

    Science.gov (United States)

    Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

    2017-12-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

  10. Fragmentation of atomic clusters: A theoretical study

    International Nuclear Information System (INIS)

    Lopez, M.J.; Jellinek, J.

    1994-01-01

    Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

  11. Nuclear energy release from fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

    2016-08-15

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  12. Fission fragment driven neutron source

    Science.gov (United States)

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  13. Developments in SPR Fragment Screening.

    Science.gov (United States)

    Chavanieu, Alain; Pugnière, Martine

    2016-01-01

    Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.

  14. Nuclear fragmentation by nucleation approach

    International Nuclear Information System (INIS)

    Chung, K.C.

    1992-01-01

    The nucleation model is used to simulate nuclear fragmentation processes. The critical value of the effective interaction radius is shown to vary linearly with the expansion factor α. The calculated mass and charge distributions are compared with some experimental data. (author)

  15. Neutron multiplicity of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Abdelrahman, Y S [Physics department, mu` rah university Al-Karak, (Jordan)

    1995-10-01

    The total average neutron multiplicity of the fission fragments produced by the spontaneous fission of {sup 248} Cm has been measured. This measurement has been done by using a new experimental technique. This technique mainly depends on {gamma}-{gamma} coincidence using a very high resolution high purity germanium (HPGe) detector. 2 figs.

  16. Fragmented nature: consequences for biodiversity

    NARCIS (Netherlands)

    Olff, H.; Ritchie, M.E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  17. Fragmented nature : consequences for biodiversity

    NARCIS (Netherlands)

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species

  18. Research of nuclear fragmentation characteristics

    International Nuclear Information System (INIS)

    Richert, J.

    1989-01-01

    Motivations for the study of nuclear fragmentation are presented. Different models and methods which were developed in the past are reviewed, critically discussed and confronted in connection with the experimental information gathered over the past years. Specific aspects related to the onset of the process, its characteristics and the mechanism which governs it are discussed [fr

  19. FRAGMENTED IDENTITIES: THE CULTURAL COLLISION ...

    African Journals Online (AJOL)

    User

    Born in the former French and German colony of. Togo, Komla-Ebri ... of how cultural barriers not only lead to isolation and fragmented identities, but also ..... and, in recreating bits of Italy, in the form of music, cinema and food, absorbs parts of ...

  20. Phthalocyanides sensitized fragmentation of proteins

    Czech Academy of Sciences Publication Activity Database

    Klementová, S.; Tothová, D.; Revaková, R.; Kasková, M.; Wagnerová, Dana Marie

    2001-01-01

    Roč. 5, č. 1 (2001), s. 13-18 ISSN 0972-0626 R&D Projects: GA ČR GA203/96/1322 Institutional research plan: CEZ:AV0Z4032918 Keywords : phthalocyanides * photosensitied fragmentation of proteins Subject RIV: CA - Inorganic Chemistry

  1. The VERDI fission fragment spectrometer

    Directory of Open Access Journals (Sweden)

    Frégeau M.O.

    2013-12-01

    Full Text Available The VERDI time-of-flight spectrometer is dedicated to measurements of fission product yields and of prompt neutron emission data. Pre-neutron fission-fragment masses will be determined by the double time-of-flight (TOF technique. For this purpose an excellent time resolution is required. The time of flight of the fragments will be measured by electrostatic mirrors located near the target and the time signal coming from silicon detectors located at 50 cm on both sides of the target. This configuration, where the stop detector will provide us simultaneously with the kinetic energy of the fragment and timing information, significantly limits energy straggling in comparison to legacy experimental setup where a thin foil was usually used as a stop detector. In order to improve timing resolution, neutron transmutation doped silicon will be used. The high resistivity homogeneity of this material should significantly improve resolution in comparison to standard silicon detectors. Post-neutron fission fragment masses are obtained form the time-of-flight and the energy signal in the silicon detector. As an intermediary step a diamond detector will also be used as start detector located very close to the target. Previous tests have shown that poly-crystalline chemical vapour deposition (pCVD diamonds provides a coincidence time resolution of 150 ps not allowing complete separation between very low-energy fission fragments, alpha particles and noise. New results from using artificial single-crystal diamonds (sCVD show similar time resolution as from pCVD diamonds but also sufficiently good energy resolution.

  2. Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

    International Nuclear Information System (INIS)

    Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

    1983-01-01

    Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

  3. Fragments

    Science.gov (United States)

    Moreira, Claudio

    2008-01-01

    This performance autoethnography shows the author's struggle in finding his place, scholarship, voice, and body, into the academic setting. Mixing together memories of his lived experience with sugar cane workers, notes, and leftovers of different fieldworks, plus 6 years of life as grad student at the University of Illinois, the author looks for…

  4. Fragmentation

    Science.gov (United States)

    K.H. Riitters

    2009-01-01

    Effective resource management takes into account the administrative and biophysical settings within which natural resources occur. A setting may be described in many ways; for example, by forest land ownership, by reserved and roadless designation, or by the distribution of human populations in relation to forest (chapter 3). The physical arrangement of forest in a...

  5. Energy production using fission fragment rockets

    International Nuclear Information System (INIS)

    Chapline, G.; Matsuda, Y.

    1991-08-01

    Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

  6. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  7. Fragmentation of suddenly heated liquids

    International Nuclear Information System (INIS)

    Blink, J.A.

    1985-03-01

    Fragmentation of free liquids in Inertial Confinement Fusion reactors could determine the upper bound on reactor pulse rate. The x-ray ablated materials must cool and recondense to allow driver beam propagation. The increased surface area caused by fragmentation will enhance the cooling and condensation rates. Relaxation from the suddenly heated state will move a liquid into the negative pressure region under the liquid-vapor P-V dome. The lithium equation of state was used to demonstrate that neutron-induced vaporization uses only a minor fraction of the added heat, much less than would be required to drive the expansion. A 77% expansion of the lithium is required before the rapid vaporization process of spinodal decomposition could begin, and nucleation and growth are too slow to contribute to the expansion

  8. Fragment separator momentum compression schemes

    Energy Technology Data Exchange (ETDEWEB)

    Bandura, Laura, E-mail: bandura@anl.gov [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Erdelyi, Bela [Argonne National Laboratory, Argonne, IL 60439 (United States); Northern Illinois University, DeKalb, IL 60115 (United States); Hausmann, Marc [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Kubo, Toshiyuki [RIKEN Nishina Center, RIKEN, Wako (Japan); Nolen, Jerry [Argonne National Laboratory, Argonne, IL 60439 (United States); Portillo, Mauricio [Facility for Rare Isotope Beams (FRIB), 1 Cyclotron, East Lansing, MI 48824-1321 (United States); Sherrill, Bradley M. [National Superconducting Cyclotron Lab, Michigan State University, 1 Cyclotron, East Lansing, MI 48824-1321 (United States)

    2011-07-21

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  9. Fragment separator momentum compression schemes

    International Nuclear Information System (INIS)

    Bandura, Laura; Erdelyi, Bela; Hausmann, Marc; Kubo, Toshiyuki; Nolen, Jerry; Portillo, Mauricio; Sherrill, Bradley M.

    2011-01-01

    We present a scheme to use a fragment separator and profiled energy degraders to transfer longitudinal phase space into transverse phase space while maintaining achromatic beam transport. The first order beam optics theory of the method is presented and the consequent enlargement of the transverse phase space is discussed. An interesting consequence of the technique is that the first order mass resolving power of the system is determined by the first dispersive section up to the energy degrader, independent of whether or not momentum compression is used. The fragment separator at the Facility for Rare Isotope Beams is a specific application of this technique and is described along with simulations by the code COSY INFINITY.

  10. Asymmetry effects in fragment production

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manpreet [Sri Guru Granth Sahib World University, Fatehgarh Sahib-140406, Punjab (India); Kaur, Varinderjit, E-mail: drvarinderjit@gmail.com [Mata Gujri College, Fatehgarh Sahib-140406, Punjab (India)

    2016-05-06

    The production of different fragments has been studied by taking into account the mass asymmetry of the reaction and employing the momentum dependent interactions. Two different set of asymmetric reactions have been analyzed while keeping At{sub otal} fixed using soft momentum dependent equation of state. Our results indicate that the impact of momentum dependent interactions is different in lighter projectile systems as compared to heavier ones. The comparative analysis of IQMD simulations with the experimental data in case of heavier projectile and lighter target system for the reaction of {sup 197}Au+{sup 27}Al (η = 0.7) at E = 600 MeV/nucleon shows that with the inclusion of MDI we are able, upto some extent, to reproduce the experimental universality of rise and fall of intermediate mass fragments (IMFs).

  11. Fragmentation of percolation cluster perimeters

    Science.gov (United States)

    Debierre, Jean-Marc; Bradley, R. Mark

    1996-05-01

    We introduce a model for the fragmentation of porous random solids under the action of an external agent. In our model, the solid is represented by a bond percolation cluster on the square lattice and bonds are removed only at the external perimeter (or `hull') of the cluster. This model is shown to be related to the self-avoiding walk on the Manhattan lattice and to the disconnection events at a diffusion front. These correspondences are used to predict the leading and the first correction-to-scaling exponents for several quantities defined for hull fragmentation. Our numerical results support these predictions. In addition, the algorithm used to construct the perimeters reveals itself to be a very efficient tool for detecting subtle correlations in the pseudo-random number generator used. We present a quantitative test of two generators which supports recent results reported in more systematic studies.

  12. Fragmented nature: consequences for biodiversity

    OpenAIRE

    Olff, Han; Ritchie, Mark E.

    2002-01-01

    We discuss how fragmentation of resources and habitat operate differently on species diversity across spatial scales, ranging from positive effects on local species coexistence to negative effect on intermediate spatial scales, to again positive effects on large spatial and temporal scales. Species with different size and mobility can be regulated by different processes at the same spatial scale, a principle that may contribute to diversity. Differences in species richness between local commu...

  13. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  14. Intermittency in 197Au fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Holynski, R.; Olszewski, A.; Szarska, M.; Wilczynska, B.; Wolter, W.; Wosiek, B.; Cherry, M.L.; Deines-Jones, P.; Jones, W.V.; Sengupta, K.; Wefel, B.

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs

  15. Residual Fragments after Percutaneous Nephrolithotomy

    Directory of Open Access Journals (Sweden)

    Kaan Özdedeli

    2012-09-01

    Full Text Available Clinically insignificant residual fragments (CIRFs are described as asymptomatic, noninfectious and nonobstructive stone fragments (≤4 mm remaining in the urinary system after the last session of any intervention (ESWL, URS or PCNL for urinary stones. Their insignificance is questionable since CIRFs could eventually become significant, as their presence may result in recurrent stone growth and they may cause pain and infection due to urinary obstruction. They may become the source of persistent infections and a significant portion of the patients will have a stone-related event, requiring auxilliary interventions. CT seems to be the ultimate choice of assessment. Although there is no concensus about the timing, recent data suggests that it may be performed one month after the procedure. However, imaging can be done in the immediate postoperative period, if there are no tubes blurring the assessment. There is some evidence indicating that selective medical therapy may have an impact on decreasing stone formation rates. Retrograde intrarenal surgery, with its minimally invasive nature, seems to be the best way to deal with residual fragments.

  16. Fragmentation measurement using image processing

    Directory of Open Access Journals (Sweden)

    Farhang Sereshki

    2016-12-01

    Full Text Available In this research, first of all, the existing problems in fragmentation measurement are reviewed for the sake of its fast and reliable evaluation. Then, the available methods used for evaluation of blast results are mentioned. The produced errors especially in recognizing the rock fragments in computer-aided methods, and also, the importance of determination of their sizes in the image analysis methods are described. After reviewing the previous work done, an algorithm is proposed for the automated determination of rock particles’ boundary in the Matlab software. This method can determinate automatically the particles boundary in the minimum time. The results of proposed method are compared with those of Split Desktop and GoldSize software in two automated and manual states. Comparing the curves extracted from different methods reveals that the proposed approach is accurately applicable in measuring the size distribution of laboratory samples, while the manual determination of boundaries in the conventional software is very time-consuming, and the results of automated netting of fragments are very different with the real value due to the error in separation of the objects.

  17. Fragmentation reduces regional-scale spatial genetic structure in a wind-pollinated tree because genetic barriers are removed.

    Science.gov (United States)

    Wang, Rong; Compton, Stephen G; Shi, Yi-Su; Chen, Xiao-Yong

    2012-09-01

    Gene flow strongly influences the regional genetic structuring of plant populations. Seed and pollen dispersal patterns can respond differently to the increased isolation resulting from habitat fragmentation, with unpredictable consequences for gene flow and population structuring. In a recently fragmented landscape we compared the pre- and post-fragmentation genetic structure of populations of a tree species where pollen and seed dispersal respond differentially to forest fragmentation generated by flooding. Castanopsis sclerophylla is wind-pollinated, with seeds that are dispersed by gravity and rodents. Using microsatellites, we found no significant difference in genetic diversity between pre- and post-fragmentation cohorts. Significant genetic structure was observed in pre-fragmentation cohorts, due to an unknown genetic barrier that had isolated one small population. Among post-fragmentation cohorts this genetic barrier had disappeared and genetic structure was significantly weakened. The strengths of genetic structuring were at a similar level in both cohorts, suggesting that overall gene flow of C. sclerophylla has been unchanged by fragmentation at the regional scale. Fragmentation has blocked seed dispersal among habitats, but this appears to have been compensated for by enhanced pollen dispersal, as indicated by the disappearance of a genetic barrier, probably as a result of increased wind speeds and easier pollen movement over water. Extensive pollen flow can counteract some negative effects of fragmentation and assist the long-term persistence of small remnant populations.

  18. Fluoxetine normalizes disrupted light-induced entrainment, fragmented ultradian rhythms and altered hippocampal clock gene expression in an animal model of high trait anxiety- and depression-related behavior.

    Science.gov (United States)

    Schaufler, Jörg; Ronovsky, Marianne; Savalli, Giorgia; Cabatic, Maureen; Sartori, Simone B; Singewald, Nicolas; Pollak, Daniela D

    2016-01-01

    Disturbances of circadian rhythms are a key symptom of mood and anxiety disorders. Selective serotonin reuptake inhibitors (SSRIs) - commonly used antidepressant drugs - also modulate aspects of circadian rhythmicity. However, their potential to restore circadian disturbances in depression remains to be investigated. The effects of the SSRI fluoxetine on genetically based, depression-related circadian disruptions at the behavioral and molecular level were examined using mice selectively bred for high anxiety-related and co-segregating depression-like behavior (HAB) and normal anxiety/depression behavior mice (NAB). The length of the circadian period was increased in fluoxetine-treated HAB as compared to NAB mice while the number of activity bouts and light-induced entrainment were comparable. No difference in hippocampal Cry2 expression, previously reported to be dysbalanced in untreated HAB mice, was observed, while Per2 and Per3 mRNA levels were higher in HAB mice under fluoxetine treatment. The present findings provide evidence that fluoxetine treatment normalizes disrupted circadian locomotor activity and clock gene expression in a genetic mouse model of high trait anxiety and depression. An interaction between the molecular mechanisms mediating the antidepressant response to fluoxetine and the endogenous regulation of circadian rhythms in genetically based mood and anxiety disorders is proposed.

  19. Geometrical scaling of jet fragmentation photons

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

    2016-12-15

    We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

  20. Evolution equations for extended dihadron fragmentation functions

    International Nuclear Information System (INIS)

    Ceccopieri, F.A.; Bacchetta, A.

    2007-03-01

    We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

  1. Polarization and alignment of nucleus fission fragments

    International Nuclear Information System (INIS)

    Barabanov, A.L.; Grechukhin, D.P.

    1987-01-01

    Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

  2. Photon-hadron fragmentation: theoretical situation

    International Nuclear Information System (INIS)

    Peschanski, R.

    1983-07-01

    Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

  3. Scaling and critical behaviour in nuclear fragmentation

    International Nuclear Information System (INIS)

    Campi, X.

    1990-09-01

    These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

  4. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  5. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  6. Self-organized criticality in fragmenting

    DEFF Research Database (Denmark)

    Oddershede, L.; Dimon, P.; Bohr, J.

    1993-01-01

    The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

  7. Neighbouring charge fragmentations in low energy fission

    International Nuclear Information System (INIS)

    Montoya, M.

    1986-10-01

    Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

  8. Fission fragment excited laser system

    Science.gov (United States)

    McArthur, David A.; Tollefsrud, Philip B.

    1976-01-01

    A laser system and method for exciting lasing action in a molecular gas lasing medium which includes cooling the lasing medium to a temperature below about 150 K and injecting fission fragments through the lasing medium so as to preferentially excite low lying vibrational levels of the medium and to cause population inversions therein. The cooled gas lasing medium should have a mass areal density of about 5 .times. 10.sup.-.sup.3 grams/square centimeter, relaxation times of greater than 50 microseconds, and a broad range of excitable vibrational levels which are excitable by molecular collisions.

  9. Fragment emission from modestly excited nuclear systems

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

    1996-07-08

    Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

  10. Velocity distribution of fragments of catastrophic impacts

    Science.gov (United States)

    Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

    1992-01-01

    Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

  11. Models of fragmentation with composite power laws

    Science.gov (United States)

    Tavassoli, Z.; Rodgers, G. J.

    1999-06-01

    Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

  12. Extraction of 16th Century Calender Fragments

    DEFF Research Database (Denmark)

    Holck, Jakob Povl; Etheridge, Christian

    at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

  13. The formation of planets by disc fragmentation

    Directory of Open Access Journals (Sweden)

    Stamatellos Dimitris

    2013-04-01

    Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

  14. Reframing landscape fragmentation's effects on ecosystem services.

    Science.gov (United States)

    Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

    2015-04-01

    Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

    Science.gov (United States)

    Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

    2016-05-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

  16. Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

    Science.gov (United States)

    Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

    2016-01-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

  17. Revisiting the Lund Fragmentation Model

    International Nuclear Information System (INIS)

    Andersson, B.; Nilsson, A.

    1992-10-01

    We present a new method to implement the Lund Model fragmentation distributions for multi-gluon situations. The method of Sjoestrand, implemented in the well-known Monte Carlo simulation program JETSET, is robust and direct and according to his findings there are no observable differences between different ways to implement his scheme. His method can be described as a space-time method because the breakup proper time plays a major role. The method described in this paper is built on energy-momentum space methods. We make use of the χ-curve, which is defined directly from the energy momentum vectors of the partons. We have shown that the χ-curve describes the breakup properties and the final state energy momentum distributions in the mean. We present a method to find the variations around the χ-curve, which also implements the basic Lund Model fragmentation distributions (the area-law and the corresponding iterative cascade). We find differences when comparing the corresponding Monte Carlo implementation REVJET to the JETSET distributions inside the gluon jets. (au)

  18. Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

    1999-09-01

    In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

  19. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  20. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  1. Knowledge-based Fragment Binding Prediction

    Science.gov (United States)

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  2. Fragmentation of Ceramics in Rapid Expansion Mode

    Science.gov (United States)

    Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

    The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

  3. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  4. Dynamic effects in fragmentation reactions

    International Nuclear Information System (INIS)

    Bertsch, G. F.; Esbensen, H.

    2002-01-01

    Fragmentation reactions offer a useful tool to study the spectroscopy of halo nuclei, but the large extent of the halo wave function makes the reaction theory more difficult. The simple reaction models based on the eikonal approximation for the nuclear interaction or first-order perturbation theory for the Coulomb interaction have systematic errors that they investigate here, comparing to the predictions of complete dynamical calculations. They find that stripping probabilities are underpredicted by the eikonal model, leading to extracted spectroscopy strengths that are two large. In contrast, the Coulomb excitation is overpredicted by the simple theory. They attribute this to a screening effect, as is well known in the Barkas effect on stopping powers. The errors decrease with beam energy as E(sub beam)(sup -1), and are not significant at beam energies above 50 MeV/u. At lower beam energies, the effects should be taken into account when extracting quantitative spectroscopic strengths

  5. Impact failure and fragmentation properties of metals

    Energy Technology Data Exchange (ETDEWEB)

    Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

    1998-03-01

    In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  6. Fragmentation and flow in central collisions

    International Nuclear Information System (INIS)

    Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

    1987-01-01

    Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

  7. Gallstone fragmentation by control electrohydraulic lithotripsy

    International Nuclear Information System (INIS)

    Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

    1989-01-01

    The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

  8. Complex fragment emission from hot compound nuclei

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1986-03-01

    The experimental evidence for compound nucleus emission of complex fragments at low energies is used to interpret the emission of the same fragments at higher energies. The resulting experimental picture is that of highly excited compound nuclei formed in incomplete fusion processes which decay statistically. In particular, complex fragments appear to be produced mostly through compound nucleus decay. In the appendix a geometric-kinematic theory for incomplete fusion and the associated momentum transfer is outlined. 10 refs., 19 figs

  9. Fragment Size Distribution of Blasted Rock Mass

    Science.gov (United States)

    Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

    2017-12-01

    Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

  10. Fragmentation of neck-like structures

    International Nuclear Information System (INIS)

    Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

    1994-01-01

    Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

  11. Fragment-based approaches to TB drugs.

    Science.gov (United States)

    Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris

    2018-02-01

    Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.

  12. Gluon fragmentation in T(1S) decays

    International Nuclear Information System (INIS)

    Bienlein, J.K.

    1983-05-01

    In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

  13. Measuring the temperature of hot nuclear fragments

    International Nuclear Information System (INIS)

    Wuenschel, S.; Bonasera, A.; May, L.W.; Souliotis, G.A.; Tripathi, R.; Galanopoulos, S.; Kohley, Z.; Hagel, K.; Shetty, D.V.; Huseman, K.; Soisson, S.N.; Stein, B.C.; Yennello, S.J.

    2010-01-01

    A new thermometer based on fragment momentum fluctuations is presented. This thermometer exhibited residual contamination from the collective motion of the fragments along the beam axis. For this reason, the transverse direction has been explored. Additionally, a mass dependence was observed for this thermometer. This mass dependence may be the result of the Fermi momentum of nucleons or the different properties of the fragments (binding energy, spin, etc.) which might be more sensitive to different densities and temperatures of the exploding fragments. We expect some of these aspects to be smaller for protons (and/or neutrons); consequently, the proton transverse momentum fluctuations were used to investigate the temperature dependence of the source.

  14. Kinetics of fragmentation-annihilation processes

    OpenAIRE

    Filipe, JAN; Rodgers, GJ

    1996-01-01

    We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

  15. Gene fragmentation: a key to mitochondrial genome evolution in Euglenozoa?

    Czech Academy of Sciences Publication Activity Database

    Flegontov, Pavel; Gray, M.W.; Burger, G.; Lukeš, Julius

    2011-01-01

    Roč. 57, č. 4 (2011), 225-232 ISSN 0172-8083 Institutional research plan: CEZ:AV0Z60220518 Keywords : Euglena * Diplonema * Mitochondrial genome * RNA editing * Constructive neutral evolution Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.556, year: 2011

  16. Mechanisms Affecting Population Density in Fragmented Habitat

    Directory of Open Access Journals (Sweden)

    Lutz Tischendorf

    2005-06-01

    Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

  17. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  18. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  19. Parton fragmentation and string dynamics

    International Nuclear Information System (INIS)

    Andersson, B.; Gustafson, G.; Ingelman, G.; Sjoestrand, T.

    1983-01-01

    While much has been learned recently about quark and gluon interactions in the framework of perturbative Quantum Chromodynamics, the relation between calculated parton properties and observed hadron densities involves models where dynamics and jet empirical rules have to be combined. The purpose of this article is to describe a presently successful approach which is based on a cascade jet model using String dynamics. It can readily lead to Monte Carlo jet programmes of great use when analyzing data. Production processes in an iterative cascade approach, with tunneling in a constant force field, are reviewed. Expected differences between quark and gluon jets are discussed. Low transverse momentum phenomena are also reviewed with emphasis on hyperon polarization. In so far as this approach uses a fragmentation scheme based on String dynamics, it was deemed appropriate to also include under the same cover a special report on the Classical theory of relativistic Strings, seen as the classical limit of the Dual Resonance model. The Equations of motion and interaction among strings are presented. (orig.)

  20. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  1. Baculovirus display of functional antibody Fab fragments.

    Science.gov (United States)

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

  2. Fragmentation of eastern United States forest types

    Science.gov (United States)

    Kurt H. Riitters; John W. Coulston

    2013-01-01

    Fragmentation is a continuing threat to the sustainability of forests in the Eastern United States, where land use changes supporting a growing human population are the primary driver of forest fragmentation (Stein and others 2009). While once mostly forested, approximately 40 percent of the original forest area has been converted to other land uses, and most of the...

  3. Thermodynamics of the fuel fragmentation gas

    International Nuclear Information System (INIS)

    Perez, R.B.; Alsmiller, R.G. Jr.

    1977-01-01

    In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

  4. Momentum sum rules for fragmentation functions

    International Nuclear Information System (INIS)

    Meissner, S.; Metz, A.; Pitonyak, D.

    2010-01-01

    Momentum sum rules for fragmentation functions are considered. In particular, we give a general proof of the Schaefer-Teryaev sum rule for the transverse momentum dependent Collins function. We also argue that corresponding sum rules for related fragmentation functions do not exist. Our model-independent analysis is supplemented by calculations in a simple field-theoretical model.

  5. A note on convex renorming and fragmentability

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Using the game approach to fragmentability, we give new and simpler proofs of the following known results: (a) If the Banach space admits an equivalent. Kadec norm, then its weak topology is fragmented by a metric which is stronger than the norm topology. (b) If the Banach space admits an equivalent rotund ...

  6. Temperatures of fragment kinetic energy spectra

    International Nuclear Information System (INIS)

    Bauer, W.

    1995-01-01

    Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework

  7. Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

    Science.gov (United States)

    David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

    2010-01-01

    Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

  8. Current fragmentation in deep inelastic scattering

    International Nuclear Information System (INIS)

    Hamer, C.J.

    1975-04-01

    It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

  9. The politics of municipal fragmentation in Ghana

    Directory of Open Access Journals (Sweden)

    Abdulai Kuyini Mohammed

    2015-06-01

    Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.

  10. Graph Theory. 1. Fragmentation of Structural Graphs

    Directory of Open Access Journals (Sweden)

    Lorentz JÄNTSCHI

    2002-12-01

    Full Text Available The investigation of structural graphs has many fields of applications in engineering, especially in applied sciences like as applied chemistry and physics, computer sciences and automation, electronics and telecommunication. The main subject of the paper is to express fragmentation criteria in graph using a new method of investigation: terminal paths. Using terminal paths are defined most of the fragmentation criteria that are in use in molecular topology, but the fields of applications are more generally than that, as I mentioned before. Graphical examples of fragmentation are given for every fragmentation criteria. Note that all fragmentation is made with a computer program that implements a routine for every criterion.[1] A web routine for tracing all terminal paths in graph can be found at the address: http://vl.academicdirect.ro/molecular_topology/tpaths/ [1] M. V. Diudea, I. Gutman, L. Jäntschi, Molecular Topology, Nova Science, Commack, New York, 2001, 2002.

  11. Sustained sleep fragmentation induces sleep homeostasis in mice

    KAUST Repository

    Baud, Maxime O.; Magistretti, Pierre J.; Petit, Jean Marie

    2015-01-01

    Study Objectives: Sleep fragmentation (SF) is an integral feature of sleep apnea and other prevalent sleep disorders. Although the effect of repetitive arousals on cognitive performance is well documented, the effects of long-term SF on electroencephalography (EEG) and molecular markers of sleep homeostasis remain poorly investigated. To address this question, we developed a mouse model of chronic SF and characterized its effect on EEG spectral frequencies and the expression of genes previously linked to sleep homeostasis including clock genes, heat shock proteins, and plasticity-related genes. Design: N/A. Setting: Animal sleep research laboratory. Participants : Sixty-six C57BL6/J adult mice. Interventions: Instrumental sleep disruption at a rate of 60/h during 14 days Measurements and Results: Locomotor activity and EEG were recorded during 14 days of SF followed by recovery for 2 days. Despite a dramatic number of arousals and decreased sleep bout duration, SF minimally reduced total quantity of sleep and did not significantly alter its circadian distribution. Spectral analysis during SF revealed a homeostatic drive for slow wave activity (SWA; 1-4 Hz) and other frequencies as well (4-40 Hz). Recordings during recovery revealed slow wave sleep consolidation and a transient rebound in SWA, and paradoxical sleep duration. The expression of selected genes was not induced following chronic SF. Conclusions: Chronic sleep fragmentation (SF) increased sleep pressure confirming that altered quality with preserved quantity triggers core sleep homeostasis mechanisms. However, it did not induce the expression of genes induced by sleep loss, suggesting that these molecular pathways are not sustainably activated in chronic diseases involving SF.

  12. Sustained sleep fragmentation induces sleep homeostasis in mice

    KAUST Repository

    Baud, Maxime O.

    2015-04-01

    Study Objectives: Sleep fragmentation (SF) is an integral feature of sleep apnea and other prevalent sleep disorders. Although the effect of repetitive arousals on cognitive performance is well documented, the effects of long-term SF on electroencephalography (EEG) and molecular markers of sleep homeostasis remain poorly investigated. To address this question, we developed a mouse model of chronic SF and characterized its effect on EEG spectral frequencies and the expression of genes previously linked to sleep homeostasis including clock genes, heat shock proteins, and plasticity-related genes. Design: N/A. Setting: Animal sleep research laboratory. Participants : Sixty-six C57BL6/J adult mice. Interventions: Instrumental sleep disruption at a rate of 60/h during 14 days Measurements and Results: Locomotor activity and EEG were recorded during 14 days of SF followed by recovery for 2 days. Despite a dramatic number of arousals and decreased sleep bout duration, SF minimally reduced total quantity of sleep and did not significantly alter its circadian distribution. Spectral analysis during SF revealed a homeostatic drive for slow wave activity (SWA; 1-4 Hz) and other frequencies as well (4-40 Hz). Recordings during recovery revealed slow wave sleep consolidation and a transient rebound in SWA, and paradoxical sleep duration. The expression of selected genes was not induced following chronic SF. Conclusions: Chronic sleep fragmentation (SF) increased sleep pressure confirming that altered quality with preserved quantity triggers core sleep homeostasis mechanisms. However, it did not induce the expression of genes induced by sleep loss, suggesting that these molecular pathways are not sustainably activated in chronic diseases involving SF.

  13. Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

    Directory of Open Access Journals (Sweden)

    S. C. Oukouomi Noutchie

    2014-01-01

    Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

  14. Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

    Science.gov (United States)

    2012-01-01

    The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

  15. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  17. Dual Fragment Impact of PBX Charges

    Science.gov (United States)

    Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

    2017-06-01

    Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

  18. Introduction to fragment-based drug discovery.

    Science.gov (United States)

    Erlanson, Daniel A

    2012-01-01

    Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.

  19. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  20. Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

    Science.gov (United States)

    Lirman

    2000-08-23

    Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

  1. HETC-3STEP included fragmentation process

    Energy Technology Data Exchange (ETDEWEB)

    Shigyo, Nobuhiro; Iga, Kiminori; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering

    1997-03-01

    High Energy Transport Code (HETC) based on the cascade-evaporation model is modified to calculate the fragmentation cross section. For the cascade process, nucleon-nucleon cross sections are used for collision computation; effective in-medium-corrected cross sections are adopted instead of the original free-nucleon collision. The exciton model is adopted for improvement of backward nucleon-emission cross section for low-energy nucleon-incident events. The fragmentation reaction is incorporated into the original HETC as a subroutine set by the use of the systematics of the reaction. The modified HETC (HETC-3STEP/FRG) reproduces experimental fragment yields to a reasonable degree. (author)

  2. Heart Rate Fragmentation: A Symbolic Dynamical Approach

    Directory of Open Access Journals (Sweden)

    Madalena D. Costa

    2017-11-01

    Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

  3. Gluon fragmentation into 3 PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1995-01-01

    The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

  4. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2003-01-01

    Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

  5. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  6. Aspect Ratio Dependence of Impact Fragmentation

    International Nuclear Information System (INIS)

    Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.

    1997-01-01

    A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society

  7. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2005-01-01

    Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

  8. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  9. Dihadron fragmentation function and its evolution

    International Nuclear Information System (INIS)

    Majumder, A.; Wang Xinnian

    2004-01-01

    Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest

  10. A Current Logical Framework: The Propositional Fragment

    National Research Council Canada - National Science Library

    Watkins, Kevin

    2003-01-01

    We present the propositional fragment CLF of the Concurrent Logical Framework (CLF). CLF extends the Linear Logical Framework to allow the natural representation of concurrent computations in an object language...

  11. Integration of fragment screening and library design.

    Science.gov (United States)

    Siegal, Gregg; Ab, Eiso; Schultz, Jan

    2007-12-01

    With more than 10 years of practical experience and theoretical analysis, fragment-based drug discovery (FBDD) has entered the mainstream of the pharmaceutical and biotech industries. An array of biophysical techniques has been used to detect the weak interaction between a fragment and the target. Each technique presents its own requirements regarding the fragment collection and the target; therefore, in order to optimize the potential of FBDD, the nature of the target should be a driving factor for simultaneous development of both the library and the screening technology. A roadmap is now available to guide fragment-to-lead evolution when structural information is available. The next challenge is to apply FBDD to targets for which high-resolution structural information is not available.

  12. An improved algorithm for MFR fragment assembly

    International Nuclear Information System (INIS)

    Kontaxis, Georg

    2012-01-01

    A method for generating protein backbone models from backbone only NMR data is presented, which is based on molecular fragment replacement (MFR). In a first step, the PDB database is mined for homologous peptide fragments using experimental backbone-only data i.e. backbone chemical shifts (CS) and residual dipolar couplings (RDC). Second, this fragment library is refined against the experimental restraints. Finally, the fragments are assembled into a protein backbone fold using a rigid body docking algorithm using the RDCs as restraints. For improved performance, backbone nuclear Overhauser effects (NOEs) may be included at that stage. Compared to previous implementations of MFR-derived structure determination protocols this model-building algorithm offers improved stability and reliability. Furthermore, relative to CS-ROSETTA based methods, it provides faster performance and straightforward implementation with the option to easily include further types of restraints and additional energy terms.

  13. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  14. Quark fragmentation into 3PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1996-01-01

    The functions of parton fragmentation into 3 P J quarkonium at order α 2 s are calculated, where the parton can be a heavy or a light quark. The obtained functions explicitly satisfy the Altarelli-Parisi equation and they are divergent, behaving as z -1 near z = O. However, if one choses the renormalization scale as twice of the heavy quark mass, the fragmentation functions are regular over the whole range of z. 15 refs., 2 figs

  15. The lund Monte Carlo for jet fragmentation

    International Nuclear Information System (INIS)

    Sjoestrand, T.

    1982-03-01

    We present a Monte Carlo program based on the Lund model for jet fragmentation. Quark, gluon, diquark and hadron jets are considered. Special emphasis is put on the fragmentation of colour singlet jet systems, for which energy, momentum and flavour are conserved explicitly. The model for decays of unstable particles, in particular the weak decay of heavy hadrons, is described. The central part of the paper is a detailed description on how to use the FORTRAN 77 program. (Author)

  16. Fragmentation of Continental United States Forests

    Science.gov (United States)

    Kurt H. Riitters; James D. Wickham; Robert V. O' Neill; K. Bruce Jones; Elizabeth R. Smith; John W. Coulston; Timothy G. Wade; Jonathan H. Smith

    2002-01-01

    We report a multiple-scale analysis of forest fragmentation based on 30-m (0.09 ha pixel-1) land- cover maps for the conterminous United States. Each 0.09-ha unit of forest was classified according to fragmentation indexes measured within the surrounding landscape, for five landscape sizes including 2.25, 7.29, 65.61, 590.49, and 5314.41 ha....

  17. Association of transforming growth factor-ß3 gene polymorphism ...

    African Journals Online (AJOL)

    Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

  18. DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

    African Journals Online (AJOL)

    The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

  19. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  20. Microstructural characterization of pipe bomb fragments

    International Nuclear Information System (INIS)

    Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher

    2010-01-01

    Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.

  1. Fragmentation of molten core material by sodium

    International Nuclear Information System (INIS)

    Chu, T.Y.

    1982-01-01

    A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed

  2. Species- and sex-specific connectivity effects of habitat fragmentation in a suite of woodland birds.

    Science.gov (United States)

    Amos, Nevil; Harrisson, Katherine A; Radford, James Q; White, Matt; Newell, Graeme; Mac Nally, Ralph; Sunnucks, Paul; Pavlova, Alexandra

    2014-06-01

    Loss of functional connectivity following habitat loss and fragmentation could drive species declines. A comprehensive understanding of fragmentation effects on functional connectivity of an ecological assemblage requires investigation of multiple species with different mobilities, at different spatial scales, for each sex, and in different landscapes. Based on published data on mobility and ecological responses to fragmentation of 10 woodland-dependent birds, and using simulation studies, we predicted that (1) fragmentation would impede dispersal and gene flow of eight "decliners" (species that disappear from suitable patches when landscape-level tree cover falls below species-specific thresholds), but not of two "tolerant" species (whose occurrence in suitable habitat patches is independent of landscape tree cover); and that fragmentation effects would be stronger (2) in the least mobile species, (3) in the more philopatric sex, and (4) in the more fragmented region. We tested these predictions by evaluating spatially explicit isolation-by-landscape-resistance models of gene flow in fragmented landscapes across a 50 x 170 km study area in central Victoria, Australia, using individual and population genetic distances. To account for sex-biased dispersal and potential scale- and configuration-specific effects, we fitted models specific to sex and geographic zones. As predicted, four of the least mobile decliners showed evidence of reduced genetic connectivity. The responses were strongly sex specific, but in opposite directions in the two most sedentary species. Both tolerant species and (unexpectedly) four of the more mobile decliners showed no reduction in gene flow. This is unlikely to be due to time lags because more mobile species develop genetic signatures of fragmentation faster than do less mobile ones. Weaker genetic effects were observed in the geographic zone with more aggregated vegetation, consistent with gene flow being unimpeded by landscape

  3. Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

    Science.gov (United States)

    Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

    2015-01-01

    Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

  4. DETECÇÃO DO COMPLEXO Mycobacterium tuberculosis NO LEITE PELA REAÇÃO EM CADEIA DA POLIMERASE SEGUIDA DE ANÁLISE DE RESTRIÇÃO DO FRAGMENTO AMPLIFICADO (PRA DETECTION OF Mycobacterium tuberculosis COMPLEX BY PCR-RESTRICTION FRAGMENT LENGTH POLYMORFISM ANALYSIS OF THE HSP65 GENE

    Directory of Open Access Journals (Sweden)

    Joab Trajano Silva

    2008-12-01

    , up to species level, is time consuming and difficult. In this work, the objective was to standardize a polymerase chain reaction followed by an enzyme restriction analysis in order to identify the M. tuberculosis complex in milk, without a microbiological isolation step. Reference strains and raw milk seeded with M. Bovis, were used as the starting material.  A 441pb fragment of the hsp65 gene was amplified and digested by two restriction enzymes BstEII and HaeIII. The obtained profile was used to identify the M. tuberculosis complex in milk. The minimum limit of detection of M. bovis in milk was 10CFU/mL. PRA methodology proved to be a specific and sensible method. It can be used to assist the microbiological and biochemical methods commonly used to identifying the bacilli in clinical samples, as milk 

    Key word: Detection limit (PRA, Mycobacterium tuberculosis complex, milk Mycobacterium bovis, Restriction Enzyme Analysis (PCR,

  5. Evaluation of radioiodinated and radiocopper labeled monovalent fragments of monoclonal antibody chCE7 for targeting of neuroblastoma

    International Nuclear Information System (INIS)

    Carrel, Francois; Amstutz, Hanspeter; Novak-Hofer, Ilse; Schubiger, P. August

    1997-01-01

    Monovalent fragments of antineuroblastoma antibody mAb chCE7 were evaluated for their in vitro and in vivo tumor cell binding properties. Single chain fragments were constructed from the variable region genes cloned from hybridoma cells, expressed in E.coli and purified by metal chelate affinity chromatography. Radioiodinated CE7-scFv fragments were found to bind with high affinity (K d ∼10 -9 M) to target cells in vitro but formed aggregates at 37 deg. C, and bound to serum proteins in vitro and in vivo. Circular Dichroism spectra revealed the protein to be in a conformationally altered form and no permanent 'refolding' could be achieved. In contrast, chCE7-Fab fragments were found to bind to target tumor cells with similar affinity than the parent mAb chCE7 (K d ∼10 -10 M), showed no tendency to aggregate and were stable in serum both in vitro and in vivo. Kinetics of association and dissociation of radioiodinated scFv and Fab fragments were found to be rapid. Radioiodination with the Iodogen method led to impaired immunoreactivity which was found to further increase the off- rates of radioiodinated fragments from tumor cells. Radioiodination with the Bolton-Hunter reagent as well as labeling of chCE7-Fab fragments with 67 Cu via the macrocyclic CPTA ligand led to fully immunoreactive Fab fragments. Radioiodinated and radiocopper labeled monovalent CE7 fragments did not internalize into target tumor cells as the parent mAb and its F(ab') 2 fragment. A comparison of the biodistribution in tumor bearing nude mice of the radiocopper labeled monovalent, non internalizing Fab fragments with the internalizing divalent F(ab') 2 fragments showed in both cases high levels of radioactivity in the kidneys. Concerning tumor uptake, radioactivity from both internalizing and non internalizing fragments remained associated with tumor tissue for longer times than in case of the corresponding radioiodinated fragments. When compared with the radioiodinated forms, tumor uptake

  6. Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

    Science.gov (United States)

    Gouge, Michael F.

    2011-01-01

    Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

  7. Fragmentation of SIV-gag vaccine induces broader T cell responses.

    Directory of Open Access Journals (Sweden)

    Adel Benlahrech

    Full Text Available High mutation rates of human immunodeficiency virus (HIV allows escape from T cell recognition preventing development of effective T cell vaccines. Vaccines that induce diverse T cell immune responses would help overcome this problem. Using SIV gag as a model vaccine, we investigated two approaches to increase the breadth of the CD8 T cell response. Namely, fusion of vaccine genes to ubiquitin to target the proteasome and increase levels of MHC class I peptide complexes and gene fragmentation to overcome competition between epitopes for presentation and recognition.three vaccines were compared: full-length unmodified SIV-mac239 gag, full-length gag fused at the N-terminus to ubiquitin and 7 gag fragments of equal size spanning the whole of gag with ubiquitin-fused to the N-terminus of each fragment. Genes were cloned into a replication defective adenovirus vector and immunogenicity assessed in an in vitro human priming system. The breadth of the CD8 T cell response, defined by the number of distinct epitopes, was assessed by IFN-γ-ELISPOT and memory phenotype and cytokine production evaluated by flow cytometry. We observed an increase of two- to six-fold in the number of epitopes recognised in the ubiquitin-fused fragments compared to the ubiquitin-fused full-length gag. In contrast, although proteasomal targeting was achieved, there was a marked reduction in the number of epitopes recognised in the ubiquitin-fused full-length gag compared to the full-length unmodified gene, but there were no differences in the number of epitope responses induced by non-ubiquitinated full-length gag and the ubiquitin-fused mini genes. Fragmentation and ubiquitination did not affect T cell memory differentiation and polyfunctionality, though most responses were directed against the Ad5 vector.Fragmentation but not fusion with ubiquitin increases the breadth of the CD8 T vaccine response against SIV-mac239 gag. Thus gene fragmentation of HIV vaccines may maximise

  8. Genetic relationships of Corynebacterium diphtheriae strains isolated from a diphtheria case and carriers by restriction fragment length polymorphism of rRNA genes Relação genética de cepas de Corynebacterium diphtheriae isoladas de caso e seus contatos por RLFP de rRNA gene

    Directory of Open Access Journals (Sweden)

    Claudio Tavares Sacchi

    1995-08-01

    Full Text Available In the present study we report the results of an analysis, based on ribotyping of Corynebacterium diphtheriae intermedius strains isolated from a 9 years old child with clinical diphtheria and his 5 contacts. Quantitative analysis of RFLPs of rRNA was used to determine relatedness of these 7 C.diphtheriae strains providing support data in the diphtheria epidemiology. We have also tested those strains for toxigenicity in vitro by using the Elek's gel diffusion method and in vivo by using cell culture method on cultured monkey kidney cell (VERO cells. The hybridization results revealed that the 5 C.diphtheriae strains isolated from contacts and one isolated from the clinical case (nose case strain had identical RFLP patterns with all 4 restriction endonucleases used, ribotype B. The genetic distance from this ribotype and ribotype A (throat case strain, that we initially assumed to be responsible for the illness of the patient, was of 0.450 showing poor genetic correlation among these two ribotypes. We found no significant differences concerned to the toxin production by using the cell culture method. In conclusion, the use of RFLPs of rRNA gene was successful in detecting minor differences in closely related toxigenic C.diphtheriae intermedius strains and providing information about genetic relationships among them.No presente estudo, nós reportamos os resultados de uma análise, baseada na ribotipagem de cepas de C. diphtheriae intermedius isoladas de uma criança de 9 anos com difteria e seus 5 contatos. Análise quantitativa por RFLP de rRNA foi usada para determinar a relação destas 7 cepas de C. diphtheriae fornecendo dados de interesse epidemiológico. Nós também testamos estas cepas para toxicidade in vitro usando método de difusão de Elek e in vivo usando método de cultura celular com células VERO. Os resultados de hibridização revelaram que as 5 cepas de C. diphtheriae isoladas dos contatos e uma isolada do caso (cepa isolada

  9. Global-Scale Patterns of Forest Fragmentation

    Directory of Open Access Journals (Sweden)

    Kurt Riitters

    2000-12-01

    Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.

  10. Global-scale patterns of forest fragmentation

    Science.gov (United States)

    Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.

    2000-01-01

    We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.

  11. Light fragment formation at intermediate energies

    International Nuclear Information System (INIS)

    Boal, D.H.

    1982-03-01

    This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

  12. Impact fragmentation of a brittle metal compact

    Science.gov (United States)

    Tang, Megan; Hooper, Joseph P.

    2018-05-01

    The fragmentation behavior of a metal powder compact which is ductile in compression but brittle in tension is studied via impact experiments and analytical models. Consolidated metal compacts were prepared via cold-isostatic pressing of powder at 380 MPa followed by moderate annealing at 365 °C. The resulting zinc material is ductile and strain-hardening in high-rate uniaxial compression like a traditional metal, but is elastic-brittle in tension with a fracture toughness comparable to a ceramic. Cylindrical samples were launched up to 800 m/s in a gas gun into thin aluminum perforation targets, subjecting the projectile to a complex multiaxial and time-dependent stress state that leads to catastrophic fracture. A soft-catch mechanism using low-density artificial snow was developed to recover the impact debris, and collected fragments were analyzed to determine their size distribution down to 30 μm. Though brittle fracture occurs along original particle boundaries, no power-law fragmentation behavior was observed as is seen in other low-toughness materials. An analytical theory is developed to predict the characteristic fragment size accounting for both the sharp onset of fragmentation and the effect of increasing impact velocity.

  13. Rock fragmentation control in opencast blasting

    Directory of Open Access Journals (Sweden)

    P.K. Singh

    2016-04-01

    Full Text Available The blasting operation plays a pivotal role in the overall economics of opencast mines. The blasting sub-system affects all the other associated sub-systems, i.e. loading, transport, crushing and milling operations. Fragmentation control through effective blast design and its effect on productivity are the challenging tasks for practicing blasting engineer due to inadequate knowledge of actual explosive energy released in the borehole, varying initiation practice in blast design and its effect on explosive energy release characteristic. This paper describes the result of a systematic study on the impact of blast design parameters on rock fragmentation at three mines in India. The mines use draglines and shovel–dumper combination for removal of overburden. Despite its pivotal role in controlling the overall economics of a mining operation, the expected blasting performance is often judged almost exclusively on the basis of poorly defined parameters such as powder factor and is often qualitative which results in very subjective assessment of blasting performance. Such an approach is very poor substitutes for accurate assessment of explosive and blasting performance. Ninety one blasts were conducted with varying blast designs and charging patterns, and their impacts on the rock fragmentation were documented. A high-speed camera was deployed to record the detonation sequences of the blasts. The efficiency of the loading machines was also correlated with the mean fragment size obtained from the fragmentation analyses.

  14. Molten aluminum alloy fuel fragmentation experiments

    International Nuclear Information System (INIS)

    Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

    1992-01-01

    Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

  15. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Simulations of High Speed Fragment Trajectories

    Science.gov (United States)

    Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

    2017-11-01

    Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

  17. Universal Rim Thickness in Unsteady Sheet Fragmentation

    Science.gov (United States)

    Wang, Y.; Dandekar, R.; Bustos, N.; Poulain, S.; Bourouiba, L.

    2018-05-01

    Unsteady fragmentation of a fluid bulk into droplets is important for epidemiology as it governs the transport of pathogens from sneezes and coughs, or from contaminated crops in agriculture. It is also ubiquitous in industrial processes such as paint, coating, and combustion. Unsteady fragmentation is distinct from steady fragmentation on which most theoretical efforts have been focused thus far. We address this gap by studying a canonical unsteady fragmentation process: the breakup from a drop impact on a finite surface where the drop fluid is transferred to a free expanding sheet of time-varying properties and bounded by a rim of time-varying thickness. The continuous rim destabilization selects the final spray droplets, yet this process remains poorly understood. We combine theory with advanced image analysis to study the unsteady rim destabilization. We show that, at all times, the rim thickness is governed by a local instantaneous Bond number equal to unity, defined with the instantaneous, local, unsteady rim acceleration. This criterion is found to be robust and universal for a family of unsteady inviscid fluid sheet fragmentation phenomena, from impacts of drops on various surface geometries to impacts on films. We discuss under which viscous and viscoelastic conditions the criterion continues to govern the unsteady rim thickness.

  18. Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

    Science.gov (United States)

    Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

  19. Meta-analysis of susceptibility of woody plants to loss of genetic diversity through habitat fragmentation.

    Science.gov (United States)

    Vranckx, Guy; Jacquemyn, Hans; Muys, Bart; Honnay, Olivier

    2012-04-01

    Shrubs and trees are assumed less likely to lose genetic variation in response to habitat fragmentation because they have certain life-history characteristics such as long lifespans and extensive pollen flow. To test this assumption, we conducted a meta-analysis with data on 97 woody plant species derived from 98 studies of habitat fragmentation. We measured the weighted response of four different measures of population-level genetic diversity to habitat fragmentation with Hedge's d and Spearman rank correlation. We tested whether the genetic response to habitat fragmentation was mediated by life-history traits (longevity, pollination mode, and seed dispersal vector) and study characteristics (genetic marker and plant material used). For both tests of effect size habitat fragmentation was associated with a substantial decrease in expected heterozygosity, number of alleles, and percentage of polymorphic loci, whereas the population inbreeding coefficient was not associated with these measures. The largest proportion of variation among effect sizes was explained by pollination mechanism and by the age of the tissue (progeny or adult) that was genotyped. Our primary finding was that wind-pollinated trees and shrubs appeared to be as likely to lose genetic variation as insect-pollinated species, indicating that severe habitat fragmentation may lead to pollen limitation and limited gene flow. In comparison with results of previous meta-analyses on mainly herbaceous species, we found trees and shrubs were as likely to have negative genetic responses to habitat fragmentation as herbaceous species. We also found that the genetic variation in offspring was generally less than that of adult trees, which is evidence of a genetic extinction debt and probably reflects the genetic diversity of the historical, less-fragmented landscape. ©2011 Society for Conservation Biology.

  20. Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

    Science.gov (United States)

    Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

    2015-06-01

    A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

  1. The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

    Science.gov (United States)

    Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

    2013-01-01

    In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

  2. Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

    DEFF Research Database (Denmark)

    Kastern, W.; Dyrberg, T.; Scholler, J.

    1984-01-01

    DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

  3. Phenomenological relation between distribution and fragmentation functions

    International Nuclear Information System (INIS)

    Ma Boqiang; Schmidt, Ivan; Soffer, Jacques; Yang Jianjun

    2002-01-01

    We study the relation between the quark distribution function q(x) and the fragmentation function D q (z) based on a general form D q (x)=C(z)z α q(z) for valence and sea quarks. By adopting two known parametrizations of quark distributions for the proton, we find three simple options for the fragmentation functions that can provide a good description of the available experimental data on proton production in e + e - inelastic annihilation. These three options support the revised Gribov-Lipatov relation D q (z)=zq(z) at z→1, as an approximate relation for the connection between distribution and fragmentation functions. The three options differ in the sea contributions and lead to distinct predictions for antiproton production in the reaction p+p→p-bar+X, thus they are distinguishable in future experiments at RHIC-BNL

  4. Projectile rapidity dependence in target fragmentation

    International Nuclear Information System (INIS)

    Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.

    1979-01-01

    The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references

  5. Antiproton Induced Fission and Fragmentation of Nuclei

    CERN Multimedia

    2002-01-01

    The annihilation of slow antiprotons with nuclei results in a large highly localized energy deposition primarily on the nuclear surface. \\\\ \\\\ The study of antiproton induced fission and fragmentation processes is expected to yield new information on special nuclear matter states, unexplored fission modes, multifragmentation of nuclei, and intranuclear cascades.\\\\ \\\\ In order to investigate the antiproton-nucleus interaction and the processes following the antiproton annihilation at the nucleus, we propose the following experiments: \\item A)~Measurement of several fragments from fission and from multifragmentation in coincidence with particle spectra, especially neutrons and kaons. \\item B)~Precise spectra of $\\pi$, K, n, p, d and t with time-of-flight techniques. \\item C)~Installation of the Berlin 4$\\pi$ neutron detector with a 4$\\pi$ Si detector placed inside for fragments and charged particles. This yields neutron multiplicity distributions and consequently distributions of thermal excitation energies and...

  6. Fragmentation in central collisions of heavy systems

    International Nuclear Information System (INIS)

    Claesson, G.; Doss, K.G.R.; Ferguson, R.

    1987-01-01

    One of the goals of heavy ion reaction studies is to understand the fragmentation of hot nuclei. The LBL/GSI Plastic Ball detector system has been used to achieve a very high solid angle for detection of light and medium-heavy fragments emitted in 200 Mev/A Au + Au and Au + Fe reactions. The simultaneous measurement of almost all of the nucleons and nuclei resulting from each collision allows an estimation of the total charged particle multiplicity and hence the impact parameter. By choosing subsets of the data corresponding to a peripheral or central collision, the assumptions inherent in various models of nuclear fragmentation can be tested. 3 refs., 3 figs

  7. Experiences in fragment-based drug discovery.

    Science.gov (United States)

    Murray, Christopher W; Verdonk, Marcel L; Rees, David C

    2012-05-01

    Fragment-based drug discovery (FBDD) has become established in both industry and academia as an alternative approach to high-throughput screening for the generation of chemical leads for drug targets. In FBDD, specialised detection methods are used to identify small chemical compounds (fragments) that bind to the drug target, and structural biology is usually employed to establish their binding mode and to facilitate their optimisation. In this article, we present three recent and successful case histories in FBDD. We then re-examine the key concepts and challenges of FBDD with particular emphasis on recent literature and our own experience from a substantial number of FBDD applications. Our opinion is that careful application of FBDD is living up to its promise of delivering high quality leads with good physical properties and that in future many drug molecules will be derived from fragment-based approaches. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. The Injured Body: Humiliation and Fragmentation

    Directory of Open Access Journals (Sweden)

    Graciela Mayet

    2017-03-01

    Full Text Available Simone de Beauvoir’s nouvelles and Titus Andronicus by Shakespeare present us opposite and complementary corporeal nature. In the first case, two women about their sixties are in front of the personal drama of their lost which happen through the years of ageing. It is a kind of fragmentation of existence. Ageing is the most authentic state of the human condition because the human being can only hang on to himself. In Titus Andronicus, are shown mutilations, murderers as fragmentation of biological body and social body. Individualism of modernity doesn’t forgive the bodies deteriorated by the years. In the early modernity, in the times of Elizabeth the First, like in the Ancient Rome, it wasn’t spared humiliations and violence towards the enemy body in order to impose power and authority. In this Shakespeare’s play, the fragmentation of the other’s body and murder are the emergence of social and individual violence.

  9. Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

    2016-11-15

    The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

  10. Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

    Science.gov (United States)

    Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

    2014-08-30

    The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    International Nuclear Information System (INIS)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

    2013-01-01

    We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  12. Dynamical effects in the Colomb expansion following nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.; Donangelo, R.J.; Schechter, H.

    1987-01-01

    The effects of the Colomb expansion on the fragment Kinetic energy spectrum for a fragmentating hot nuclear system is investigated. In particular, 12 C fragment spectra are calculated and compared with those predicted by the uniform expansion approximation. The results indicate that energy spectra of fragments are quite sensitive to the details of the Coulomb expansion treatment. (Author) [pt

  13. Genetic and functional properties of uncultivated thermophilic crenarchaeotes from a subsurface gold mine as revealed by analysis of genome fragments.

    Science.gov (United States)

    Nunoura, Takuro; Hirayama, Hisako; Takami, Hideto; Oida, Hanako; Nishi, Shinro; Shimamura, Shigeru; Suzuki, Yohey; Inagaki, Fumio; Takai, Ken; Nealson, Kenneth H; Horikoshi, Koki

    2005-12-01

    Within a phylum Crenarchaeota, only some members of the hyperthermophilic class Thermoprotei, have been cultivated and characterized. In this study, we have constructed a metagenomic library from a microbial mat formation in a subsurface hot water stream of the Hishikari gold mine, Japan, and sequenced genome fragments of two different phylogroups of uncultivated thermophilic Crenarchaeota: (i) hot water crenarchaeotic group (HWCG) I (41.2 kb), and (ii) HWCG III (49.3 kb). The genome fragment of HWCG I contained a 16S rRNA gene, two tRNA genes and 35 genes encoding proteins but no 23S rRNA gene. Among the genes encoding proteins, several genes for putative aerobic-type carbon monoxide dehydrogenase represented a potential clue with regard to the yet unknown metabolism of HWCG I Archaea. The genome fragment of HWCG III contained a 16S/23S rRNA operon and 44 genes encoding proteins. In the 23S rRNA gene, we detected a homing-endonuclease encoding a group I intron similar to those detected in hyperthermophilic Crenarchaeota and Bacteria, as well as eukaryotic organelles. The reconstructed phylogenetic tree based on the 23S rRNA gene sequence reinforced the intermediate phylogenetic affiliation of HWCG III bridging the hyperthermophilic and non-thermophilic uncultivated Crenarchaeota.

  14. Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

    Energy Technology Data Exchange (ETDEWEB)

    Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1965-07-01

    This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

  15. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  16. Dynamics and instabilities in nuclear fragmentation

    International Nuclear Information System (INIS)

    Colonna, M.; Guarnera, A.; Di Toro, M.; Latora, V.; Smerzi, A.; Catania Univ.

    1993-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The method covers all possible sources of dynamical instabilities. Informations on the instability point, like the time when the nuclear system enters the critical region, the most unstable modes and the time constant of the exponential growing of the relative variances, are deduced without any numerical bias. Important memory effects in the fragmentation pattern are revealed. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. (author) 7 refs., 3 figs

  17. Parton Propagation and Fragmentation in QCD Matter

    Energy Technology Data Exchange (ETDEWEB)

    Alberto Accardi, Francois Arleo, William Brooks, David D' Enterria, Valeria Muccifora

    2009-12-01

    We review recent progress in the study of parton propagation, interaction and fragmentation in both cold and hot strongly interacting matter. Experimental highlights on high-energy hadron production in deep inelastic lepton-nucleus scattering, proton-nucleus and heavy-ion collisions, as well as Drell-Yan processes in hadron-nucleus collisions are presented. The existing theoretical frameworks for describing the in-medium interaction of energetic partons and the space-time evolution of their fragmentation into hadrons are discussed and confronted to experimental data. We conclude with a list of theoretical and experimental open issues, and a brief description of future relevant experiments and facilities.

  18. Strain-energy effects on dynamic fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Chudnovsky, A.

    1986-01-01

    Grady's model of the dynamic fragmentation process, in which the average fragment size is determined by balancing the local kinetic energy and the surface energy, is modified to include the stored elastic (strain) energy. The revised model predicts that the strain energy should dominate for brittle materials, with low fracture toughness and high fracture-initiation stress. This conclusion is not borne out, however, by limited experimental data on brittle steels, even when the kinetic-energy density is small compared with the strain-energy density

  19. Rotating bubble and toroidal nuclei and fragmentation

    International Nuclear Information System (INIS)

    Royer, G.; Haddad, F.; Jouault, B.

    1995-01-01

    The energy of rotating bubble and toroidal nuclei predicted to be formed in central heavy-ion collisions at intermediate energies is calculated within the generalized rotating liquid drop model. The potential barriers standing in these exotic deformation paths are compared with the three dimensional and plane fragmentation barriers. In the toroidal deformation path of the heaviest systems exists a large potential pocket localised below the plane fragmentation barriers. This might allow the temporary survival of heavy nuclear toroids before the final clusterization induced by the surface and proximity tension. (author)

  20. Complejo Ojosmin: fragment of ophiolite transamazonian

    International Nuclear Information System (INIS)

    Bossi, J.; Pineyro, D. . Email geologia@fagro.edu.uy

    2004-01-01

    A preliminary geological survey of a previously unknown basic igneous complex in the Padre Alta Terrane (Pat) is presented. We report petrographic, geochemical and stratigraphic data for more than 200 outcrops. Geological evolution of the complex can be described in terms of four main events: (1) formation Pat units around 2000 Ma; (2) granodiorite thrusting onto possible ophiolite ca 1900 Ma ; (3) granophyric magmatism around 1700 Ma(4) intrusion of trachyte dykes. Data available suggest thrusting onto fragment of oceanic crust. Since the described structure presupposes the existence of pre transamazonian continental fragments in the TPA, it is very important to study the area in detail in the future [es

  1. Radio Frequency Fragment Separator at NSCL

    International Nuclear Information System (INIS)

    Bazin, D.; Andreev, V.; Becerril, A.; Doleans, M.; Mantica, P.F.; Ottarson, J.; Schatz, H.; Stoker, J.B.; Vincent, J.

    2009-01-01

    A new device has been designed and built at NSCL which provides additional filtering of radioactive beams produced via projectile fragmentation. The Radio Frequency Fragment Separator (RFFS) uses the time micro structure of the beams accelerated by the cyclotrons to deflect particles according to their time-of-flight, in effect producing a phase filtering. The transverse RF (Radio Frequency) electric field of the RFFS has superior filtering performance compared to other electrostatic devices, such as Wien filters. Such filtering is critical for radioactive beams produced on the neutron-deficient side of the valley of stability, where strong contamination occurs at intermediate energies from 50 to 200 MeV/u.

  2. The Zero-Degree Detector system for fragmentation studies

    International Nuclear Information System (INIS)

    Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.

    2007-01-01

    The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan

  3. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  4. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  5. Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

    Science.gov (United States)

    Dubinets, Nikita; Slipchenko, Lyudmila V

    2017-07-20

    Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

  6. Fragment informatics and computational fragment-based drug design: an overview and update.

    Science.gov (United States)

    Sheng, Chunquan; Zhang, Wannian

    2013-05-01

    Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

  7. Relationships between Liquid Atomization and Solid Fragmentation

    Science.gov (United States)

    2016-03-01

    1 2. Basic Definitions ...expressions for average fragment sizes. These observations are surprising, given the fundamental phenomenological differences between liquid and solid...smaller children droplets in the secondary stage. The basic phenomenology of the second stage is much the same as that of the first stage. For

  8. Modelling of the PELE fragmentation dynamics

    Science.gov (United States)

    Verreault, J.

    2014-05-01

    The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.

  9. Modelling of the PELE fragmentation dynamics

    NARCIS (Netherlands)

    Verreault, J.

    2014-01-01

    The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a

  10. Modelling of the PELE fragmentation dynamics

    International Nuclear Information System (INIS)

    Verreault, J

    2014-01-01

    The Penetrator with Enhanced Lateral Effect (PELE) is a type of explosive-free projectile that undergoes radial fragmentation upon an impact with a target plate. This type of projectile is composed of a brittle cylindrical shell (the jacket) filled in its core with a material characterized with a large Poisson's ratio. Upon an impact with a target, the axial compression causes the filling to expand in the radial direction. However, due to the brittleness of the jacket material, very little radial deformation can occur which creates a radial stress between the two materials and a hoop stress in the jacket. Fragmentation of the jacket occurs if the hoop stress exceeds the material's ultimate stress. The PELE fragmentation dynamics is explored via Finite-Element Method (FEM) simulations using the Autodyn explicit dynamics hydrocode. The numerical results are compared with an analytical model based on wave interactions, as well as with the experimental investigation of Paulus and Schirm (1996). The comparison is based on the mechanical stress in the filling and the qualitative fragmentation of the jacket.

  11. Diquark fragmentation in leptoproduction of hadrons

    International Nuclear Information System (INIS)

    Beavis, D.; Desai, B.R.

    1981-08-01

    In the analysis of the leptoproduction data for the charge ratios of hadrons, the Sukhatme, Lassila and Orava (SLO) model for diquark fragmentation is shown to be consistent with the hypothesis of a diquark acting as a single unit. The baryon contribution to the charge ratio, ignored earlier by SLO, makes a significant effect. (author)

  12. Heavy Flavor Fragmentation and Decay at SLD

    Energy Technology Data Exchange (ETDEWEB)

    Plano, Richard M

    1999-02-24

    Results on heavy quark fragmentation obtained using the SLD detector at the SLAC Linear Collider are presented. This talk will cover the ratio of vector to pseudoscalar charmed meson production, the inclusive B hadron energy distribution, the inclusive particle production in heavy jets compared to their production in light jets, and charged and neutral B meson lifetimes.

  13. Probabilistic Role Models and the Guarded Fragment

    DEFF Research Database (Denmark)

    Jaeger, Manfred

    2004-01-01

    We propose a uniform semantic framework for interpreting probabilistic concept subsumption and probabilistic role quantification through statistical sampling distributions. This general semantic principle serves as the foundation for the development of a probabilistic version of the guarded fragm...... fragment of first-order logic. A characterization of equivalence in that logic in terms of bisimulations is given....

  14. Probabilistic role models and the guarded fragment

    DEFF Research Database (Denmark)

    Jaeger, Manfred

    2006-01-01

    We propose a uniform semantic framework for interpreting probabilistic concept subsumption and probabilistic role quantification through statistical sampling distributions. This general semantic principle serves as the foundation for the development of a probabilistic version of the guarded fragm...... fragment of first-order logic. A characterization of equivalence in that logic in terms of bisimulations is given....

  15. OSCILLATING FILAMENTS. I. OSCILLATION AND GEOMETRICAL FRAGMENTATION

    Energy Technology Data Exchange (ETDEWEB)

    Gritschneder, Matthias; Heigl, Stefan; Burkert, Andreas, E-mail: gritschm@usm.uni-muenchen.de [University Observatory Munich, LMU Munich, Scheinerstrasse 1, D-81679 Munich (Germany)

    2017-01-10

    We study the stability of filaments in equilibrium between gravity and internal as well as external pressure using the grid-based AMR code RAMSES. A homogeneous, straight cylinder below a critical line mass is marginally stable. However, if the cylinder is bent, such as with a slight sinusoidal perturbation, an otherwise stable configuration starts to oscillate, is triggered into fragmentation, and collapses. This previously unstudied behavior allows a filament to fragment at any given scale, as long as it has slight bends. We call this process “geometrical fragmentation.” In our realization, the spacing between the cores matches the wavelength of the sinusoidal perturbation, whereas up to now, filaments were thought to be only fragmenting on the characteristic scale set by the mass-to-line ratio. Using first principles, we derive the oscillation period as well as the collapse timescale analytically. To enable a direct comparison with observations, we study the line-of-sight velocity for different inclinations. We show that the overall oscillation pattern can hide the infall signature of cores.

  16. Continuous fragment of the mu-calculus

    NARCIS (Netherlands)

    Fontaine, G.

    2008-01-01

    In this paper we investigate the Scott continuous fragment of the modal μ-calculus. We discuss its relation with constructivity, where we call a formula constructive if its least fixpoint is always reached in at most ω steps. Our main result is a syntactic characterization of this continuous

  17. Fragmentation of forest, grassland, and shrubland

    Science.gov (United States)

    Kurt H. Riitters

    2013-01-01

    As humans introduce competing land uses into natural landscapes, the public concerns regarding landcover patterns are expressed through headline issues such as urban sprawl, forest fragmentation, water quality, and wilderness preservation. The spatial arrangement of an environment affects all human perceptions and ecological processes within that environment, but this...

  18. Intraday Price Discovery in Fragmented Markets

    NARCIS (Netherlands)

    S.R. Ozturk (Sait); M. van der Wel (Michel); D.J.C. van Dijk (Dick)

    2014-01-01

    textabstractFor many assets, trading is fragmented across multiple exchanges. Price discovery measures summarize the informativeness of trading on each venue for discovering the asset’s true underlying value. We explore intraday variation in price discovery using a structural model with

  19. Targeting incentives to reduce habitat fragmentation

    Science.gov (United States)

    David Lewis; Andrew Plantinga; Junjie Wu

    2009-01-01

    This article develops a theoretical model to analyze the spatial targeting of incentives for the restoration of forested landscapes when wildlife habitat can be enhanced by reducing fragmentation. The key theoretical result is that the marginal net benefits of increasing forest can be convex, in which case corner solutions--converting either none or all of the...

  20. Fragmentation and structure of silicon microclusters

    International Nuclear Information System (INIS)

    Feuston, B.P.; Kalia, R.K.; Vashishta, P.

    1987-01-01

    It may be possible to determine the magic numbers and fragmentation spectra from the ground-state binding energies and structure, but the relationship between the lowest-energy zero-temperature configurations and the energetics of finite-temperature microclusters is not obvious. Recall fragmentation of Si clusters occurs at temperatures the order of the melting temperature (T∼2000 K). What is needed, a first-principles finite-temperature calculation, allowing the determination of all possible structures, their corresponding binding energies, and fragmentation spectra, is not presently possible. However, a molecular dynamics calculation does allow one to study the nature of fragmentation in addition to determination of the global ground-state structure and all mechanically stable configurations underlying the finite-temperature cluster, once given an interaction potential. The authors present results for such a calculation for Si/sub 2-14/ using the Stillinger-Weber 3-body potential. Their results indicate that the existence of magic numbers is determined by the topology and energetics of high-energy bound structures rather than the structure and ground-state energies at zero temperature

  1. Strategic Targeted Advertising and Market Fragmentation

    OpenAIRE

    Lola Esteban; Jose M. Hernandez

    2007-01-01

    This paper proves that oligopolistic price competition with both targeted advertising and targeted prices can lead to a permanent fragmentation of the market into a local monopoly. However, compared to mass advertising, targeting increases social welfare and turns out to be more beneficial for consumers than for firms.

  2. Habitat fragmentation causes rapid genetic differentiation and ...

    African Journals Online (AJOL)

    ... city buildings. These results were supported by multiple statistical analyses including Mantel's test, PCOORDA and AMOVA. Genetic enrichment and epigenetic variation studies can be included in habitat fragmentation analysis and its implications in inducing homogenization and susceptibility in natural plant populations.

  3. Searching Fragment Spaces with feature trees.

    Science.gov (United States)

    Lessel, Uta; Wellenzohn, Bernd; Lilienthal, Markus; Claussen, Holger

    2009-02-01

    Virtual combinatorial chemistry easily produces billions of compounds, for which conventional virtual screening cannot be performed even with the fastest methods available. An efficient solution for such a scenario is the generation of Fragment Spaces, which encode huge numbers of virtual compounds by their fragments/reagents and rules of how to combine them. Similarity-based searches can be performed in such spaces without ever fully enumerating all virtual products. Here we describe the generation of a huge Fragment Space encoding about 5 * 10(11) compounds based on established in-house synthesis protocols for combinatorial libraries, i.e., we encode practically evaluated combinatorial chemistry protocols in a machine readable form, rendering them accessible to in silico search methods. We show how such searches in this Fragment Space can be integrated as a first step in an overall workflow. It reduces the extremely huge number of virtual products by several orders of magnitude so that the resulting list of molecules becomes more manageable for further more elaborated and time-consuming analysis steps. Results of a case study are presented and discussed, which lead to some general conclusions for an efficient expansion of the chemical space to be screened in pharmaceutical companies.

  4. Element Distribution and Multiplicity of Heavy Fragments

    CERN Multimedia

    2002-01-01

    This experiment will measure the energy and angular distribution of heavy fragments produced in the reactions of |1|2C on several targets between |2|7Al and |2|3|8U at 86~MeV/u. The systematic investigation of a highly excited interaction region (fireball) by means of a clean N and Z identification of heavy tar fragments, may result in a better understanding of temperature concept and of the degree of equilibration of the local interaction region with respect to the total system. For this investigation a large-area position sensitive ionization chamber of 50~msr solid angle in conjunction with a time-of-flight telescope consisting of parallel-plate detectors will be used. \\\\ \\\\ In order to get information on the transverse momentum transfer and the inelasticity of the collision, the energy of the PROJECTILE-FRAGMENTS will be measured at forward angles with a plastic scintillator hodoscope. In addition to this inclusive measurement correlations between heavy fragments will be investigated by means of three pos...

  5. Efficient clustering aggregation based on data fragments.

    Science.gov (United States)

    Wu, Ou; Hu, Weiming; Maybank, Stephen J; Zhu, Mingliang; Li, Bing

    2012-06-01

    Clustering aggregation, known as clustering ensembles, has emerged as a powerful technique for combining different clustering results to obtain a single better clustering. Existing clustering aggregation algorithms are applied directly to data points, in what is referred to as the point-based approach. The algorithms are inefficient if the number of data points is large. We define an efficient approach for clustering aggregation based on data fragments. In this fragment-based approach, a data fragment is any subset of the data that is not split by any of the clustering results. To establish the theoretical bases of the proposed approach, we prove that clustering aggregation can be performed directly on data fragments under two widely used goodness measures for clustering aggregation taken from the literature. Three new clustering aggregation algorithms are described. The experimental results obtained using several public data sets show that the new algorithms have lower computational complexity than three well-known existing point-based clustering aggregation algorithms (Agglomerative, Furthest, and LocalSearch); nevertheless, the new algorithms do not sacrifice the accuracy.

  6. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  7. Albumin modification and fragmentation in renal disease.

    Science.gov (United States)

    Donadio, Carlo; Tognotti, Danika; Donadio, Elena

    2012-02-18

    Albumin is the most important antioxidant substance in plasma and performs many physiological functions. Furthermore, albumin is the major carrier of endogenous molecules and exogenous ligands. This paper reviews the importance of post-translational modifications of albumin and fragments thereof in patients with renal disease. First, current views and controversies on renal handling of proteins, mainly albumin, will be discussed. Post-translational modifications, namely the fragmentation of albumin found with proteomic techniques in nephrotic patients, diabetics, and ESRD patients will be presented and discussed. It is reasonable to hypothesize that proteolytic fragmentation of serum albumin is due to a higher susceptibility to proteases, induced by oxidative stress. The clinical relevance of the fragmentation of albumin has not yet been established. These modifications could affect some physiological functions of albumin and have a patho-physiological role in uremic syndrome. Proteomic analysis of serum allows the identification of over-expressed proteins and can detect post-translational modifications of serum proteins, hitherto hidden, using standard laboratory techniques. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Quantum properties of QCD string fragmentation

    Directory of Open Access Journals (Sweden)

    Todorova-Nová Šárka

    2016-01-01

    Full Text Available A simple quantization concept for a 3-dim QCD string is used to derive properties of QCD flux tube from the mass spectrum of light mesons and to predict observable quantum effects in correlations between adjacent hadrons. The quantized fragmentation model is presented and compared with experimental observations.

  9. Genetic connectivity of the moth pollinated tree Glionnetia sericea in a highly fragmented habitat.

    Directory of Open Access Journals (Sweden)

    Aline Finger

    Full Text Available Long-distance gene flow is thought to be one prerequisite for the persistence of plant species in fragmented environments. Human influences have led to severe fragmentation of native habitats in the Seychelles islands, with many species surviving only in small and isolated populations. The endangered Seychelles endemic tree Glionnetia sericea is restricted to altitudes between 450 m and 900 m where the native forest vegetation has been largely lost and replaced with exotic invasives over the last 200 years. This study explores the genetic and ecological consequences of population fragmentation in this species by analysing patterns of genetic diversity in a sample of adults, juveniles and seeds, and by using controlled pollination experiments. Our results show no decrease in genetic diversity and no increase in genetic structuring from adult to juvenile cohorts. Despite significant inbreeding in some populations, there is no evidence of higher inbreeding in juvenile cohorts relative to adults. A Bayesian structure analysis and a tentative paternity analysis indicate extensive historical and contemporary gene flow among remnant populations. Pollination experiments and a paternity analysis show that Glionnetia sericea is self-compatible. Nevertheless, outcrossing is present with 7% of mating events resulting from pollen transfer between populations. Artificial pollination provided no evidence for pollen limitation in isolated populations. The highly mobile and specialized hawkmoth pollinators (Agrius convolvuli and Cenophodes tamsi; Sphingidae appear to promote extensive gene flow, thus mitigating the potential negative ecological and genetic effects of habitat fragmentation in this species. We conclude that contemporary gene flow is sufficient to maintain genetic connectivity in this rare and restricted Seychelles endemic, in contrast to other island endemic tree species with limited contemporary gene flow.

  10. The expression and genetic immunization of chimeric fragment of Hantaan virus M and S segments

    International Nuclear Information System (INIS)

    Zhang Fanglin; Wu Xingan; Luo Wen; Bai Wentao; Liu Yong; Yan Yan; Wang Haitao; Xu Zhikai

    2007-01-01

    Hemorrhagic fever with renal syndrome (HFRS), which is characterized by severe symptoms and high mortality, is caused by hantavirus. There are still no effective prophylactic vaccines directed to HFRS until now. In this research, we fused expressed G2 fragment of M segment and 0.7 kb fragment of S segment. We expect it could be a candidate vaccine. Chimeric gene G2S0.7 was first expressed in prokaryotic expression system pGEX-4T. After inducing expressed fusion proteins, GST-G2S0.7 was induced and its molecular weight was about 100 kDa. Meanwhile, the fusion protein kept the activity of its parental proteins. Further, BALB/c mice were vaccinated by the chimeric gene. ELISA, cell microculture neutralization test in vitro were used to detect the humoral immune response in immunized BALB/c mice. Lymphocyte proliferation assay was used to detect the cellular immune response. The results showed that the chimeric gene could simultaneously evoke specific antibody against nucleocapsid protein (NP) and glycoprotein (GP). And the immunized mice of every group elicited neutralizing antibodies with different titers. But the titers were low. Lymphocyte proliferation assay results showed that the stimulation indexes of splenocytes of chimeric gene to NP and GP were significantly higher than that of control. It suggested that the chimeric gene of Hantaan virus containing G2 fragment of M segment and 0.7 kb fragment of S segment could directly elicit specific anti-Hantaan virus humoral and cellular immune response in BALB/c mice

  11. Genetic connectivity of the moth pollinated tree Glionnetia sericea in a highly fragmented habitat.

    Science.gov (United States)

    Finger, Aline; Kaiser-Bunbury, Christopher N; Kettle, Chris J; Valentin, Terence; Ghazoul, Jaboury

    2014-01-01

    Long-distance gene flow is thought to be one prerequisite for the persistence of plant species in fragmented environments. Human influences have led to severe fragmentation of native habitats in the Seychelles islands, with many species surviving only in small and isolated populations. The endangered Seychelles endemic tree Glionnetia sericea is restricted to altitudes between 450 m and 900 m where the native forest vegetation has been largely lost and replaced with exotic invasives over the last 200 years. This study explores the genetic and ecological consequences of population fragmentation in this species by analysing patterns of genetic diversity in a sample of adults, juveniles and seeds, and by using controlled pollination experiments. Our results show no decrease in genetic diversity and no increase in genetic structuring from adult to juvenile cohorts. Despite significant inbreeding in some populations, there is no evidence of higher inbreeding in juvenile cohorts relative to adults. A Bayesian structure analysis and a tentative paternity analysis indicate extensive historical and contemporary gene flow among remnant populations. Pollination experiments and a paternity analysis show that Glionnetia sericea is self-compatible. Nevertheless, outcrossing is present with 7% of mating events resulting from pollen transfer between populations. Artificial pollination provided no evidence for pollen limitation in isolated populations. The highly mobile and specialized hawkmoth pollinators (Agrius convolvuli and Cenophodes tamsi; Sphingidae) appear to promote extensive gene flow, thus mitigating the potential negative ecological and genetic effects of habitat fragmentation in this species. We conclude that contemporary gene flow is sufficient to maintain genetic connectivity in this rare and restricted Seychelles endemic, in contrast to other island endemic tree species with limited contemporary gene flow.

  12. Lack of Population Genetic Structuring in Ocelots (Leopardus pardalis in a Fragmented Landscape

    Directory of Open Access Journals (Sweden)

    Marina G. Figueiredo

    2015-07-01

    Full Text Available Habitat fragmentation can promote patches of small and isolated populations, gene flow disruption between those populations, and reduction of local and total genetic variation. As a consequence, these small populations may go extinct in the long-term. The ocelot (Leopardus pardalis, originally distributed from Texas to southern Brazil and northern Argentina, has been impacted by habitat fragmentation throughout much of its range. To test whether habitat fragmentation has already induced genetic differentiation in an area where this process has been documented for a larger felid (jaguars, we analyzed molecular variation in ocelots inhabiting two Atlantic Forest fragments, Morro do Diabo (MD and Iguaçu Region (IR. Analyses using nine microsatellites revealed mean observed and expected heterozygosity of 0.68 and 0.70, respectively. The MD sampled population showed evidence of a genetic bottleneck under two mutational models (TPM = 0.03711 and SMM = 0.04883. Estimates of genetic structure (FST = 0.027; best fit of k = 1 with STRUCTURE revealed no meaningful differentiation between these populations. Thus, our results indicate that the ocelot populations sampled in these fragments are still not significantly different genetically, a pattern that strongly contrasts with that previously observed in jaguars for the same comparisons. This observation is likely due to a combination of two factors: (i larger effective population size of ocelots (relative to jaguars in each fragment, implying a slower effect of drift-induced differentiation; and (ii potentially some remaining permeability of the anthropogenic matrix for ocelots, as opposed to the observed lack of permeability for jaguars. The persistence of ocelot gene flow between these areas must be prioritized in long-term conservation planning on behalf of these felids.

  13. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  14. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  15. Localized extinction of an arboreal desert lizard caused by habitat fragmentation

    Science.gov (United States)

    Munguia-Vega, Adrian; Rodriguez-Estrella, Ricardo; Shaw, William W.; Culver, Melanie

    2013-01-01

    We adopted a species’ perspective for predicting extinction risk in a small, endemic, and strictly scansorial lizard (Urosaurus nigricaudus), in an old (∼60 year) and highly fragmented (8% habitat remaining) agricultural landscape from the Sonoran Desert, Mexico. We genotyped 10 microsatellite loci in 280 individuals from 11 populations in fragmented and continuous habitat. Individual dispersal was restricted to less than 400 m, according to analyses of spatial autocorrelation and spatially explicit Bayesian assignment methods. Within this scale, continuous areas and narrow washes with native vegetation allowed high levels of gene flow over tens of kilometers. In the absence of the native vegetation, cleared areas and highways were identified as partial barriers. In contrast, outside the scale of dispersal, cleared areas behaved as complete barriers, and surveys corroborated the species went extinct after a few decades in all small (less than 45 ha), isolated habitat fragments. No evidence for significant loss of genetic diversity was found, but results suggested fragmentation increased the spatial scale of movements, relatedness, genetic structure, and potentially affected sex-biased dispersal. A plausible threshold of individual dispersal predicted only 23% of all fragments in the landscape were linked with migration from continuous habitat, while complete barriers isolated the majority of fragments. Our study suggested limited dispersal, coupled with an inability to use a homogeneous and hostile matrix without vegetation and shade, could result in frequent time-delayed extinctions of small ectotherms in highly fragmented desert landscapes, particularly considering an increase in the risk of overheating and a decrease in dispersal potential induced by global warming.

  16. Habitat Fragmentation Differentially Affects Genetic Variation, Phenotypic Plasticity and Survival in Populations of a Gypsum Endemic

    Directory of Open Access Journals (Sweden)

    Silvia Matesanz

    2017-05-01

    Full Text Available Habitat fragmentation, i.e., fragment size and isolation, can differentially alter patterns of neutral and quantitative genetic variation, fitness and phenotypic plasticity of plant populations, but their effects have rarely been tested simultaneously. We assessed the combined effects of size and connectivity on these aspects of genetic and phenotypic variation in populations of Centaurea hyssopifolia, a narrow endemic gypsophile that previously showed performance differences associated with fragmentation. We grew 111 maternal families sampled from 10 populations that differed in their fragment size and connectivity in a common garden, and characterized quantitative genetic variation, phenotypic plasticity to drought for key functional traits, and plant survival, as a measure of population fitness. We also assessed neutral genetic variation within and among populations using eight microsatellite markers. Although C. hyssopifolia is a narrow endemic gypsophile, we found substantial neutral genetic variation and quantitative variation for key functional traits. The partition of genetic variance indicated that a higher proportion of variation was found within populations, which is also consistent with low population differentiation in molecular markers, functional traits and their plasticity. This, combined with the generally small effect of habitat fragmentation suggests that gene flow among populations is not restricted, despite large differences in fragment size and isolation. Importantly, population’s similarities in genetic variation and plasticity did not reflect the lower survival observed in isolated populations. Overall, our results indicate that, although the species consists of genetically variable populations able to express functional plasticity, such aspects of adaptive potential may not always reflect populations’ survival. Given the differential effects of habitat connectivity on functional traits, genetic variation and fitness

  17. Fragmentation of CagA Reduces Hummingbird Phenotype Induction by Helicobactor pylori.

    Directory of Open Access Journals (Sweden)

    Chih-Chi Chang

    Full Text Available Infection with Helicobacter pylori (H. pylori has been linked to various gastro-intestinal diseases; nevertheless it remains to be clarified why only a minority of infected individuals develop illness. Studies from the West have indicated that the cagA gene and the associated EPIYA genotype of H. pylori is closely linked to the development of severe gastritis and gastric carcinoma; however, as yet no consistent correlation has been found among the bacteria from East Asia. In addition to genotype variation, the CagA protein undergoes fragmentation; however, the functional significance of fragmentation with respect to H. pylori infection remains unknown. In this study, we isolated 594 H. pylori colonies from 99 patients and examined the fragmentation patterns of CagA protein using immunoblotting. By analyzing the ability of the isolates to induce the host cell morphological transition to the highly invasive hummingbird phenotype, we demonstrated that H. pylori colonies with substantial CagA fragmentation are less potent in terms of causing this morphological transition. Our results uncovered a functional role for CagA fragmentation with respect to H. pylori-induced hummingbird phenotype formation and these findings suggest the possibility that the post-translational processing of CagA may be involved in H. pylori infection pathogenesis.

  18. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  19. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    International Nuclear Information System (INIS)

    Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

    2014-01-01

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  20. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    Energy Technology Data Exchange (ETDEWEB)

    Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

    2014-04-10

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  1. Spatio-temporal Genetic Structure of a Tropical Bee Species Suggests High Dispersal Over a Fragmented Landscape.

    Science.gov (United States)

    Suni, Sevan S; Bronstein, Judith L; Brosi, Berry J

    2014-03-01

    Habitat destruction threatens biodiversity by reducing the amount of available resources and connectivity among geographic areas. For organisms living in fragmented habitats, population persistence may depend on dispersal, which maintains gene flow among fragments and can prevent inbreeding within them. It is centrally important to understand patterns of dispersal for bees living in fragmented areas given the importance of pollination systems and recently documented declines in bee populations. We used population and landscape genetic techniques to characterize patterns of dispersal over a large fragmented area in southern Costa Rica for the orchid bee species Euglossa championi . First, we estimated levels of genetic differentiation among forest fragments as φ pt , an analog to the traditional summary statistic F st , as well as two statistics that may more adequately represent levels of differentiation, G ' st and D est . Second, we used a Bayesian approach to determine the number and composition of genetic groups in our sample. Third we investigated how genetic differentiation changes with distance. Fourth, we determined the extent to which deforested areas restrict dispersal. Finally, we estimated the extent to which there were temporal differences in allele frequencies within the same forest fragments. Within years we found low levels of differentiation even over 80 km, and no effect of land use type on level of genetic differentiation. However, we found significant genetic differentiation between years. Taken together our results suggest that there are high levels of gene flow over this geographic area, and that individuals show low site fidelity over time.

  2. A rapid, strong, and convergent genetic response to urban habitat fragmentation in four divergent and widespread vertebrates.

    Directory of Open Access Journals (Sweden)

    Kathleen Semple Delaney

    2010-09-01

    Full Text Available Urbanization is a major cause of habitat fragmentation worldwide. Ecological and conservation theory predicts many potential impacts of habitat fragmentation on natural populations, including genetic impacts. Habitat fragmentation by urbanization causes populations of animals and plants to be isolated in patches of suitable habitat that are surrounded by non-native vegetation or severely altered vegetation, asphalt, concrete, and human structures. This can lead to genetic divergence between patches and in turn to decreased genetic diversity within patches through genetic drift and inbreeding.We examined population genetic patterns using microsatellites in four common vertebrate species, three lizards and one bird, in highly fragmented urban southern California. Despite significant phylogenetic, ecological, and mobility differences between these species, all four showed similar and significant reductions in gene flow over relatively short geographic and temporal scales. For all four species, the greatest genetic divergence was found where development was oldest and most intensive. All four animals also showed significant reduction in gene flow associated with intervening roads and freeways, the degree of patch isolation, and the time since isolation.Despite wide acceptance of the idea in principle, evidence of significant population genetic changes associated with fragmentation at small spatial and temporal scales has been rare, even in smaller terrestrial vertebrates, and especially for birds. Given the striking pattern of similar and rapid effects across four common and widespread species, including a volant bird, intense urbanization may represent the most severe form of fragmentation, with minimal effective movement through the urban matrix.

  3. BARNARD 59: NO EVIDENCE FOR FURTHER FRAGMENTATION

    Energy Technology Data Exchange (ETDEWEB)

    Roman-Zuniga, C. G. [Instituto de Astronomia, Universidad Nacional Autonoma de Mexico, Km 103 Carr. Tijuana-Ensenada, Ensenada BC 22860 (Mexico); Frau, P.; Girart, J. M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB, Facultat de Ciencies, Torre C-5p, 08193 Bellaterra, Catalunya (Spain); Alves, Joao F., E-mail: croman@astrosen.unam.mx [Institute of Astronomy, University of Vienna, Tuerkenschanzstr. 17, 1180 Vienna (Austria)

    2012-03-10

    The dense molecular clump at the center of the Barnard 59 (B59) complex is the only region in the Pipe Nebula that has formed a small, stellar cluster. The previous analysis of a high-resolution near-IR dust extinction map revealed that the nuclear region in B59 is a massive, mostly quiescent clump of 18.9 M{sub Sun }. The clump shows a monolithic profile, possibly indicating that the clump is on the way to collapse, with no evident fragmentation that could lead to another group of star systems. In this paper, we present new analysis that compares the dust extinction map with a new dust emission radio-continuum map of higher spatial resolution. We confirm that the clump does not show any significant evidence for prestellar fragmentation at scales smaller than those probed previously.

  4. BARNARD 59: NO EVIDENCE FOR FURTHER FRAGMENTATION

    International Nuclear Information System (INIS)

    Román-Zúñiga, C. G.; Frau, P.; Girart, J. M.; Alves, João F.

    2012-01-01

    The dense molecular clump at the center of the Barnard 59 (B59) complex is the only region in the Pipe Nebula that has formed a small, stellar cluster. The previous analysis of a high-resolution near-IR dust extinction map revealed that the nuclear region in B59 is a massive, mostly quiescent clump of 18.9 M ☉ . The clump shows a monolithic profile, possibly indicating that the clump is on the way to collapse, with no evident fragmentation that could lead to another group of star systems. In this paper, we present new analysis that compares the dust extinction map with a new dust emission radio-continuum map of higher spatial resolution. We confirm that the clump does not show any significant evidence for prestellar fragmentation at scales smaller than those probed previously.

  5. Fission fragment distributions within dynamical approach

    Energy Technology Data Exchange (ETDEWEB)

    Mazurek, K. [Institute of Nuclear, Physics Polish Academy of Sciences, Krakow (Poland); Nadtochy, P.N. [Omsk State Technical University, Omsk (Russian Federation); Ryabov, E.G.; Adeev, G.D. [Omsk State University, Physics Department, Omsk (Russian Federation)

    2017-04-15

    The review covers recent developments and achievements in the dynamical description of fission process at high excitation energy. It is shown that the dynamical approach based on multidimensional Langevin equations combined with the statistical description of nuclear decay by particles evaporation is capable of fairly well describing the formation of fission fragment mass-energy, charge, and angular distributions of fission fragments in coincidence with the pre- and post-scission particle emission. The final yields of fission and evaporation residues channels products could be obtained. The detailed description of fission dynamics allows studying different stages of fission process, indicating the most important ingredients governing fission process and studying in detail such fundamental nuclear properties as nuclear viscosity and fission timescale. The tasks and perspectives of multidimensional dynamical approach are also discussed. (orig.)

  6. Gastric Perforation by Ingested Rabbit Bone Fragment

    Directory of Open Access Journals (Sweden)

    Giulio Gambaracci

    2016-04-01

    Full Text Available The majority of accidentally ingested foreign bodies is excreted from the gastrointestinal (GI tract without any complications. Sometimes sharp foreign bodies – like chicken and fish bones – can lead to intestinal perforation and may present insidiously with a wide range of symptoms and, consequently, different diagnoses. We report the case of a 59-year-old woman presenting with fever and a 1-month history of vague abdominal pain. Computed tomography (CT showed the presence of a hyperdense linear image close to the gastric antrum surrounded by a fluid collection and free peritoneal air. At laparotomy, a 4-cm rabbit bone fragment covered in inflamed tissue was detected next to a gastric wall perforation. Rabbit bone fragment ingestion, even if rarely reported, should not be underestimated as a possible cause of GI tract perforation.

  7. Transport of Calcareous Fragments by Reef Fishes.

    Science.gov (United States)

    Bardach, J E

    1961-01-13

    The weight of sand, coral scrapings, algal fragments, and other calcareous materials which pass through the intestines of reef fishes was calculated on a hectare-per-year basis. It was found that browsing omnivorous reef fishes which rely, in part, on a plant diet ingested and redeposited at least 2300 kg of such material on a 1-hectare study reef near Bermuda. Reasons are presented why this estimate, certainly in order of magnitude, should be applicable to coral reefs in general.

  8. On the universality of quark jet fragmentation

    International Nuclear Information System (INIS)

    Dias de Deus, J.; Jadach, S.

    1977-01-01

    Universality of inclusive fragmentation density functions in lepton induced processes (ep, γp, e + e - ) and purely hadronic processes is discussed from the point of view of the Topological Expansion/Dual Unitarization Scheme. It is shown that planar, single jet dominated processes have universal inclusive distributions and average multiplicities. In multi-jet processes, treated in a simple approximation, is inversely proportional to the number N of jets and the magnitude of the seagull effect increases as N 2 . (Auth.)

  9. Fragmentation model analysis of EN2700 fireball

    Czech Academy of Sciences Publication Activity Database

    Spurný, Pavel; Ceplecha, Zdeněk

    2005-01-01

    Roč. 95, 1-4 (2005), s. 477-487 ISSN 0167-9295. [Meteoroids 2004. London, Ontario, 16.08.2004-20.08.2004] R&D Projects: GA ČR GA205/03/1404 Institutional research plan: CEZ:AV0Z10030501 Keywords : ablation * fireball * fragmentation Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.975, year: 2005

  10. Fragmentation in rotating isothermal protostellar clouds

    International Nuclear Information System (INIS)

    Bodenheimer, P.; Black, D.C.

    1980-01-01

    In this paper we report briefly the results of an extensive set of 3-D hydrodynamic calculations that have been performed during the past two and one-half years to investigate the susceptibility of rotating clouds to gravitational fragmentation. Because of the immensity of parameter space and the expense of computations, we have chosen to restrict this investigation to strictly isothermal collapse sequences. (orig./WL)

  11. Validating PHITS for heavy ion fragmentation reactions

    International Nuclear Information System (INIS)

    Ronningen, Reginald M.

    2015-01-01

    The performance of the Monte Carlo code system PHITS is validated for heavy-ion transport capabilities by performing simulations and comparing results against experimental data from heavy-ion reactions of benchmark quality. These data are from measurements of isotope yields produced in the fragmentation of a 140 MeV/u "4"8Ca beam on a beryllium target and on a tantalum target. The results of this study show that PHITS performs reliably. (authors)

  12. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  13. Study of fragmentation reactions of light nucleus

    International Nuclear Information System (INIS)

    Toneli, David Arruda; Carlson, Brett Vern

    2011-01-01

    Full text: The decay of the compound nucleus is traditionally calculated using a sequential emission model, such as the Weisskopf-Ewing or Hauser-Feshbach ones, in which the compound nucleus decays through a series of residual nuclei by emitting one particle at a time until there is no longer sufficient energy for further emission. In light compound nucleus, however, the excitation energy necessary to fully disintegrate the system is relatively easy to attain. In such cases, decay by simultaneous emission of two or more particles becomes important. A model which takes into account all these decay is the Fermi fragmentation model. Recently, the equivalence between the Fermi fragmentation model and statistical multifragmentation model used to describe the decay for highly excited fragments for reactions of heavy ions was demonstrated. Due the simplicity of the thermodynamic treatment used in the multifragmentation model, we have adapted it to the calculation of Fermi breakup of light nuclei. The ultimate goal of this study is to calculate the distribution of isotopes produced in proton-induced reactions on light nuclei of biological interest, such as C, O e Ca. Although most of these residual nuclei possess extremely short half-lives and thus represent little long-term danger, they tend to be deficient in neutrons and to decay by positron emission, which allows the monitoring of proton radiotherapy by PET (Positron Emission Tomography). (author)

  14. Commissioning the A1900 projectile fragment separator

    CERN Document Server

    Morrissey, D J; Steiner, M; Stolz, A; Wiedenhöver, I

    2003-01-01

    An important part of the recent upgrade of the NSCL facility is the replacement of the A1200 fragment separator with a new high acceptance device called the A1900. The design of the A1900 device represents a third generation projectile fragment separator (relative to the early work at LBL) as it is situated immediately after the primary accelerator, has a very large acceptance, a bending power significantly larger than that of the cyclotron and is constructed from large superconducting magnets (quadrupoles with 20 and 40 cm diameter warm bores). The A1900 can accept over 90% of a large range of projectile fragmentation products produced at the NSCL, leading to large gains in the intensity of the secondary beams. The results of initial tests of the system with a restricted momentum acceptance (+-0.5%) indicate that the A1900 is performing up to specifications. Further large gains in the intensities of primary beams, typically two or three orders of magnitude, will be possible as the many facets of high current...

  15. Equilibrium and non equilibrium in fragmentation

    International Nuclear Information System (INIS)

    Dorso, C.O.; Chernomoretz, A.; Lopez, J.A.

    2001-01-01

    Full text: In this communication we present recent results regarding the interplay of equilibrium and non equilibrium in the process of fragmentation of excited finite Lennard Jones drops. Because the general features of such a potential resemble the ones of the nuclear interaction (fact that is reinforced by the similarity between the EOS of both systems) these studies are not only relevant from a fundamental point of view but also shed light on the problem of nuclear multifragmentation. We focus on the microscopic analysis of the state of the fragmenting system at fragmentation time. We show that the Caloric Curve (i e. the functional relationship between the temperature of the system and the excitation energy) is of the type rise plateau with no vapor branch. The usual rise plateau rise pattern is only recovered when equilibrium is artificially imposed. This result puts a serious question on the validity of the freeze out hypothesis. This feature is independent of the dimensionality or excitation mechanism. Moreover we explore the behavior of magnitudes which can help us determine the degree of the assumed phase transition. It is found that no clear cut criteria is presently available. (Author)

  16. Formation and fragmentation of protostellar dense cores

    International Nuclear Information System (INIS)

    Maury, Anaelle

    2009-01-01

    Stars form in molecular clouds, when they collapse and fragment to produce protostellar dense cores. These dense cores are then likely to contract under their own gravity, and form young protostars, that further evolve while accreting their circumstellar mass, until they reach the main sequence. The main goal of this thesis was to study the formation and fragmentation of protostellar dense cores. To do so, two main studies, described in this manuscript, were carried out. First, we studied the formation of protostellar cores by quantifying the impact of protostellar outflows on clustered star formation. We carried out a study of the protostellar outflows powered by the young stellar objects currently formed in the NGc 2264-C proto-cluster, and we show that protostellar outflows seem to play a crucial role as turbulence progenitors in clustered star forming regions, although they seem unlikely to significantly modify the global infall processes at work on clump scales. Second, we investigated the formation of multiple systems by core fragmentation, by using high - resolution observations that allow to probe the multiplicity of young protostars on small scales. Our results suggest that the multiplicity rate of protostars on small scales increase while they evolve, and thus favor dynamical scenarios for the formation of multiple systems. Moreover, our results favor magnetized scenarios of core collapse to explain the small-scale properties of protostars at the earliest stages. (author) [fr

  17. Intermittency in {sup 197}Au fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Dabrowska, A; Holynski, R; Olszewski, A; Szarska, M; Wilczynska, B; Wolter, W; Wosiek, B [Institute of Nuclear Physics, Cracow (Poland); Cherry, M L; Deines-Jones, P; Jones, W V; Sengupta, K; Wefel, B [Louisiana State Univ., Baton Rouge, LA (United States). Dept. of Physics and Astronomy; Waddington, C J [Minnesota Univ., Minneapolis, MN (United States). School of Physics and Astronomy; Pozharova, E A; Skorodko, T Yu [Inst. of Theoretical and Experimental Physics, Moscow (Russian Federation); KLMM Collaboration

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs.

  18. In silico fragment-based drug design.

    Science.gov (United States)

    Konteatis, Zenon D

    2010-11-01

    In silico fragment-based drug design (FBDD) is a relatively new approach inspired by the success of the biophysical fragment-based drug discovery field. Here, we review the progress made by this approach in the last decade and showcase how it complements and expands the capabilities of biophysical FBDD and structure-based drug design to generate diverse, efficient drug candidates. Advancements in several areas of research that have enabled the development of in silico FBDD and some applications in drug discovery projects are reviewed. The reader is introduced to various computational methods that are used for in silico FBDD, the fragment library composition for this technique, special applications used to identify binding sites on the surface of proteins and how to assess the druggability of these sites. In addition, the reader will gain insight into the proper application of this approach from examples of successful programs. In silico FBDD captures a much larger chemical space than high-throughput screening and biophysical FBDD increasing the probability of developing more diverse, patentable and efficient molecules that can become oral drugs. The application of in silico FBDD holds great promise for historically challenging targets such as protein-protein interactions. Future advances in force fields, scoring functions and automated methods for determining synthetic accessibility will all aid in delivering more successes with in silico FBDD.

  19. Integrated delivery systems: the cure for fragmentation.

    Science.gov (United States)

    Enthoven, Alain C

    2009-12-01

    Our healthcare system is fragmented, with a misalignment of incentives, or lack of coordination, that spawns inefficient allocation of resources. Fragmentation adversely impacts quality, cost, and outcomes. Eliminating waste from unnecessary, unsafe care is crucial for improving quality and reducing costs--and making the system financially sustainable. Many believe this can be achieved through greater integration of healthcare delivery, more specifically via integrated delivery systems (IDSs). An IDS is an organized, coordinated, and collaborative network that links various healthcare providers to provide a coordinated, vertical continuum of services to a particular patient population or community. It is also accountable, both clinically and fiscally, for the clinical outcomes and health status of the population or community served, and has systems in place to manage and improve them. The marketplace already contains numerous styles and degrees of integration, ranging from Kaiser Permanente-style full integration, to more loosely organized individual practice associations, to public-private partnerships. Evidence suggests that IDSs can improve healthcare quality, improve outcomes, and reduce costs--especially for patients with complex needs--if properly implemented and coordinated. No single approach or public policy will fix the fragmented healthcare system, but IDSs represent an important step in the right direction.

  20. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  1. Fragmentation Point Detection of JPEG Images at DHT Using Validator

    Science.gov (United States)

    Mohamad, Kamaruddin Malik; Deris, Mustafa Mat

    File carving is an important, practical technique for data recovery in digital forensics investigation and is particularly useful when filesystem metadata is unavailable or damaged. The research on reassembly of JPEG files with RST markers, fragmented within the scan area have been done before. However, fragmentation within Define Huffman Table (DHT) segment is yet to be resolved. This paper analyzes the fragmentation within the DHT area and list out all the fragmentation possibilities. Two main contributions are made in this paper. Firstly, three fragmentation points within DHT area are listed. Secondly, few novel validators are proposed to detect these fragmentations. The result obtained from tests done on manually fragmented JPEG files, showed that all three fragmentation points within DHT are successfully detected using validators.

  2. Production of a phage-displayed single chain variable fragment ...

    African Journals Online (AJOL)

    Abstract. Purpose: To develop specific single chain variable fragments (scFv) against ... libraries. The binding ability of the selected scFv antibody fragments against the IBDV particles was ..... Hermelink H, Koscielniak E. A human recombinant.

  3. Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

    Science.gov (United States)

    Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

    2018-03-01

    It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

  4. [The fragmentation of representational space in schizophrenia].

    Science.gov (United States)

    Plagnol, A; Oïta, M; Montreuil, M; Granger, B; Lubart, T

    2003-01-01

    Existent neurocognitive models of schizophrenia converge towards a core of impairments involving working memory, context processing, action planning, controlled and intentional processing. However, the emergence of this core remains itself difficult to explain and more specific hypotheses do not explain the heterogeneity of schizophrenia. To overcome these limits, we propose a new paradigm based on representational theory from cognitive science. Some recent developments of this theory enable us to describe a subjective universe as a representational space which is displayed from memory. We outline a conceptual framework to construct such a representational space from analogical -representations that can be activated in working memory and are connected to a network of symbolic structures. These connections are notably made through an analytic process of the analogical fragments, which involves the attentional focus. This framework allows us to define rigorously some defense processes in response to traumatic tensions that are expressed on the representational space. The fragmentation of representational space is a consequence of a defensive denial based on an impairment of the analytic process. The fragmentation forms some parasitic areas in memory which are excluded from the main part of the representational space and disturb information processing. The key clinical concepts of paranoid syndromes can be defined in this conceptual framework: mental automatism, delusional intuition, acute destructuration, psychotic dissociation, and autistic withdrawal. We show that these syndromes imply each other, which in return increases the fragmentation of the representational space. Some new concepts emerge naturally in this framework, such as the concept of "suture" which is defined as a link between a parasitic area and the main representational space. Schizophrenia appears as a borderline case of fragmentation of the representational space. This conceptual framework is

  5. Global patterns of fragmentation and connectivity of mammalian carnivore habitat

    OpenAIRE

    Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; Rondinini, Carlo; Boitani, Luigi

    2011-01-01

    Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges...

  6. Cross sections and kinematics of proton induced fragmentation of carbon

    International Nuclear Information System (INIS)

    Streibel, T.; Roecher, H.; Huentrup, G.; Heinrich, W.

    1997-01-01

    Charge changing fragmentation cross sections for C at a proton energy of about 70 MeV were measured. The discrepancies between measurement and model predictions indicate the necessity of further investigations. We have also measured distributions of fragment emission angles which can be described using a model with a momentum transfer to the fragmenting nucleus. The developed model leads to predictions for momentum distributions of proton induced target fragments of C at small energies. (orig.)

  7. Cross sections and kinematics of proton induced fragmentation of carbon

    Energy Technology Data Exchange (ETDEWEB)

    Streibel, T; Roecher, H; Huentrup, G; Heinrich, W [Siegen Univ. (Germany). Dept. of Physics

    1997-09-01

    Charge changing fragmentation cross sections for C at a proton energy of about 70 MeV were measured. The discrepancies between measurement and model predictions indicate the necessity of further investigations. We have also measured distributions of fragment emission angles which can be described using a model with a momentum transfer to the fragmenting nucleus. The developed model leads to predictions for momentum distributions of proton induced target fragments of C at small energies. (orig.)

  8. Effect of fragmentation on the Costa Rican dry forest avifauna

    OpenAIRE

    Barrantes, Gilbert; Ocampo, Diego; Ram?rez-Fern?ndez, Jos? D.; Fuchs, Eric J.

    2016-01-01

    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird comm...

  9. Temporal change in fragmentation of continental US forests

    Science.gov (United States)

    James D. Wickham; Kurt H. Riitters; Timothy G. Wade; Collin Homer

    2008-01-01

    Changes in forest ecosystem function and condition arise from changes in forest fragmentation. Previous studies estimated forest fragmentation for the continental United States (US). In this study, new temporal land-cover data from the National Land Cover Database (NLCD) were used to estimate changes in forest fragmentation at multiple scales for the continental US....

  10. Regional Forest Fragmentation and the Nesting Success of Migratory Birds

    Science.gov (United States)

    Scott K. Robinson; Frank R. Thompson III; Therese M. Donovan; Donald R. Whitehead; John Faaborg

    1995-01-01

    Forest fragmentation, the disruption in the continuity of forest habitat, is hypothesized to be a major cause of population decline for, some species of forest birds because fragmentation reduces nesting (reproductive) success. Nest predation and parasitism by cowbirds increased with forest fragmentation in nine midwestern (United States)landscapes that varied from 6...

  11. Fission fragment mass distributions via prompt γ-ray spectroscopy

    Indian Academy of Sciences (India)

    The distribution of fragment masses formed in nuclear fission is one of the most strik- ing features .... 80. 100. 120. 140. 160. 10. 3. 10. 4. Fragment Mass. Relative yield. Sn. Cd. Te. Pd ... the secondary fragment at Z = 50 and N = 82 shells, where the yields are depleted. Both ... More systematic experimental data are required.

  12. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  13. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  14. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  15. Production of bifunctional proteins by Aspergillus awamori: Llama variable heavy chain antibody fragment (V-HH) R9 coupled to Arthromyces ramosus peroxidase (ARP)

    NARCIS (Netherlands)

    Joosten, V.; Roelofs, M.S.; Dries, van den N.; Goosen, T.; Verrips, C.T.; Hondel, van den C.A.M.J.J.; Lokman, B.C.

    2005-01-01

    The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5'- or 3'-terminal ends of the gene encoding llama variable heavy chain antibody fragment V-HH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which

  16. Production of bifunctional proteins by Aspergillus awamori: Llama variable heavy chain antibody fragment (VHH) R9 coupled to Arthromyces ramosus peroxidase (ARP)

    NARCIS (Netherlands)

    Joosten, V.; Roelofs, M.S.; Dries, N. van den; Goosen, T.; Verrips, C.T.; Hondel, C.A.M.J.J. van den; Lokman, B.C.

    2005-01-01

    The Arthromyces ramosus peroxidase gene (arp) was genetically fused to either the 5′- or 3′-terminal ends of the gene encoding llama variable heavy chain antibody fragment VHH R9, resulting in the fusion expression cassettes ARP-R9 or R9-ARP. Aspergillus awamori transformants were obtained which

  17. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  18. Influence of spin on fission fragments anisotropy

    Directory of Open Access Journals (Sweden)

    Ghodsi Omid N.

    2005-01-01

    Full Text Available An analysis of selected fission fragment angular distribution when at least one of the spins of the projectile or target is appreciable in induced fission was made by using the statistical scission model. The results of this model predicate that the spins of the projectile or target are affected on the nuclear level density of the compound nucleus. The experimental data was analyzed by means of the couple channel spin effect formalism. This formalism suggests that the projectile spin is more effective on angular anisotropies within the limits of energy near the fusion barrier.

  19. Deciding Security for a Fragment of ASLan

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander

    situations in security such as the interaction between the work ow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding \\type-confusions" similar to some tagging results for security protocols....

  20. Fragmentation of Relativistic 56Fe Nuclei in Emulsion

    International Nuclear Information System (INIS)

    Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.

    1983-03-01

    Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)

  1. Light particles emitted with the fission fragments of thorium

    Energy Technology Data Exchange (ETDEWEB)

    San-Tsiang, T; Faraggi, H

    1947-01-01

    The traces produced by the fission of thorium with fast neutrons have been recorded photographically and studied. The formation of a light fragment of long range by either quadripartition or tripartition was not observed. The release of a short-range light fragment by bipartition was observed about one hundred times more frequently than was the release of such a fragment by tripartition. The ratio of the range of the two heavy fragments produced by tripartition was 1:2; this compares with a ratio of 1:3 for the heavy fragments produced by bipartition.

  2. SCEDS: protein fragments for molecular replacement in Phaser

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

    2013-11-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

  3. SCEDS: protein fragments for molecular replacement in Phaser

    International Nuclear Information System (INIS)

    McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

    2013-01-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

  4. Predicting "Hot" and "Warm" Spots for Fragment Binding.

    Science.gov (United States)

    Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L

    2017-05-11

    Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .

  5. Kaon fragmentation function from NJL-jet model

    International Nuclear Information System (INIS)

    Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang

    2010-01-01

    The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.

  6. Heavy-Quark Production in the Target Fragmentation Region

    CERN Document Server

    Graudenz, Dirk

    1997-01-01

    Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...

  7. Agricultural matrices affect ground ant assemblage composition inside forest fragments.

    Directory of Open Access Journals (Sweden)

    Diego Santana Assis

    Full Text Available The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates; sugarcane (3; and pasture (3. At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart. Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

  8. Agricultural matrices affect ground ant assemblage composition inside forest fragments.

    Science.gov (United States)

    Assis, Diego Santana; Dos Santos, Iracenir Andrade; Ramos, Flavio Nunes; Barrios-Rojas, Katty Elena; Majer, Jonathan David; Vilela, Evaldo Ferreira

    2018-01-01

    The establishment of agricultural matrices generally involves deforestation, which leads to fragmentation of the remaining forest. This fragmentation can affect forest dynamics both positively and negatively. Since most animal species are affected, certain groups can be used to measure the impact of such fragmentation. This study aimed to measure the impacts of agricultural crops (matrices) on ant communities of adjacent lower montane Atlantic rainforest fragments. We sampled nine forest fragments at locations surrounded by different agricultural matrices, namely: coffee (3 replicates); sugarcane (3); and pasture (3). At each site we installed pitfall traps along a 500 m transect from the interior of the matrix to the interior of the fragment (20 pitfall traps ~25 m apart). Each transect was partitioned into four categories: interior of the matrix; edge of the matrix; edge of the fragment; and interior of the fragment. For each sample site, we measured ant species richness and ant community composition within each transect category. Ant richness and composition differed between fragments and matrices. Each sample location had a specific composition of ants, probably because of the influence of the nature and management of the agricultural matrices. Species composition in the coffee matrix had the highest similarity to its corresponding fragment. The variability in species composition within forest fragments surrounded by pasture was greatest when compared with forest fragments surrounded by sugarcane or, to a lesser extent, coffee. Functional guild composition differed between locations, but the most representative guild was 'generalist' both in the agricultural matrices and forest fragments. Our results are important for understanding how agricultural matrices act on ant communities, and also, how these isolated forest fragments could act as an island of biodiversity in an 'ocean of crops'.

  9. Ternary-fragmentation-driving potential energies of 252Cf

    Science.gov (United States)

    Karthikraj, C.; Ren, Zhongzhou

    2017-12-01

    Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

  10. The Munich accelerator for fission fragments MAFF

    International Nuclear Information System (INIS)

    Habs, D.; Gross, M.; Assmann, W.; Ames, F.; Bongers, H.; Emhofer, S.; Heinz, S.; Henry, S.; Kester, O.; Neumayr, J.; Ospald, F.; Reiter, P.; Sieber, T.; Szerypo, J.; Thirolf, P.G.; Varentsov, V.; Wilfart, T.; Faestermann, T.; Kruecken, R.; Maier-Komor, P.

    2003-01-01

    The Munich Accelerator for Fission Fragments MAFF has been designed for the new Munich research reactor FRM-II. It will deliver several intense beams (∼3x10 11 s -1 ) of very neutron-rich fission fragments with a final energy of 30 keV (low-energy beam) or energies between 3.7 and 5.9 MeV·A (high-energy beam). Such beams are of interest for the creation of super-heavy elements by fusion reactions, nuclear spectroscopy of exotic nuclei, but they also have a potential for applications, e.g. in medicine. Presently the Munich research reactor FRM-II is ready for operation, but authorities delay the final permission to turn the reactor critical probably till the end of 2002. Only after this final permission the financing of the major parts of MAFF can start. On the other hand all major components have been designed and special components have been tested in separate setups

  11. Inclusive projectile fragmentation in the spectator model

    International Nuclear Information System (INIS)

    Hussein, M.S.; McVoy, K.W.

    1985-01-01

    Crazing-angle single spectra for projectile fragments from nuclear collisions exhibit a broad peak centered near the beam velocity, suggesting that these observed fragments play only a 'spectator' role in the reaction. Using only this spectator assumption (but not DWBA), it is found that a 'prior form' formulation of the reaction leads, via closure, to a -type estimate of the inclusive spectator spectrum, thus relating it to the reaction cross section for the 'participant' with the target. It is shown explicitly that this expression includes an improved multi-channel version of the Udagawa-Tamura formula for the 'breakup-fusion' or incomplete fusion cross section, and identifies it as the fluctuation part of the participant-target reaction cross section. A Glauber-type estimate of the distorted wave functions which enter clearly shows how the width of the peak in the spectator spectrum arises from the 'Fermi motion' within the projectile, as in the simple Serber model, but is modified by the 'overlap geometry' of the collision. (Author) [pt

  12. Alkaline glass as induced fission fragment detectors

    International Nuclear Information System (INIS)

    Amorim, A.M.M.

    1986-01-01

    The slide glass, registered trade marks INLAB, INVICT and PERFECTA were compared. For the three kinds of glasses the following studies were done: chemical composition; general dissolution rate for hydrofluoric acid solutions of concentrations between 1 and 10M, at 30 0 C and ultrasound shaking; relative efficiency for recording fission fragment tracks from 252 Cf. The INLAB glass was selected due to the better quality of its surface after chemical etching. The HF concentration 2.5M was determined for chemical etching of INLAB glass, and the optimum etching time was chosen between 8 and 10 minutes. The thermal attenuation of latent tracks in the environmental temperature was observed for intervals uo to 31 days between the detector exposure to the fission fragment source and etching of tracks. Several methods were used for determining the detector parameters, such as: critical angle, angle of the cone and efficiency of etching. The effects of gamma irradiation from 60 Co and reactor neutrons in material properties as track detector were studied. Attenuation of latent tracks and saturation of color centers were observed for doses over 100M Rad. Since this kind of material contains uranium as impurity, uniformely distributed, slide glass were calibrated to be applied as a monitor of thermal neutron flux in nuclear reactor. (Author) [pt

  13. Improvements to a model of projectile fragmentation

    International Nuclear Information System (INIS)

    Mallik, S.; Chaudhuri, G.; Das Gupta, S.

    2011-01-01

    In a recent paper [Phys. Rev. C 83, 044612 (2011)] we proposed a model for calculating cross sections of various reaction products which arise from disintegration of projectile-like fragments resulting from heavy-ion collisions at intermediate or higher energy. The model has three parts: (1) abrasion, (2) disintegration of the hot abraded projectile-like fragment (PLF) into nucleons and primary composites using a model of equilibrium statistical mechanics, and (3) possible evaporation of hot primary composites. It was assumed that the PLF resulting from abrasion has one temperature T. Data suggested that, while just one value of T seemed adequate for most cross-section calculations, a single value failed when dealing with very peripheral collisions. We have now introduced a variable T=T(b) where b is the impact parameter of the collision. We argue that there are data which not only show that T must be a function of b but, in addition, also point to an approximate value of T for a given b. We propose a very simple formula: T(b)=D 0 +D 1 [A s (b)/A 0 ] where A s (b) is the mass of the abraded PLF and A 0 is the mass of the projectile; D 0 and D 1 are constants. Using this model we compute cross sections for several collisions and compare with data.

  14. Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

    Science.gov (United States)

    Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

    2017-02-01

    A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  16. PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration

    Directory of Open Access Journals (Sweden)

    Alexander Jonathan S

    2010-12-01

    Full Text Available Abstract The normal function of poly (ADP-ribose polymerase-1 (PARP-1 is the routine repair of DNA damage by adding poly (ADP ribose polymers in response to a variety of cellular stresses. Recently, it has become widely appreciated that PARP-1 also participates in diverse physiological and pathological functions from cell survival to several forms of cell death and has been implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging. In the CNS, PARP inhibition attenuates injury in pathologies like cerebral ischemia, trauma and excitotoxicity demonstrating a central role of PARP-1 in these pathologies. PARP-1 is also a preferred substrate for several 'suicidal' proteases and the proteolytic action of suicidal proteases (caspases, calpains, cathepsins, granzymes and matrix metalloproteinases (MMPs on PARP-1 produces several specific proteolytic cleavage fragments with different molecular weights. These PARP-1 signature fragments are recognized biomarkers for specific patterns of protease activity in unique cell death programs. This review focuses on specific suicidal proteases active towards PARP-1 to generate signature PARP-1 fragments that can identify key proteases and particular forms of cell death involved in pathophysiology. The roles played by some of the PARP-1 fragments and their associated binding partners in the control of different forms of cell death are also discussed.

  17. Thermostable cellulase from a thermomonospora gene

    Science.gov (United States)

    Wilson, D.B.; Walker, L.P.; Zhang, S.

    1997-10-14

    The invention relates to a gene isolated from Thermomonospora fusca, wherein the gene encodes a thermostable cellulase. Disclosed is the nucleotide sequence of the T. fusca gene; and nucleic acid molecules comprising the gene, or a fragment of the gene, that can be used to recombinantly express the cellulase or a catalytically active polypeptide thereof, respectively. The isolated and purified recombinant cellulase or catalytically active polypeptide may be used to hydrolyze substrate either by itself; or in combination with other cellulases, with the resultant combination having unexpected hydrolytic activity. 3 figs.

  18. MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.

    Science.gov (United States)

    The, Matthew; Käll, Lukas

    2016-03-04

    Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).

  19. Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

    Science.gov (United States)

    Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

    2018-04-01

    The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

  20. When fragments link : a bibliometric perspective on the development of fragment-based drug discovery

    NARCIS (Netherlands)

    Romasanta, A.K.S.; van der Sijde, P.C.; Hellsten, I.; Hubbard, Roderick E.; Keseru, Gyorgy M.; van Muijlwijk-Koezen, Jacqueline E.; de Esch, I.J.P.

    2018-01-01

    Fragment-based drug discovery (FBDD) is a highly interdisciplinary field, rich in ideas integrated from pharmaceutical sciences, chemistry, biology, and physics, among others. To enrich our understanding of the development of the field, we used bibliometric techniques to analyze 3642 publications in

  1. On the fragmentation of biomolecules: fragmentation of alanine dipeptide along the polypeptide chain

    DEFF Research Database (Denmark)

    Solov'yov, Ilia; Yakubovich, Alexander; Solov'yov, Andrey

    2006-01-01

    The interaction potential between amino acids in alanine dipeptide has been studied for the first time taking into account exact molecular geometry. Ab initio calculation has been performed in the framework of density functional theory taking into account all electrons in the system. The fragment...

  2. Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

    Directory of Open Access Journals (Sweden)

    Paula Eveline Ribeiro D’Anunciação

    2013-01-01

    Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

  3. A new location to split Cre recombinase for protein fragment complementation.

    Science.gov (United States)

    Rajaee, Maryam; Ow, David W

    2017-11-01

    We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Linear dose-response of acentric chromosome fragments down to 1 R of x-rays in grasshopper neuroblasts, a potential mutagen-test system

    International Nuclear Information System (INIS)

    Gaulden, M.E.; Read, C.B.

    1978-01-01

    Grasshopper-embryo neuroblasts have no spontaneous chromosome breakage; therefore they permit easy detection of agents that break chromosomes. An X-ray exposure of 1 R induces in them a detectable number of chromosome fragments. The dose-response of acentric fragment frequency fits a linear model between 0 and 128 R. Thus another cell type is added to those previously demonstrated to have no threshold dose for the induction of chromosome or gene mutations

  5. Fragger: a protein fragment picker for structural queries.

    Science.gov (United States)

    Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

    2017-01-01

    Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

  6. Anisotropy in highly charged ion induced molecule fragmentation

    International Nuclear Information System (INIS)

    Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

    2006-01-01

    Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

  7. Microbial platform technology for recombinant antibody fragment production: A review.

    Science.gov (United States)

    Gupta, Sanjeev Kumar; Shukla, Pratyoosh

    2017-02-01

    Recombinant antibody fragments are being used for the last few years as an important therapeutic protein to cure various critical and life threatening human diseases. Several expression platforms now days employed for the production of these recombinant fragments, out of which bacterial system has emerged a promising host for higher expression. Since, a small antibody fragment unlike full antibody does not require human-like post-translational modification therefore it is potentially expressed in prokaryotic production system. Recently, small antibody fragments such as scFvs (single-chain variable fragments) and Fabs (antibody fragments) which does not require glycosylation are successfully produced in bacteria and have commercially launched for therapeutic use as these fragments shows better tissue penetration and less immunogenic to human body compared to full-size antibody. Recently developed Wacker's ESETEC secretion technology is an efficient technology for the expression and secretion of the antibody fragment (Fab) exceeded up to 4.0 g/L while scFv up to 3.5 g/L into the fermentation broth. The Pfenex system and pOP prokaryotic expression vector are another platform used for the considerably good amount of antibody fragment production successfully. In this review, we summarize the recent progress on various expression platforms and cloning approaches for the production of different forms of antibody fragments in E. coli.

  8. Benchmarking of gene prediction programs for metagenomic data.

    Science.gov (United States)

    Yok, Non; Rosen, Gail

    2010-01-01

    This manuscript presents the most rigorous benchmarking of gene annotation algorithms for metagenomic datasets to date. We compare three different programs: GeneMark, MetaGeneAnnotator (MGA) and Orphelia. The comparisons are based on their performances over simulated fragments from one hundred species of diverse lineages. We defined four different types of fragments; two types come from the inter- and intra-coding regions and the other types are from the gene edges. Hoff et al. used only 12 species in their comparison; therefore, their sample is too small to represent an environmental sample. Also, no predecessors has separately examined fragments that contain gene edges as opposed to intra-coding regions. General observations in our results are that performances of all these programs improve as we increase the length of the fragment. On the other hand, intra-coding fragments of our data show low annotation error in all of the programs if compared to the gene edge fragments. Overall, we found an upper-bound performance by combining all the methods.

  9. Next-generation sequencing of multiple individuals per barcoded library by deconvolution of sequenced amplicons using endonuclease fragment analysis

    DEFF Research Database (Denmark)

    Andersen, Jeppe D; Pereira, Vania; Pietroni, Carlotta

    2014-01-01

    The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease...... digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72...... individuals using only 24 barcoded libraries....

  10. AFM picking-up manipulation of the metaphase chromosome fragment by using the tweezers-type probe

    International Nuclear Information System (INIS)

    Yamanaka, Keiichiro; Saito, Masato; Shichiri, Motoharu; Sugiyama, Sigeru; Takamura, Yuzuru; Hashiguchi, Gen; Tamiya, Eiichi

    2008-01-01

    We have studied the development of a new procedure based on atomic force microscopy (AFM) for the analysis of metaphase chromosome. The aim of this study was to obtain detailed information about the specific locations of genes on the metaphase chromosome. In this research, we performed the manipulation of the metaphase chromosome by using novel AFM probes to obtain chromosome fragments of a smaller size than the ones obtained using the conventional methods, such as glass microneedles. We could pick up the fragment of the metaphase chromosome dissected by the knife-edged probe by using our tweezers-type probe

  11. Deciding Security for a Fragment of ASLan

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander

    2012-01-01

    situations in security such as the interaction between the workflow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound......ASLan is the input language of the verification tools of the AVANTSSAR platform, and an extension of the AVISPA Intermediate Format IF. One of ASLan's core features over IF is to integrate a transition system with Horn clauses that are evaluated at every state. This allows for modeling many common...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding “type-confusions” similar to some tagging results for security protocols....

  12. A semiclassical model for quark jet fragmentation

    International Nuclear Information System (INIS)

    Andersson, B.; Gustafson, G.; Peterson, C.

    1979-01-01

    A semiclassical model is presented for the way the energy of a fast quark is transformed into observable hadrons. It reproduces the features of 1+1 dimensional QED (the Schwinger model) concerning a flat rapidity distribution in the central region. It also reproduces results from phenomenological considerations, which, based upon scaling, predict that meson formation in the fragmentation region can be described by an iterative scheme, implying a set of coupled integral equations. In particular the model predicts that the probability to find a meson containing the leading quark is independent of the Feynman scaling variable z. The iterative structure corresponds to a Brownian motion with relevance both to the cofinement problems and to the distribution of mass in the quark jet. (orig.) [de

  13. Characterization of IFR metal fuel fragmentation

    International Nuclear Information System (INIS)

    Gabor, J.D.; Purviance, R.T.; Aeschlimann, R.W.; Spencer, B.W.

    1987-01-01

    The integral fast reactor (IFR) employs a reactor design that has inherent safety features. An important safety advantage is derived from its pool configuration, which facilitates passive decay heat removal and isolates the core from accidents that might occur elsewhere in the plant. The metal-alloy fuel has superior heat transfer properties compared to oxide fuels. While the IFR design has these inherent safety features, a complete analysis of reactor safety requires assessment of the consequences of the melting of the uranium alloy fuel in the core and the contact of molten core materials with sodium. A series of eight tests was conducted in which the fragmentation and interaction behavior of kilogram quantities of uranium-zirconium alloy in sodium was studied

  14. FLORULA URBAN FRAGMENT OF TROPICAL DRY FOREST

    Directory of Open Access Journals (Sweden)

    Willington Barranco-Pérez

    2016-01-01

    Full Text Available The aim of this study was to record the composition of plant species in an urban fragment of tropical dry forest of secondary regeneration (bs-T to generate information that can be used in the planning and management of green spaces in the city of Santa Marta. Transects of 2 x 50 m were established equivalent to 0.1 ha and all species were counted >1.0 cm DBH (Diameter at Breast Height: 1.3m. 100 species of angiosperms were recorded of which 47% have herbaceous habit. The number of species recorded in this study represents 39.6% of the species reported for the hills of Santa Marta and 3.8% for the dry forests of Colombia. It is suggested to isolate this type of secondary formations of any intervention and contemplate the reintroduction of individuals and conservation strategies.

  15. Couleur de temps, fragments d’histoires.

    Directory of Open Access Journals (Sweden)

    Daniel Russo

    2003-12-01

    Full Text Available Exposition « Couleur de temps, fragments d’histoires : XIIe-XXe siècles », Dijon, Musée Archéologique, 20 juin-2 novembre 2003Le travail est le résultat d’une collaboration entre l’Université, les Services de l’Inventaire, le Musée Archéologique et l’“Association Patrimoine Ambiance et Couleurs en Bourgogne”. Dix ans après l’exposition “D’ocre et d’Azur”, en 1992, et la parution du catalogue, il était opportun de revenir sur les découvertes et les redécouvertes de peintures murales en Bourgog...

  16. Mind the gap; seven reasons to close fragmented genome assemblies.

    Science.gov (United States)

    Thomma, Bart P H J; Seidl, Michael F; Shi-Kunne, Xiaoqian; Cook, David E; Bolton, Melvin D; van Kan, Jan A L; Faino, Luigi

    2016-05-01

    Like other domains of life, research into the biology of filamentous microbes has greatly benefited from the advent of whole-genome sequencing. Next-generation sequencing (NGS) technologies have revolutionized sequencing, making genomic sciences accessible to many academic laboratories including those that study non-model organisms. Thus, hundreds of fungal genomes have been sequenced and are publically available today, although these initiatives have typically yielded considerably fragmented genome assemblies that often lack large contiguous genomic regions. Many important genomic features are contained in intergenic DNA that is often missing in current genome assemblies, and recent studies underscore the significance of non-coding regions and repetitive elements for the life style, adaptability and evolution of many organisms. The study of particular types of genetic elements, such as telomeres, centromeres, repetitive elements, effectors, and clusters of co-regulated genes, but also of phenomena such as structural rearrangements, genome compartmentalization and epigenetics, greatly benefits from having a contiguous and high-quality, preferably even complete and gapless, genome assembly. Here we discuss a number of important reasons to produce gapless, finished, genome assemblies to help answer important biological questions. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.

    Science.gov (United States)

    Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A

    2009-07-01

    Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.

  18. Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿

    Science.gov (United States)

    Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.

    2009-01-01

    Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766

  19. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  20. Fragmentation Pathways of Lithiated Hexose Monosaccharides

    Science.gov (United States)

    Abutokaikah, Maha T.; Frye, Joseph W.; Tschampel, John; Rabus, Jordan M.; Bythell, Benjamin J.

    2018-05-01

    We characterize the primary fragmentation reactions of three isomeric lithiated D-hexose sugars (glucose, galactose, and mannose) utilizing tandem mass spectrometry, regiospecific labeling, and theory. We provide evidence that these three isomers populate similar fragmentation pathways to produce the abundant cross-ring cleavage peaks (0,2A1 and 0,3A1). These pathways are highly consistent with the prior literature (Hofmeister et al. J. Am. Chem. Soc. 113, 5964-5970, 1991, Bythell et al. J. Am. Soc. Mass Spectrom. 28, 688-703, 2017, Rabus et al. Phys. Chem. Chem. Phys. 19, 25643-25652, 2017) and the present labeling data. However, the structure-specific energetics and rate-determining steps of these reactions differ as a function of precursor sugar and anomeric configuration. The lowest energy water loss pathways involve loss of the anomeric oxygen to furnish B1 ions. For glucose and galactose, the lithiated α-anomers generate ketone structures at C2 in a concerted reaction involving a 1,2-migration of the C2-H to the anomeric carbon (C1). In contrast, the β-anomers are predicted to form 1,3-anhydroglucose/galactose B1 ion structures. Initiation of the water loss reactions from each anomeric configuration requires distinct reactive conformers, resulting in different product ion structures. Inversion of the stereochemistry at C2 has marked consequences. Both lithiated mannose forms expel water to form 1,2-anhydromannose B1 ions with the newly formed epoxide group above the ring. Additionally, provided water loss is not instantaneous, the α-anomer can also isomerize to generate a ketone structure at C2 in a concerted reaction involving a 1,2-migration of the C2-H to C1. This product is indistinguishable to that from α-glucose. The energetics and interplay of these pathways are discussed. [Figure not available: see fulltext.

  1. Quantum Correlated Multi-Fragment Reaction Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Feagin, James M. [California State Univ., Fullerton, CA (United States)

    2017-06-30

    This grant supported research in basic atomic, molecular and optical physics related to the interactions of atoms with particles and fields. This report will focus on the 12 year period from 2004 to 2017, although the DOE–BES has supported my research every year since 1986. All of the support from the grant was used to pay summer salaries of the PI and students and travel to conferences and meetings. The results were in the form of publications in peer reviewed journals as well as conference invited talks and colloquiums. There were 12 peer reviewed publications in these 12+ years. Innovations in few-body science at molecular and nano levels are a critical component of on- going efforts to establish sustainable environmental and energy resources. The varied research paths taken will require the development of basic science on broad fronts with increasing flexi- bility to crossover technologies. We thus worked to extract understanding and quantum control of few-body microscopic systems based on our long-time experience with more conventional studies of correlated electrons and ions. Given the enormous advances over the past 20 years to our understanding of quantum cor- relations with photon interferometry, AMO collision science generally is ready to move beyond the one-particle, single-port momentum detection that has dominated collision physics since Rutherford. Nevertheless, our familiar theoretical tools for collision theory need to be up- graded to incorporate these more generalized measurement formalisms and ultimately to give incentive for a new generation of experiments. Our interest in these topics remains motivated by the recent surge in and success of exper- iments involving few-body atomic and molecular fragmentation and the detection of all the fragments. The research described here thus involved two parallel efforts with (i) emphasis on reaction imaging while (ii) pursuing longtime work on quantum correlated collective excitations.

  2. arXiv Generalized Fragmentation Functions for Fractal Jet Observables

    CERN Document Server

    Elder, Benjamin T.; Thaler, Jesse; Waalewijn, Wouter J.; Zhou, Kevin

    2017-06-15

    We introduce a broad class of fractal jet observables that recursively probe the collective properties of hadrons produced in jet fragmentation. To describe these collinear-unsafe observables, we generalize the formalism of fragmentation functions, which are important objects in QCD for calculating cross sections involving identified final-state hadrons. Fragmentation functions are fundamentally nonperturbative, but have a calculable renormalization group evolution. Unlike ordinary fragmentation functions, generalized fragmentation functions exhibit nonlinear evolution, since fractal observables involve correlated subsets of hadrons within a jet. Some special cases of generalized fragmentation functions are reviewed, including jet charge and track functions. We then consider fractal jet observables that are based on hierarchical clustering trees, where the nonlinear evolution equations also exhibit tree-like structure at leading order. We develop a numeric code for performing this evolution and study its phen...

  3. Land reform and land fragmentation in Central and Eastern Europe

    DEFF Research Database (Denmark)

    Hartvigsen, Morten B.

    2014-01-01

    It has often been stated that land fragmentation and farm structures characterized by small agricultural holdings and farms divided in a large number of parcels have been the side-effect of land reform in Central and Eastern Europe. This article reports the findings of a study of land reform in 25...... countries in the region from 1989 and onwards and provides an overview of applied land reform approaches. With a basis in theory on land fragmentation, the linkage between land reform approaches and land fragmentation is explored. It is discussed in which situations land fragmentation is a barrier...... for the development of the agricultural and rural sector. The main finding is that land fragmentation is often hampering agricultural and rural development when both land ownership and land use is highly fragmented....

  4. Effective Fragmentation and Flyrock Control Strategies at Quarries

    Directory of Open Access Journals (Sweden)

    Sedat Esen

    2017-01-01

    Full Text Available This paper presents the effective fragmentation and flyrock control strategies that could be applied at quarries to improve the productivity and safety. Fragmentation measurement and modelling as well as a comprehensive drill and blast audit are essential for improving the fragmentation. Face profiling and bore tracking are good tools to manage the ―as-designed‖ and ―as-drilled‖ conditions to get reasonable fragmentation from face burden zone and minimise the flyrock risk. In general, a large scatter in fragmentation data was observed at sites and the causes should be analysed by a detailed root-cause analysis technique. Two case studies were presented in this paper showing some of the effective fragmentation strategies. Finally, a flyrock model was shown to determine the safe blast exclusion zone for the mining equipment and personnel. Some key guidelines were suggested to minimise the occurrence of the flyrock.

  5. Fragmentation of dimethyl ether in femtosecond intense field

    Science.gov (United States)

    Zhu, Jingyi; Guo, Wei; Wang, Yanqiu; Wang, Li

    2006-08-01

    The fragmentation of dimethyl ether (DME) in intense femtosecond laser field has been studied at 810, 405 and 270 nm with intensities up to 2.48 × 10 15, 3.86 × 10 15 and 1.62 × 10 14 W/cm 2, respectively. At 405 nm, DME is possibly firstly ionized by multiphoton absorption, and then parent ion DME + dissociates into fragments via filed-induced dissociation. For 810 and 270 nm laser fields, DME firstly dissociates into CH 3O and CH 3 fragments and then these neutral fragments are ionized by field tunneling. Another possible way for DME to dissociate at 810 and 270 nm is that DME is ionized by intense field ejection of inner valance electron and then the excited DME + dissociates into fragment ions. Ultrafast rearrangement of DME or DME + in intense field may be responsible to the unpredictable fragment ions, CHO+/C2H5+andH2+.

  6. On the application of gluon to heavy quarkonium fragmentation function

    International Nuclear Information System (INIS)

    Qi Wei; Wang Jianxiong

    2007-01-01

    We analyze the uncertainties induced by different definitions of the momentum fraction z in the application of gluon to heavy quarkonium fragmentation function. We numerically calculate the initial g→J/ψ fragmentation functions by using the non-covariant definitions of z with finite gluon momentum and find that these fragmentation functions have strong dependence on the gluon momentum k. As |k|→∞, these fragmentation functions approach to the fragmentation function in the light-cone definition. We find that when |k| is small (for instance in the typical energy scale (about 4-20GeV) of the gluon production at the hadron colliders, such as Tevatron and LHC), large uncertainty remains while the in-covariant definitions of z are employed in the application of the fragmentation functions. (authors)

  7. Public Values in Water Law: A Case of Substantive Fragmentation?

    OpenAIRE

    Ambrus, Monika; Gilissen, Herman Kasper; van Kempen, Jasper JH

    2014-01-01

    Horizontal fragmentation, from a public-values perspective, is a quite well-documented phenomenon in international (water) law. However, the literature does not provide any insight into vertical or substantive fragmentation, i.e. differences in the protection of public values at the various institutional levels. This article assesses whether there is substantive fragmentation in water law at the international, the European, the sub-regional (Danube River Basin), and the Dutch domestic level. ...

  8. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Science.gov (United States)

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  9. Habitat connectivity and fragmented nuthatch populations in agricultural landscapes

    OpenAIRE

    Langevelde, van, F.

    1999-01-01

    In agricultural landscapes, the habitat of many species is subject to fragmentation. When the habitat of a species is fragmented and the distances between patches of habitat are large relative to the movement distances of the species, it can be expected that the degree of habitat connectivity affects processes at population and individual level. In this thesis, I report on a study of effects of habitat fragmentation and opportunities to mitigate these effects by planning ecological n...

  10. RECOVERY OF DOCUMENT TEXT FROM TORN FRAGMENTS USING IMAGE PROCESSING

    OpenAIRE

    C.Prasad; Dr.Mahesh; Dr.S.A.K. Jilani

    2016-01-01

    Recovery of document from its torn or damaged fragments play an important role in the field of forensics and archival study. Reconstruction of the torn papers manually with the help of glue and tapes etc., is tedious, time consuming and not satisfactory. For torn images reconstruction we go for image mosaicing, where we reconstruct the image using features (corners) and RANSAC with homography.But for the torn fragments there is no such similarity portion between fragments. Hence we propose a ...

  11. Observation for really cold fragmentation of heavy nucleus

    International Nuclear Information System (INIS)

    Goverdovskij, A.A.; Ketlerov, V.V.; Mitrofanov, V.F.; Ostapenko, Yu.B.; Khryachkov, V.A.

    1998-01-01

    The results of the detailed study on mass-energy charged correlations of the thorium-232 fission fragments, produced by the 5 MeV neutrons are presented. The event of the thorium nucleus really cold fragmentation into tellurium-134 and strontium-99 at the basic quantum states is identified. It is shown that the whole reaction energy is exhausted by the motion kinetic energy of the fragments in the mutual field

  12. Structural mechanisms of photoeffect in polyimide structures containing heterocyclic fragments

    International Nuclear Information System (INIS)

    Aleksandrova, E. L.

    2006-01-01

    Trends in the variation in the quantum yields of charge-carrier photogeneration in polyimide structures containing heterocyclic fragments are studied. It is shown that the efficiency of sensitization of polyimides depends on the donor and acceptor properties of the fragments of monomeric units of the polyimide. It is established that the range of spectral sensitivity for heterocyclic fragments representing intramolecular complexes with charge transport is wider than that for heterocycles that do not represent such complexes

  13. Oral lead bullet fragment exposure in northern bobwhite (Colinus virginianus).

    Science.gov (United States)

    Kerr, Richard; Holladay, Jeremy; Holladay, Steven; Tannenbaum, Lawrence; Selcer, Barbara; Meldrum, Blair; Williams, Susan; Jarrett, Timothy; Gogal, Robert

    2011-11-01

    Lead (Pb) is a worldwide environmental contaminant known to adversely affect multiple organ systems in both mammalian and avian species. In birds, a common route of exposure is via oral ingestion of lead particles. Data are currently lacking for the retention and clearance of Pb bullet fragments in gastrointestinal (GI) tract of birds while linking toxicity with blood Pb levels. In the present study, northern bobwhite quail fed a seed-based diet were orally gavaged with Pb bullet fragments (zero, one or five fragments/bird) and evaluated for rate of fragment clearance, and changes in peripheral blood, renal, immune, and gastrointestinal parameters. Based on radiographs, the majority of the birds cleared or absorbed the fragments by seven days, with the exception of one five-fragment bird which took between 7 and 14 days. Blood Pb levels were higher in males than females, which may be related to egg production in females. In males but not females, feed consumption, body weight gain, packed cell volume (PCV), plasma protein concentration, and δ-aminolevulinic acid dehydratase (δ-ALAD) activity were all adversely affected by five Pb fragments. Birds of both sexes that received a single Pb fragment displayed depressed δ-ALAD, suggesting altered hematologic function, while all birds dosed with five bullet fragments exhibited greater morbidity.

  14. The split comets: gravitational interaction between the fragments

    International Nuclear Information System (INIS)

    Sekanina, Z.

    1979-01-01

    The n-body computer program by Schubart and Stumpff (1966) has been slightly modified to study the gravitational interaction between two fragments of a split comet nucleus in the sun's gravitational field. All calculations refer to the orbit of Comet West (1976 VI), the velocity of separation of the fragments is assumed to be equal in magnitude to the velocity of escape from the parent nucleus, and the numerical integration of the relative motion of one fragment (called the companion) with respect to the other (principal fragment) is carried over the period of 200 days from separation. (Auth.)

  15. Improved Barriers to Turbine Engine Fragments: Interim Report II

    National Research Council Canada - National Science Library

    Shockey, Donald

    1999-01-01

    Because fragments from in-flight engine failures can damage critical aircraft components and produce catastrophic consequences, the Federal Aviation Administration is sponsoring research to mitigate...

  16. Quantitative experimental modelling of fragmentation during explosive volcanism

    Science.gov (United States)

    Thordén Haug, Ø.; Galland, O.; Gisler, G.

    2012-04-01

    Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of

  17. Fuel fragmentation data review and separate effects testing

    International Nuclear Information System (INIS)

    Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.

    2014-01-01

    A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)

  18. The multi-step prompt particle emission from fission fragments

    International Nuclear Information System (INIS)

    Zhivopistsev, A.; Oprea, C.; Oprea, I.

    2003-01-01

    The purpose of this work is the study of non-equilibrium high-energy gamma emission from 252 Cf. In the framework of the formalism of statistical multi-step compound processes in nuclear reactions. A relation was found between the shape of the high-energy part of the gamma spectrum and different mechanisms of excitation of the fission fragments. Agreement with experimental data for different groups of fission fragments was obtained. The analysis of the experimental high-energy part of gamma spectra yields information about the mechanism of excitation of fission fragments. The influence of dissipation of the deformation excess on intrinsic excitation of fission fragments was studied. (authors)

  19. The effective fragment molecular orbital method for fragments connected by covalent bonds.

    Directory of Open Access Journals (Sweden)

    Casper Steinmann

    Full Text Available We extend the effective fragment molecular orbital method (EFMO into treating fragments connected by covalent bonds. The accuracy of EFMO is compared to FMO and conventional ab initio electronic structure methods for polypeptides including proteins. Errors in energy for RHF and MP2 are within 2 kcal/mol for neutral polypeptides and 6 kcal/mol for charged polypeptides similar to FMO but obtained two to five times faster. For proteins, the errors are also within a few kcal/mol of the FMO results. We developed both the RHF and MP2 gradient for EFMO. Compared to ab initio, the EFMO optimized structures had an RMSD of 0.40 and 0.44 Å for RHF and MP2, respectively.

  20. When fragments link: a bibliometric perspective on the development of fragment-based drug discovery.

    Science.gov (United States)

    Romasanta, Angelo K S; van der Sijde, Peter; Hellsten, Iina; Hubbard, Roderick E; Keseru, Gyorgy M; van Muijlwijk-Koezen, Jacqueline; de Esch, Iwan J P

    2018-05-05

    Fragment-based drug discovery (FBDD) is a highly interdisciplinary field, rich in ideas integrated from pharmaceutical sciences, chemistry, biology, and physics, among others. To enrich our understanding of the development of the field, we used bibliometric techniques to analyze 3642 publications in FBDD, complementing accounts by key practitioners. Mapping its core papers, we found the transfer of knowledge from academia to industry. Co-authorship analysis showed that university-industry collaboration has grown over time. Moreover, we show how ideas from other scientific disciplines have been integrated into the FBDD paradigm. Keyword analysis showed that the field is organized into four interconnected practices: library design, fragment screening, computational methods, and optimization. This study highlights the importance of interactions among various individuals and institutions from diverse disciplines in newly emerging scientific fields. Copyright © 2018. Published by Elsevier Ltd.