WorldWideScience

Sample records for b-globin gene fragments

  1. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  2. Fate of a redundant gamma-globin gene in the atelid clade of New World monkeys: implications concerning fetal globin gene expression.

    Science.gov (United States)

    Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M

    1995-01-01

    Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927

  3. Inactivation of human α-globin gene expression by a de novo deletion located upstream of the α-globin gene cluster

    International Nuclear Information System (INIS)

    Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.

    1990-01-01

    Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes

  4. Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids

    DEFF Research Database (Denmark)

    Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S

    2008-01-01

    Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...

  5. Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus

    Directory of Open Access Journals (Sweden)

    Weiqun Lu

    2011-01-01

    Full Text Available In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW- than in seawater- (SW-adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.

  6. Molecular nature of alpha-globin genes in the Saudi population

    Directory of Open Access Journals (Sweden)

    J. Francis Borgio

    2015-11-01

    Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.

  7. Asynchronous DNA replication within the human β-globin gene locus

    International Nuclear Information System (INIS)

    Epner, E.; Forrester, W.C.; Groudine, M.

    1988-01-01

    The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks

  8. Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

    Science.gov (United States)

    Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

    2016-10-01

    β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Genetic relationships among native americans based on b-globin gene cluster haplotype frequencies

    OpenAIRE

    Mousinho-Ribeiro Rita de Cassia; Pante-de-Sousa Gabriella; Santos Eduardo José Melo dos; Guerreiro João Farias

    2003-01-01

    The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village), Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13) had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - -) was the most common in all groups studied, with frequencies varying from 70% to 100%, followed...

  10. Human γ-globin genes silenced independently of other genes in the β-globin locus.

    NARCIS (Netherlands)

    N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'

  11. Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

    Science.gov (United States)

    Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

    2017-07-11

    In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

  12. In vivo protein-DNA interactions at the β-globin gene locus

    International Nuclear Information System (INIS)

    Tohru Ikuta; Yuet Wai Kan

    1991-01-01

    The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells

  13. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  14. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  15. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  16. Importance of globin gene order for correct developmental expression.

    NARCIS (Netherlands)

    O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

  17. Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

    Science.gov (United States)

    Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

    2009-12-01

    Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

  18. Regulated expression of genes inserted at the human chromosomal β-globin locus by homologous recombination

    International Nuclear Information System (INIS)

    Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.

    1988-01-01

    The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation

  19. Distinctive patterns of evolution of the δ-globin gene (HBD in primates.

    Directory of Open Access Journals (Sweden)

    Ana Moleirinho

    Full Text Available In most vertebrates, hemoglobin (Hb is a heterotetramer composed of two dissimilar globin chains, which change during development according to the patterns of expression of α- and β-globin family members. In placental mammals, the β-globin cluster includes three early-expressed genes, ε(HBE-γ(HBG-ψβ(HBBP1, and the late expressed genes, δ (HBD and β (HBB. While HBB encodes the major adult β-globin chain, HBD is weakly expressed or totally silent. Paradoxically, in human populations HBD shows high levels of conservation typical of genes under strong evolutionary constraints, possibly due to a regulatory role in the fetal-to-adult switch unique of Anthropoid primates. In this study, we have performed a comprehensive phylogenetic and comparative analysis of the two adult β-like globin genes in a set of diverse mammalian taxa, focusing on the evolution and functional divergence of HBD in primates. Our analysis revealed that anthropoids are an exception to a general pattern of concerted evolution in placental mammals, showing a high level of sequence conservation at HBD, less frequent and shorter gene conversion events. Moreover, this lineage is unique in the retention of a functional GATA-1 motif, known to be involved in the control of the developmental expression of the β-like globin genes. We further show that not only the mode but also the rate of evolution of the δ-globin gene in higher primates are strictly associated with the fetal/adult β-cluster developmental switch. To gain further insight into the possible functional constraints that have been shaping the evolutionary history of HBD in primates, we calculated dN/dS (ω ratios under alternative models of gene evolution. Although our results indicate that HBD might have experienced different selective pressures throughout primate evolution, as shown by different ω values between apes and Old World Monkeys + New World Monkeys (0.06 versus 0.43, respectively, these estimates

  20. High-level transfer and long-term expression of the human beta-globin gene in a mouse transplant model.

    Science.gov (United States)

    Raftopoulos, H; Ward, M; Bank, A

    1998-06-30

    Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.

  1. Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

    Directory of Open Access Journals (Sweden)

    Supachai Ekwattanakit

    2012-01-01

    Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

  2. Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.

    Science.gov (United States)

    Raftopoulos, H; Ward, M; Leboulch, P; Bank, A

    1997-11-01

    Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.

  3. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    Energy Technology Data Exchange (ETDEWEB)

    Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  4. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

    1988-01-01

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  5. Human β-globin locus control region: Analysis of the 5' DNase I hypersensitive site HS 2 in transgenic mice

    International Nuclear Information System (INIS)

    Caterina, J.J.; Ryan, T.M.; Pawlik, K.M.; Townes, T.M.; Brinster, R.L.; Behringer, R.R.; Palmiter, R.D.

    1991-01-01

    The human β-globin locus control region (LCR) is essential for high-level expression of human var-epsilon-, γ-, and β-globin genes. Developmentally stable DNase I hypersensitive sites (designated HS) mark sequences within this region that are important for LCR activity. A 1.9-kilobase (kb) fragment containing the 5' HS 2 site enhances human β-globin gene expression 100-fold in transgenic mice and also confers position-independent expression. To further define important sequences within this region, deletion mutations of the 1.9-kb fragment were introduced upstream of the human β-globin gene, and the constructs were tested for activity in transgenic mice. Although enhancer activity was gradually lost with deletion of both 5' and 3' sequences, a 373-base-pair (BP) fragment retained the ability to confer relative position-independent expression. Three prominent DNase I footprints were observed in this region with extracts from the human erythroleukemia cell line K-562, one of which contained duplicated binding sites for transcription factor AP-1 (activator protein 1). When the 1.9-kb fragment containing an 19-bp deletion of the AP-1 binding sites was tested in transgenic mice, enhancer activity decreased 20-fold but position-independent expression was retained

  6. Compensatory increase in alpha 1-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion.

    OpenAIRE

    Liebhaber, S A; Cash, F E; Main, D M

    1985-01-01

    alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...

  7. Genome scan identifies a locus affecting gamma-globin expression in human beta-cluster YAC transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.

    2000-03-01

    Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.

  8. Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

    Science.gov (United States)

    Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

    2018-01-01

    The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

  9. Activation of Fetal γ-globin Gene Expression via Direct Protein Delivery of Synthetic Zinc-finger DNA-Binding Domains

    Directory of Open Access Journals (Sweden)

    Mir A Hossain

    2016-01-01

    Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.

  10. Chicken globin gene transcription is cell lineage specific during the time of the switch

    International Nuclear Information System (INIS)

    Lois, R.; Martinson, H.G.

    1989-01-01

    Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position

  11. Expression of human gamma-globin genes in human erythroleukemia (K562) cells.

    Science.gov (United States)

    Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A

    1987-12-15

    K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.

  12. The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

    NARCIS (Netherlands)

    E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

    1983-01-01

    textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

  13. S1 nuclease analysis of α-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells

    International Nuclear Information System (INIS)

    Helder, J.; Deisseroth, A.

    1987-01-01

    The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients

  14. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    Science.gov (United States)

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  15. Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

    NARCIS (Netherlands)

    Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)

    2018-01-01

    textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of

  16. Position-independent high level expression of the human β-globin gene in transgenic mice.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)

    1987-01-01

    textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of

  17. The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

    Science.gov (United States)

    Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

    2017-01-01

    Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

  18. Dominant control region of the human β- like globin gene cluster

    NARCIS (Netherlands)

    Blom van Assendelft, Margaretha van

    1989-01-01

    The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

  19. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    Directory of Open Access Journals (Sweden)

    Giulia Breveglieri

    2015-01-01

    Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

  20. Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

    Science.gov (United States)

    Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

  1. Conservation of the primary structure, organization, and function of the human and mouse β-globin locus-activating regions

    International Nuclear Information System (INIS)

    Moon, A.M.; Ley, T.J.

    1990-01-01

    DNA sequences located in a region 6-18 kilobases (kb) upstream from the human ε-globin gene are known as the locus-activating region (LAR) or dominant control region. This region is thought to play a key role in chromatin organization of the β-like globin gene cluster during erythroid development. Since the human β-globin LAR is functional in mice, the authors reasoned that critical LAR sequence elements might be conserved between mice and humans. They therefore cloned murine genomic sequences homologous to one portion of the human LAR. They found that this murine DNA fragment (mouse LAR site II) and sequences homologous to human LAR sites I and III are located upstream from the mouse β-like globin gene cluster and determined that their locations relative to the cluster are similar to that of their human counterparts. The homologous site II sequences are 70% identical between mice and humans over a stretch of ∼800 base pairs. These results suggest that primary structural elements endash and the spatial organization of these elements endash are important for function of the β-globin LAR

  2. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    International Nuclear Information System (INIS)

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  3. A phylogenomic profile of globins

    Directory of Open Access Journals (Sweden)

    Dewilde Sylvia

    2006-04-01

    Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.

  4. Chromosome 11-linked determinant controls fetal globin expression and the fetal-to-adult globin switch

    International Nuclear Information System (INIS)

    Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.

    1987-01-01

    Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11

  5. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

    International Nuclear Information System (INIS)

    Evans, T.; Reitman, M.; Felsenfeld, G.

    1988-01-01

    The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

  6. Allele specific hybridization using oligonucleotide probes of very high specific activity: Discrimination of the human β/sup A/ and β/sup S/-globin genes

    International Nuclear Information System (INIS)

    Studencki, A.B.; Wallace, R.B.

    1984-01-01

    The repair activity of E. coli DNA polymerase I (Klenow fragment) was used to prepare nonadecanucleotide hybridization probes which were complementary either to the normal human β-globin (β/sup A/) or to the sickle cell human β-globin (β/sup S/) gene. Template directed polymerization of highly radiolabeled α-/sup 32/P-deoxyribonucleoside triphosphates (3200, 5000 and/or 7800 Ci/mmol) onto nonamer and decamer primers produced probes with specific activities ranging from 1.0 - 2.0 x 10/sup 10/ dpm/μg. The extremely high specific activities of these probes made it possible to detect the β/sup A/ and β/sup S/ single copy gene sequences in as little as 1 μg of total human genomic DNA as well as to discriminate between the homozygous and heterozygous states. This means that it was possible to detect 0.5 - 1.0 x 10/sup -18/ moles of a given single copy sequence

  7. Geographical distribution of β-globin gene mutations in Syria.

    Science.gov (United States)

    Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

    2018-04-11

    Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

  8. A new gene deletion in the alpha-like globin gene cluster as the molecular basis for the rare alpha-thalassemia-1(--/alpha alpha) in blacks: HbH disease in sickle cell trait.

    Science.gov (United States)

    Steinberg, M H; Coleman, M B; Adams, J G; Hartmann, R C; Saba, H; Anagnou, N P

    1986-02-01

    A novel deletion of at least 26 kilobase of DNA, including both alpha-globin genes, the psi alpha- and psi zeta-globin genes, but sparing the functional zeta-gene was found in a 10-year-old black boy with HbH disease and sickle cell trait. This particular deletion has not previously been described in blacks. Its existence makes it likely that the absence of Hb Barts hydrops fetalis in blacks is due to the rarity of the chromosome lacking two alpha-globin genes rather than a result of early embryonic death due to the failure to synthesize embryonic hemoglobins because of deletion of functional zeta-globin genes.

  9. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  10. Genetic relationships among native americans based on beta-globin gene cluster haplotype frequencies

    Directory of Open Access Journals (Sweden)

    Rita de Cassia Mousinho-Ribeiro

    2003-01-01

    Full Text Available The distribution of b-globin gene haplotypes was studied in 209 Amerindians from eight tribes of the Brazilian Amazon: Asurini from Xingú, Awá-Guajá, Parakanã, Urubú-Kaapór, Zoé, Kayapó (Xikrin from the Bacajá village, Katuena, and Tiriyó. Nine different haplotypes were found, two of which (n. 11 and 13 had not been previously identified in Brazilian indigenous populations. Haplotype 2 (+ - - - - was the most common in all groups studied, with frequencies varying from 70% to 100%, followed by haplotype 6 (- + + - +, with frequencies between 7% and 18%. The frequency distribution of the b-globin gene haplotypes in the eighteen Brazilian Amerindian populations studied to date is characterized by a reduced number of haplotypes (average of 3.5 and low levels of heterozygosity and intrapopulational differentiation, with a single clearly predominant haplotype in most tribes (haplotype 2. The Parakanã, Urubú-Kaapór, Tiriyó and Xavante tribes constitute exceptions, presenting at least four haplotypes with relatively high frequencies. The closest genetic relationships were observed between the Brazilian and the Colombian Amerindians (Wayuu, Kamsa and Inga, and, to a lesser extent, with the Huichol of Mexico. North-American Amerindians are more differentiated and clearly separated from all other tribes, except the Xavante, from Brazil, and the Mapuche, from Argentina. A restricted pool of ancestral haplotypes may explain the low diversity observed among most present-day Brazilian and Colombian Amerindian groups, while interethnic admixture could be the most important factor to explain the high number of haplotypes and high levels of diversity observed in some South-American and most North-American tribes.

  11. Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

    Science.gov (United States)

    Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

    2016-05-17

    ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  13. Same β-globin gene mutation is present on nine different β-thalassemia chromosomes in a Sardinian population

    International Nuclear Information System (INIS)

    Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

    1987-01-01

    The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region

  14. Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

    Science.gov (United States)

    Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

    2017-12-30

    Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

  15. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    International Nuclear Information System (INIS)

    Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

    1990-08-01

    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  16. A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations

    NARCIS (Netherlands)

    P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)

    2012-01-01

    textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative

  17. Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

    Science.gov (United States)

    Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

    2016-01-01

    Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

  18. EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

    Directory of Open Access Journals (Sweden)

    Anita Nadkarni

    2013-02-01

    Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

  19. Generation of a high-titer retroviral vector capable of expressing high levels of the human β-globin gene

    NARCIS (Netherlands)

    M. Sadelain (Michel); C.H.J. Wang (Jason); M. Antoniou (Michael); F.G. Grosveld (Frank); R.C. Mulligan

    1995-01-01

    textabstractRetrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and

  20. Application of Single Strand Conformational Polymorphism (PCR-SSCP) in Identification of Some Beta-Globin Gene Mutations in A Group of Egyptian Beta-Thalassemia Patients and Carriers

    International Nuclear Information System (INIS)

    Somaya, E.T.; Soliman, M.D

    2010-01-01

    The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)

  1. Characterization of histone H3K27 modifications in the β-globin locus

    International Nuclear Information System (INIS)

    Kim, Yea Woon; Kim, AeRi

    2011-01-01

    Research highlights: → The β-globin locus control region is hyperacetylated and monomethylated at histone H3K27. → Highly transcribed globin genes are marked by H3K27ac, but H3K27me2 is remarkable at silent globin genes in erythroid K562 cells. → Association of PRC2 subunits is comparable with H3K27me3 pattern. → Modifications of histone H3K27 are established in an enhancer-dependent manner. -- Abstract: Histone H3K27 is acetylated or methylated in the environment of nuclear chromatin. Here, to characterize the modification pattern of H3K27 in locus control region (LCR) and to understand the correlation of various H3K27 modifications with transcriptional activity of genes, we analyzed the human β-globin locus using the ChIP assay. The LCR of the human β-globin locus was enriched by H3K27ac and H3K27me1 in erythroid K562 cells. The highly transcribed globin genes were hyperacetylated at H3K27, but the repressed globin genes were highly dimethylated at this lysine in these cells. However, in non-erythroid 293FT cells, the β-globin locus was marked by a high level of H3K27me3. EZH2 and SUZ12, subunits of polycomb repressive complex 2, were comparably detected with the H3K27me3 pattern in K562 and 293FT cells. In addition, H3K27ac, H3K27me1 and H3K27me3 were established in an enhancer-dependent manner in a model minichromosomal locus containing an enhancer and its target gene. Taken together, these results show that H3K27 modifications have distinctive correlations with the chromatin state or transcription level of genes and are influenced by an enhancer.

  2. CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

    Science.gov (United States)

    Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

    2017-07-01

    In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

  3. Molecular analysis of the human β-globin locus activation region

    International Nuclear Information System (INIS)

    Forrester, W.C.; Novak, U.; Gelinas, R.; Groudine, M.

    1989-01-01

    Recently, DNA sequences containing four erythroid-specific DNase I hypersensitive sites within 20 kilobases 5' of the human ε-globin gene have been identified as an important cis-acting regulatory element, the locus activation region (LAR). Subfragments of the LAR, containing either all or only the two 5' or two 3' hypersensitive sites were linked to the human β-globin gene and analyzed for their effect on globin gene expression in stably transformed mouse erythroleukemia (MEL) cells. Constructs containing all four of the hypersensitive sites increase β-gobin mRNA levels 8- to 13-fold, while constructs with only the 5' or 3' sites increase globin expression to a lesser extent. No effect was seen when the constructs were assayed in 3T3 fibroblasts. All of the LAR derivatives form hypersensitive sites at the corresponding sequence position in MEL cells prior to and after induction of MEL cell differentiation. However, in 3T3 fibroblasts only the hypersensitive site corresponding to the previously described erythroid-specific -10.9 site was formed

  4. Long-term high-level expression of human beta-globin occurs following transplantation of transgenic marrow into irradiated mice.

    Science.gov (United States)

    Himelstein, A; Ward, M; Podda, S; de la Flor Weiss, E; Costantini, F; Bank, A

    1993-03-01

    When the human beta-globin gene is transferred into the bone marrow cells of live mice, its expression is very low. To investigate the reason for this, we transferred the bone marrow of transgenic mice containing and expressing the human beta-globin into irradiated recipients. We demonstrate that long-term high level expression of the human beta-globin gene can be maintained in the marrow and blood of irradiated recipients following transplantation. Although expression decreased over time in most animals because of host marrow reconstitution, the ratio of human beta-globin transgene expression to endogenous mouse beta-globin gene expression in donor-derived erythroid cells remained constant over time. We conclude that there is no inherent limitation to efficient expression of an exogenous human beta-globin gene in mouse bone marrow cells following marrow transplantation.

  5. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  6. Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

    Science.gov (United States)

    Kaushik, Mahima; Kukreti, Shrikant

    2015-01-01

    Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

  7. The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

    Directory of Open Access Journals (Sweden)

    Zulema Romero

    Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

  8. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  9. A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

    Science.gov (United States)

    Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

    2016-01-01

    We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

  10. Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

    Science.gov (United States)

    NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

    2018-05-10

    Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

  11. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  12. Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

    OpenAIRE

    Liebhaber, S A; Kan, Y W

    1981-01-01

    The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

  13. A membrane-bound vertebrate globin.

    Directory of Open Access Journals (Sweden)

    Miriam Blank

    Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.

  14. Contribution of long-range interactions to the secondary structure of an unfolded globin.

    Science.gov (United States)

    Fedyukina, Daria V; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C; Eun, Ye-Jin; Cavagnero, Silvia

    2010-09-08

    This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an alpha-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable alpha-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  15. Semisynthetic hemoglobin A: Reconstitution of functional tetramer from semisynthetic α-globin

    International Nuclear Information System (INIS)

    Sahni, G.; Cho, Y.J.; Iyer, K.S.; Khan, S.A.; Seetharam, R.; Acharya, A.S.

    1989-01-01

    The optimal conditions for the semisynthesis of α-globin through Staphylococcus aureus V8 protease condensation of a synthetic fragment (α 1-30 ) with the complementary apo fragment (α 31-141 ) in the presence of structure-inducing organic cosolvents and the reconstitution of the functional tetramer from semisynthetic α-globin have been investigated. The protease-catalyzed ligation of the complementary apo fragments α 1-30 and α 31-141 proceeds with very high selectivity at pH 6.0 and 4 degree C in the presence of 1-propanol as the organic cosolvent. A 30% 1-propanol solution was optimal for the semisynthetic reaction, and the synthetic reaction attained an equilibrium (approximately 50%) in 72 h. The synthetic reaction proceeds smoothly over a wide pH range (pH 5-8). Besides, the semisynthetic system is flexible, and it also proceeded well if trifluoroethanol or 2-propanol was used instead of 1-propanol. However, glycerol, a versatile organic cosolvent used in all other proteosynthetic reactions reported in the literature, was not very efficient as an organic cosolvent in the present synthetic reaction. The semisynthetic α-globin prepared with 1-propanol as the organic cosolvent has been reconstituted into HbA. The semisynthetic HbA was then purified by CM-cellulose chromatography. The semisynthetic HbA is indistinguishable from native HbA, in terms of its structural and functional properties. The semisynthetic approach provides the flexibility in protein engineering studies for the incorporation of spectroscopic labels ( 13 C- and/or 15 N-labeled amino acids), noncoded amino acids, or unnatural bond functionalities, which at present is not possible with genetic approaches

  16. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...

  17. In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

    Directory of Open Access Journals (Sweden)

    Mohammed Alanazi

    Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

  18. the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

    International Nuclear Information System (INIS)

    Abass, M.M.E.

    2004-01-01

    β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

  19. Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction

    Directory of Open Access Journals (Sweden)

    Čokić Vladan P.

    2014-01-01

    Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053

  20. Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks

    Directory of Open Access Journals (Sweden)

    Marcelo M. Santoro

    2010-10-01

    Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.

  1. Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

    Science.gov (United States)

    Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

    2005-11-01

    Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

  2. Efficient production of antibody Fab fragment by transient gene expression in insect cells.

    Science.gov (United States)

    Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

    2017-08-01

    Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

    Science.gov (United States)

    Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

    2012-01-01

    Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

  4. Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells

    Czech Academy of Sciences Publication Activity Database

    Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav

    2004-01-01

    Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004

  5. Search for antisense copies of beta-globin mRNA in anemic mouse spleen

    Directory of Open Access Journals (Sweden)

    Taylor John M

    2001-03-01

    Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

  6. Co-inheritance of the rare β hemoglobin variants Hb Yaounde, Hb Görwihl and Hb City of Hope with other alterations in globin genes: impact in genetic counseling.

    Science.gov (United States)

    Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino

    2015-04-01

    Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

    Science.gov (United States)

    Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

    2014-06-01

    Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

  8. Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

    Science.gov (United States)

    Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2015-01-01

    Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

  9. Variation in RNA-Seq transcriptome profiles of peripheral whole blood from healthy individuals with and without globin depletion.

    Directory of Open Access Journals (Sweden)

    Heesun Shin

    Full Text Available BACKGROUND: The molecular profile of circulating blood can reflect physiological and pathological events occurring in other tissues and organs of the body and delivers a comprehensive view of the status of the immune system. Blood has been useful in studying the pathobiology of many diseases. It is accessible and easily collected making it ideally suited to the development of diagnostic biomarker tests. The blood transcriptome has a high complement of globin RNA that could potentially saturate next-generation sequencing platforms, masking lower abundance transcripts. Methods to deplete globin mRNA are available, but their effect has not been comprehensively studied in peripheral whole blood RNA-Seq data. In this study we aimed to assess technical variability associated with globin depletion in addition to assessing general technical variability in RNA-Seq from whole blood derived samples. RESULTS: We compared technical and biological replicates having undergone globin depletion or not and found that the experimental globin depletion protocol employed removed approximately 80% of globin transcripts, improved the correlation of technical replicates, allowed for reliable detection of thousands of additional transcripts and generally increased transcript abundance measures. Differential expression analysis revealed thousands of genes significantly up-regulated as a result of globin depletion. In addition, globin depletion resulted in the down-regulation of genes involved in both iron and zinc metal ion bonding. CONCLUSIONS: Globin depletion appears to meaningfully improve the quality of peripheral whole blood RNA-Seq data, and may improve our ability to detect true biological variation. Some concerns remain, however. Key amongst them the significant reduction in RNA yields following globin depletion. More generally, our investigation of technical and biological variation with and without globin depletion finds that high-throughput sequencing by RNA

  10. Brain alpha- and beta-globin expression after intracerebral hemorrhage

    OpenAIRE

    He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua

    2010-01-01

    Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...

  11. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  12. Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

    Science.gov (United States)

    Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

    Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

  13. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  14. Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

    International Nuclear Information System (INIS)

    Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

    1998-01-01

    Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

  15. Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

    Science.gov (United States)

    Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

    2018-03-01

    There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

  16. Investigation of benzo(a)pyrene-globin adducts

    Energy Technology Data Exchange (ETDEWEB)

    Wallin, H; Jeffre, A M; Santella, R M

    1987-05-01

    The nature of the adducts formed between benzo(a)pyrene (BP) and globin were investigated in animals treated with (/sup 3/H)BP. Modification levels on globin were determined by radioactivity measurements. Since BP tetraols can be released from benzo(a)pyrene diol epoxide modified protein and DNA by acid treatment, globin samples were treated with acid, released tetraols separated by HPLC and quantitated by scintillation counting. In addition, acid released material was measured in competitive enzyme linked immunosorbent assay (ELISA) using antibodies which recognize BP tetraols. Both measurements indicate that only 2% of bound radioactivity could be released as free BP tetraols. These studies indicate that benzo(a)pyrene diol epoxide may not be the major metabolite of BP involved in globin binding. (author). 14 refs.

  17. Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

    Directory of Open Access Journals (Sweden)

    Elza Miyuki Kimura

    2015-04-01

    Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

  18. Gene Prediction in Metagenomic Fragments with Deep Learning

    Directory of Open Access Journals (Sweden)

    Shao-Wu Zhang

    2017-01-01

    Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

  19. Evolutionary and functional properties of a two-locus β-globin polymorphism in Indian house mice

    DEFF Research Database (Denmark)

    Runck, Amy M; Weber, Roy E.; Fago, Angela

    2010-01-01

    exceeded neutral expectations, and reconstructed haplotype networks for both β-globin paralogs revealed extensive allele sharing with several other closely related species of Mus. However, despite this suggestive evidence for balancing selection, O2-equilibrium curves revealed no discernible functional......Electrophoretic surveys of hemoglobin (Hb) polymorphism in house mice from South Asia and the Middle East have revealed that two alternative β-globin haplotypes, Hbbd and Hbbp, are often present at intermediate frequencies in geographically disparate populations. Both haplotypes harbor two......) are distinguished by two amino acid substitutions. To investigate the possible adaptive significance of the Hbbd/Hbbp polymorphism we conducted a population genetic analysis of the duplicated β-globin genes of Indian house mice (Mus castaneus) in conjunction with experimental studies of Hb function in inbred...

  20. Ribose catabolism of Escherichia coli: characterization of the rpiB gene encoding ribose phosphate isomerase B and of the rpiR gene, which is involved in regulation of rpiB expression

    DEFF Research Database (Denmark)

    Sørensen, Kim I.; Hove-Jensen, Bjarne

    1996-01-01

    . The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...

  1. Diversity of [beta]-globin mutations in Israeli ethnic groups reflects recent historic events

    Energy Technology Data Exchange (ETDEWEB)

    Filon, D.; Oron, V.; Krichevski, S.; Shaag, A.; Goldfarb, A.; Aker, M.; Rachmilewitz, E.A.; Rund, D.; Oppenheim, A. (Hebrew Univ. Hadassah-Medical School, Jerusalem (Israel)) (and others)

    1994-05-01

    The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsense codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.

  2. Production and characterization of monoclonal antibodies against α-globin chain-containing human hemoglobins for detecting α-thalassemia disease.

    Science.gov (United States)

    Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak

    2016-01-01

    Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.

  3. Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes

    Science.gov (United States)

    Jarvi, S.I.; Goto, R.M.; Gee, G.F.; Briles, W.E.; Miller, M.M.

    1999-01-01

    We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbgl and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of '-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

  4. Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.

    Science.gov (United States)

    Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M

    1999-01-01

    We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

  5. Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

    Science.gov (United States)

    Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

    2011-01-01

    Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

  6. Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

    Directory of Open Access Journals (Sweden)

    2006-02-01

    Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

  7. Mitochondrial nad2 gene is co-transcripted with CMS-associated orfB gene in cytoplasmic male-sterile stem mustard (Brassica juncea).

    Science.gov (United States)

    Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan

    2009-02-01

    The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.

  8. Oxygen Association-Dissociation and Stability Analysis on Mouse Hemoglobins with Mutant α- and β-Globins

    Science.gov (United States)

    D'Surney, S. J.; Popp, R. A.

    1992-01-01

    Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042

  9. Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

    Science.gov (United States)

    Jorgez, Carolina J; Bischoff, Farideh Z

    2009-01-01

    Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

  10. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  11. Fragmentation mechanism reflecting the cluster structure of {sup 19}B

    Energy Technology Data Exchange (ETDEWEB)

    Takemoto, H.; Horiuchi, H. [Kyoto Univ., Dept. of Physics, Kyoto (Japan); Ono, A.

    1999-08-01

    Clustering structure of neutron dripline nucleus {sup 19}B which was predicted theoritically is investigated by studying the fragmentation reaction of {sup 19}B. We compare {sup 19}B fragmentation with {sup 13}B fragmentation in {sup 19}B + {sup 14}N and {sup 13}B + {sup 14}N reactions by using antisymmetrized molecular dynamics, where {sup 13}B has no clustering feature in its structure. We find that the cluster structure of the {sup 19}B nucleus is reflected in its fragmentation as the simultaneous production of He and Li isotopes. Furthermore we investigate the dependence of the cluster decay of {sup 19}B on the incident energy, and find that the cluster structure of {sup 19}B in its ground state is more reflected in lower incident-energy reactions. (author)

  12. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  13. Targeted correction of a thalassemia-associated beta-globin mutation induced by pseudo-complementary peptide nucleic acids

    DEFF Research Database (Denmark)

    Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y

    2009-01-01

    Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...

  14. Spectrin interactions with globin chains in the presence of ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    chains, respectively. The fluorescence-binding data, on the other hand, revealed a larger number of about 80 globin chains binding to spectrin. Cross-linked aggregates of haemoglobin/globin and spectrin have been found under different pathophysiological conditions, e.g. in senescent red blood cells, under oxidative.

  15. CTCF-mediated transcriptional regulation through cell type-specific chromosome organization in the β-globin locus

    OpenAIRE

    Junier, Ivan; Dale, Ryan K.; Hou, Chunhui; Képès, François; Dean, Ann

    2012-01-01

    International audience; The principles underlying the architectural landscape of chromatin beyond the nucleosome level in living cells remains largely unknown despite its potential to play a role in mammalian gene regulation. We investigated the three-dimensional folding of a 1 Mbp region of human chromosome 11 containing the β-globin genes by integrating looping interactions of the CCCTC-binding insulator protein CTCF determined comprehensively by chromosome conformation capture (3C) into a ...

  16. VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

    Energy Technology Data Exchange (ETDEWEB)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

    1994-09-01

    Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. We have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.

  17. Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

    Science.gov (United States)

    Van Doorslaer, Sabine; Cuypers, Bert

    2018-02-01

    At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

  18. The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

    Science.gov (United States)

    Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

    1994-01-28

    The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

  19. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A

    2010-09-01

    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  20. Linkage of genes for laminin B1 and B2 subunits on chromosome 1 in mouse.

    Science.gov (United States)

    Elliott, R W; Barlow, D; Hogan, B L

    1985-08-01

    We have used cDNA clones for the B1 and B2 subunits of laminin to find restriction fragment length DNA polymorphisms for the genes encoding these polypeptides in the mouse. Three alleles were found for LamB2 and two for LamB1 among the inbred mouse strains. The segregation of these polymorphisms among recombinant inbred strains showed that these genes are tightly linked in the central region of mouse Chromosome 1 between Sas-1 and Ly-m22, 7.4 +/- 3.2 cM distal to the Pep-3 locus. There is no evidence in the mouse for pseudogenes for these proteins.

  1. Gene prediction in metagenomic fragments: A large scale machine learning approach

    Directory of Open Access Journals (Sweden)

    Morgenstern Burkhard

    2008-04-01

    Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

  2. GFP expression by intracellular gene delivery of GFP-coding fragments using nanocrystal quantum dots

    International Nuclear Information System (INIS)

    Hoshino, Akiyoshi; Manabe, Noriyoshi; Fujioka, Kouki; Hanada, Sanshiro; Yamamoto, Kenji; Yasuhara, Masato; Kondo, Akihiko

    2008-01-01

    Gene therapy is an attractive approach to supplement a deficient gene function. Although there has been some success with specific gene delivery using various methods including viral vectors and liposomes, most of these methods have a limited efficiency or also carry a risk for oncogenesis. We herein report that quantum dots (QDs) conjugated with nuclear localizing signal peptides (NLSP) successfully introduced gene-fragments with promoter elements, which promoted the expression of the enhanced green fluorescent protein (eGFP) gene in mammalian cells. The expression of eGFP protein was observed when the QD/gene-construct was added to the culture media. The gene-expression efficiency varied depending on multiple factors around QDs, such as (1) the reading direction of the gene-fragments, (2) the quantity of gene-fragments attached on the surface of the QD-constructs, (3) the surface electronic charges varied according to the structure of the QD/gene-constructs, and (4) the particle size of QD/gene complex varied according to the structure and amounts of gene-fragments. Using this QD/gene-construct system, eGFP protein could be detected 28 days after the gene-introduction whereas the fluorescence of QDs had disappeared. This system therefore provides another method for the intracellular delivery of gene-fragments without using either viral vectors or specific liposomes.

  3. Effect ALPHA Globalin Gene Deletion and GAMMA Globin Gene -158 (C/T) Polymorphism in BETA- Thalassaemic Patients

    International Nuclear Information System (INIS)

    EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.

    2008-01-01

    The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.

  4. Usage of U7 snRNA in gene therapy of hemoglobin C disorder ...

    African Journals Online (AJOL)

    Here, a bioinformatic analysis was performed to study the effect of co-expression between human Hb C b-globin chain gene and U7.623. The gene ontological results show that full recovery of hemoglobin function and biological process can be derived. This confirms that U7 snRNA can be a good tool for gene therapy in Hb ...

  5. Structural analysis of the 5' flanking region of the β-globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

    International Nuclear Information System (INIS)

    Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.

    1988-01-01

    Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa

  6. Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.

    OpenAIRE

    Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T

    1983-01-01

    We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...

  7. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra

    2012-11-01

    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  8. Opposite responses of rabbit and human globin mRNAs to translational inhibition by cap analogues

    International Nuclear Information System (INIS)

    Shakin, S.H.; Liebhaber, S.A.

    1987-01-01

    The translational efficiency of an mRNA may be determined at the step of translational initiation by the efficiency of its interaction with the cap binding protein complex. To further investigate the role of these interactions in translational control, the authors compare in vitro the relative sensitivities of rabbit and human α- and β-globin mRNAs to translational inhibition by cap analogues. They find that rabbit β-globin mRNA is more resistant to translational inhibition by cap analogues than rabbit α-globin mRNA, while in contrast, human β-globin mRNA is more sensitive to cap analogue inhibition than human α- and β-globin mRNAs is unexpected as direct in vivo and in vitro comparisons of polysome profiles reveal parallel translational handling of the α- and β-globin mRNAs from these two species. This discordance between the relative translational sensitivities of these mRNAs to cap analogues and their relative ribosome loading activities suggests that cap-dependent events may not be rate limiting in steady-state globin translation

  9. Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia.

    Science.gov (United States)

    Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

    2013-12-01

    Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.

  10. Isolation and expression pattern of COR15b and KIN1 genes in ...

    African Journals Online (AJOL)

    sequences of COR15b and KIN1 genes were firstly isolated from leaves of watermelon (Citrullus lanatus) and pumpkin (Cucurbita moschata). Sequencing results indicated that the open reading fragments (ORF) of COR15b in watermelon (ClCOR15b) and COR15b in pumpkin (CmCOR15b) were 348 and 426 bp, which ...

  11. Molecular cloning and sequence of the B880 holochrome gene from Rhodospirillum rubrum

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    Restriction fragments of genomic Rhodospirillum rubrum DNA were selected according to size by electrophoresis followed by hybridization with [ 32 P]mRNA encoding the two B880 holochrome polypeptides. The fragments were cloned into Escherchia coli C600 with plasmid pBR327 as a vector. The clones were selected by colony hybridization with 32 P-holochrome-mRNA and counter selected by hybridization with Rs. rubrum ribosomal RNA, a minor contaminant of the mRNA preparation. Chimeric plasmid pRR22 was shown to contain the B880 genes by hybrid selection of B880 holochrome-mRNA. A restriction map of its 2.2-kilobase insert and the sequence of a 430 base pair fragment thereof is reported. Genes α and β are nearly contiguous, indicating that they are transcribed as a single operon. The predicted amino acid sequences coincide with the sequences of the α and β polypeptides established in other laboratories, except for additional C-terminal tails of 10 and 13 amino acid residues, respectively

  12. Hemoglobin genetics: recent contributions of GWAS and gene editing

    Science.gov (United States)

    Smith, Elenoe C.; Orkin, Stuart H.

    2016-01-01

    The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

  13. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

  14. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  15. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    Energy Technology Data Exchange (ETDEWEB)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

  16. A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

    Science.gov (United States)

    Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

    2014-01-01

    β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

  17. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  18. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  19. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  20. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  1. Co-expression of the Thermotoga neapolitana aglB gene with an upstream 3'-coding fragment of the malG gene improves enzymatic characteristics of recombinant AglB cyclomaltodextrinase.

    Science.gov (United States)

    Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A

    2007-07-01

    A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.

  2. Increased expression of alpha- and beta-globin mRNAs at the pituitary following exposure to estrogen during the critical period of neonatal sex differentiation in the rat

    DEFF Research Database (Denmark)

    Leffers, H; Navarro, V M; Nielsen, John E

    2006-01-01

    Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...

  3. A practical platform for blood biomarker study by using global gene expression profiling of peripheral whole blood.

    Directory of Open Access Journals (Sweden)

    Ze Tian

    Full Text Available Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study.We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal.We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study.

  4. Partial Gene Cloning and Enzyme Structure Modeling of Exolevanase Fragment from Bacillus subtilis

    Science.gov (United States)

    Azhar, M.; Natalia, D.; Syukur, S.; Andriani, N.; Jamsari, J.

    2018-04-01

    Inulin hydrolysis thermophilic and thermotolerant bacteria are potential sources of inulin hydrolysis enzymes. Partial gene that encodes inulin hydrolysis enzymes had been isolated from Bacillus subtilis using polymerase chain reaction (PCR) method with the DPE.slFandDPE.eR degenerative primers. The partial gene was cloned into pGEM-T Easy vector with E. coli as host cells and analyzed using BLASTx, CrustalW2, and Phyre2 programs. Size of thepartial gene had been found539 bp that encoded 179aminoacid residues of protein fragment. The sequences of protein fragment was more similar to exolevanase than exoinulinase. The protein fragment had conserved motif FSGS, and specific hits GH32 β-fructosidase. It had three residues of active site and five residues of substrate binding. The active site on the protein fragment were D (1-WLNDP-5), D (125-FRDPK-129) and E (177-WEC-179). Substrate binding on the protein fragment were ND (1-WLNDP-5), Q (18-FYQY-21), FS (60-FSGS-63) RD (125-FRDPK-129) and E (177-WEC-179).

  5. Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

    International Nuclear Information System (INIS)

    Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

    1988-01-01

    In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

  6. Recent trends in the gene therapy of β-thalassemia

    Science.gov (United States)

    Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

  7. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB

    Directory of Open Access Journals (Sweden)

    Lenice Roteia Cardoso Jung

    2015-06-01

    Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

  8. Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).

    Science.gov (United States)

    Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini

    2015-06-01

    Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.

  9. Study of the fragmentation of $b$ quarks into $B$ mesons at the $Z$ peak

    CERN Document Server

    Heister, A.; Barate, R.; De Bonis, I.; Decamp, D.; Goy, C.; Lees, J.P.; Merle, E.; Minard, M.N.; Pietrzyk, B.; Bravo, S.; Casado, M.P.; Chmeissani, M.; Crespo, J.M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, L.; Grauges, E.; Martinez, M.; Merino, G.; Miquel, R.; Mir, L.M.; Pacheco, A.; Ruiz, H.; Colaleo, A.; Creanza, D.; de Palma, M.; Iaselli, G.; Maggi, G.; Maggi, M.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Azzurri, P.; Boix, G.; Buchmuller, O.; Cattaneo, M.; Cerutti, F.; Clerbaux, B.; Dissertori, G.; Drevermann, H.; Forty, R.W.; Frank, M.; Greening, T.C.; Hansen, J.B.; Harvey, John; Janot, P.; Jost, B.; Kado, M.; Mato, P.; Moutoussi, A.; Ranjard, F.; Rolandi, Gigi; Schlatter, D.; Schneider, O.; Spagnolo, P.; Tejessy, W.; Teubert, F.; Tournefier, E.; Ward, J.; Ajaltouni, Z.; Badaud, F.; Falvard, A.; Gay, P.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.C.; Pallin, D.; Perret, P.; Podlyski, F.; Hansen, J.D.; Hansen, J.R.; Hansen, P.H.; Nilsson, B.S.; Waananen, A.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Zachariadou, K.; Blondel, A.; Bonneaud, G.; Brient, J.C.; Rouge, A.; Rumpf, M.; Swynghedauw, M.; Verderi, M.; Videau, H.; Ciulli, V.; Focardi, E.; Parrini, G.; Antonelli, A.; Antonelli, M.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Chiarella, V.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G.P.; Passalacqua, L.; Pepe-Altarelli, M.; Halley, A.W.; Lynch, J.G.; Negus, P.; O'Shea, V.; Raine, C.; Thompson, A.S.; Wasserbaech, S.; Cavanaugh, R.; Dhamotharan, S.; Geweniger, C.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E.E.; Putzer, A.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D.M.; Cameron, W.; Dornan, P.J.; Girone, M.; Marinelli, N.; Sedgbeer, J.K.; Thompson, J.C.; Ghete, V.M.; Girtler, P.; Kneringer, E.; Kuhn, D.; Rudolph, G.; Bouhova-Thacker, E.; Bowdery, C.K.; Finch, A.J.; Foster, F.; Hughes, G.; Jones, R.W.L.; Pearson, M.R.; Robertson, N.A.; Giehl, I.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.G.; Wachsmuth, H.; Zeitnitz, C.; Bonissent, A.; Carr, J.; Coyle, P.; Leroy, O.; Payre, P.; Rousseau, D.; Talby, M.; Aleppo, M.; Ragusa, F.; David, A.; Dietl, H.; Ganis, G.; Huttmann, K.; Lutjens, G.; Mannert, C.; Manner, W.; Moser, H.G.; Settles, R.; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Davier, M.; Duflot, L.; Grivaz, J.F.; Heusse, P.; Jacholkowska, A.; Lefrancois, J.; Veillet, J.J.; Videau, I.; Yuan, C.; Bagliesi, Giuseppe; Boccali, T.; Calderini, G.; Foa, L.; Giammanco, A.; Giassi, A.; Ligabue, F.; Messineo, A.; Palla, F.; Sanguinetti, G.; Sciaba, A.; Sguazzoni, G.; Tenchini, R.; Venturi, A.; Verdini, P.G.; Blair, G.A.; Cowan, G.; Green, M.G.; Medcalf, T.; Misiejuk, A.; Strong, J.A.; Teixeira-Dias, P.; von Wimmersperg-Toeller, J.H.; Clifft, R.W.; Edgecock, T.R.; Norton, P.R.; Tomalin, I.R.; Bloch-Devaux, Brigitte; Colas, P.; Emery, S.; Kozanecki, W.; Lancon, E.; Lemaire, M.C.; Locci, E.; Perez, P.; Rander, J.; Renardy, J.F.; Roussarie, A.; Schuller, J.P.; Schwindling, J.; Trabelsi, A.; Vallage, B.; Konstantinidis, N.; Litke, A.M.; Taylor, G.; Booth, C.N.; Cartwright, S.; Combley, F.; Lehto, M.; Thompson, L.F.; Affholderbach, K.; Boehrer, Armin; Brandt, S.; Grupen, C.; Ngac, A.; Prange, G.; Sieler, U.; Giannini, G.; Rothberg, J.; Armstrong, S.R.; Cranmer, K.; Elmer, P.; Ferguson, D.P.S.; Gao, Y.; Gonzalez, S.; Hayes, O.J.; Hu, H.; Jin, S.; Kile, J.; McNamara, P.A., III; Nielsen, J.; Orejudos, W.; Pan, Y.B.; Saadi, Y.; Scott, I.J.; Walsh, J.; Wu, Sau Lan; Wu, X.; Zobernig, G.

    2001-01-01

    The fragmentation of b quarks into B mesons is studied with four million hadronic Z decays collected by the ALEPH experiment during the years 1991-1995. A semi-exclusive reconstruction of B->l nu D(*) decays is performed, by combining lepton candidates with fully reconstructed D(*) mesons while the neutrino energy is estimated from the missing energy of the event. The mean value of xewd, the energy of the weakly-decaying B meson normalised to the beam energy, is found to be mxewd = 0.716 +- 0.006 (stat) +- 0.006 \\, (syst) using a model-independent method; the corresponding value for the energy of the leading B meson is mxel = 0.736 +- 0.006 (stat) +- 0.006 (syst). The reconstructed spectra are compared with different fragmentation models.

  10. Factors Affecting Pro- and Anti-Oxidant Properties of Fragments of the b-Protein Precursor (bPP): Implication for Alzheimer's Disease.

    Science.gov (United States)

    Andorn, Anne C.; Kalaria, Rajesh N.

    2000-06-01

    Oxidative stress may have a key pathogenetic role in neurodegenerative diseases including Alzheimer's disease (AD). While there is evidence that some amyloid-b (Ab) peptides can initiate oxidative stress at micromolar doses, there is also some evidence that oxidative stress increases the concentration of the b-protein precursor (bPP) and the potential for increased formation of the Ab peptides. The following studies were performed to test the hypothesis that fragments of bPP could be antioxidants and hence that oxidative stress might be an early event in AD. We found that several fragments of bPP, including the Ab peptides, inhibit ascorbate-stimulated lipid peroxidation (ASLP) in membrane fragment preparations of postmortem human brain. In contrast, other fragments of bPP enhance ASLP. These data indicate that bPP or fragments of bPP could play a key role in the redox status of cells and that alterations in bPP processing could have profound effects on the cellular response to oxidative stress.

  11. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  12. An N-myristoylated globin with a redox-sensing function that regulates the defecation cycle in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Lesley Tilleman

    Full Text Available Globins occur in all kingdoms of life where they fulfill a wide variety of functions. In the past they used to be primarily characterized as oxygen transport/storage proteins, but since the discovery of new members of the globin family like neuroglobin and cytoglobin, more diverse and complex functions have been assigned to this heterogeneous family. Here we propose a function for a membrane-bound globin of C. elegans, GLB-26. This globin was predicted to be myristoylated at its N-terminus, a post-translational modification only recently described in the globin family. In vivo, this globin is found in the membrane of the head mesodermal cell and in the tail stomato-intestinal and anal depressor muscle cells. Since GLB-26 is almost directly oxidized when exposed to oxygen, we postulate a possible function as electron transfer protein. Phenotypical studies show that GLB-26 takes part in regulating the length of the defecation cycle in C. elegans under oxidative stress conditions.

  13. Gene Therapy Approaches to Hemoglobinopathies.

    Science.gov (United States)

    Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

    2017-10-01

    Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  15. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  16. Oxygen binding properties of non-mammalian nerve globins

    DEFF Research Database (Denmark)

    Hundahl, Christian; Fago, Angela; Dewilde, Sylvia

    2006-01-01

    Oxygen-binding globins occur in the nervous systems of both invertebrates and vertebrates. While the function of invertebrate nerve haemoglobins as oxygen stores that extend neural excitability under hypoxia has been convincingly demonstrated, the physiological role of vertebrate neuroglobins...... is less well understood. Here we provide a detailed analysis of the oxygenation characteristics of nerve haemoglobins from an annelid (Aphrodite aculeata), a nemertean (Cerebratulus lacteus) and a bivalve (Spisula solidissima) and of neuroglobin from zebrafish (Danio rerio). The functional differences...... have been related to haem coordination: the haem is pentacoordinate (as in human haemoglobin and myoglobin) in A. aculeata and C. lacteus nerve haemoglobins and hexacoordinate in S. solidissima nerve haemoglobin and D. rerio neuroglobin. Whereas pentacoordinate nerve globins lacked Bohr effects at all...

  17. alpha-Globin genes: thalassemic and structural alterations in a Brazilian population

    Directory of Open Access Journals (Sweden)

    M.R.S.C. Wenning

    2000-09-01

    Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.

  18. A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

    Directory of Open Access Journals (Sweden)

    Marta Durlak

    Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

  19. The b Quark Fragmentation Function, From LEP to TeVatron

    Energy Technology Data Exchange (ETDEWEB)

    Ben-haim, Eli [Univ. Pierre et Marie Curie, Paris (France)

    2004-12-01

    The b quark fragmentation distribution has been measured, using data registered by the DELPHI experiment at the Z pole, in the years 1994-1995. The measurement made use of 176000 inclusively reconstructed B meson candidates. The errors of this measurement are dominated by systematic effects, the principal ones being related to the energy calibration. The distribution has been established in a nine bin histogram. Its mean value has been found to be E> = 0.704 ± 0.001(stat.) ± 0.008(syst.). Using this measurement, and other available analyses of the b-quark fragmentation distribution in e+e- collisions, the non-perturbative QCD component of the distribution has been extracted independently of any hadronic physics modeling. This distribution depends only on the way the perturbative QCD component has been defined. When the perturbative QCD component is taken from a parton shower Monte-Carlo, the non-perturbative QCD component is rather similar with those obtained from the Lund or Bowler models. When the perturbative QCD component is the result of an analytic NLL computation, the non-perturbative QCD component has to be extended in a non-physical region and thus cannot be described by any hadronic modeling. In the two examples, used to characterize these two situations, which are studied at present, it happens that the extracted non-perturbative QCD distribution has the same shape, being simply translated to higher-x values in the second approach, illustrating the ability of the analytic perturbative QCD approach to account for softer gluon radiation than with a parton shower generator. Using all the available analyses of the b-quark fragmentation distribution in e+e- collisions, together with the result from DELPHI presented in this thesis, a combined world average b fragmentation distribution has been obtained. Its mean value has been found to be E> = 0.714 ± 0.002. An analysis of the B hadron

  20. Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

    Directory of Open Access Journals (Sweden)

    Jackie A Pallister

    Full Text Available BACKGROUND: The cane toad, Bufo (Chaunus marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. METHODOLOGY/PRINCIPAL FINDINGS: The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs, developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin and genetic (adult globin mRNA levels measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. CONCLUSIONS/SIGNIFICANCE: While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

  1. Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

    Science.gov (United States)

    Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

    2011-01-25

    The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

  2. The Use of Cytochrome b Gene as a Specific Marker of the Rat Meat (Rattus norvegicus on Meat and Meat Products

    Directory of Open Access Journals (Sweden)

    C. Sumantri

    2012-04-01

    Full Text Available Falsification of the origin of livestock meat and its processed with rat meat is a problem that must be overcome to ensure food safety. One way that is often used to detect forgeries by using cytochrome b gene as a marker. The purpose of this study was to create a specific primer derived from cytochrome b sequences in rat (Rattus norvegicus as the DNA marker to detect any contamination of rat meat on fresh livestock meat and its processed meat products. Meatballs were made from beef meat with the addition of rat 1%-25%, and the meatballs were obtained from traditional markets. DNA extraction was conducted from seven species (goat, chicken, cattle, sheep, pig, horse, and rat by using phenol-chloroform. The highest success rate in detecting the presence of rat meat in a mixture of beef meatballs at concentration of 15% was 100%. The specific fragment of cytochrome b gene in R. norvegicus has no similarity with the cytochrome b gene from six other species, so it can be used as molecular markers to detect the presence of rat meat contamination in the processed of meat products. Amplified fragment length for goats, chickens, cattle, sheep, pigs, horses, and rats 157, 227, 274, 331, 398, 439 and 603 bp respectively. The amplification of cytochrome b gene in seven species of animals with different fragment length indicated the specificity of cytochrome b gene sequences among species.

  3. Measurement of the b quark fragmentation function in Z{sup 0} decays

    Energy Technology Data Exchange (ETDEWEB)

    Dong, D.

    1999-12-01

    The authors present results of a new measurement of the inclusive b quark fragmentation function in Z decays using a novel kinematic B hadron energy reconstruction technique. The measurement is performed using 150,000 hadronic Z events recorded in the SLD experiment at SLAC between 1996 and 1997. The small and stable SLC beam spot and the CCD-based vertex detector are used to reconstruct topological B-decay vertices with high efficiency and purity, and to provide precise measurements of the kinematic quantities used in this technique. The authors measure the B energy with good efficiency and resolution over the full kinematic range. While comparing the scaled B energy distribution with predictions of several models of b quark fragmentation, the authors also test several functional forms of the B energy distribution. Several fragmentation models and functional forms are excluded by the data. The mean of the scaled energy distribution of the weakly decaying B hadron is measured to be x{sub B} = 0.714{+-}0.00(stat){+-}0.007(syst){+-}0.002 (model).

  4. Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

    Science.gov (United States)

    Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

    2012-07-15

    Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    Science.gov (United States)

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

  6. Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

    NARCIS (Netherlands)

    R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)

    1999-01-01

    textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch

  7. The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

    Science.gov (United States)

    Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

    1985-01-01

    The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

  8. The heterothallic sugarbeet pathogen Cercospora beticola contains exon fragments of both MAT genes that are homogenized by concerted evolution.

    Science.gov (United States)

    Bolton, Melvin D; de Jonge, Ronnie; Inderbitzin, Patrik; Liu, Zhaohui; Birla, Keshav; Van de Peer, Yves; Subbarao, Krishna V; Thomma, Bart P H J; Secor, Gary A

    2014-01-01

    Dothideomycetes is one of the most ecologically diverse and economically important classes of fungi. Sexual reproduction in this group is governed by mating type (MAT) genes at the MAT1 locus. Self-sterile (heterothallic) species contain one of two genes at MAT1 (MAT1-1-1 or MAT1-2-1) and only isolates of opposite mating type are sexually compatible. In contrast, self-fertile (homothallic) species contain both MAT genes at MAT1. Knowledge of the reproductive capacities of plant pathogens are of particular interest because recombining populations tend to be more difficult to manage in agricultural settings. In this study, we sequenced MAT1 in the heterothallic Dothideomycete fungus Cercospora beticola to gain insight into the reproductive capabilities of this important plant pathogen. In addition to the expected MAT gene at MAT1, each isolate contained fragments of both MAT1-1-1 and MAT1-2-1 at ostensibly random loci across the genome. When MAT fragments from each locus were manually assembled, they reconstituted MAT1-1-1 and MAT1-2-1 exons with high identity, suggesting a retroposition event occurred in a homothallic ancestor in which both MAT genes were fused. The genome sequences of related taxa revealed that MAT gene fragment pattern of Cercospora zeae-maydis was analogous to C. beticola. In contrast, the genome of more distantly related Mycosphaerella graminicola did not contain MAT fragments. Although fragments occurred in syntenic regions of the C. beticola and C. zeae-maydis genomes, each MAT fragment was more closely related to the intact MAT gene of the same species. Taken together, these data suggest MAT genes fragmented after divergence of M. graminicola from the remaining taxa, and concerted evolution functioned to homogenize MAT fragments and MAT genes in each species. Published by Elsevier Inc.

  9. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  10. A theoretical study of the c and b fragmentation function in e+e- annihilation

    International Nuclear Information System (INIS)

    Colangelo, G.

    1992-01-01

    We present an analysis of the c and b fragmentation functions which includes in a consistent fashion leading and next-to-leading perturbative contributions, effects due to soft gluon emission and a parametrization of effects of non-perturbative origin. We show that the data on D meson production at intermediate energy constrain the parametrization of the effects of non-perturbative nature. We can therefore make a prediction for the B fragmentation function. Results for the B, D and D * fragmentation functions at LEP energy are given, and compared with existing data. (orig.)

  11. Identification of genes affecting vacuole membrane fragmentation in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Lydie Michaillat

    Full Text Available The equilibrium of membrane fusion and fission influences the volume and copy number of organelles. Fusion of yeast vacuoles has been well characterized but their fission and the mechanisms determining vacuole size and abundance remain poorly understood. We therefore attempted to systematically characterize factors necessary for vacuole fission. Here, we present results of an in vivo screening for deficiencies in vacuolar fragmentation activity of an ordered collection deletion mutants, representing 4881 non-essential genes of the yeast Saccharomyces cerevisiae. The screen identified 133 mutants with strong defects in vacuole fragmentation. These comprise numerous known fragmentation factors, such as the Fab1p complex, Tor1p, Sit4p and the V-ATPase, thus validating the approach. The screen identified many novel factors promoting vacuole fragmentation. Among those are 22 open reading frames of unknown function and three conspicuous clusters of proteins with known function. The clusters concern the ESCRT machinery, adaptins, and lipases, which influence the production of diacylglycerol and phosphatidic acid. A common feature of these factors of known function is their capacity to change membrane curvature, suggesting that they might promote vacuole fragmentation via this property.

  12. Characterization of the haloacid dehalogenase from Xanthobacter autotrophicus GJ10 and sequencing of the dhlB gene

    DEFF Research Database (Denmark)

    van der Ploeg, J; Van Hall, Gerrit; Janssen, D B

    1991-01-01

    B) was cloned and could be allocated to a 6.5-kb EcoRI-BglII fragment. Part of this fragment was sequenced, and the dhlB open reading frame was identified by comparison with the N-terminal amino acid sequence of the protein. The gene was found to encode a protein of 27,433 Da that showed considerable homology...... chromatography. The enzyme was active with 2-halogenated carboxylic acids and converted only the L-isomer of 2-chloropropionic acid with inversion of configuration to produce D-lactate. The activity of the enzyme was not readily influenced by thiol reagents. The gene encoding the haloacid dehalogenase (dhl...... (60.5 and 61.0% similarity) with the two other haloacid dehalogenases sequenced to date but not with the haloalkane dehalogenase from X. autotrophicus GJ10....

  13. Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

    Science.gov (United States)

    Guerreiro, J F; Figueiredo, M S; Zago, M A

    1994-01-01

    We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

  14. Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

    Science.gov (United States)

    Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

    2010-05-16

    Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

  15. Synthesis of an A'B' Precursor to Angelmicin B: Product Diversification in the Suárez Lactol Fragmentation.

    Science.gov (United States)

    Li, Jialiang; Todaro, Louis; Mootoo, David R

    2011-11-01

    We describe a synthetic strategy for the angelimicin family of anthraquinoid natural products that involves converting a central highly oxygenated decalin intermediate to the AB and A'B' subunits. Herein, we report the synthesis of the bicyclic A'B' subunit that complements our earlier route to the tricyclic AB framework. The differentiating tact in the two syntheses focused on controlling the Suárez radical fragmentation of lactol precursors by modulating the substrate's structural rigidity. A more flexible lactol gave the tricyclic AB framework, whereas a more rigid substrate led to the bicyclic A'B' precursor, presumably through divergent pathways from the radical produced in the initial fragmentation step. These results establish a versatile advanced synthetic precursor for the angelimicins, and on a more general note, illustrate strategies for applying the Suárez fragmentation to diverse and complex molecular frameworks.

  16. Chromatin loops, gene positioning, and gene expression

    NARCIS (Netherlands)

    Holwerda, S.; de Laat, W.

    2012-01-01

    Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

  17. Fragmentation of the CRISPR-Cas Type I-B signature protein Cas8b.

    Science.gov (United States)

    Richter, Hagen; Rompf, Judith; Wiegel, Julia; Rau, Kristina; Randau, Lennart

    2017-11-01

    CRISPR arrays are transcribed into long precursor RNA species, which are further processed into mature CRISPR RNAs (crRNAs). Cas proteins utilize these crRNAs, which contain spacer sequences that can be derived from mobile genetic elements, to mediate immunity during a reoccurring virus infection. Type I CRISPR-Cas systems are defined by the presence of different Cascade interference complexes containing large and small subunits that play major roles during target DNA selection. Here, we produce the protein and crRNA components of the Type I-B CRISPR-Cas complex of Clostridium thermocellum and Methanococcus maripaludis. The C. thermocellum Cascade complexes were reconstituted and analyzed via size-exclusion chromatography. Activity of the heterologous M. maripaludis CRISPR-Cas system was followed using phage lambda plaques assays. The reconstituted Type-I-B Cascade complex contains Cas7, Cas5, Cas6b and the large subunit Cas8b. Cas6b can be omitted from the reconstitution protocol. The large subunit Cas8b was found to be represented by two tightly associated protein fragments and a small C-terminal Cas8b segment was identified in recombinant complexes and C. thermocellum cell lysate. Production of Cas8b generates a small C-terminal fragment, which is suggested to fulfill the role of the missing small subunit. A heterologous, synthetic M. maripaludis Type I-B system is active in E. coli against phage lambda, highlighting a potential for genome editing using endogenous Type-I-B CRISPR-Cas machineries. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  19. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  20. Evaluation of TNFRSF11B Gene Polymorphism in Patients with Acute Stroke

    Directory of Open Access Journals (Sweden)

    Pınar Çoğaş

    2016-06-01

    Full Text Available Objective: Tumor necrosis factor receptor superfamily, member 11b (TNFRSF11B has been suggested to be a risk fac­tor for atherosclerosis and cardiovascular diseases because of the observation of osteoporosis and vascular diseases together in human, and the high levels of serum TNFRSF11B in these patients in clinical trials. In this study, we aimed to investigate the association between TNFRSF11B gene 1181G˃C polymorphism and acute stroke as a cerebrovascular disease. Methods: In this study, the DNAs of 107 acute stroke patients and 100 healthy controls have been analyzed by poly­merase chain reaction (PCR and restriction fragment length polymorphism (RFLP. Statistical analyses were performed by using chi-square and analysis of variance tests. Results: When we compared the genotype and allele frequencies of patients and controls, any statistically significant differences was not found between them (p=0.476 and p=0.622, respectively. Any association also was not observed when demographical and clinical characteristics of patients was compared with TNFRSF11B gene 1181G˃C polymor­phism (p>0.05. Conclusion: As a result, our findings showed that there was no association between TNFRSF11B gene 1181G>C poly­morphism and acute stroke. However, further studies can reveal more clearly whether there is a relationship between TNFRSF11B gene polymorphism and acute stroke in Turkish population.

  1. Production of recombinant Ig molecules from antigen-selected single B cells and restricted usage of Ig-gene segments by anti-D antibodies

    NARCIS (Netherlands)

    Dohmen, Serge E.; Mulder, Arend; Verhagen, Onno J. H. M.; Eijsink, Chantal; Franke-van Dijk, Marry E. I.; van der Schoot, C. Ellen

    2005-01-01

    The Ig-genes of the heavy chains in anti-D-specific hybridomas and Fab/scFv-fragments selected from phage-display libraries are restricted to a group of closely related genes (IGHV3s genes). We analyzed the Ig-gene repertoire in anti-D-specific B cells of two hyperimmunized donors using a completely

  2. Gene flow of common ash (Fraxinus excelsior L. in a fragmented landscape.

    Directory of Open Access Journals (Sweden)

    Devrim Semizer-Cuming

    Full Text Available Gene flow dynamics of common ash (Fraxinus excelsior L. is affected by several human activities in Central Europe, including habitat fragmentation, agroforestry expansion, controlled and uncontrolled transfer of reproductive material, and a recently introduced emerging infectious disease, ash dieback, caused by Hymenoscyphus fraxineus. Habitat fragmentation may alter genetic connectivity and effective population size, leading to loss of genetic diversity and increased inbreeding in ash populations. Gene flow from cultivated trees in landscapes close to their native counterparts may also influence the adaptability of future generations. The devastating effects of ash dieback have already been observed in both natural and managed populations in continental Europe. However, potential long-term effects of genetic bottlenecks depend on gene flow across fragmented landscapes. For this reason, we studied the genetic connectivity of ash trees in an isolated forest patch of a fragmented landscape in Rösenbeck, Germany. We applied two approaches to parentage analysis to estimate gene flow patterns at the study site. We specifically investigated the presence of background pollination at the landscape level and the degree of genetic isolation between native and cultivated trees. Local meteorological data was utilized to understand the effect of wind on the pollen and seed dispersal patterns. Gender information of the adult trees was considered for calculating the dispersal distances. We found that the majority of the studied seeds (55-64% and seedlings (75-98% in the forest patch were fathered and mothered by the trees within the same patch. However, we determined a considerable amount of pollen flow (26-45% from outside of the study site, representing background pollination at the landscape level. Limited pollen flow was observed from neighbouring cultivated trees (2%. Both pollen and seeds were dispersed in all directions in accordance with the local

  3. Gene flow of common ash (Fraxinus excelsior L.) in a fragmented landscape.

    Science.gov (United States)

    Semizer-Cuming, Devrim; Kjær, Erik Dahl; Finkeldey, Reiner

    2017-01-01

    Gene flow dynamics of common ash (Fraxinus excelsior L.) is affected by several human activities in Central Europe, including habitat fragmentation, agroforestry expansion, controlled and uncontrolled transfer of reproductive material, and a recently introduced emerging infectious disease, ash dieback, caused by Hymenoscyphus fraxineus. Habitat fragmentation may alter genetic connectivity and effective population size, leading to loss of genetic diversity and increased inbreeding in ash populations. Gene flow from cultivated trees in landscapes close to their native counterparts may also influence the adaptability of future generations. The devastating effects of ash dieback have already been observed in both natural and managed populations in continental Europe. However, potential long-term effects of genetic bottlenecks depend on gene flow across fragmented landscapes. For this reason, we studied the genetic connectivity of ash trees in an isolated forest patch of a fragmented landscape in Rösenbeck, Germany. We applied two approaches to parentage analysis to estimate gene flow patterns at the study site. We specifically investigated the presence of background pollination at the landscape level and the degree of genetic isolation between native and cultivated trees. Local meteorological data was utilized to understand the effect of wind on the pollen and seed dispersal patterns. Gender information of the adult trees was considered for calculating the dispersal distances. We found that the majority of the studied seeds (55-64%) and seedlings (75-98%) in the forest patch were fathered and mothered by the trees within the same patch. However, we determined a considerable amount of pollen flow (26-45%) from outside of the study site, representing background pollination at the landscape level. Limited pollen flow was observed from neighbouring cultivated trees (2%). Both pollen and seeds were dispersed in all directions in accordance with the local wind directions

  4. The b Quark Fragmentation Function, From LEP to TeVatron

    CERN Document Server

    Ben-Haim, Eli; Savoy-Navarro, Aurore

    2004-01-01

    The b quark fragmentation distribution has been measured, using data registered by the DELPHI experiment at the Z pole, in the years 1994-1995. The measurement made use of 176000 inclusively reconstructed B meson candidates. The uncertainties of this measurement are dominated by systematic effects, the principal ones being related to the energy calibration. The distribution has been established in a nine bin histogram. Its mean value has been found to be = 0.704±0.001(stat.)±0.008(syst.) Using this measurement, and other available analyses of the b-quark fragmentation distribution in e +e − collisions, the non-perturbative QCD component of the distribution has been extracted independently of any hadronic physics modeling. This distribution depends only on the way the perturbative QCD component has been defined. When the perturbative QCD component is taken from a parton shower Monte-Carlo, the non-perturbative QCD component is rather similar with those obtained from the Lund or Bowler models. When the pert...

  5. Complementary b/y fragment ion pairs from post-source decay of metastable YahO for calibration of MALDI-TOF-TOF-MS/MS

    Science.gov (United States)

    Complementary b/y fragment ion pairs from post-source decay (PSD) of metastable YahO protein ion were evaluated for use in the calibration of MALDI-TOF-TOF for tandem mass spectrometry (MS/MS). The yahO gene from pathogenic Escherichia coli O157:H7 strain EDL933 was cloned into a pBAD18 plasmid vect...

  6. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    Science.gov (United States)

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  7. Gene flow and pathogen transmission among bobcats (Lynx rufus) in a fragmented urban landscape

    Science.gov (United States)

    Lee, Justin S.; Ruell, Emily W.; Boydston, Erin E.; Lyren, Lisa M.; Alonso, Robert S.; Troyer, Jennifer L.; Crooks, Kevin R.; VandeWoude, Sue

    2012-01-01

    Urbanization can result in the fragmentation of once contiguous natural landscapes into a patchy habitat interspersed within a growing urban matrix. Animals living in fragmented landscapes often have reduced movement among habitat patches because of avoidance of intervening human development, which potentially leads to both reduced gene flow and pathogen transmission between patches. Mammalian carnivores with large home ranges, such as bobcats (Lynx rufus), may be particularly sensitive to habitat fragmentation. We performed genetic analyses on bobcats and their directly transmitted viral pathogen, feline immunodeficiency virus (FIV), to investigate the effects of urbanization on bobcat movement. We predicted that urban development, including major freeways, would limit bobcat movement and result in genetically structured host and pathogen populations. We analysed molecular markers from 106 bobcats and 19 FIV isolates from seropositive animals in urban southern California. Our findings indicate that reduced gene flow between two primary habitat patches has resulted in genetically distinct bobcat subpopulations separated by urban development including a major highway. However, the distribution of genetic diversity among FIV isolates determined through phylogenetic analyses indicates that pathogen genotypes are less spatially structured--exhibiting a more even distribution between habitat fragments. We conclude that the types of movement and contact sufficient for disease transmission occur with enough frequency to preclude structuring among the viral population, but that the bobcat population is structured owing to low levels of effective bobcat migration resulting in gene flow. We illustrate the utility in using multiple molecular markers that differentially detect movement and gene flow between subpopulations when assessing connectivity.

  8. Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

    Science.gov (United States)

    Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

    1993-03-01

    We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

  9. The 3D chromatin structure of the mouse β-haemoglobin gene cluster

    NARCIS (Netherlands)

    M.P.C. van de Corput (Mariëtte); T.A. Knoch (Tobias); E. de Boer (Ernie); W.A. van Cappellen (Gert); M. Lesnussa (Michael); H.J.F.M.M. Eussen (Bert)

    2010-01-01

    textabstractHere we show a 3D DNA-FISH method to visualizes the 3D structure of the β-globin locus. Geometric size and shape measurements of the 3D rendered signals (128Kb) show that the volume of the β-globin locus decreases almost two fold upon gene activation. A decrease in length and a

  10. High gene flow in epiphytic ferns despite habitat loss and fragmentation.

    Science.gov (United States)

    Winkler, Manuela; Koch, Marcus; Hietz, Peter

    2011-01-01

    Tropical montane forests suffer from increasing fragmentation and replacement by other types of land-use such as coffee plantations. These processes are known to affect gene flow and genetic structure of plant populations. Epiphytes are particularly vulnerable because they depend on their supporting trees for their entire life-cycle. We compared population genetic structure and genetic diversity derived from AFLP markers of two epiphytic fern species differing in their ability to colonize secondary habitats. One species, Pleopeltis crassinervata , is a successful colonizer of shade trees and isolated trees whereas the other species, Polypodium rhodopleuron , is restricted to forests with anthropogenic separation leading to significant isolation between populations. By far most genetic variation was distributed within rather than among populations in both species, and a genetic admixture analysis did not reveal any clustering. Gene flow exceeded by far the benchmark of one migrant per generation to prevent genetic divergence between populations in both species. Though populations are threatened by habitat loss, long-distance dispersal is likely to support gene flow even between distant populations, which efficiently delays genetic isolation. Consequently, populations may rather be threatened by ecological consequences of habitat loss and fragmentation.

  11. The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

    Directory of Open Access Journals (Sweden)

    Türker Bilgen

    2011-09-01

    Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

  12. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  13. A family of selfish minicircular chromosomes with jumbled chloroplast gene fragments from a dinoflagellate.

    Science.gov (United States)

    Zhang, Z; Cavalier-Smith, T; Green, B R

    2001-08-01

    Chloroplast genes of several dinoflagellate species are located on unigenic DNA minicircular chromosomes. We have now completely sequenced five aberrant minicircular chromosomes from the dinoflagellate Heterocapsa triquetra. These probably nonfunctional DNA circles lack complete genes, with each being composed of several short fragments of two or three different chloroplast genes and a common conserved region with a tripartite 9G-9A-9G core like the putative replicon origin of functional single-gene circular chloroplast chromosomes. Their sequences imply that all five circles evolved by differential deletions and duplications from common ancestral circles bearing fragments of four genes: psbA, psbC, 16S rRNA, and 23S rRNA. It appears that recombination between separate unigenic chromosomes initially gave intermediate heterodimers, which were subsequently stabilized by deletions that included part or all of one putative replicon origin. We suggest that homologous recombination at the 9G-9A-9G core regions produced a psbA/psbC heterodimer which generated two distinct chimeric circles by differential deletions and duplications. A 23S/16S rRNA heterodimer more likely formed by illegitimate recombination between 16S and 23S rRNA genes. Homologous recombination between the 9G-9A-9G core regions of both heterodimers and additional differential deletions and duplications could then have yielded the other three circles. Near identity of the gene fragments and 9G-9A-9G cores, despite diverging adjacent regions, may be maintained by gene conversion. The conserved organization of the 9G-9A-9G cores alone favors the idea that they are replicon origins and suggests that they may enable the aberrant minicircles to parasitize the chloroplast's replication machinery as selfish circles.

  14. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  15. Coordinate expression of heme and globin is essential for effective erythropoiesis.

    Science.gov (United States)

    Doty, Raymond T; Phelps, Susan R; Shadle, Christina; Sanchez-Bonilla, Marilyn; Keel, Siobán B; Abkowitz, Janis L

    2015-12-01

    Erythropoiesis requires rapid and extensive hemoglobin production. Heme activates globin transcription and translation; therefore, heme synthesis must precede globin synthesis. As free heme is a potent inducer of oxidative damage, its levels within cellular compartments require stringent regulation. Mice lacking the heme exporter FLVCR1 have a severe macrocytic anemia; however, the mechanisms that underlie erythropoiesis dysfunction in these animals are unclear. Here, we determined that erythropoiesis failure occurs in these animals at the CFU-E/proerythroblast stage, a point at which the transferrin receptor (CD71) is upregulated, iron is imported, and heme is synthesized--before ample globin is produced. From the CFU-E/proerythroblast (CD71(+) Ter119(-) cells) stage onward, erythroid progenitors exhibited excess heme content, increased cytoplasmic ROS, and increased apoptosis. Reducing heme synthesis in FLVCR1-defient animals via genetic and biochemical approaches improved the anemia, implying that heme excess causes, and is not just associated with, the erythroid marrow failure. Expression of the cell surface FLVCR1 isoform, but not the mitochondrial FLVCR1 isoform, restored normal rbc production, demonstrating that cellular heme export is essential. Together, these studies provide insight into how heme is regulated to allow effective erythropoiesis, show that erythropoiesis fails when heme is excessive, and emphasize the importance of evaluating Ter119(-) erythroid cells when studying erythroid marrow failure in murine models.

  16. Measurement of the Relative Fragmentation Fractions of B-bar Hadrons

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, Karen Ruth [Carnegie Mellon Univ., Pittsburgh, PA (United States)

    2006-06-09

    This thesis describes the first Run II measurement of b quark fragmentation into $\\bar{B}$0, B-, and B$0\\atop{s}$ mesons and Λ$0\\atop{b}$ baryons using semileptonic B decays. The result is based on 360 pb-1 of data collected with the CDF detector in p$\\bar{p}$ collisions at √s = 1,960 GeV at the Tevatron Collider at Fermilab. The fragmentation fractions are measured for an effective $\\bar{B}$ hadron pT threshold of 7 GeV/c to be fu/fd = 1.054 ± 0.018(stat)$+0.025\\atop{-0.045}$(syst) ± 0.058(BR), fs/(fu + fd) = 0.160 ± 0.005(stat)$+0.011\\atop{-0.010}$(syst)Λ$+0.057\\atop{-0.034}$(BR), and fΛb/(fu + fd) = 0.281 ± 0.012(stat)$+0.058\\atop{-0.056}$(syst)$+0.128\\atop{-0.086}$(BR). fs/(fu + fd) agrees both with previous CDF measurements and the world averages, dominated by the LEP measurements, with ~ 1σ. However, fΛb/(fu + fd) is approximately twice the value which has been measured at LEP and in CDF Run I and disagrees with the LEP results by approximately 2 σ.

  17. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  18. Involvement of the 5'-leader sequence in coupling the stability of a human H3 histone mRNA with DNA replication

    International Nuclear Information System (INIS)

    Morris, T.; Marashi, F.; Weber, L.; Hickey, E.; Greenspan, D.; Bonner, J.; Stein, J.; Stein, G.

    1986-01-01

    Two lines of evidence derived from fusion gene constructs indicate that sequences residing in the 5'-nontranslated region of a cell cycle-dependent human H3 histone mRNA are involved in the selective destabilization that occurs when DNA synthesis is terminated. The experimental approach was to construct chimeric genes in which fragments of the mRNA coding regions of the H3 histone gene were fused with fragments of genes not expressed in a cell cycle-dependent manner. After transfection in HeLa S3 cells with the recombinant plasmids, levels of fusion mRNAs were determined by S1 nuclease analysis prior to and following DNA synthesis inhibition. When the first 20 nucleotides of an H3 histone mRNA leader were replaced with 89 nucleotides of the leader from a Drosophila heat-shock (hsp70) mRNA, the fusion transcript remained stable during inhibition of DNA synthesis, in contrast to the rapid destabilization of the endogenous histone mRNA in these cells. In a reciprocal experiment, a histone-globin fusion gene was constructed that produced a transcript with the initial 20 nucleotides of the H3 histone mRNA substituted for the human β-globin mRNA leader. In HeLa cells treated with inhibitors of DNA synthesis and/or protein synthesis, cellular levels of this histone-globin fusion mRNA appeared to be regulated in a manner similar to endogenous histone mRNA levels. These results suggest that the first 20 nucleotides of the leader are sufficient to couple histone mRNA stability with DNA replication

  19. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  20. Gene Flow of a Forest-Dependent Bird across a Fragmented Landscape.

    Directory of Open Access Journals (Sweden)

    Rachael V Adams

    Full Text Available Habitat loss and fragmentation can affect the persistence of populations by reducing connectivity and restricting the ability of individuals to disperse across landscapes. Dispersal corridors promote population connectivity and therefore play important roles in maintaining gene flow in natural populations inhabiting fragmented landscapes. In the prairies, forests are restricted to riparian areas along river systems which act as important dispersal corridors for forest dependent species across large expanses of unsuitable grassland habitat. However, natural and anthropogenic barriers within riparian systems have fragmented these forested habitats. In this study, we used microsatellite markers to assess the fine-scale genetic structure of a forest-dependent species, the black-capped chickadee (Poecile atricapillus, along 10 different river systems in Southern Alberta. Using a landscape genetic approach, landscape features (e.g., land cover were found to have a significant effect on patterns of genetic differentiation. Populations are genetically structured as a result of natural breaks in continuous habitat at small spatial scales, but the artificial barriers we tested do not appear to restrict gene flow. Dispersal between rivers is impeded by grasslands, evident from isolation of nearby populations (~ 50 km apart, but also within river systems by large treeless canyons (>100 km. Significant population genetic differentiation within some rivers corresponded with zones of different cottonwood (riparian poplar tree species and their hybrids. This study illustrates the importance of considering the impacts of habitat fragmentation at small spatial scales as well as other ecological processes to gain a better understanding of how organisms respond to their environmental connectivity. Here, even in a common and widespread songbird with high dispersal potential, small breaks in continuous habitats strongly influenced the spatial patterns of genetic

  1. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  2. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  3. A measurement of the b quark fragmentation function at √Q2 = 45.6 GeV

    International Nuclear Information System (INIS)

    Church, E.D.

    1996-06-01

    Presented here is a measurement of the b quark fragmentation function D b (X), taken from a sample of 504 semi-leptonic B decays which were selected from the 150,000 Z 0 decays collected between 1993 and 1995 at the SLD at SLAC. The energy of each tagged B hadron is reconstructed using missing jet energy, based on the information from the lepton and a partially-reconstructed charm-decay vertex. Account is taken of the effect of primary orbitally excited mesons (B**s). An iterative unfolding procedure is used which serves to effectively extract the true fragmentation function from the reconstructed B energy spectrum. The final result is shown to be compatible with many theoretical models. A comparison is made with other b fragmentation function measurements at 45.6 GeV, and this measurement is shown to be consistent with those results. The average scaled energy is found to be (x E ) = 0.697± 0.017(stat) ± 0.034(sys)

  4. Development of methods to measure hemoglobin adducts by gel electrophoresis - Preliminary results

    International Nuclear Information System (INIS)

    Sun, J.D.; McBride, S.M.

    1988-01-01

    Chemical adducts formed on blood hemoglobin may be a useful biomarker for assessing human exposures to these compounds. This paper reports preliminary results in the development of methods to measure such adducts that may be generally applicable for a wide variety of chemicals. Male F344/N rats were intraperitoneally injected with 14 C-BaP dissolved in corn oil. Twenty-four hours later, the rats were sacrificed. Blood samples were collected and globin was isolated. Globin protein was then cleaved into peptide fragments using cyanogen bromide and the fragments separated using 2-dimensional gel electrophoresis. The results showed that the adducted 14 C-globin fragments migrated to different areas of the gel than did unadducted fragments. Further research is being conducted to develop methods that will allow quantitation of separated adducted globin fragments from human blood samples without the use of a radiolabel. (author)

  5. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  6. Determination of the spectrum of beta-thalassemia genes in Spain by use of dot-blot analysis of amplified beta-globin DNA.

    OpenAIRE

    Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M

    1988-01-01

    We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...

  7. Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

    Science.gov (United States)

    Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

    1998-01-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

  8. Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

    Science.gov (United States)

    Allignet, J; Liassine, N; el Solh, N

    1998-07-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

  9. Crystallization and preliminary crystallographic studies of the single-chain variable fragment of antibody chA21 in complex with an N-terminal fragment of ErbB2

    International Nuclear Information System (INIS)

    Liu, Yang; Zhou, Huihao; Zhu, Juanjuan; Gao, Yongxiang; Niu, Liwen; Liu, Jing; Teng, Maikun

    2009-01-01

    An antibody–antigen complex consisting of a single-chain variable fragment of the potential therapeutic antibody chA21 and an N-terminal fragment (residues 1–192) of the human ErbB2 extracellular domain was expressed, purified and crystallized. X-ray diffraction data were collected to 2.45 Å resolution. ErbB2 is a transmembrane tyrosine kinase, the overexpression of which causes abnormality and disorder in cell signalling and leads to cell transformation. Previously, an anti-ErbB2 single-chain chimeric antibody chA21 that specifically inhibits the growth of ErbB2-overexpressing cancer cells in vitro and in vivo was developed. Here, an antibody–antigen complex consisting of the single-chain variable fragment (scFv) of chA21 and an N-terminal fragment (residues 1–192, named EP I) of the ErbB2 extracellular domain was crystallized using the sitting-drop vapour-diffusion method. An X-ray diffraction data set was collected to 2.45 Å resolution from a single flash-cooled crystal; the crystal belonged to space group P2 1 2 1 2 1

  10. Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-01-01

    Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

  11. Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

    Directory of Open Access Journals (Sweden)

    Byoung-Jun Kim

    Full Text Available Recent multi locus sequence typing (MLST and genome based studies indicate that lateral gene transfer (LGT events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas, we applied rpoB typing (711 bp to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp. The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60 genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46, showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41 PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

  12. Protective vaccination with a recombinant fragment of Clostridium botulinum neurotoxin serotype A expressed from a synthetic gene in Escherichia coli.

    OpenAIRE

    Clayton, M A; Clayton, J M; Brown, D R; Middlebrook, J L

    1995-01-01

    A completely synthetic gene encoding fragment C, a approximately 50-kDa fragment, of botulinum neurotoxin serotype A was constructed from oligonucleotides. The gene was expressed in Escherichia coli, and full-sized product was produced as judged by Western blot (immunoblot) analysis. Crude extracts of E. coli expressing the gene were used to vaccinate mice and evaluate their survival against challenge with active toxin. Mice given three subcutaneous vaccinations were protected against an intr...

  13. Biochemical and molecular investigations on qualitative and quantitative Hb polymorphism in the river buffalo (Bubalus bubalis L. population reared in Southern Italy

    Directory of Open Access Journals (Sweden)

    Mario Iorio

    2004-01-01

    Full Text Available On 398 river buffalo samples, randomly collected in distinct breeding areas of the Campania region, high-resolution analytical systems were used to identify both qualitative and quantitative variations of the Hb phenotype. Polyacrylamide gel isoelectric focusing and HPLC were used to determine the ratio between HBA1 and HBA2 globin chains; restriction endonuclease analysis was performed to assess whether quantitative variations in Hb bands were related to an unusual number of a-globin genes. In the two buffalo subpopulations, allele frequencies of the alpha and beta globin systems were calculated, and F statistics (FIS, FIT and FST were estimated as parameters of genetic diversity. The results suggest that: i as shown by RFLP analysis, only a couple of associated a globin genes account for the quantitative variations recorded at the phenotypic level; ii as expected, in the a globin gene system (HBA, the frequency of haplotype B (HBA-B largely exceeded that of haplotype A (HBA-A (95.1% vs 4.9%; iii the frequency of the usual allele at the beta locus is 0.6, as opposed to 0.4 of the slow variant; iiii the most significant component of variation of the genetic system of hemoglobin is between individuals within the same location.

  14. Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

    Science.gov (United States)

    Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

    2010-09-16

    The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

  15. Recent trends in the gene therapy of β-thalassemia

    Directory of Open Access Journals (Sweden)

    Finotti A

    2015-02-01

    Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

  16. A measurement of the b quark fragmentation function at {radical}Q{sup 2} = 45.6 GeV

    Energy Technology Data Exchange (ETDEWEB)

    Church, E.D.

    1996-06-01

    Presented here is a measurement of the b quark fragmentation function D{sub b}(X), taken from a sample of 504 semi-leptonic B decays which were selected from the 150,000 Z{sup 0} decays collected between 1993 and 1995 at the SLD at SLAC. The energy of each tagged B hadron is reconstructed using missing jet energy, based on the information from the lepton and a partially-reconstructed charm-decay vertex. Account is taken of the effect of primary orbitally excited mesons (B**s). An iterative unfolding procedure is used which serves to effectively extract the true fragmentation function from the reconstructed B energy spectrum. The final result is shown to be compatible with many theoretical models. A comparison is made with other b fragmentation function measurements at 45.6 GeV, and this measurement is shown to be consistent with those results. The average scaled energy is found to be (x{sub E}) = 0.697{+-} 0.017(stat) {+-} 0.034(sys).

  17. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  18. Activation of the human beta interferon gene by the adenovirus type 12 E1B gene

    International Nuclear Information System (INIS)

    Shiroki, K.; Toth, M.

    1988-01-01

    The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT

  19. Detection in a Japanese population of a length polymorphism in the 5' flanking region of the human β-globin gene with denaturing gradient gel electrophoresis

    International Nuclear Information System (INIS)

    Takahashi, Noria; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko

    1992-10-01

    An analysis of the ATTTT repeat polymorphism located approximately 1,400 base pairs upstream from the β-globin structural gene was carried out by denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes. Genomic or cloned DNAs were digested with restriction enzymes and hybridized with 32 P-labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. A difference in the number of repeat units was recognized by differences in duplex mobility on the DGGE gel. In this study of 81 unrelated Japanese from Hiroshima, a sequence heteromorphism was observed at this site. Alleles with 5 and 6 repeats of the ATTTT unit, which had already been reported, were found in polymorphic proportions. In addition, two unreported alleles, one having 7 repeats and the other having an A-to-G nucleotide substitution in the 5th repeat, were detected. Family study data showed that the segregation of these four types of variants is consistent with an autosomal codominant mode of inheritance. This study also demonstrated that DGGE of RNA:DNA duplexes is a sensitive tool for detecting variations in DNA. (author)

  20. Variation in Gamma-Globin Expression before and after Induction with Hydroxyurea Associated with BCL11A, KLF1 and TAL1.

    Directory of Open Access Journals (Sweden)

    Amanda J Grieco

    Full Text Available The molecular mechanisms governing γ-globin expression in a subset of fetal hemoglobin (α2γ2: HbF expressing red blood cells (F-cells and the mechanisms underlying the variability of response to hydroxyurea induced γ-globin expression in the treatment of sickle cell disease are not completely understood. Here we analyzed intra-person clonal populations of basophilic erythroblasts (baso-Es derived from bone marrow common myeloid progenitors in serum free cultures and report the level of fetal hemoglobin production in F-cells negatively correlates with expression of BCL11A, KLF1 and TAL1. We then examined the effects of hydroxyurea on these three transcription factors and conclude that a successful induction of γ-globin includes a reduction in BCL11A, KLF1 and TAL1 expression. These data suggests that expression changes in this transcription factor network modulate γ-globin expression in F-cells during steady state erythropoiesis and after induction with hydroxyurea.

  1. Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

    Science.gov (United States)

    Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

    2018-04-01

    Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

  2. Population Genetic Structure of Glycyrrhiza inflata B. (Fabaceae) Is Shaped by Habitat Fragmentation, Water Resources and Biological Characteristics.

    Science.gov (United States)

    Yang, Lulu; Chen, Jianjun; Hu, Weiming; Yang, Tianshun; Zhang, Yanjun; Yukiyoshi, Tamura; Zhou, Yanyang; Wang, Ying

    2016-01-01

    Habitat fragmentation, water resources and biological characteristics are important factors that shape the genetic structure and geographical distribution of desert plants. Analysis of the relationships between these factors and population genetic variation should help to determine the evolutionary potential and conservation strategies for genetic resources for desert plant populations. As a traditional Chinese herb, Glycyrrhiza inflata B. (Fabaceae) is restricted to the fragmented desert habitat in China and has undergone a dramatic decline due to long-term over-excavation. Determining the genetic structure of the G. inflata population and identifying a core collection could help with the development of strategies to conserve this species. We investigated the genetic variation of 25 G. inflata populations based on microsatellite markers. A high level of population genetic divergence (FST = 0.257), population bottlenecks, reduced gene flow and moderate genetic variation (HE = 0.383) were detected. The genetic distances between the populations significantly correlated with the geographical distances, and this suggests that habitat fragmentation has driven a special genetic structure of G. inflata in China through isolation by distance. STRUCTURE analysis showed that G. inflata populations were structured into three clusters and that the populations belonged to multiple water systems, which suggests that water resources were related to the genetic structure of G. inflata. In addition, the biological characteristics of the perennial species G. inflata, such as its long-lived seeds, asexual reproduction, and oasis ecology, may be related to its resistance to habitat fragmentation. A core collection of G. inflata, that included 57 accessions was further identified, which captured the main allelic diversity of G. inflata. Recent habitat fragmentation has accelerated genetic divergence. The population genetic structure of G. inflata has been shaped by habitat

  3. The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

    Science.gov (United States)

    Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

    2012-01-01

    Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

  4. Hematological Characterizations and Molecular Diagnostic Aspects of Hb Wiangpapao [α44(CE2)Pro→Ser (α1), CCG>TCG; HBA1: c.133C>T], a New α-Globin Variant Found in a Pregnant Thai Woman.

    Science.gov (United States)

    Panyasai, Sitthichai; Pornprasert, Sakorn

    2017-03-01

    We report the hematological parameters and provide a rapid molecular analysis method for detection of Hb Wiangpapao [α44(CE2)Pro→Ser, CCG>TCG; HBA1: c.133C>T], a new α-globin variant found in a pregnant Thai woman. Her red cell indices were measured by an automated blood counter. The results were: red blood cell (RBC) count 4.03 × 10 12 /L, Hb 13.1 (g/dL), packed cell volume (PCV) 0.39 L/L, mean corpuscular volume (MCV) 97.0 fL, mean corpuscular hemoglobin (Hb) (MCH) 32.5 pg, mean corpuscular Hb concentration (MCHC) 33.4 g/dL, and RBC distribution width (RDW) 9.4%. The Hb typing by high performance liquid chromatography (HPLC) showed 13.6% abnormal Hb at a retention time of 2.20 min. that was difficult to distinguish from Hb A. On the capillary electrophoresis (CE) electropherogram, this hemoglobinopathy peak did not separate from the Hb A peak. DNA sequencing showed a C>T transition at the first position of codon 44 (CCG>TCG) of the α1-globin gene that led to a substitution of proline for serine. This mutation has not been recorded in the public databases. Therefore, we named it Hb Wiangpapao as it was first discovered in the Wiangpapao District, Chiang Rai, Thailand. The multiplex allele-specific polymerase chain reaction (ASPCR) for detection of Hb Wiangpapao was developed and revealed a 510 bp specifically amplified fragment. The better understanding of hematological characterizations and the newly developed multiplex ASPCR for diagnosis of Hb Wiangpapao are useful for genetic counseling and family education.

  5. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    Science.gov (United States)

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  7. Loss of Major DNase I Hypersensitive Sites in Duplicatedglobin Gene Cluster Incompletely Silences HBB Gene Expression

    Czech Academy of Sciences Publication Activity Database

    Reading, N. S.; Shooter, C.; Song, J.; Miller, R.; Agarwal, A.; Láníková, Lucie; Clark, B.; Thein, S.L.; Divoký, V.; Prchal, J.T.

    2016-01-01

    Roč. 37, č. 11 (2016), s. 1153-1156 ISSN 1059-7794 R&D Projects: GA MŠk(CZ) LH15223 Institutional support: RVO:68378050 Keywords : globin genes * regulation * sickle cell disease * HBB duplication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.601, year: 2016

  8. Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

    African Journals Online (AJOL)

    Dilay Ciglidag Dungul

    carrying individuals with intact beta globin gene. DNA was extracted from peripheral blood sam- ples of seven healthy carrier individuals who have abnormal hemoglobin variants and 16 control individuals from Turkey. Complete coding and intronic sequences of HBA1 and HBA2 genes were amplified by polymerase chain ...

  9. Distant homology between yeast photoreactivating gene fragment and human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1985-01-01

    Hybridization of DNA coding for the yeast DNA photolyase to human genomic DNA appears to allow one to determine whether a conserved enzyme is coded for in human cells. Under stringent conditions (68 0 C), hybridization is not found between the cloned yeast fragment (YEp13-phr1) and human or chick genomic digests. At less stringent conditions (60 0 C), hybridization is observed with chick digests, indicating evolutionary divergence even among organisms capable of photo-reactivation. At 50 0 C, weak hybridization with human digests was observed, indicating further divergence from the cloned gene. Data concerning the precise extent of homology and methods to clone the chick gene for use as another probe are discussed

  10. High gene flow in epiphytic ferns despite habitat loss and fragmentation

    OpenAIRE

    Winkler, Manuela; Koch, Marcus; Hietz, Peter

    2011-01-01

    Tropical montane forests suffer from increasing fragmentation and replacement by other types of land-use such as coffee plantations. These processes are known to affect gene flow and genetic structure of plant populations. Epiphytes are particularly vulnerable because they depend on their supporting trees for their entire life-cycle. We compared population genetic structure and genetic diversity derived from AFLP markers of two epiphytic fern species differing in their ability to colonize sec...

  11. Evidence for Sequence Scrambling and Divergent H/D Exchange Reactions of Doubly-Charged Isobaric b-Type Fragment Ions

    Science.gov (United States)

    Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H.; Somogyi, Arpad; Solouki, Touradj

    2014-02-01

    To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10 2+ that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10 2+ and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10 2+, suggesting that b10 2+ may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10 2+; over 30 % of the observed SORI-CID fragment ions from substance P b10 2+ had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10 2+, whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10 2+.

  12. Evidence for sequence scrambling and divergent H/D exchange reactions of doubly-charged isobaric b-type fragment ions.

    Science.gov (United States)

    Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H; Somogyi, Arpad; Solouki, Touradj

    2014-02-01

    To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10(2+) that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10(2+) and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10(2+), suggesting that b10(2+) may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10(2+); over 30% of the observed SORI-CID fragment ions from substance P b10(2+) had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10(2+), whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10(2+).

  13. Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

    OpenAIRE

    Babiss, L E; Friedman, J M; Darnell, J E

    1986-01-01

    In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

  14. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  15. Atypical Genetic Locus Associated with Constitutive Production of Enterocin B by Enterococcus faecium BFE 900

    Science.gov (United States)

    Franz, Charles M. A. P.; Worobo, Randy W.; Quadri, Luis E. N.; Schillinger, Ulrich; Holzapfel, Wilhelm H.; Vederas, John C.; Stiles, Michael E.

    1999-01-01

    A purified bacteriocin produced by Enterococcus faecium BFE 900 isolated from black olives was shown by Edman degradation and mass spectrometric analyses to be identical to enterocin B produced by E. faecium T136 from meat (P. Casaus, T. Nilsen, L. M. Cintas, I. F. Nes, P. E. Hernández, and H. Holo, Microbiology 143:2287–2294, 1997). The structural gene was located on a 2.2-kb HindIII fragment and a 12.0-kb EcoRI chromosomal fragment. The genetic characteristics and production of EntB by E. faecium BFE 900 differed from that described so far by the presence of a conserved sequence like a regulatory box upstream of the EntB gene, and its production was constitutive and not regulated. The 2.2-kb chromosomal fragment contained the hitherto undetected immunity gene for EntB in an atypical orientation that is the reverse of that of the structural gene. Typical transport and other genes associated with bacteriocin production were not detected on the 12.0-kb chromosomal fragment containing the EntB structural gene. This makes the EntB genetic system different from most other bacteriocin systems, where transport and possible regulatory genes are clustered. EntB was subcloned and expressed by the dedicated secretion machinery of Carnobacterium piscicola LV17A. The structural gene was amplified by PCR, fused to the divergicin A signal peptide, and expressed by the general secretory pathway in Enterococcus faecalis ATCC 19433. PMID:10224016

  16. Inclusive Analysis of the b Quark Fragmentation Function in Z Decays at LEP

    CERN Document Server

    Abbiendi, G.; Akesson, P.F.; Alexander, G.; Allison, John; Amaral, P.; Anagnostou, G.; Anderson, K.J.; Arcelli, S.; Asai, S.; Axen, D.; Azuelos, G.; Bailey, I.; Barberio, E.; Barlow, R.J.; Batley, R.J.; Bechtle, P.; Behnke, T.; Bell, Kenneth Watson; Bell, P.J.; Bella, G.; Bellerive, A.; Benelli, G.; Bethke, S.; Biebel, O.; Bloodworth, I.J.; Boeriu, O.; Bock, P.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Buesser, K.; Burckhart, H.J.; Cammin, J.; Campana, S.; Carnegie, R.K.; Caron, B.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Cohen, I.; Csilling, A.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Dallison, S.; De Roeck, A.; De Wolf, E.A.; Desch, K.; Donkers, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Elfgren, E.; Etzion, E.; Fabbri, F.; Feld, L.; Ferrari, P.; Fiedler, F.; Fleck, I.; Ford, M.; Frey, A.; Furtjes, A.; Gagnon, P.; Gary, John William; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Giunta, Marina; Goldberg, J.; Gross, E.; Grunhaus, J.; Gruwe, M.; Gunther, P.O.; Gupta, A.; Hajdu, C.; Hamann, M.; Hanson, G.G.; Harder, K.; Harel, A.; Harin-Dirac, M.; Hauschild, M.; Hauschildt, J.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Hensel, C.; Herten, G.; Heuer, R.D.; Hill, J.C.; Hoffman, Kara Dion; Homer, R.J.; Horvath, D.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Ishii, K.; Jeremie, H.; Jovanovic, P.; Junk, T.R.; Kanaya, N.; Kanzaki, J.; Karapetian, G.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kim, D.H.; Klein, K.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Kokott, T.P.; Komamiya, S.; Kormos, Laura L.; Kowalewski, Robert V.; Kramer, T.; Kress, T.; Krieger, P.; von Krogh, J.; Krop, D.; Kupper, M.; Kyberd, P.; Lafferty, G.D.; Landsman, H.; Lanske, D.; Layter, J.G.; Leins, A.; Lellouch, D.; Letts, J.; Levinson, L.; Lillich, J.; Lloyd, S.L.; Loebinger, F.K.; Lu, J.; Ludwig, J.; Macpherson, A.; Mader, W.; Marcellini, S.; Marchant, T.E.; Martin, A.J.; Martin, J.P.; Masetti, G.; Mashimo, T.; Mattig, Peter; McDonald, W.J.; McKenna, J.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Mendez-Lorenzo, P.; Menges, W.; Merritt, F.S.; Mes, H.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Moed, S.; Mohr, W.; Mori, T.; Mutter, A.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nisius, R.; O'Neale, S.W.; Oh, A.; Okpara, A.; Oreglia, M.J.; Orito, S.; Pahl, C.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poli, B.; Polok, J.; Pooth, O.; Przybycien, M.; Quadt, A.; Rabbertz, K.; Rembser, C.; Renkel, P.; Rick, H.; Roney, J.M.; Rosati, S.; Rozen, Y.; Runge, K.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sarkisyan, E.K.G.; Schaile, A.D.; Schaile, O.; Scharff-Hansen, P.; Schieck, J.; Schoerner-Sadenius, Thomas; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.; Skuja, A.; Smith, A.M.; Sobie, R.; Soldner-Rembold, S.; Spagnolo, S.; Spano, F.; Stahl, A.; Stephens, K.; Strom, David M.; Strohmer, R.; Tarem, S.; Tasevsky, M.; Taylor, R.J.; Teuscher, R.; Thomson, M.A.; Torrence, E.; Toya, D.; Tran, P.; Trefzger, T.; Tricoli, A.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turner-Watson, M.F.; Ueda, I.; Ujvari, B.; Vachon, B.; Vollmer, C.F.; Vannerem, P.; Verzocchi, M.; Voss, H.; Vossebeld, J.; Waller, D.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wengler, T.; Wermes, N.; Wetterling, D.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Zacek, V.; Zer-Zion, D.; Zivkovic, Lidija

    2003-01-01

    A study of b quark hadronisation is presented using inclusively reconstructed B hadrons in about four million hadronic Z decays recorded in 1992-2000 with the OPAL detector at LEP. The data are compared to different theoretical models, and fragmentation function parameters of these models are fitted. The average scaled energy of weakly decaying B hadrons is determined to be =0.7193+-0.0016(stat)+0.0036-0.0031(syst)

  17. Phylogenetic reconstruction of the family Acrypteridae (Orthoptera: Acridoidea) based on mitochondrial cytochrome B gene.

    Science.gov (United States)

    Huo, Guangming; Jiang, Guofang; Sun, Zhengli; Liu, Dianfeng; Zhang, Yalin; Lu, Lin

    2007-04-01

    Sequences from the mitochondrial cytochrome b gene (Cyt b) were determined for 25 species from the superfamily Acridoidae and the homologous sequences of 19 species of grasshoppers were downloaded from the GenBank data library. The purpose was to develop a molecular phylogeny of the Acrypteridae, and to interpret the phylogenetic position of the family within the superfamily Acridoidea. Phylogeny was reconstructed by Maximum-parsimony (MP) and Bayesian criteria using Yunnanites coriacea and Tagasta marginella as outgroups. The alignment length of the fragments was 384 bp after excluding ambiguous sites, including 167 parsimony informative sites. In the fragments, the percentages of A + T and G + C were 70.7% and 29.3%, respectively. The monophyly of Arcypteridae is not supported by phylogenetic trees. Within the Arcypteridae, neither Arcypterinae nor Ceracrinae is supported as a monophyletic group. The current genus Chorthippus is not a monophyletic group, and should be a polyphyletic group. The present results are significantly different from the classification scheme of Arcypteridae, which is based on morphology.

  18. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  19. Correlation of MFOLD-predicted DNA secondary structures with separation patterns obtained by capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis.

    Science.gov (United States)

    Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka

    2002-04-01

    We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.

  20. Atrial cardiomyocyte-specific expression of Cre recombinase driven by an Nppa gene fragment

    NARCIS (Netherlands)

    de Lange, Frederik J.; Moorman, Antoon F. M.; Christoffels, Vincent M.

    2003-01-01

    To study the development of the atria, we produced a transgenic mouse line that expresses Cre under the regulatory control of a 7 kbp fragment of the Natriuretic peptide precursor type A gene (Nppa), from -3 kbp to +4 kbp relative to the transcription start site. Crossing this line with the R26R and

  1. Hb H disease resulting from the association of an αº-thalassemia allele [-(α20.5] with an unstable α-globin variant [Hb Icaria]: first report on the occurrence in Brazil

    Directory of Open Access Journals (Sweden)

    Elza M. Kimura

    2009-01-01

    Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.

  2. Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

    African Journals Online (AJOL)

    Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...

  3. Mapping of the antigenic and allergenic epitopes of Lol p VB using gene fragmentation.

    Science.gov (United States)

    Ong, E K; Knox, R B; Singh, M B

    1995-03-01

    The recombinant proteins of Lol p VA and Lol p VB expressed in E. coli reacted with IgE antibodies from sera of allergic patients and mAbs FMC A7 and PpV1. Cross-absorption analyses using these recombinant proteins showed that Lol p VA and Lol p VB possess both similar and unique IgE binding determinants. Gene fragmentation was utilized to localize the antigenic and allergenic determinants of Lol p VB. When full-length cDNA of Lol p VB was digested into three fragments and expressed as the fusions from the glutathione transferase of pGEX vectors, fragments Met1-Val196 and Asp197-Val339 bound IgE while fragment Met1-Pro96 did not. The data suggest that there are at least two IgE binding determinants in Lol p VB. In addition, only fragment Met1-Val196 reacted with mAb PpV1. The localization of these determinants was further resolved using random fragment expression libraries. The mAb PpV1 determinant was near the N-terminal region of Lol p VB molecule. The IgE binding determinants were distributed in the central region: region I (amino acids 111-195) and II (199-254). These IgE binding determinants are conserved in Lol p VA.

  4. Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).

    OpenAIRE

    Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H

    1987-01-01

    An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...

  5. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  6. Polymorphisms of CCL3L1/CCR5 genes and recurrence of hepatitis B in liver transplant recipients.

    Science.gov (United States)

    Li, Hong; Xie, Hai-Yang; Zhou, Lin; Wang, Wei-Lin; Liang, Ting-Bo; Zhang, Min; Zheng, Shu-Sen

    2011-12-01

    The genetic diversity of chemokines and chemokine receptors has been associated with the outcome of hepatitis B virus infection. The aim of this study was to evaluate whether the copy number variation in the CCL3L1 gene and the polymorphisms of CCR5Δ32 and CCR5-2459A→G (rs1799987) are associated with recurrent hepatitis B in liver transplantation for hepatitis B virus infection-related end-stage liver disease. A total of 185 transplant recipients were enrolled in this study. The genomic DNA was extracted from whole blood, the copy number of the CCL3L1 gene was determined by a quantitative real-time PCR based assay, CCR5Δ32 was detected by a sizing PCR method, and a single-nucleotide polymorphism in CCR5-2459 was detected by restriction fragment length polymorphism PCR. No CCR5Δ32 mutation was detected in any of the individuals from China. Neither copy number variation nor polymorphism in CCR5-2459 was associated with post-transplant re-infection with hepatitis B virus. However, patients with fewer copies (CCR5 genes might be more likely to have recurrence of hepatitis B after transplantation.

  7. Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

    Science.gov (United States)

    Chu, L Y; Rhoads, R E

    1978-06-13

    The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

  8. Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

    International Nuclear Information System (INIS)

    Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.; Yankovskii, N.K.; Debabov, V.G.

    1989-01-01

    Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector λpSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB + clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA + transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmids consistently transduced the markers thrB + and lysA + . The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes

  9. A Measurement of $B$ Quark Fragmentation Fractions in $p\\bar{p}$ Collisions at 1.8-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Wendy Jane [Toronto U.

    1999-01-01

    Fragmentation is the process by which quarks and gluons organize themselves into hadrons. The fragmentation properties of the bottom quark cannot be predicted from fundamental principles and hence must be determined empirically. We investigate one such property, namely the avour dependence of the fragmentation process for bottom quarks produced in 1.8-TeV proton-antiproton collisions. This avour dependence is investigated by determining the B-hadron production ratios....

  10. A Survey of ABO, Rhesus (D) Antigen and Haemoglobin Genes ...

    African Journals Online (AJOL)

    olayemitoyin

    transporting the bound oxygen throughout the body where it is used in ... the globin genes that alter the protein composition but not necessarily ... oxygen carrying capacity and hence the rate of aerobic metabolic ... to participate in the exercise.

  11. Pollen and gene flow in fragmented habitats

    NARCIS (Netherlands)

    Kwak, Manja M.; Velterop, Odilia; van Andel, Jelte

    . Habitat fragmentation affects both plants and pollinators. Habitat fragmentation leads to changes in species richness, population number and size, density, and shape, thus to changes in the spatial arrangement of flowers. These changes influence the amount of food for flower-visiting insects and

  12. The role of the β-1,6-endoglucanase gene vegB in physiology and virulence of Verticillium dahliae

    Directory of Open Access Journals (Sweden)

    Lugard EBOIGBE

    2014-05-01

    Full Text Available The β-1,6-endoglucanase gene (vegB of Verticillium dahliae was isolated using a genome walking technique. Nucleotide and deduced amino acid sequences of the gene showed high identity with the PAN1 sequence deposited at the Verticillium genome database (Broad Institute, but significant differences in intron numbers and sites of insertion. Detailed in silico analysis, accompanied by sequencing of both genomic and cDNA, as well as RT-PCR experiments, provided the correct size of the gene and the exact number, length and positions of introns. The putative protein of this gene was compared with corresponding β-1,6-endoglucanases from other fungi, and sequences were used to construct a phylogenetic tree. A clear differentiation between enzymes derived from plant pathogenic and mycoparasitic fungi was observed, fully supported by bootstrap data. An internal fragment (1.2kb of vegB was used to disrupt the wild-type gene of a V. dahliae tomato race 2 strain, and the mutant strain, vegB-, was tested for pathogenicity on tomato plants. Results showed a small but constant reduction in disease symptoms only on eggplants for the vegB- strain in comparison with the wild type. Growth on minimal medium supplemented with different carbon sources showed reduced ability of the mutant to breakdown cellulose, whereas growth on glucose, pectin and sucrose was similar to the wild type.

  13. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  14. Molecular phylogeny of ateline new world monkeys (Platyrrhini, atelinae) based on gamma-globin gene sequences: evidence that brachyteles is the sister group of lagothrix.

    Science.gov (United States)

    Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M

    1999-06-01

    Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)

  15. Molecular Properties of Globin Channels and Pores: Role of Cholesterol in Ligand Binding and Movement

    Directory of Open Access Journals (Sweden)

    Gene A Morrill

    2016-09-01

    Full Text Available ABSTRACT: Globins contain one or more cavities that control or affect such functions as ligand movement and ligand binding. Here we report that the extended globin family [cytoglobin (Cygb; neuroglobin (Ngb; myoglobin (Mb; hemoglobin (Hb subunits Hba(α and Hbb(β] contain either a transmembrane (TM helix or pore-lining region as well as internal cavities. Protein motif/domain analyses indicate that Ngb and Hbb each contain 5 cholesterol-binding (CRAC/CARC domains and 1 caveolin binding motif, whereas the Cygb dimer has 6 cholesterol-binding domains but lacks caveolin-binding motifs. Mb and Hba each exhibit 2 cholesterol-binding domains and also lack caveolin-binding motifs. The Hb αβ-tetramer contains 14 cholesterol-binding domains. Computer algorithms indicate that Cygb and Ngb cavities display multiple partitions and C-terminal pore-lining regions, whereas Mb has three major cavities plus a C-terminal pore-lining region. The Hb tetramer exhibits a large internal cavity but the subunits differ in that they contain a C-terminal TM helix (Hba and pore-lining region (Hbb. The cavities include 43 of 190 Cygb residues, 38 of 151 of Ngb residues, 55 of 154 Mb residues and 137 of 688 residues in the Hb tetramer. Each cavity complex includes 6 to 8 residues of the TM helix or pore-lining region and CRAC/CARC domains exist within all cavities. Erythrocyte Hb αβ-tetramers are largely cytosolic but also bind to a membrane anion exchange protein, band 3, which contains a large internal cavity and 12 TM helices (5 being pore-lining regions. The Hba TM helix may be the erythrocyte membrane band 3 attachment site. Band 3 contributes 4 caveolin binding motifs and 10 CRAC/CARC domains. Cholesterol binding may create lipid-disordered phases that alter globin cavities and facilitate ligand movement, permitting ion channel formation and conformational changes that orchestrate anion and ligand (O2, CO2, NO movement within the large internal cavities and

  16. Use of a fragment of the tuf gene for phytoplasma 16Sr group/subgroup differentiation

    DEFF Research Database (Denmark)

    Contaldo, Nicoletta; Canel, Alessandro; Makarova, Olga

    2011-01-01

    The usefulness of RFLP analyses on a 435 bp fragment of the tuf gene for preliminary identification of phytoplasmas from a number of phytoplasma ribosomal groups and/or 'Candidatus. Phytoplasma' was verified. The strains employed belong to thirteen 16Sr DNA groups and 22 different subgroups...

  17. Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

    Science.gov (United States)

    2012-01-01

    The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

  18. Genetic diversity of nifH gene sequences in Paenibacillus azotofixans strains and soil samples analyzed by denaturing gradiënt gel electrophoresis of PCR-amplified gene fragments

    NARCIS (Netherlands)

    Rosado, A.S.; Duarte, G.F.; Seldin, L.; Elsas, van J.D.

    1998-01-01

    The diversity of dinitrogenase reductase gene (nifH) fragments in Paenibacillus azotofixans strains was investigated by using molecular methods. The partial nifH gene sequences of eight P. azotofixans strains, as well as one strain each of the close relatives Paenibacillus durum, Paenibacillus

  19. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  20. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  1. Hepatitis B virus DNA integration and transactivation of cellular genes

    Directory of Open Access Journals (Sweden)

    Vijay Kumar

    2007-02-01

    Full Text Available

    Chronic hepatitis B virus (HBV infection is etiologically related to human hepatocellular carcinoma (HCC. Most HCCs contain integrated HBV DNA in hepatocyte, suggesting that the integration may be involved in carcinogenesis. Available data on the integrants from human hepatocellular carcinomas seem to represent primary integrants as well as the products of secondary rearrangements. By means of structural analyses of the possible primary integrants, it has been observed that the replication intermediates of the viral genome are the preferred substrates for integration. The integrated HBV DNA and the target cellular DNA are invariably associated with deletions, possibly reflecting the substrate for, and the mechanism of, the integration reaction. The host DNA sequences as well as the target site of integration in chromosomes are selected randomly suggesting that HBV DNA integration should bring about random mutagenic effects. Analysis of the samples recovered from hepatocellular carcinomas show that the integrated HBV DNA can mediate secondary rearrangements of chromosomes, such as translocations, inversions, deletions and (possibly amplifications. The integration of HBV DNA into the host genome occurs at early steps of clonal tumor expansion. The integration has been shown in a number of cases to affect a variety of cancer-related genes and to exert insertional mutagenesis. However, in contrast to the woodchuck model, in which specific HBV-DNA integration is detectable in most cases, insertional activation or inactivation of cellular genes appears to be a rare event in man. The discovery of transactivating functions exerted by HBx and truncated HBs(urface proteins supports the notion that these could be relevant to hepatocarcinogenesis as these transactivator sequences have been found in a large number of HCC tumors or hepatoma-derived cell lines. The HBx

  2. Double mutation of cell wall proteins CspB and PBP1a increases secretion of the antibody Fab fragment from Corynebacterium glutamicum

    Science.gov (United States)

    2014-01-01

    Background Among other advantages, recombinant antibody-binding fragments (Fabs) hold great clinical and commercial potential, owing to their efficient tissue penetration compared to that of full-length IgGs. Although production of recombinant Fab using microbial expression systems has been reported, yields of active Fab have not been satisfactory. We recently developed the Corynebacterium glutamicum protein expression system (CORYNEX®) and demonstrated improved yield and purity for some applications, although the system has not been applied to Fab production. Results The Fab fragment of human anti-HER2 was successfully secreted by the CORYNEX® system using the conventional C. glutamicum strain YDK010, but the productivity was very low. To improve the secretion efficiency, we investigated the effects of deleting cell wall-related genes. Fab secretion was increased 5.2 times by deletion of pbp1a, encoding one of the penicillin-binding proteins (PBP1a), mediating cell wall peptidoglycan (PG) synthesis. However, this Δpbp1a mutation did not improve Fab secretion in the wild-type ATCC13869 strain. Because YDK010 carries a mutation in the cspB gene encoding a surface (S)-layer protein, we evaluated the effect of ΔcspB mutation on Fab secretion from ATCC13869. The Δpbp1a mutation showed a positive effect on Fab secretion only in combination with the ΔcspB mutation. The ΔcspBΔpbp1a double mutant showed much greater sensitivity to lysozyme than either single mutant or the wild-type strain, suggesting that these mutations reduced cell wall resistance to protein secretion. Conclusion There are at least two crucial permeability barriers to Fab secretion in the cell surface structure of C. glutamicum, the PG layer, and the S-layer. The ΔcspBΔpbp1a double mutant allows efficient Fab production using the CORYNEX® system. PMID:24731213

  3. Expression of fully functional tetrameric human hemoglobin in Escherichia coli

    International Nuclear Information System (INIS)

    Hoffman, S.J.; Looker, D.L.; Roehrich, J.M.; Cozart, P.E.; Durfee, S.L.; Tedesco, J.L.; Stetler, G.L.

    1990-01-01

    Synthesis genes encoding the human α- and β-globin polypeptides have been expressed from a single operon in Escherichia coli. The α- and β-globin polypeptides associate into soluble tetramers, incorporate heme, and accumulate to >5% of the total cellular protein. Purified recombinant hemoglobin has the correct stoichiometry of α- and β-globin chains and contains a full complement of heme. Each globin chain also contains an additional methionine as an extension to the amino terminus. The recombinant hemoglobin has a C 4 reversed-phase HPLC profile essentially identical to that of human hemoglobin A 0 and comigrates with hemoglobin A 0 on SDS/PAGE. The visible spectrum and oxygen affinity are similar to that of native human hemoglobin A 0 . The authors have also expressed the α- and β-globin genes separately and found that the expression of the α-globin gene alone results in a marked decrease in the accumulation of α-globin in the cell. Separate expression of the β-globin gene results in high levels of insoluble β-globin. These observations suggest that the presence of α- and β-globin in the same cell stabilizes α-globin and aids the correct folding of β-globin. This system provides a simple method for expressing large quantities of recombinant hemoglobin and allows facile manipulation of the genes encoding hemoglobin to produce functionally altered forms of this protein

  4. Genes from plasmid pKM101 in Haemophilus influenzae: separation of functions of mucA and mucB

    International Nuclear Information System (INIS)

    Balganesh, M.; Setlow, J.K.

    1985-01-01

    Haemophilus influenzae, normally not mutable by UV, became UV mutable with a recombinant plasmid insertion. A 7.8-kilobase-pair (kbp) fragment of the plasmid pKM101 containing the mucA and mucB genes was ligated to the shuttle vector pDM2, and a Rec- strain of H. influenzae was transformed with the ligated mixture. All of the transformants, unlike the parent Rec- strain, were resistant to UV, could carry out postreplication repair and Weigle reactivation, showed greatly increased spontaneous mutation, and contained a plasmid carrying an insert of only 1.2 rather than 7.8 kbp. This plasmid in a umuC mutant strain of Escherichia coli complemented a pKM101 derivative lacking mucA function but with an intact mucB gene, although there was no complementation with a mucA+ mucB- plasmid, suggesting that the newly constructed plasmid coded for the mucA protein; this is in accord with the restriction analysis and hybridization between the plasmid and a probe containing all of the mucA gene but only a small fraction of mucB. When one of the H. influenzae Rec- transformants lost the plasmid, the resistance to UV was retained but the high spontaneous mutation and UV mutability were not. The fact that there was hybridization between the chromosome of the cured strain and a probe containing both muc genes but none when almost no mucB was present suggested that at least part of the mucB gene had been integrated into the Rec- chromosome. Five different postreplication repair-proficient strains became UV mutable and had high spontaneous mutation rates caused by the putative mucA plasmid, indicating that these strains already possessed a chromosomal equivalent of the mucB gene

  5. Factor IX gene haplotypes in Amerindians.

    Science.gov (United States)

    Franco, R F; Araújo, A G; Zago, M A; Guerreiro, J F; Figueiredo, M S

    1997-02-01

    We have determined the haplotypes of the factor IX gene for 95 Indians from 5 Brazilian Amazon tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Eight polymorphisms linked to the factor IX gene were investigated: MseI (at 5', nt -698), BamHI (at 5', nt -561), DdeI (intron 1), BamHI (intron 2), XmnI (intron 3), TaqI (intron 4), MspI (intron 4), and HhaI (at 3', approximately 8 kb). The results of the haplotype distribution and the allele frequencies for each of the factor IX gene polymorphisms in Amerindians were similar to the results reported for Asian populations but differed from results for other ethnic groups. Only five haplotypes were identified within the entire Amerindian study population, and the haplotype distribution was significantly different among the five tribes, with one (Arára) to four (Wayampí) haplotypes being found per tribe. These findings indicate a significant heterogeneity among the Indian tribes and contrast with the homogeneous distribution of the beta-globin gene cluster haplotypes but agree with our recent findings on the distribution of alpha-globin gene cluster haplotypes and the allele frequencies for six VNTRs in the same Amerindian tribes. Our data represent the first study of factor IX-associated polymorphisms in Amerindian populations and emphasizes the applicability of these genetic markers for population and human evolution studies.

  6. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Replacement of glycoprotein B gene in the Herpes simplex virus type 1 strain ANGpath DNA that originating from non-pathogenic strain KOS reduces the pathogenicity of recombinant virus

    International Nuclear Information System (INIS)

    Kostal, M.; Bacik, I.; Rajcani, J.; Kaerner, H.C.

    1994-01-01

    Herpes simplex virus type-1 (HSV-1) strain ANGpath and its recombinants, in which the 8.1 kbp BamHI G restriction fragment (0.345-0.399) containing the glycoprotein B (gB path ) gene (UL27) or its sub-fragments-coding either for cytoplasmic or surface domain of gB-had been replaced with the corresponding fragments from non-pathogenic KOS virus DNA (gB KOS ), were tested for their pathogenicity for DBA/2 mice and rabbits. The recombinant ANGpath/B6 KOS prepared by transferring the 2.7 kbp SstI-SstI sub-fragment (0.351-0.368) of the BamHI G KOS fragment still had the original sequence of ANGpath DNA coding for the syn 3 marker in the cytoplasmic domain of gB and was pathogenic for mice as well as for rabbits. Virological and immuno-histological studies in DBA/2 mice infected with the latter pathogenic recombinant and with ANGpath showed the presence of infectious virus and viral antigen at inoculation site (epidermis, subcutaneous connective tissue and striated muscle in the area of right lip), in homo-lateral trigeminal nerve and ganglion, brain stem, midbrain, thalamic and hypothalamic nuclei. In contrast, non-pathogenic recombinants ANGpath/syn + B6 KOS (prepared by transferring the whole BamHI G KOS fragment) and ANGpath/syn +KOS (prepared by transferring the 0.8 kbp BamHI-SstI sub-fragment of the BamHI G KOS fragment) showed limited hematogenous and neural spread, but no evidence of replication in CNS; thus, their behaviour resembled that of the wild type strain KOS. The recombinant ANGpath/syn +KOS , which was not pathogenic for mice, still remained pathogenic for rabbits, a phenomenon indicating the presence of an additional locus in the gB molecule participating on virulence. Sequencing the 1478 bp SstI-SstI sub-fragment of the BamHI G path fragment (nt 53,348 - 54,826 of UL segment) showed the presence of at least 3 mutations as compared to the KOS sequence, from which the change of cytosine at nt 54,2251 altered the codon for arginine to that histidine

  8. Delayed globin synthesis leads to excess heme and the macrocytic anemia of Diamond Blackfan anemia and del(5q) myelodysplastic syndrome.

    Science.gov (United States)

    Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L

    2016-05-11

    Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.

  9. Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

    Science.gov (United States)

    Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

    2014-01-01

    Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

  10. Globin haplotypes of human T-cell lymphotropic virus type I-infected individuals in Salvador, Bahia, Brazil, suggest a post-Columbian African origin of this virus.

    Science.gov (United States)

    Alcantara, Luiz Carlos; Van Dooren, Sonia; Gonçalves, Marilda Souza; Kashima, Simone; Costa, Maria Cristina Ramos; Santos, Fred Luciano Neves; Bittencourt, Achilea Lisboa; Dourado, Inês; Filho, Antonio Andrade; Covas, Dimas Tadeu; Vandamme, Anne-Mieke; Galvão-Castro, Bernardo

    2003-08-01

    The city of Salvador, Bahia, Brazil, has sociodemographic characteristics similar to some African cities. Up to now, it has had the highest prevalence of human T-cell lymphotropic virus type I (HTLV-I) infection (1.74%) in the country. To investigate which strains of HTLV-I are circulating in Salvador, we studied isolates from 82 patients infected with HTLV-I: 19 from the general population, 21 from pregnant women, 16 from intravenous drug users, and 26 from patients and their family attending a neurologic clinic. Phylogenetic analysis from part of the LTR fragments showed that most of these isolates belonged to the Transcontinental subgroup of the Cosmopolitan subtype (HTLV-Ia). Only one sample from a pregnant woman was closely related to the Japanese subgroup, suggesting recent introduction of a Japanese HTLV-I lineage into Salvador. betaA-Globin haplotypes were examined in 34 infected individuals and found to be atypical, confirming the racial heterogeneity of this population. A total of 20 chromosomes were characterized as Central African Republic (CAR) haplotype (29.4%), 31 (45.6%) were characterized as Benin (BEN) haplotype, and 17 (25%) were characterized as Senegal (SEN) haplotype. Five patients' genotypes (14.7%) were CAR/CAR; 10 (29,4%), BEN/BEN; 9 (26.5%), CAR/BEN; 2 (5.9%), BEN/SEN; and 7 (20.6%), SEN/SEN. One patient's genotype (2.9%) was CAR/SEN. The betaA-globin haplotype distribution in Salvador is unusual compared with other Brazilian states. Our data support the hypothesis of multiple post-Columbian introductions of African HTLV-Ia strains in Salvador, Bahia, Brazil.

  11. Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

    Science.gov (United States)

    Groner, B; Hynes, N E

    1980-01-01

    The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

  12. Conserved genomic organisation of Group B Sox genes in insects.

    Directory of Open Access Journals (Sweden)

    Woerfel Gertrud

    2005-05-01

    Full Text Available Abstract Background Sox domain containing genes are important metazoan transcriptional regulators implicated in a wide rage of developmental processes. The vertebrate B subgroup contains the Sox1, Sox2 and Sox3 genes that have early functions in neural development. Previous studies show that Drosophila Group B genes have been functionally conserved since they play essential roles in early neural specification and mutations in the Drosophila Dichaete and SoxN genes can be rescued with mammalian Sox genes. Despite their importance, the extent and organisation of the Group B family in Drosophila has not been fully characterised, an important step in using Drosophila to examine conserved aspects of Group B Sox gene function. Results We have used the directed cDNA sequencing along with the output from the publicly-available genome sequencing projects to examine the structure of Group B Sox domain genes in Drosophila melanogaster, Drosophila pseudoobscura, Anopheles gambiae and Apis mellifora. All of the insect genomes contain four genes encoding Group B proteins, two of which are intronless, as is the case with vertebrate group B genes. As has been previously reported and unusually for Group B genes, two of the insect group B genes, Sox21a and Sox21b, contain introns within their DNA-binding domains. We find that the highly unusual multi-exon structure of the Sox21b gene is common to the insects. In addition, we find that three of the group B Sox genes are organised in a linked cluster in the insect genomes. By in situ hybridisation we show that the pattern of expression of each of the four group B genes during embryogenesis is conserved between D. melanogaster and D. pseudoobscura. Conclusion The DNA-binding domain sequences and genomic organisation of the group B genes have been conserved over 300 My of evolution since the last common ancestor of the Hymenoptera and the Diptera. Our analysis suggests insects have two Group B1 genes, SoxN and

  13. Plasmid fingerprinting and virulence gene detection among indigenous strains of salmonella enterica serovar enteritidis

    International Nuclear Information System (INIS)

    Sajid, S.U.; Schwarz, S.

    2009-01-01

    Salmonella enterica serovar Enteritidis is an important frequently reported zoonotic pathogen and a common cause of human gastroenteritis worldwide. The highly conserved Serospecific plasmids (SSPs) and Salmonella plasmid virulence (Spv) genes have been shown to mediate extra-intestinal colonization and systemic infection. The objective of current study was to document the presence of SSPs and SpvB/SpvC genes prevailing in the indigenous population of serovar Enteritidis. A total of 48 epidemiologically unrelated strains of Salmonella enteritidis were included in the study. Preparation of plasmids DNA suitable for endonuclease digestion and separation of respective fragments by agarose gel electrophoresis followed previously described protocols. The plasmids of Escherichia coli V517, 1-kbp ladder, and lambda DNA HindIII fragments served as DNA size standards. Transfer of DNA fragments from agarose gels to nitrocellulose membranes was achieved by capillary blot procedure. An ECL labeled 3.6 kbp HindIII fragment of plasmid PRQ 51 was used as probe for SpvB/SpvC gene detection. Plasmid DNA fingerprinting revealed the presence of two different profiles of approximately 55 kbp and 90 kbp and were identified as virulence plasmids by DNA hybridization. The SpvB/SpvC genes were located on HindIII fragments of 3.6 kbp in each of the two types of virulence plasmids. The study confirms the presence of SSPs and SpvB/SpvC genes in indigenous strains of S. enteritidis isolated from Northern Punjab area of Pakistan and substantiate the previous data on such findings from other parts of the world. (author)

  14. S-(3-Aminobenzanthron-2-yl)cysteine in the globin of rats as a novel type of adduct and possible biomarker of exposure to 3-nitrobenzanthrone, a potent environmental carcinogen.

    Science.gov (United States)

    Linhart, Igor; Hanzlíková, Iveta; Mráz, Jaroslav; Dušková, Šárka

    2017-10-01

    3-Nitrobenzanthrone (3-NBA), a potent environmental mutagen and carcinogen, is known to be activated in vivo to 3-benzanthronylnitrenium ion which forms both NH and C2-bound adducts with DNA and also reacts with glutathione giving rise to urinary 3-aminobenzanthron-2-ylmercapturic acid. In this study, acid hydrolysate of globin from rats dosed intraperitoneally with 3-NBA was analysed by HPLC/MS to identify a novel type of cysteine adduct, 3-aminobenzanthron-2-ylcysteine (3-ABA-Cys), confirmed using a synthesised standard. The 3-ABA-Cys levels in globin peaked after single 3-NBA doses of 1 and 2 mg/kg on day 2 to attain 0.25 and 0.49 nmol/g globin, respectively, thereafter declining slowly to 70-80% of their maximum values during 15 days. After dosing rats for three consecutive days with 1 mg 3-NBA/kg a significant cumulation of 3-ABA-Cys in globin was observed. 3-ABA-Cys was also found in the plasma hydrolysate. Herein, after dosing with 1 and 2 mg 3-NBA/kg the adduct levels peaked on day 1 at 0.15 and 0.51 nmol/ml plasma, respectively, thereafter declining rapidly to undetectable levels on day 15. In addition, sulphinamide adducts were also found in the exposed rats, measured indirectly as 3-aminobenzanthrone (3-ABA) split off from globin by mild acid hydrolysis. Levels of both types of adducts in the globin samples parallelled very well with 3-ABA/3-ABA-Cys ratio being around 1:8. In conclusion, 3-ABA-Cys is the first example of arylnitrenium-cysteine adduct in globin representing a new promising class of biomarkers to assess cumulative exposures to aromatic amines, nitroaromatics and heteroaromatic amines.

  15. Towards a "Golden Standard" for computing globin stability: Stability and structure sensitivity of myoglobin mutants

    DEFF Research Database (Denmark)

    Kepp, Kasper Planeta

    2015-01-01

    Fast and accurate computation of protein stability is increasingly important for e.g. protein engineering and protein misfolding diseases, but no consensus methods exist for important proteins such as globins, and performance may depend on the type of structural input given. This paper reports be...

  16. Gene therapy for sickle cell disease: An update.

    Science.gov (United States)

    Demirci, Selami; Uchida, Naoya; Tisdale, John F

    2018-05-30

    Sickle cell disease (SCD) is one of the most common life-threatening monogenic diseases affecting millions of people worldwide. Allogenic hematopietic stem cell transplantation is the only known cure for the disease with high success rates, but the limited availability of matched sibling donors and the high risk of transplantation-related side effects force the scientific community to envision additional therapies. Ex vivo gene therapy through globin gene addition has been investigated extensively and is currently being tested in clinical trials that have begun reporting encouraging data. Recent improvements in our understanding of the molecular pathways controlling mammalian erythropoiesis and globin switching offer new and exciting therapeutic options. Rapid and substantial advances in genome engineering tools, particularly CRISPR/Cas9, have raised the possibility of genetic correction in induced pluripotent stem cells as well as patient-derived hematopoietic stem and progenitor cells. However, these techniques are still in their infancy, and safety/efficacy issues remain that must be addressed before translating these promising techniques into clinical practice. Published by Elsevier Inc.

  17. Chromium resistance characteristics of Cr(VI) resistance genes ChrA and ChrB in Serratia sp. S2.

    Science.gov (United States)

    He, Yuan; Dong, Lanlan; Zhou, Simin; Jia, Yan; Gu, Ruijia; Bai, Qunhua; Gao, Jieying; Li, Yingli; Xiao, Hong

    2018-08-15

    To find an efficient chromium (VI) resistance system, with a highly efficient, economical, safe, and environmentally friendly chromium-removing strain, ChrA, ChrB, and ChrAB fragments of the chromium (VI) resistance gene in Serratia sp. S2 were cloned, and their prokaryotic expression vectors were constructed and transformed into E. coli BL21. The anti-chromium (VI) capacity and characteristics of engineered bacteria, role of ChrA and ChrB genes in the anti-chromium (VI) processes, and the mechanism of chromium metabolism, were explored. The PCR technique was used to amplify ChrA, ChrB, and ChrAB genes from the Serratia sp. S2 genome. ChrA, ChrB, and ChrAB genes were connected to the prokaryotic expression vector pET-28a and transferred into E. coli BL21 for prokaryotic expression. Cr-absorption and Cr-efflux ability of the engineered strains were determined. The effects of respiratory inhibitors and oxygenated anions on Cr-efflux of ChrA and ChrB engineered strains were explored. ChrA, ChrB, and ChrAB engineered strains were constructed successfully; there was no significant difference between the control strain and the ChrB engineered strain for Cr-metabolism (P > 0.05). Cr-absorption and Cr-efflux of ChrA and ChrAB engineered strains were significantly stronger than the control strain (P < 0.05). Oxyanions (sulfate and molybdate) and inhibitors (valinomycin and CN - ) could significantly inhibit the Cr-efflux capacities of ChrA and ChrAB engineered strains (P < 0.05), while NADPH could significantly promote such capacities (P < 0.05). The Cr-transporter, encoded by ChrA gene, confer the ability to pump out intracellular Cr on ChrA and ChrAB engineered strains. The ChrB gene plays a positive regulatory role in ChrA gene regulation. The Cr-metabolism ability of the ChrAB engineered strain is stronger than the ChrA engineered strain. ChrA and ChrAB genes in the Cr-resistance system may involve a variety of mechanisms, such as sulfate ion channel and

  18. Análise dos haplótipos do gene da betaS-globina no Ceará Analysis of betaS-globin gene haplotypes in Ceará, Brazil

    Directory of Open Access Journals (Sweden)

    Gentil Claudino de Galiza Neto

    2005-10-01

    Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.

  19. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  20. Characterization of dapB, a gene required by Pseudomonas syringae pv. tabaci BR2.024 for lysine and tabtoxinine-beta-lactam biosynthesis.

    Science.gov (United States)

    Liu, L; Shaw, P D

    1997-01-01

    The dapB gene, which encodes L-2,3-dihydrodipicolinate reductase, the second enzyme of the lysine branch of the aspartic amino acid family, was cloned and sequenced from a tabtoxin-producing bacterium, Pseudomonas syringae pv. tabaci BR2.024. The deduced amino acid sequence shared 60 to 90% identity to known dapB gene products from gram-negative bacteria and 19 to 21% identity to the dapB products from gram-positive bacteria. The consensus sequence for the NAD(P)H binding site [(V/I)(A/G)(V/I)XGXXGXXG)] and the proposed substrate binding site (HHRHK) were conserved in the polypeptide. A BR2.024 dapB mutant is a diaminopimelate auxotroph and tabtoxin negative. The addition of a mixture of L-,L-, D,D-, and meso-diaminopimelate to defined media restored growth but not tabtoxin production. Cloned DNA fragments containing the parental dapB gene restored the ability to grow in defined media and tabtoxin production to the dapB mutant. These results indicate that the dapB gene is required for both lysine and tabtoxin biosynthesis, thus providing the first genetic evidence that the biosynthesis of tabtoxin proceeds in part along the lysine biosynthetic pathway. These data also suggest that L-2,3,4,5-tetrahydrodipicolinate is a common intermediate for both lysine and tabtoxin biosynthesis. PMID:8990304

  1. Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

    Science.gov (United States)

    Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

    2017-03-01

    Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

  2. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    1987-10-16

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

  3. MspI and PvuII polymorphisms in the Na,K-ATPase. beta. subunit gene ATP1B1

    Energy Technology Data Exchange (ETDEWEB)

    Shull, M.M.; Pugh, D.G.; Lane, L.K.; Lingrel, J.B. (Univ. of Cincinnati College of Medicine, OH (USA))

    1990-02-25

    ATP1B HH1.2 is a 1.2 kb HindIII fragment from the 3{prime} portion of the human Na,K-ATPase {beta} subunit gene, ATP1B1. MspI identifies a two allele polymorphism (M1: 6.7 kb, M2: 5.3 kb). PvuII also detects a two-allele polymorphism (P1: 5.1 kb, P2: 4.7 kb). ATP1B1 has been assigned to chromosome 1q by somatic cell hybrid analysis. Codominant segregation of the MspI RFLP was observed in one two-generation family (5 individuals). Codominant segregation of the PvuII RFLP was observed in a two-generation (8 individuals) and a three-generation (12 individuals) family.

  4. Identification of Candidate B-Lymphoma Genes by Cross-Species Gene Expression Profiling

    Science.gov (United States)

    Tompkins, Van S.; Han, Seong-Su; Olivier, Alicia; Syrbu, Sergei; Bair, Thomas; Button, Anna; Jacobus, Laura; Wang, Zebin; Lifton, Samuel; Raychaudhuri, Pradip; Morse, Herbert C.; Weiner, George; Link, Brian; Smith, Brian J.; Janz, Siegfried

    2013-01-01

    Comparative genome-wide expression profiling of malignant tumor counterparts across the human-mouse species barrier has a successful track record as a gene discovery tool in liver, breast, lung, prostate and other cancers, but has been largely neglected in studies on neoplasms of mature B-lymphocytes such as diffuse large B cell lymphoma (DLBCL) and Burkitt lymphoma (BL). We used global gene expression profiles of DLBCL-like tumors that arose spontaneously in Myc-transgenic C57BL/6 mice as a phylogenetically conserved filter for analyzing the human DLBCL transcriptome. The human and mouse lymphomas were found to have 60 concordantly deregulated genes in common, including 8 genes that Cox hazard regression analysis associated with overall survival in a published landmark dataset of DLBCL. Genetic network analysis of the 60 genes followed by biological validation studies indicate FOXM1 as a candidate DLBCL and BL gene, supporting a number of studies contending that FOXM1 is a therapeutic target in mature B cell tumors. Our findings demonstrate the value of the “mouse filter” for genomic studies of human B-lineage neoplasms for which a vast knowledge base already exists. PMID:24130802

  5. Hb A2 Episkopi - a novel δ-globin chain variant [HBD:c.428C>T] in a family of mixed Cypriot-Lebanese descent.

    Science.gov (United States)

    Lederer, Carsten W; Pavlou, Eleni; Tanteles, George A; Evangelidou, Paola; Sismani, Carolina; Kolnagou, Annita; Sitarou, Maria; Christou, Soteroulla; Hadjigavriel, Michael; Kleanthous, Marina

    2017-06-01

    Thalassaemia is a potentially lethal inherited anaemia, caused by reduced or absent synthesis of globin chains. Measurement of the minor adult haemoglobin Hb A 2 , combining α- with δ-globin, is critical for the routine diagnosis of carrier status for α- or β-thalassaemia. Here, we aim to characterize a novel δ-globin variant, Hb A 2 Episkopi, in a single family of mixed Lebanese and Cypriot ancestry with mild hypochromic anaemia and otherwise normal globin genotype, which also presents with a coincidental 0.78-Mb sequence duplication on chromosome 1 (1q44) and developmental abnormalities. Analyses included comprehensive haematological analyses, cation-exchange high-performance liquid chromatography (CE-HPLC), cellulose acetate electrophoresis (CAE), Sanger sequencing and structure-based stability predictions for Hb A 2 Episkopi. The GCT > GTT missense mutation, underlying Hb A 2 Episkopi, HBD:c.428C > T, introduces a cd142 codon change in the mature protein, resulting in reduced normal Hb A 2 amounts and a novel, less abundant Hb A 2 variant (HGVS: HBD:p.A143V), detectable as a delayed peak by CE-HPLC. The latter was in line with structure-based stability predictions, which indicated that the substitution of a marginal, non-helical and non-interface residue, five amino acids from the δ-globin chain carboxy-terminus, was moderately destabilizing. Detection of the new variant depends on the diagnostic set-up and had failed by CAE and on an independent CE-HPLC system, which, in unfavourable circumstances, may lead to misdiagnoses of β-thalassaemia as α-thalassaemia. Given the mixed background of the affected family, the ethnic origin of the mutation is unclear, and this study thus suggests awareness for possible detection of Hb A 2 Episkopi in both the Cypriot and the Lebanese populations.

  6. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  7. Combining EL4-B5-based B-cell stimulation and phage display technology for the successful isolation of human anti-Scl-70 autoantibody fragments.

    Science.gov (United States)

    Weber, Malte; Weiss, Etienne; Engel, Alfred M

    2003-07-01

    Scl-70 is the major antigen recognised by autoantibodies in the sera of patients with systemic sclerosis (SSc). The autoantibodies that specifically react with Scl-70 are highly characteristic of the disease and represent valuable markers for the diagnosis of SSc. We describe a novel strategy for cloning autoantibody fragments starting with a small blood sample from an SSc patient. B cells isolated from the collected peripheral blood mononuclear cells (PBMCs) were cultured in vitro using the EL4-B5 system. Anti-Scl-70 IgG-producing cells were pooled for RNA preparation followed by the generation of phagemid libraries of approximately 10(7) independent single-chain Fvs (scFvs). The screening of these libraries by phage display allowed us to isolate four anti-Scl-70 scFvs following three rounds of biopanning. About 10 times more starting blood material was needed to generate scFv libraries of similar size from PBMCs of an SSc patient and only two anti-Scl-70 scFvs were isolated after three rounds of phage selection. Together, this work shows that functional autoantibody fragments can be advantageously cloned after in vitro expansion of B cells. The isolated anti-Scl-70 autoantibody fragments represent useful tools for calibrating SSc diagnostic assays.

  8. Two cloned β thalassemia genes are associated with amber mutations at codon 39

    Science.gov (United States)

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

    1981-01-01

    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  9. A novel MADS-box gene subfamily with a sister-group relationship to class B floral homeotic genes.

    Science.gov (United States)

    Becker, A; Kaufmann, K; Freialdenhoven, A; Vincent, C; Li, M-A; Saedler, H; Theissen, G

    2002-02-01

    Class B floral homeotic genes specify the identity of petals and stamens during the development of angiosperm flowers. Recently, putative orthologs of these genes have been identified in different gymnosperms. Together, these genes constitute a clade, termed B genes. Here we report that diverse seed plants also contain members of a hitherto unknown sister clade of the B genes, termed B(sister) (B(s)) genes. We have isolated members of the B(s) clade from the gymnosperm Gnetum gnemon, the monocotyledonous angiosperm Zea mays and the eudicots Arabidopsis thaliana and Antirrhinum majus. In addition, MADS-box genes from the basal angiosperm Asarum europaeum and the eudicot Petunia hybrida were identified as B(s) genes. Comprehensive expression studies revealed that B(s) genes are mainly transcribed in female reproductive organs (ovules and carpel walls). This is in clear contrast to the B genes, which are predominantly expressed in male reproductive organs (and in angiosperm petals). Our data suggest that the B(s) genes played an important role during the evolution of the reproductive structures in seed plants. The establishment of distinct B and B(s) gene lineages after duplication of an ancestral gene may have accompanied the evolution of male microsporophylls and female megasporophylls 400-300 million years ago. During flower evolution, expression of B(s) genes diversified, but the focus of expression remained in female reproductive organs. Our findings imply that a clade of highly conserved close relatives of class B floral homeotic genes has been completely overlooked until recently and awaits further evaluation of its developmental and evolutionary importance. Electronic supplementary material to this paper can be obtained by using the Springer Link server located at http://dx.doi.org/10.1007/s00438-001-0615-8.

  10. Determination of proteolytic activity using L-[4,5-3H]leucine-labelled globin as a substrate

    International Nuclear Information System (INIS)

    Maliopoulou, T.B.; Dionyssiou-Asteriou, A.; Loucopoulos, D.

    1980-01-01

    A simple and sensitive method for the assay of proteolytic enzyme activity is described. This is based on the digestion of L-[4,5- 3 H]leucine globin by proteolytic enzymes and radioactivity measurement of the trichloroacetic acid soluble cleavage products. (Auth.)

  11. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  12. Does fragmentation of wetlands affect gene flow in sympatric Acrocephalus warblers with different migration strategies?

    OpenAIRE

    Ceresa, Francesco; Belda, E.J.; Kvist, Laura; Rguibi-Idrissi, Hamid; Monrós González, Juan Salvador

    2015-01-01

    Wetlands are naturally patchy habitats, but patchiness has been accentuated by the extensive wetlands loss due to human activities. In such a fragmented habitat, dispersal ability is especially important to maintain gene flow between populations. Here we studied population structure, genetic diversity and demographic history of Iberian and North African populations of two wetland passerines, the Eurasian reed warbler Acrocephalus scirpaceus and the moustached warbler Acrocephalus melanopogon....

  13. Delineation of the genus Actinobacillus by comparison of partial infB sequences

    DEFF Research Database (Denmark)

    Nørskov-Lauritsen, Niels; Christensen, H; Okkels, H.

    2004-01-01

    A 426 bp fragment of infB, a housekeeping gene that encodes translation initiation factor 2, was sequenced from 59 clinical isolates and type strains of Actinobacillus species and sequences were compared. Partial sequences of 16S rRNA genes were also obtained. By comparing infB sequences, Actinob...

  14. TRUNCATED OR 2/2 HEMOGLOBINS : A NEW CLASS OF GLOBINS WITH NOVEL STRUCTURE AND FUNCTION

    Directory of Open Access Journals (Sweden)

    Amit Kumar

    2013-06-01

    Full Text Available Bright red hemoglobins, the most well-known paradigm in protein science, seem to be ubiquitous in nature. With advances in modern tools and techniques, discovery of new globins at a rapid pace has expanded this family. With every discovery, new insights emerged regarding their novel structure, function and several other characteristics previously not observed for hemoglobins. Even the classical function unanimously assigned to hemoglobins – oxygen transport and storage – needed re-evaluation. The ability of this class of proteins to show responses against various gaseous ligands, even the poisonous ones, indicate that it is obviously as ancient as life. As organisms evolved, hemoglobins also evolved, and accumulated a great degree of diversity in all aspects. The classical globin fold is very unique with 3-on-3 alpha helical bundle as observed in the traditional oxygen-transport hemoglobins like myoglobin, human blood hemoglobin and leghemoglobins in plants. However, a class of the newly discovered hemoglobins, which dominate the superfamily and appears ancient in origin mostly have 2-on-2 fold, commonly termed as “truncated” hemoglobins. These hemoglobins are phylogenetically distinct from their classical counterparts and are often shorter in their polypeptide length by 20-40 residues mainly due to a lack of short A helix, D helix and F helix. However, hemoglobins with 2-on-2 fold were also later found to have polypeptide chain lengths similar in size to classical globins. Disordered pre-F helix region, conserved glycine motifs and other key residues and apolar tunnels through their protein matrix for migration of ligands are some unique characteristics features of these truncated hemoglobins. Some of these are also hexacoordinated at heme iron where an amino acid from within the protein coordinates heme iron in absence of a ligand. These hemoglobins are well known for their high affinity towards ligand and have a diverse mechanism of

  15. Characteristics of β-lactamases and their genes (blaA and blaB in Yersinia intermedia and Y. frederiksenii

    Directory of Open Access Journals (Sweden)

    Sharma Sachin

    2007-04-01

    Full Text Available Abstract Background The presence of β-lactamases in Y. enterocolitica has been reported to vary with serovars, biovars and geographical origin of the isolates. An understanding of the β-lactamases in other related species is important for an overall perception of antibiotic resistance in yersiniae. The objective of this work was to study the characteristics of β-lactamases and their genes in strains of Y. intermedia and Y. frederiksenii, isolated from clinical and non-clinical sources in India. Results The enzymes, Bla-A (a constitutive class A penicillinase and Bla-B (an inducible class C cephalosporinase were found to be present in all the clinical and non-clinical strains of Y. intermedia and Y. frederiksenii by double disc diffusion method. The results showed differential expression of Bla-A as indicated by presence/absence of synergy whereas expression of Bla-B was quite consistent. The presence of these enzymes was also reflected in the high minimum inhibitory concentrations, MIC50 (126–1024 mg/L and MIC90 (256–1024 mg/L of β-lactam antibiotics against these species. Restriction fragment length polymorphism (RFLP revealed heterogeneity in both blaA and blaB genes of Y. intermedia and Y. frederiksenii. The blaA gene of Y. intermedia shared significant sequence identity (87–96% with blaA of Y. enterocolitica biovars 1A, 1B and 4. The sequence identity of blaA of Y. frederiksenii with these biovars was 77–79%. The sequence identity of blaB gene of Y. intermedia and Y. frederiksenii was more (85% with that of Y. enterocolitica biovars 1A, 1B and 2 compared to other species viz., Y. bercovieri, Y. aldovae and Y. ruckeri. Isoelectric focusing data further revealed that both Y. intermedia and Y. frederiksenii produced Bla-A (pI 8.7 and "Bla-B like" (pI 5.5–7.1 enzymes. Conclusion Both Y. intermedia and Y. frederiksenii showed presence of blaA and blaB genes and unequivocal expression of the two β-lactamases. Limited heterogeneity

  16. Data for increase of Lymantria dispar male survival after topical application of single-stranded RING domain fragment of IAP-3 gene of its nuclear polyhedrosis virus

    Science.gov (United States)

    Oberemok, Volodymyr V.; Laikova, Kateryna V.; Zaitsev, Aleksei S.; Gushchin, Vladimir A.; Skorokhod, Oleksii A.

    2016-01-01

    This data article is related to the research article entitled “The RING for gypsy moth control: topical application of fragment of its nuclear polyhedrosis virus anti-apoptosis gene as insecticide” [1]. This article reports on significantly higher survival of gypsy moth Lymantria dispar male individuals in response to topical application of single-stranded DNA, based on RING (really interesting new gene) domain fragment of LdMNPV (L. dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene and acted as DNA insecticide. PMID:27054151

  17. Therapeutic hemoglobin levels after gene transfer in β-thalassemia mice and in hematopoietic cells of β-thalassemia and sickle cells disease patients.

    Directory of Open Access Journals (Sweden)

    Laura Breda

    Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these

  18. Quantification of virus genes provides evidence for seed-bank populations of phycodnaviruses in Lake Ontario, Canada.

    Science.gov (United States)

    Short, Cindy M; Rusanova, Oksana; Short, Steven M

    2011-05-01

    Using quantitative PCR, the abundances of six phytoplankton viruses DNA polymerase (polB) gene fragments were estimated in water samples collected from Lake Ontario, Canada over 26 months. Four of the polB fragments were most related to marine prasinoviruses, while the other two were most closely related to cultivated chloroviruses. Two Prasinovirus-related genes reached peak abundances of >1000 copies ml(-1) and were considered 'high abundance', whereas the other two Prasinovirus-related genes peaked at abundances bank populations with members that can become numerically dominant when their host abundances reach appropriate levels.

  19. Gene Therapy in Thalassemia and Hemoglobinopathies

    OpenAIRE

    Breda, Laura; Gambari, Roberto; Rivella, Stefano

    2009-01-01

    Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

  20. Structure and inhibition analysis of the mouse SAD-B C-terminal fragment.

    Science.gov (United States)

    Ma, Hui; Wu, Jing-Xiang; Wang, Jue; Wang, Zhi-Xin; Wu, Jia-Wei

    2016-10-01

    The SAD (synapses of amphids defective) kinases, including SAD-A and SAD-B, play important roles in the regulation of neuronal development, cell cycle, and energy metabolism. Our recent study of mouse SAD-A identified a unique autoinhibitory sequence (AIS), which binds at the junction of the kinase domain (KD) and the ubiquitin-associated (UBA) domain and exerts autoregulation in cooperation with UBA. Here, we report the crystal structure of the mouse SAD-B C-terminal fragment including the AIS and the kinase-associated domain 1 (KA1) at 2.8 Å resolution. The KA1 domain is structurally conserved, while the isolated AIS sequence is highly flexible and solvent-accessible. Our biochemical studies indicated that the SAD-B AIS exerts the same autoinhibitory role as that in SAD-A. We believe that the flexible isolated AIS sequence is readily available for interaction with KD-UBA and thus inhibits SAD-B activity.

  1. Systematic documentation and analysis of human genetic variation using the microattribution approach

    Science.gov (United States)

    Giardine, Belinda; Borg, Joseph; Higgs, Douglas R.; Peterson, Kenneth R.; Maglott, Donna; Basak, A. Nazli; Clark, Barnaby; Faustino, Paula; Felice, Alex E.; Francina, Alain; Gallivan, Monica V. E.; Georgitsi, Marianthi; Gibbons, Richard J.; Giordano, Piero C.; Harteveld, Cornelis L.; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N.; Papadopoulos, Petros; Pavlovic, Sonja; Philipsen, Sjaak; Radmilovic, Milena; Riemer, Cathy; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John; Wiemann, Claudia; Zukic, Branka; Chui, David H. K.; Wajcman, Henri; Hardison, Ross C.; Patrinos, George P.

    2013-01-01

    We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to these disorders, and then implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories 1. A total of 1,941 unique genetic variants in 37 genes, encoding globins (HBA2, HBA1, HBG2, HBG1, HBD, HBB) and other erythroid proteins (ALOX5AP, AQP9, ARG2, ASS1, ATRX, BCL11A, CNTNAP2, CSNK2A1, EPAS1, ERCC2, FLT1, GATA1, GPM6B, HAO2, HBS1L, KDR, KL, KLF1, MAP2K1, MAP3K5, MAP3K7, MYB, NOS1, NOS2, NOS3, NOX3, NUP133, PDE7B, SMAD3, SMAD6, and TOX) are currently documented in these databases with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants and now provides a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The large repository of previously reported data, together with more recent data, acquired by microattribution, demonstrates how the comprehensive documentation of human variation will provide key insights into normal biological processes and how these are perturbed in human genetic disease. Using the microattribution process set out here, datasets which took decades to accumulate for the globin genes could be assembled rapidly for other genes and disease systems. The principles established here for the globin gene system will serve as a model for other systems and the analysis of other common and/or complex human genetic diseases. PMID:21423179

  2. The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

    Science.gov (United States)

    Nadeau, J H; Phillips, S J

    1987-11-01

    Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

  3. CYP1B1 gene polymorphisms correlate with an increased risk of urinary bladder cancer in India.

    Science.gov (United States)

    Sankhwar, Monica; Sankhwar, Satya Narayan; Abhishek, Amar; Gupta, Nishi; Rajender, Singh

    2016-04-01

    The urinary bladder is the target of several toxic compounds, which makes the bladder more prone to cancer. Cytochrome P450 1B1 enzyme is present in tumor tissues and metabolizes the polyaromatic carcinogens and activates several procarcinogens that cause DNA damage. We examined the functional single-nucleotide polymorphisms in the CYP1B1 gene to study their association with the urinary bladder cancer. We recruited 234 cases of pure urothelial and 258 bladder cancer-free control samples from the individuals visiting the clinic for various investigations. We genotyped 4 CYP1B1 single-nucleotide polymorphisms using the polymerase chain reaction-restriction fragment length polymorphism analysis. The genotype data were analyzed by the Chi-square test. Haplotypes were constructed to evaluate the joint effect of the 4 polymorphisms. Overall, 3 polymorphisms-rs10012, rs150799650, and rs1056827 (odds ratio [OR] = 2.34, CI: 1.59-3.45, Pbladder cancer. Haplotype analysis suggested GTTC, GTTG, and ATGC to be the risk factors for bladder cancer. Overall, 3 polymorphisms, rs10012, rs1056827, and rs150799650 in the CYP1B1 gene correlate with urinary bladder cancer significantly in the Indo-European population of Uttar Pradesh, India. Further investigations in other populations are advised. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  5. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  6. PCR Assay Based on the gyrB Gene for Rapid Identification of Acinetobacter baumannii-calcoaceticus Complex at Specie Level.

    Science.gov (United States)

    Teixeira, Aline B; Barin, Juliana; Hermes, Djuli M; Barth, Afonso L; Martins, Andreza F

    2017-05-01

    The genus Acinetobacter sp. comprises more than 50 species, and four are closely related and difficult to be distinguished by either phenotypic or genotypic methods: the Acinetobacter calcoaceticus-baumannii complex (ABC). The correct identification at species level is necessary mainly due to the epidemiological aspects. We evaluated a multiplex PCR for gyrB gene to identify the species of the ABC using the sequencing of the ITS 16S-23S fragment as a gold standard. Isolates identified as Acinetobacter calcoaceticus-baumannii from three hospitals at southern Brazil in 2011 were included in this study. A total of 117 isolates were obtained and 106 (90.6%) were confirmed as A. baumannii, 6 (5.1%) as A. nosocomialis and 4 (3.4%) as A. pittii by PCR for gyrB gene. Only one isolate did not present a product of the PCR for the gyrB gene; this isolate was identified as Acinetobacter genospecie 10 by sequencing of ITS. We also noted that the non-A. baumannii isolates were recovered from respiratory tract (8/72.7%), blood (2/18.2%) and urine (1/9.1%), suggesting that these species can cause serious infection. These findings evidenced that the multiplex PCR of the gyrB is a feasible and simple method to identify isolates of the ABC at the species level. © 2016 Wiley Periodicals, Inc.

  7. Regulation of Neph3 gene in podocytes - key roles of transcription factors NF-kappaB and Sp1

    LENUS (Irish Health Repository)

    Ristola, Mervi

    2009-08-24

    Abstract Background Neph3 (filtrin) is expressed in the glomerular podocytes where it localizes at the specialized cell adhesion structures of the foot processes called slit diaphragms which form the outermost layer of the glomerular filtration barrier. Neph3 protein shows homology and structural similarity to Neph1, Neph2 and nephrin, which all are crucial for maintaining the normal glomerular ultrafiltration function. The exact function of Neph3 in the kidney is not known but we have previously shown that the level of Neph3 mRNA is decreased in proteinuric diseases. This suggests that Neph3 may play a role in the pathogenesis of kidney damage, and emphasizes the need to analyze the regulatory mechanisms of Neph3 gene. In this study we investigated the transcriptional regulation of Neph3 gene by identifying transcription factors that control Neph3 expression. Results We cloned and characterized approximately 5 kb fragment upstream of the Neph3 gene. Neph3 proximal promoter near the transcription start site was found to be devoid of TATA and CAAT boxes, but to contain a highly GC-rich area. Using promoter reporter gene constructs, we localized the main activating regulatory region of Neph3 gene in its proximal promoter region from -105 to -57. Within this region, putative transcription factor binding sites for NF-κB and Sp1 were found by computational analysis. Mutational screening indicated that NF-κB and Sp1 response elements are essential for the basal transcriptional activity of the Neph3 promoter. Co-transfection studies further showed that NF-κB and Sp1 regulate Neph3 promoter activity. In addition, overexpression of NF-κB increased endogenous Neph3 gene expression. Chromatin immunoprecipitation assay using cultured human podocytes demonstrated that both NF-κB and Sp1 interact with the Neph3 promoter. Conclusion Our results show that NF-κB and Sp1 are key regulators of Neph3 expression at the basal level in podocytes, therefore providing new insight

  8. Recurrent targeted genes of hepatitis B virus in the liver cancer genomes identified by a next-generation sequencing-based approach.

    Directory of Open Access Journals (Sweden)

    Dong Ding

    Full Text Available Integration of the viral DNA into host chromosomes was found in most of the hepatitis B virus (HBV-related hepatocellular carcinomas (HCCs. Here we devised a massive anchored parallel sequencing (MAPS method using next-generation sequencing to isolate and sequence HBV integrants. Applying MAPS to 40 pairs of HBV-related HCC tissues (cancer and adjacent tissues, we identified 296 HBV integration events corresponding to 286 unique integration sites (UISs with precise HBV-Human DNA junctions. HBV integration favored chromosome 17 and preferentially integrated into human transcript units. HBV targeted genes were enriched in GO terms: cAMP metabolic processes, T cell differentiation and activation, TGF beta receptor pathway, ncRNA catabolic process, and dsRNA fragmentation and cellular response to dsRNA. The HBV targeted genes include 7 genes (PTPRJ, CNTN6, IL12B, MYOM1, FNDC3B, LRFN2, FN1 containing IPR003961 (Fibronectin, type III domain, 7 genes (NRG3, MASP2, NELL1, LRP1B, ADAM21, NRXN1, FN1 containing IPR013032 (EGF-like region, conserved site, and three genes (PDE7A, PDE4B, PDE11A containing IPR002073 (3', 5'-cyclic-nucleotide phosphodiesterase. Enriched pathways include hsa04512 (ECM-receptor interaction, hsa04510 (Focal adhesion, and hsa04012 (ErbB signaling pathway. Fewer integration events were found in cancers compared to cancer-adjacent tissues, suggesting a clonal expansion model in HCC development. Finally, we identified 8 genes that were recurrent target genes by HBV integration including fibronectin 1 (FN1 and telomerase reverse transcriptase (TERT1, two known recurrent target genes, and additional novel target genes such as SMAD family member 5 (SMAD5, phosphatase and actin regulator 4 (PHACTR4, and RNA binding protein fox-1 homolog (C. elegans 1 (RBFOX1. Integrating analysis with recently published whole-genome sequencing analysis, we identified 14 additional recurrent HBV target genes, greatly expanding the HBV recurrent target list

  9. A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

    NARCIS (Netherlands)

    Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.

    2010-01-01

    Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

  10. Detection of trans-acting factors for hemoglobin switching by cell fusions

    International Nuclear Information System (INIS)

    Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.

    1986-01-01

    The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching

  11. Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

    Science.gov (United States)

    Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2014-01-01

    The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

  12. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

  13. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  14. Clock gene modulates roles of OXTR and AVPR1b genes in prosociality.

    Directory of Open Access Journals (Sweden)

    Haipeng Ci

    Full Text Available BACKGROUND: The arginine vasopressin receptor (AVPR and oxytocin receptor (OXTR genes have been demonstrated to contribute to prosocial behavior. Recent research has focused on the manner by which these simple receptor genes influence prosociality, particularly with regard to the AVP system, which is modulated by the clock gene. The clock gene is responsible for regulating the human biological clock, affecting sleep, emotion and behavior. The current study examined in detail whether the influences of the OXTR and AVPR1b genes on prosociality are dependent on the clock gene. METHODOLOGY/PRINCIPAL FINDINGS: This study assessed interactions between the clock gene (rs1801260, rs6832769 and the OXTR (rs1042778, rs237887 and AVPR1b (rs28373064 genes in association with individual differences in prosociality in healthy male Chinese subjects (n = 436. The Prosocial Tendencies Measure (PTM-R was used to assess prosociality. Participants carrying both the GG/GA variant of AVPR1b rs28373064 and the AA variant of clock rs6832769 showed the highest scores on the Emotional PTM. Carriers of both the T allele of OXTR rs1042778 and the C allele of clock rs1801260 showed the lowest total PTM scores compared with the other groups. CONCLUSIONS: The observed interaction effects provide converging evidence that the clock gene and OXT/AVP systems are intertwined and contribute to human prosociality.

  15. Clock gene modulates roles of OXTR and AVPR1b genes in prosociality.

    Science.gov (United States)

    Ci, Haipeng; Wu, Nan; Su, Yanjie

    2014-01-01

    The arginine vasopressin receptor (AVPR) and oxytocin receptor (OXTR) genes have been demonstrated to contribute to prosocial behavior. Recent research has focused on the manner by which these simple receptor genes influence prosociality, particularly with regard to the AVP system, which is modulated by the clock gene. The clock gene is responsible for regulating the human biological clock, affecting sleep, emotion and behavior. The current study examined in detail whether the influences of the OXTR and AVPR1b genes on prosociality are dependent on the clock gene. This study assessed interactions between the clock gene (rs1801260, rs6832769) and the OXTR (rs1042778, rs237887) and AVPR1b (rs28373064) genes in association with individual differences in prosociality in healthy male Chinese subjects (n = 436). The Prosocial Tendencies Measure (PTM-R) was used to assess prosociality. Participants carrying both the GG/GA variant of AVPR1b rs28373064 and the AA variant of clock rs6832769 showed the highest scores on the Emotional PTM. Carriers of both the T allele of OXTR rs1042778 and the C allele of clock rs1801260 showed the lowest total PTM scores compared with the other groups. The observed interaction effects provide converging evidence that the clock gene and OXT/AVP systems are intertwined and contribute to human prosociality.

  16. N-alkylvaline levels in globin as a new type of biomarker in risk assessment of alkylating agents.

    Science.gov (United States)

    Lewalter, J

    1996-01-01

    Adducts with the N-terminal valine of erythrocyte globin can serve as individual biomarkers of systemic and cellular exposure to endogenous and exogenous alkylating agents. In contrast to "detoxification markers" of this kind of mecapturic acids derived from alkylation of glutathione, individual N-alkylations of valine in globin reflect the formally "toxifying" part of the stress due to alkylating agents transformed into the ultimate toxicant. Thus, in contrast to the traditional methods of biological monitoring this approach enables a better evaluation of systemic exposure to reactive agents, adapted more sensibly to the exposure situation over the whole life span of erythrocytes, and it can serve as a specific biomarker of exposure for the purpose of health surveillance in occupational medicine. An individual evaluation of exposures in comparison with the range of corresponding background levels is discussed from the point of view of supplementary risk assessment in medical surveillance of occupationally exposed persons.

  17. Efficacy of a potential trivalent vaccine based on Hc fragments of botulinum toxins A, B, and E produced in a cell-free expression system.

    Science.gov (United States)

    Zichel, R; Mimran, A; Keren, A; Barnea, A; Steinberger-Levy, I; Marcus, D; Turgeman, A; Reuveny, S

    2010-05-01

    Botulinum toxins produced by the anaerobic bacterium Clostridium botulinum are the most potent biological toxins in nature. Traditionally, people at risk are immunized with a formaldehyde-inactivated toxin complex. Second generation vaccines are based on the recombinant carboxy-terminal heavy-chain (Hc) fragment of the neurotoxin. However, the materialization of this approach is challenging, mainly due to the high AT content of clostridial genes. Herein, we present an alternative strategy in which the native genes encoding Hc proteins of botulinum toxins A, B, and E were used to express the recombinant Hc fragments in a cell-free expression system. We used the unique property of this open system to introduce different combinations of chaperone systems, protein disulfide isomerase (PDI), and reducing/oxidizing environments directly to the expression reaction. Optimized expression conditions led to increased production of soluble Hc protein, which was successfully scaled up using a continuous exchange (CE) cell-free system. Hc proteins were produced at a concentration of more than 1 mg/ml and purified by one-step Ni(+) affinity chromatography. Mice immunized with three injections containing 5 microg of any of the in vitro-expressed, alum-absorbed, Hc vaccines generated a serum enzyme-linked immunosorbent assay (ELISA) titer of 10(5) against the native toxin complex, which enabled protection against a high-dose toxin challenge (10(3) to 10(6) mouse 50% lethal dose [MsLD(50)]). Finally, immunization with a trivalent HcA, HcB, and HcE vaccine protected mice against the corresponding trivalent 10(5) MsLD(50) toxin challenge. Our results together with the latest developments in scalability of the in vitro protein expression systems offer alternative routes for the preparation of botulinum vaccine.

  18. Analysis of IL-6, IL-10 and NF-κB Gene Polymorphisms in Aggressive and Chronic Periodontitis.

    Science.gov (United States)

    Toker, Hülya; Görgün, Emine Pirim; Korkmaz, Ertan Mahir

    2017-06-01

    Pro-inflammatory cytokines, interleukin-6 (IL-6), demonstrated to be suppressed by interleukin-10 (IL-10) are known to be regulated by the transcription factor nuclear factor-κB(NF-κB). The aim of this study was to ascertain the association between genetic polymorphism of these genes (IL-6(-174), IL-10(-597) and NF-κB1-94ins/del)) and chronic/aggressive periodontitis. Forty-five patients with chronic periodontitis (CP), 58 patients with aggressive periodontitis (AP) and 38 periodontally healthy subjects were included in this study. Genomic DNA was isolated from whole blood samples. The NF-κB, IL-6, and IL-10 polymorphisms were determined by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Among subjects for the ins/ins genotypes of NF-κB1 gene, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis group than in healthy controls (p=0.023). A statistically significant difference in genotyping frequencies between AP group and healthy controls was observed for the IL-6 gene. The AA genotype of IL-10 was overrepresented in CP and AP groups compared to healthy controls (OR=9.93, 95% CI: 2.11-46.7, OR=5.7, 95% CI: 1.22-26.89, respectively). Within the limits of this study, it can be concluded that the IL-10 (-597) AA genotype is associated with susceptibility to chronic/aggressive periodontitis and IL-6 (-174) GG genotypes and G allele seems to be associated with aggressive periodontitis. Clinical relevance: The results of the current study indicate that IL-6 and IL-10 genotypes seem to be associated with aggressive periodontitis. Also, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis subjects with carrying NF-κB1 ins/ins genotypes. Copyright© by the National Institute of Public Health, Prague 2017

  19. Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi

    Directory of Open Access Journals (Sweden)

    In Sun Hwang

    2016-06-01

    Full Text Available Gene disruption by homologous recombination is widely used to investigate and analyze the function of genes in Fusarium fujikuroi, a fungus that causes bakanae disease and root rot symptoms in rice. To generate gene deletion constructs, the use of conventional cloning methods, which rely on restriction enzymes and ligases, has had limited success due to a lack of unique restriction enzyme sites. Although strategies that avoid the use of restriction enzymes have been employed to overcome this issue, these methods require complicated PCR steps or are frequently inefficient. Here, we introduce a cloning system that utilizes multi-fragment assembly by In-Fusion to generate a gene disruption construct. This method utilizes DNA fragment fusion and requires only one PCR step and one reaction for construction. Using this strategy, a gene disruption construct for Fusarium cyclin C1 (FCC1 , which is associated with fumonisin B1 biosynthesis, was successfully created and used for fungal transformation. In vivo and in vitro experiments using confirmed fcc1 mutants suggest that fumonisin production is closely related to disease symptoms exhibited by F. fujikuroi strain B14. Taken together, this multi-fragment assembly method represents a simpler and a more convenient process for targeted gene disruption in fungi.

  20. An expanded allosteric network in PTP1B by multitemperature crystallography, fragment screening, and covalent tethering.

    Science.gov (United States)

    Keedy, Daniel A; Hill, Zachary B; Biel, Justin T; Kang, Emily; Rettenmaier, T Justin; Brandao-Neto, Jose; Pearce, Nicholas M; von Delft, Frank; Wells, James A; Fraser, James S

    2018-06-07

    Allostery is an inherent feature of proteins, but it remains challenging to reveal the mechanisms by which allosteric signals propagate. A clearer understanding of this intrinsic circuitry would afford new opportunities to modulate protein function. Here we have identified allosteric sites in protein tyrosine phosphatase 1B (PTP1B) by combining multiple-temperature X-ray crystallography experiments and structure determination from hundreds of individual small-molecule fragment soaks. New modeling approaches reveal 'hidden' low-occupancy conformational states for protein and ligands. Our results converge on allosteric sites that are conformationally coupled to the active-site WPD loop and are hotspots for fragment binding. Targeting one of these sites with covalently tethered molecules or mutations allosterically inhibits enzyme activity. Overall, this work demonstrates how the ensemble nature of macromolecular structure, revealed here by multitemperature crystallography, can elucidate allosteric mechanisms and open new doors for long-range control of protein function. © 2018, Keedy et al.

  1. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  2. Pharmacologic study of C-terminal fragments of frog skin calcitonin gene-related peptide.

    Science.gov (United States)

    Ladram, Ali; Besné, Isabelle; Breton, Lionel; de Lacharrière, Olivier; Nicolas, Pierre; Amiche, Mohamed

    2008-07-01

    The calcitonin gene-related peptide from the skin of the frog Phyllomedusa bicolor (pbCGRP) is a 37-residue neuropeptide that differs from human alpha CGRP (halphaCGRP) at 16 positions. The affinities of the C-terminal fragments of pbCGRP and halphaCGRP were evaluated in SK-N-MC cells: pbCGRP(8-37) (K(i)=0.2nM) and pbCGRP(27-37) (K(i)=95nM) were, respectively, 3 times and 20 times more potent than the human fragments halphaCGRP(8-37) and halphaCGRP(27-37). Their antagonistic potencies were measured in SK-N-MC and Col 29 cells, and the rat vas deferens. pbCGRP(8-37) inhibited the halphaCGRP-stimulated production of cAMP by SK-N-MC and Col 29 cells 3 to 4 times more strongly than halphaCGRP(8-37). Thus pbCGRP(8-37) is the most potent CGRP-1 competitive antagonist of all the natural sequences reported to date. pbCGRP(27-37) was also as potent as [D(31), A(34), F(35)] halphaCGRP(27-37), a prototypic antagonist analog derived from structure-activity relationship studies of halphaCGRP(8-37).

  3. [Variability of Cytochrome b Gene and Adjacent Section of Gene tRNA-Thr of Mitochondrial DNA in the Northern Mole Vole Ellobius talpinus (Mammalia, Rodentia)].

    Science.gov (United States)

    Bogdanov, A S; Lebedev, V S; Zykov, A E; Bakloushinskaya, I Yu

    2015-12-01

    The Northern mole vole E. talpinus, despite its wide distribution, is characterized by a stable karyotype (2n = NF = 54) and slight morphological polymorphism. We made a preliminary analysis of a mitochondrial DNA fragment to clarify the level of genetic variation and differentiation of E. talpinus. the complete cytochrome b gene (cyt b, 1143 bp) and a short part of its flanking gene tRNA-Thr (27 bp) were sequenced. We studied 16 specimens from eight localities, including Crimea, the Volga region, the Trans-Volga region, the Southern Urals, Western Siberia, and Eastern Turkmenistan. Mitotypes of E. talpinus were distributed on a ML dendrogram as four distinct clusters: the first (I) contains specimens from the Crimea, the second (II) combines individuals from the Volgograd region and the left bank of the Don River, the third (III) includes those from the Trans-Volga region, Southern Urals, the left bank of the Irtysh River, and Eastern Turkmenistan; the fourth (IV) are those from the right bank of the Irtysh River. These clusters were relatively distant from each other: the mean genetic distances (D) between them are 0.021-0.051. The Eastern mole vole E. tancrei differed from E. talpinus population groups 1.5-2 times more (D = 0.077-0.084) than the latter did among themselves. Such variations indirectly proved the unity of E. talpinus, despite its high intraspecific differentiation for the studied fragment of mitochondrial DNA. This differentiation apparently occurred because of the long isolation of E. talpinus population groups, which was due to geographic barriers, in particular, the large rivers that completely separate the species range meridionally (the Volga River, the Irtysh River). Sociality and underground lifestyle could accelerate the fixation of mutations in disjunct populations. The composition and distribution of intraspecific groups of E. talpinus, which were identified in analysis of the mitochondrial DNA fragment, do not coincide with the

  4. Cloning of the Bacillus subtilis recE+ gene and functional expression of recE+ in B. subtilis

    International Nuclear Information System (INIS)

    Marrero, R.; Yasbin, R.E.

    1988-01-01

    By use of the Bacillus subtilis bacteriophage cloning vehicle Phi 105J23, B. subtilis chromosomal MboI fragments have been cloned that alleviate the pleiotropic effects of the recE4 mutation. The recombinant bacteriophages Phi 105Rec Phi1 (3.85-kilobase insert) and Phi 105Rec Phi4 (3.3-kilobase insert) both conferred on the recE4 strain YB1015 resistance to ethylmethane sulfonate, methylmethane sulfonate, mitomycin C, and UV irradiation comparable with the resistance observed in recE + strains. While strain YB1015 (recE4) and its derivatives lysogenized with bacteriophage Phi105J23 were not transformed to prototrophy by B. subtilis chromosomal DNA, strain YB1015 lysogenized with either Phi 105Rec Phi 1 or Phi 105RecPhi 4 was susceptible to transformation with homologous B. subtilis chromosomal DNA. The heteroimmune prophages Phi 105 and SPO2 were essentially uninducible in strain YB1015. Significantly, both recombinant prophages Phi 105RecPhi 1 and Phi 105Rec Phi 4 were fully inducible and allowed the spontaneous and mitomycin C-dependent induction of a coresident SPO2 prophage in a recE4 host. The presence of the recombinant prophages also restored the ability of din genes to be induced in strains carrying the recE4 mutation. Finally, both recombinant bacteriophages elaborated a mitomycin C-inducible, 45-kilodalton protein that was immunoreactive with Escherichia coli recA + gene product antibodies. Collectively, these data demonstrate that the recE + gene has been cloned and that this gene elaborates the 45-kilodalton protein that is involved in SOB induction and homologous recombination

  5. Tumour Necrosis Factor-alpha and Nuclear Factor-kappa B Gene Variants in Sepsis.

    Science.gov (United States)

    Acar, Leyla; Atalan, Nazan; Karagedik, E Hande; Ergen, Arzu

    2018-01-20

    The humoral system is activated and various cytokines are released due to infections in tissues and traumatic damage. Nuclear factor-kappa B dimers are encoded by nuclear factor-kappa B genes and regulate transcription of several crucial proteins of inflammation such as tumour necrosis factor-alpha. To investigate the possible effect of polymorphisms on tumour necrosis factor-alpha serum levels with clinical and prognostic parameters of sepsis by determining the nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A) gene polymorphisms and tumour necrosis factor-alpha serum levels. Case-control study. Seventy-two patients with sepsis and 104 healthy controls were included in the study. In order to determine the polymorphisms of nuclear factor-kappa B-1-94 ins/del ATTG and tumour necrosis factor-alpha (-308 G/A), polymerase chain reaction-restriction fragment length polymorphism analysis was performed and serum tumour necrosis factor-alpha levels were determined using an enzyme-linked immunosorbent assay. We observed no significant differences in tumour necrosis factor-alpha serum levels between the study groups. In the patient group, an increase in the tumour necrosis factor-alpha serum levels in patients carrying the tumour necrosis factor-alpha (-308 G/A) A allele compared to those without the A allele was found to be statistically significant. Additionally, an increase in the tumour necrosis factor-alpha serum levels in patients carrying tumour necrosis factor-alpha (-308 G/A) AA genotype compared with patients carrying the AG or GG genotypes was statistically significant. No significant differences were found in these 2 polymorphisms between the patient and control groups (p>0.05). Our results showed the AA genotype and the A allele of the tumour necrosis factor-alpha (-308 G/A) polymorphism may be used as a predictor of elevated tumour necrosis factor-alpha levels in patients with sepsis.

  6. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  7. Characterization of adult α- and β-globin elevated by hydrogen peroxide in cervical cancer cells that play a cytoprotective role against oxidative insults.

    Directory of Open Access Journals (Sweden)

    Xiaolei Li

    Full Text Available OBJECTIVES: Hemoglobin (Hgb is the main oxygen and carbon dioxide carrier in cells of erythroid lineage and is responsible for oxygen delivery to the respiring tissues of the body. However, Hgb is also expressed in nonerythroid cells. In the present study, the expression of Hgb in human uterine cervix carcinoma cells and its role in cervical cancer were investigated. METHODOLOGY: The expression level of Hgb in cervical cancer tissues was assessed by quantitative reverse transcriptase-PCR (qRT-PCR. We applied multiple methods, such as RT-PCR, immunoblotting, and immunohistochemical analysis, to confirm Hgb expression in cervical cancer cells. The effects of ectopic expression of Hgb and Hgb mutants on oxidative stress and cell viability were investigated by cellular reactive oxygen species (ROS analysis and lactate dehydrogenase (LDH array, respectively. Both Annexin V staining assay by flow cytometry and caspase-3 activity assay were used, respectively, to evaluate cell apoptosis. RESULTS: qRT-PCR analysis showed that Hgb-α- (HBA1 and Hgb-β-globin (HBB gene expression was significantly higher in cervical carcinoma than in normal cervical tissues, whereas the expression of hematopoietic transcription factors and erythrocyte specific marker genes was not increased. Immunostaining experiments confirmed the expression of Hgb in cancer cells of the uterine cervix. Hgb mRNA and protein were also detected in the human cervical carcinoma cell lines SiHa and CaSki, and Hgb expression was up-regulated by hydrogen peroxide-induced oxidative stress. Importantly, ectopic expression of wild type HBA1/HBB or HBA1, rather than mutants HBA1(H88R/HBB(H93R unable to bind hemo, suppressed oxidative stress and improved cell viability. CONCLUSIONS: The present findings show for the first time that Hgb is expressed in cervical carcinoma cells and may act as an antioxidant, attenuating oxidative stress-induced damage in cervical cancer cells. These data provide a

  8. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  9. Identification of B. anthracis N(5)-carboxyaminoimidazole ribonucleotide mutase (PurE) active site binding compounds via fragment library screening.

    Science.gov (United States)

    Lei, Hao; Jones, Christopher; Zhu, Tian; Patel, Kavankumar; Wolf, Nina M; Fung, Leslie W-M; Lee, Hyun; Johnson, Michael E

    2016-02-15

    The de novo purine biosynthesis pathway is an attractive target for antibacterial drug design, and PurE from this pathway has been identified to be crucial for Bacillus anthracis survival in serum. In this study we adopted a fragment-based hit discovery approach, using three screening methods-saturation transfer difference nucleus magnetic resonance (STD-NMR), water-ligand observed via gradient spectroscopy (WaterLOGSY) NMR, and surface plasmon resonance (SPR), against B. anthracis PurE (BaPurE) to identify active site binding fragments by initially testing 352 compounds in a Zenobia fragment library. Competition STD NMR with the BaPurE product effectively eliminated non-active site binding hits from the primary hits, selecting active site binders only. Binding affinities (dissociation constant, KD) of these compounds varied between 234 and 301μM. Based on test results from the Zenobia compounds, we subsequently developed and applied a streamlined fragment screening strategy to screen a much larger library consisting of 3000 computationally pre-selected fragments. Thirteen final fragment hits were confirmed to exhibit binding affinities varying from 14μM to 700μM, which were categorized into five different basic scaffolds. All thirteen fragment hits have ligand efficiencies higher than 0.30. We demonstrated that at least two fragments from two different scaffolds exhibit inhibitory activity against the BaPurE enzyme. Published by Elsevier Ltd.

  10. Occurrence of the structural enterocin A, P, B, L50B genes in enterococci of different origin.

    Science.gov (United States)

    Strompfová, Viola; Lauková, Andrea; Simonová, Monika; Marcináková, Miroslava

    2008-12-10

    Enterococci are well-known producers of antimicrobial peptides--bacteriocins (enterocins) and the number of characterized enterocins has been significantly increased. Recently, enterocins are of great interest for their potential as biopreservatives in food or feed while research on enterocins as alternative antimicrobials in humans and animals is only at the beginning. The present study provides a survey about the occurrence of enterocin structural genes A, P, B, L50B in a target of 427 strains of Enterococcus faecium (368) and Enterococcus faecalis (59) species from different sources (animal isolates, food and feed) performed by PCR method. Based on our results, 234 strains possessed one or more enterocin structural gene(s). The genes of enterocin P and enterocin A were the most frequently detected structural genes among the PCR positive strains (170 and 155 strains, respectively). Different frequency of the enterocin genes occurrence was detected in strains according to their origin; the strains from horses and silage showed the highest frequency of enterocin genes presence. All possible combinations of the tested genes occurred at least twice except the combination of the gene of enterocin B and L50B which possessed neither strain. The gene of enterocin A was exclusively detected among E. faecium strains, while the gene of enterocin P, B, L50B were detected in strains of both species E. faecium and E. faecalis. In conclusion, a high-frequency and variability of enterocin structural genes exists among enterococci of different origin what offers a big possibility to find effective bacteriocin-producing strains for their application in veterinary medicine.

  11. Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B cell differentiation by cDNA array analyses.

    Science.gov (United States)

    Kim, Unkyu; Siegel, Rachael; Ren, Xiaodi; Gunther, Cary S; Gaasterland, Terry; Roeder, Robert G

    2003-07-22

    The tissue-specific transcriptional coactivator OCA-B is required for antigen-dependent B cell differentiation events, including germinal center formation. However, the identity of OCA-B target genes involved in this process is unknown. This study has used large-scale cDNA arrays to monitor changes in gene expression patterns that accompany mature B cell differentiation. B cell receptor ligation alone induces many genes involved in B cell expansion, whereas B cell receptor and helper T cell costimulation induce genes associated with B cell effector function. OCA-B expression is induced by both B cell receptor ligation alone and helper T cell costimulation, suggesting that OCA-B is involved in B cell expansion as well as B cell function. Accordingly, several genes involved in cell proliferation and signaling, such as Lck, Kcnn4, Cdc37, cyclin D3, B4galt1, and Ms4a11, have been identified as OCA-B-dependent genes. Further studies on the roles played by these genes in B cells will contribute to an understanding of B cell differentiation.

  12. Fragmentation of SIV-gag vaccine induces broader T cell responses.

    Directory of Open Access Journals (Sweden)

    Adel Benlahrech

    Full Text Available High mutation rates of human immunodeficiency virus (HIV allows escape from T cell recognition preventing development of effective T cell vaccines. Vaccines that induce diverse T cell immune responses would help overcome this problem. Using SIV gag as a model vaccine, we investigated two approaches to increase the breadth of the CD8 T cell response. Namely, fusion of vaccine genes to ubiquitin to target the proteasome and increase levels of MHC class I peptide complexes and gene fragmentation to overcome competition between epitopes for presentation and recognition.three vaccines were compared: full-length unmodified SIV-mac239 gag, full-length gag fused at the N-terminus to ubiquitin and 7 gag fragments of equal size spanning the whole of gag with ubiquitin-fused to the N-terminus of each fragment. Genes were cloned into a replication defective adenovirus vector and immunogenicity assessed in an in vitro human priming system. The breadth of the CD8 T cell response, defined by the number of distinct epitopes, was assessed by IFN-γ-ELISPOT and memory phenotype and cytokine production evaluated by flow cytometry. We observed an increase of two- to six-fold in the number of epitopes recognised in the ubiquitin-fused fragments compared to the ubiquitin-fused full-length gag. In contrast, although proteasomal targeting was achieved, there was a marked reduction in the number of epitopes recognised in the ubiquitin-fused full-length gag compared to the full-length unmodified gene, but there were no differences in the number of epitope responses induced by non-ubiquitinated full-length gag and the ubiquitin-fused mini genes. Fragmentation and ubiquitination did not affect T cell memory differentiation and polyfunctionality, though most responses were directed against the Ad5 vector.Fragmentation but not fusion with ubiquitin increases the breadth of the CD8 T vaccine response against SIV-mac239 gag. Thus gene fragmentation of HIV vaccines may maximise

  13. Glycoprotein B genotyping in congenital/perinatal Cytomegalovirus infection in symptomatic infants.

    Science.gov (United States)

    Gandhoke, Inderjeet; Hussain, S Akhtar; Pasha, S T; Chauhan, L S; Khare, Shashi

    2013-07-01

    Molecular epidemiological studies on circulating strains of CMV in cogenital/perinatal infections have not been done earlier in this region. To study the glycoprotein B genotypes in babies with symptomatic congenital/perinatal CMV infection and to assess the possible influence of genotype on the outcome of the infection. Clinical samples (blood and urine) of symptomatic babies are sent to the Virology Department of NCDC, Delhi for the diagnosis of congenital infections. 375 clinical samples of infants (newborn - 6 months old) were included for the study. Serum samples were subjected to ELISA for detection of IgM antibodies against CMV. DNA isolation and amplification of CMV genomic DNA targeting gB gene fragment by nested PCR, was carried out in the samples. The amplified fragment including the cleavage site was subjected to RFLP using restriction enzymes Rsal and Hinf1. They were also verified by sequencing using Big Dye Terminator chemistry. 75 samples out of 375 tested were confirmed positive for CMV infection by serology and PCR. Both RFLP and sequencing of gB gene fragment showed that gB 1, 2 and 3 genotypes were in circulation. gB 3 was the most prevalent genotype in symptomatic infants. Hepatosplenomegaly was the most common feature in gB-3 genotype of CMV. gB2 congenital CMV infection was more commonly associated with long term sequelae.

  14. Cylindrospermopsin and Saxitoxin Synthetase Genes in Cylindrospermopsis raciborskii Strains from Brazilian Freshwater

    Science.gov (United States)

    Hoff-Risseti, Caroline; Dörr, Felipe Augusto; Schaker, Patricia Dayane Carvalho; Pinto, Ernani; Werner, Vera Regina; Fiore, Marli Fatima

    2013-01-01

    The Cylindrospermopsis raciborskii population from Brazilian freshwater is known to produce saxitoxin derivatives (STX), while cylindrospermopsin (CYN), which is commonly detected in isolates from Australia and Asia continents, has thus far not been detected in South American strains. However, during the investigation for the presence of cyrA, cyrB, cyrC and cyrJ CYN synthetase genes in the genomes of four laboratory-cultured C. raciborskii Brazilian strains, the almost complete cyrA gene sequences were obtained for all strains, while cyrB and cyrC gene fragments were observed in two strains. These nucleotide sequences were translated into amino acids, and the predicted protein functions and domains confirmed their identity as CYN synthetase genes. Attempts to PCR amplify cyrJ gene fragments from the four strains were unsuccessful. Phylogenetic analysis grouped the nucleotide sequences together with their homologues found in known CYN synthetase clusters of C. raciborskii strains with high bootstrap support. In addition, fragments of sxtA, sxtB and sxtI genes involved in STX production were also obtained. Extensive LC-MS analyses were unable to detect CYN in the cultured strains, whereas the production of STX and its analogues was confirmed in CENA302, CENA305 and T3. To our knowledge, this is the first study reporting the presence of cyr genes in South American strains of C. raciborskii and the presence of sxt and cyr genes in a single C. raciborskii strain. This discovery suggests a shift in the type of cyanotoxin production over time of South American strains of C. raciborskii and contributes to the reconstruction of the evolutionary history and diversification of cyanobacterial toxins. PMID:24015317

  15. Cylindrospermopsin and saxitoxin synthetase genes in Cylindrospermopsis raciborskii strains from Brazilian freshwater.

    Directory of Open Access Journals (Sweden)

    Caroline Hoff-Risseti

    Full Text Available The Cylindrospermopsis raciborskii population from Brazilian freshwater is known to produce saxitoxin derivatives (STX, while cylindrospermopsin (CYN, which is commonly detected in isolates from Australia and Asia continents, has thus far not been detected in South American strains. However, during the investigation for the presence of cyrA, cyrB, cyrC and cyrJ CYN synthetase genes in the genomes of four laboratory-cultured C. raciborskii Brazilian strains, the almost complete cyrA gene sequences were obtained for all strains, while cyrB and cyrC gene fragments were observed in two strains. These nucleotide sequences were translated into amino acids, and the predicted protein functions and domains confirmed their identity as CYN synthetase genes. Attempts to PCR amplify cyrJ gene fragments from the four strains were unsuccessful. Phylogenetic analysis grouped the nucleotide sequences together with their homologues found in known CYN synthetase clusters of C. raciborskii strains with high bootstrap support. In addition, fragments of sxtA, sxtB and sxtI genes involved in STX production were also obtained. Extensive LC-MS analyses were unable to detect CYN in the cultured strains, whereas the production of STX and its analogues was confirmed in CENA302, CENA305 and T3. To our knowledge, this is the first study reporting the presence of cyr genes in South American strains of C. raciborskii and the presence of sxt and cyr genes in a single C. raciborskii strain. This discovery suggests a shift in the type of cyanotoxin production over time of South American strains of C. raciborskii and contributes to the reconstruction of the evolutionary history and diversification of cyanobacterial toxins.

  16. Molecular characterization of genes of Pseudomonas sp. strain HR199 involved in bioconversion of vanillin to protocatechuate.

    Science.gov (United States)

    Priefert, H; Rabenhorst, J; Steinbüchel, A

    1997-01-01

    The gene loci vdh, vanA, and vanB, which are involved in the bioconversion of vanillin to protocatechuate by Pseudomonas sp. strain HR199 (DSM 7063), were identified as the structural genes of a novel vanillin dehydrogenase (vdh) and the two subunits of a vanillate demethylase (vanA and vanB), respectively. These genes were localized on an EcoRI fragment (E230), which was cloned from a Pseudomonas sp. strain HR199 genomic library in the cosmid pVK100. The vdh gene was identified on a subfragment (HE35) of E230, and the vanA and vanB genes were localized on a different subfragment (H110) of E230. The nucleotide sequences of fragment HE35 and part of fragment H110 were determined, revealing open reading frames of 1062, 951, and 1446 bp, representing vanA, vanB, and vdh, respectively. The vdh gene was organized in one operon together with a fourth open reading frame (ORF2), of 735 bp, which was located upstream of vdh. The deduced amino acid sequences of vanA and vanB exhibited 78.8 and 62.1% amino acid identity, respectively, to the corresponding gene products from Pseudomonas sp. strain ATCC 19151 (F. Brunel and J. Davison, J. Bacteriol. 170:4924-4930, 1988). The deduced amino acid sequence of the vdh gene exhibited up to 35.3% amino acid identity to aldehyde dehydrogenases from different sources. The deduced amino acid sequence of ORF2 exhibited up to 28.4% amino acid identity to those of enoyl coenzyme A hydratases. Escherichia coli strains harboring fragment E230 cloned in pBluescript SK- converted vanillin to protocatechuate via vanillate, indicating the functional expression of vdh, vanA, and vanB in E. coli. High expression of vdh in E. coli was achieved with HE35 cloned in pBluescript SK-. The resulting recombinant strains converted vanillin to vanillate at a rate of up to 0.3 micromol per min per ml of culture. Transfer of vanA, vanB, and vdh to Alcaligenes eutrophus and to different Pseudomonas strains, which were unable to utilize vanillin or vanillate as

  17. HS5 of the human β-globin Locus Control Region: a developmental stage-specific border in erythroid cells.

    NARCIS (Netherlands)

    A. Wai (Albert); N. Gillemans (Nynke); S. Raguz-Bolognesi (Selina); S. Pruzina (Sara); G. Zafarana (Gaetano); D.N. Meijer (Dies); F.G. Grosveld (Frank); J.N.J. Philipsen (Sjaak)

    2003-01-01

    textabstractElements with insulator/border activity have been characterized most extensively in Drosophila melanogaster. In vertebrates, the first example of such an element was provided by a hypersensitive site of the chicken beta-globin locus, cHS4. It has been proposed that the homologous site in

  18. Recent habitat fragmentation caused by major roads leads to reduction of gene flow and loss of genetic variability in ground beetles.

    Science.gov (United States)

    Keller, Irene; Largiadèr, Carlo R

    2003-02-22

    Although habitat fragmentation is suspected to jeopardize the long-term survival of many species, few data are available on its impact on the genetic variability of invertebrates. We assess the genetic population structure of the flightless ground beetle Carabus violaceus L., 1758 in a Swiss forest, which is divided into several fragments by a highway and two main roads. Eight samples were collected from different forest fragments and analysed at six microsatellite loci. The largest genetic differentiation was observed between samples separated by roads and in particular by the highway. The number of roads between sites explained 44% of the variance in pairwise F(ST) estimates, whereas the age of the road and the geographical distance between locations were not significant factors. Furthermore, a comparison of allelic richness showed that the genetic variability in a small forest fragment isolated by the highway was significantly lower than in the rest of the study area. These findings strongly support the hypothesis that large roads are absolute barriers to gene flow in C. violaceus, which may lead to a loss of genetic variability in fragmented populations.

  19. Comparative genomics of neuroglobin reveals its early origins.

    Directory of Open Access Journals (Sweden)

    Jasmin Dröge

    Full Text Available Neuroglobin (Ngb is a hexacoordinated globin expressed mainly in the central and peripheral nervous system of vertebrates. Although several hypotheses have been put forward regarding the role of neuroglobin, its definite function remains uncertain. Ngb appears to have a neuro-protective role enhancing cell viability under hypoxia and other types of oxidative stress. Ngb is phylogenetically ancient and has a substitution rate nearly four times lower than that of other vertebrate globins, e.g. hemoglobin. Despite its high sequence conservation among vertebrates Ngb seems to be elusive in invertebrates.We determined candidate orthologs in invertebrates and identified a globin of the placozoan Trichoplax adhaerens that is most likely orthologous to vertebrate Ngb and confirmed the orthologous relationship of the polymeric globin of the sea urchin Strongylocentrotus purpuratus to Ngb. The putative orthologous globin genes are located next to genes orthologous to vertebrate POMT2 similarly to localization of vertebrate Ngb. The shared syntenic position of the globins from Trichoplax, the sea urchin and of vertebrate Ngb strongly suggests that they are orthologous. A search for conserved transcription factor binding sites (TFBSs in the promoter regions of the Ngb genes of different vertebrates via phylogenetic footprinting revealed several TFBSs, which may contribute to the specific expression of Ngb, whereas a comparative analysis with myoglobin revealed several common TFBSs, suggestive of regulatory mechanisms common to globin genes.Identification of the placozoan and echinoderm genes orthologous to vertebrate neuroglobin strongly supports the hypothesis of the early evolutionary origin of this globin, as it shows that neuroglobin was already present in the placozoan-bilaterian last common ancestor. Computational determination of the transcription factor binding sites repertoire provides on the one hand a set of transcriptional factors that are

  20. Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

    Science.gov (United States)

    Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

    2014-08-30

    The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Identification of a seed coat-specific promoter fragment from the Arabidopsis MUCILAGE-MODIFIED4 gene.

    Science.gov (United States)

    Dean, Gillian H; Jin, Zhaoqing; Shi, Lin; Esfandiari, Elahe; McGee, Robert; Nabata, Kylie; Lee, Tiffany; Kunst, Ljerka; Western, Tamara L; Haughn, George W

    2017-09-01

    The Arabidopsis seed coat-specific promoter fragment described is an important tool for basic and applied research in Brassicaceae species. During differentiation, the epidermal cells of the Arabidopsis seed coat produce and secrete large quantities of mucilage. On hydration of mature seeds, this mucilage becomes easily accessible as it is extruded to form a tightly attached halo at the seed surface. Mucilage is composed mainly of pectin, and also contains the key cell wall components cellulose, hemicellulose, and proteins, making it a valuable model for studying numerous aspects of cell wall biology. Seed coat-specific promoters are an important tool that can be used to assess the effects of expressing biosynthetic enzymes and diverse cell wall-modifying proteins on mucilage structure and function. Additionally, they can be used for production of easily accessible recombinant proteins of commercial interest. The MUCILAGE-MODIFIED4 (MUM4) gene is expressed in a wide variety of plant tissues and is strongly up-regulated in the seed coat during mucilage synthesis, implying the presence of a seed coat-specific region in its promoter. Promoter deletion analysis facilitated isolation of a 308 base pair sequence (MUM4 0.3Pro ) that directs reporter gene expression in the seed coat cells of both Arabidopsis and Camelina sativa, and is regulated by the same transcription factor cascade as endogenous MUM4. Therefore, MUM4 0.3Pro is a promoter fragment that serves as a new tool for seed coat biology research.

  2. Disruption of the Eng18B ENGase gene in the fungal biocontrol agent Trichoderma atroviride affects growth, conidiation and antagonistic ability.

    Directory of Open Access Journals (Sweden)

    Mukesh K Dubey

    Full Text Available The recently identified phylogenetic subgroup B5 of fungal glycoside hydrolase family 18 genes encodes enzymes with mannosyl glycoprotein endo-N-acetyl-β-D-glucosaminidase (ENGase-type activity. Intracellular ENGase activity is associated with the endoplasmic reticulum associated protein degradation pathway (ERAD of misfolded glycoproteins, although the biological relevance in filamentous fungi is not known. Trichoderma atroviride is a mycoparasitic fungus that is used for biological control of plant pathogenic fungi. The present work is a functional study of the T. atroviride B5-group gene Eng18B, with emphasis on its role in fungal growth and antagonism. A homology model of T. atroviride Eng18B structure predicts a typical glycoside hydrolase family 18 (αβ(8 barrel architecture. Gene expression analysis shows that Eng18B is induced in dual cultures with the fungal plant pathogens Botrytis cinerea and Rhizoctonia solani, although a basal expression is observed in all growth conditions tested. Eng18B disruption strains had significantly reduced growth rates but higher conidiation rates compared to the wild-type strain. However, growth rates on abiotic stress media were significantly higher in Eng18B disruption strains compared to the wild-type strain. No difference in spore germination, germ-tube morphology or in hyphal branching was detected. Disruption strains produced less biomass in liquid cultures than the wild-type strain when grown with chitin as the sole carbon source. In addition, we determined that Eng18B is required for the antagonistic ability of T. atroviride against the grey mould fungus B. cinerea in dual cultures and that this reduction in antagonistic ability is partly connected to a secreted factor. The phenotypes were recovered by re-introduction of an intact Eng18B gene fragment in mutant strains. A putative role of Eng18B ENGase activity in the endoplasmic reticulum associated protein degradation pathway of endogenous

  3. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  4. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  5. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    Science.gov (United States)

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. © 2014 American Society of Plant Biologists. All Rights Reserved.

  6. Phosphoribosylpyrophosphate synthetase of Bacillus subtilis. Cloning, characterization and chromosomal mapping of the prs gene

    DEFF Research Database (Denmark)

    Nilsson, Dan; Hove-Jensen, Bjarne

    1987-01-01

    The gene (prs) encoding phosphoribosylpyrophosphate (PRPP) synthetase has been cloned from a library of Bacillus subtilis DNA by complementation of an Escherichia coli prs mutation. Flanking DNA sequences were pruned away by restriction endonuclease and exonuclease BAL 31 digestions, resulting...... in a DNA fragment of approx. 1.8 kb complementing the E. coli prs mutation. Minicell experiments revealed that this DNA fragment coded for a polypeptide, shown to be the PRPP synthetase subunit, with an Mr of approx. 40,000. B. subtilis strains harbouring the prs gene in a multicopy plasmid contained up...... to nine-fold increased PRPP synthetase activity. The prs gene was cloned in an integration vector and the resulting hybrid plasmid inserted into the B. subtilis chromosome by homologous recombination. The integration site was mapped by transduction and the gene order established as purA-guaA-prs-cysA....

  7. Generating and Purifying Fab Fragments from Human and Mouse IgG Using the Bacterial Enzymes IdeS, SpeB and Kgp.

    Science.gov (United States)

    Sjögren, Jonathan; Andersson, Linda; Mejàre, Malin; Olsson, Fredrik

    2017-01-01

    Fab fragments are valuable research tools in various areas of science including applications in imaging, binding studies, removal of Fc-mediated effector functions, mass spectrometry, infection biology, and many others. The enzymatic tools for the generation of Fab fragments have been discovered through basic research within the field of molecular bacterial pathogenesis. Today, these enzymes are widely applied as research tools and in this chapter, we describe methodologies based on bacterial enzymes to generate Fab fragments from both human and mouse IgG. For all human IgG subclasses, the IdeS enzyme from Streptococcus pyogenes has been applied to generate F(ab')2 fragments that subsequently can be reduced under mild conditions to generate a homogenous pool of Fab' fragments. The enzyme Kgp from Porphyromonas gingivalis has been applied to generate intact Fab fragments from human IgG1 and the Fab fragments can be purified using a CH1-specific affinity resin. The SpeB protease, also from S. pyogenes, is able to digest mouse IgGs and has been applied to digest antibodies and Fab fragments can be purified on light chain affinity resins. In this chapter, we describe methodologies that can be used to obtain Fab fragments from human and mouse IgG using bacterial proteases.

  8. High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

    Science.gov (United States)

    Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

    2016-08-01

    Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

  9. A murC gene from coryneform bacteria.

    Science.gov (United States)

    Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

    1999-02-01

    The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

  10. Genes involved in degradation of para-nitrophenol are differentially arranged in form of non-contiguous gene clusters in Burkholderia sp. strain SJ98.

    Directory of Open Access Journals (Sweden)

    Surendra Vikram

    Full Text Available Biodegradation of para-Nitrophenol (PNP proceeds via two distinct pathways, having 1,2,3-benzenetriol (BT and hydroquinone (HQ as their respective terminal aromatic intermediates. Genes involved in these pathways have already been studied in different PNP degrading bacteria. Burkholderia sp. strain SJ98 degrades PNP via both the pathways. Earlier, we have sequenced and analyzed a ~41 kb fragment from the genomic library of strain SJ98. This DNA fragment was found to harbor all the lower pathway genes; however, genes responsible for the initial transformation of PNP could not be identified within this fragment. Now, we have sequenced and annotated the whole genome of strain SJ98 and found two ORFs (viz., pnpA and pnpB showing maximum identity at amino acid level with p-nitrophenol 4-monooxygenase (PnpM and p-benzoquinone reductase (BqR. Unlike the other PNP gene clusters reported earlier in different bacteria, these two ORFs in SJ98 genome are physically separated from the other genes of PNP degradation pathway. In order to ascertain the identity of ORFs pnpA and pnpB, we have performed in-vitro assays using recombinant proteins heterologously expressed and purified to homogeneity. Purified PnpA was found to be a functional PnpM and transformed PNP into benzoquinone (BQ, while PnpB was found to be a functional BqR which catalyzed the transformation of BQ into hydroquinone (HQ. Noticeably, PnpM from strain SJ98 could also transform a number of PNP analogues. Based on the above observations, we propose that the genes for PNP degradation in strain SJ98 are arranged differentially in form of non-contiguous gene clusters. This is the first report for such arrangement for gene clusters involved in PNP degradation. Therefore, we propose that PNP degradation in strain SJ98 could be an important model system for further studies on differential evolution of PNP degradation functions.

  11. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  12. NF-kappa B genes have a major role in Inflammatory Breast Cancer

    International Nuclear Information System (INIS)

    Lerebours, Florence; Vacher, Sophie; Andrieu, Catherine; Espie, Marc; Marty, Michel; Lidereau, Rosette; Bieche, Ivan

    2008-01-01

    IBC (Inflammatory Breast cancer) is a rare form of breast cancer with a particular phenotype. New molecular targets are needed to improve the treatment of this rapidly fatal disease. Given the role of NF-κB-related genes in cell proliferation, invasiveness, angiogenesis and inflammation, we postulated that they might be deregulated in IBC. We measured the mRNA expression levels of 60 NF-κB-related genes by using real-time quantitative RT-PCR in a well-defined series of 35 IBCs, by comparison with 22 stage IIB and III non inflammatory breast cancers. Twenty-four distant metastases of breast cancer served as 'poor prognosis' breast tumor controls. Thirty-five (58%) of the 60 NF-κB-related genes were significantly upregulated in IBC compared with non IBC. The upregulated genes were NF-κB genes (NFKB1, RELA, IKBKG, NFKBIB, NFKB2, REL, CHUK), apoptosis genes (MCL1L, TNFAIP3/A20, GADD45B, FASLG, MCL1S, IER3L, TNFRSF10B/TRAILR2), immune response genes (CD40, CD48, TNFSF11/RANKL, TNFRSF11A/RANK, CCL2/MCP-1, CD40LG, IL15, GBP1), proliferation genes (CCND2, CCND3, CSF1R, CSF1, SOD2), tumor-promoting genes (CXCL12, SELE, TNC, VCAM1, ICAM1, PLAU/UPA) or angiogenesis genes (PTGS2/COX2, CXCL1/GRO1). Only two of these 35 genes (PTGS2/COX2 and CXCL1/GRO1)were also upregulated in breast cancer metastases. We identified a five-gene molecular signature that matched patient outcomes, consisting of IL8 and VEGF plus three NF-κB-unrelated genes that we had previously identified as prognostic markers in the same series of IBC. The NF-κB pathway appears to play a major role in IBC, possibly contributing to the unusual phenotype and aggressiveness of this form of breast cancer. Some upregulated NF-κB-related genes might serve as novel therapeutic targets in IBC

  13. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  14. Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

    Science.gov (United States)

    Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

    2015-01-01

    Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

  15. Genes on B chromosomes: old questions revisited with new tools.

    Science.gov (United States)

    Banaei-Moghaddam, Ali M; Martis, Mihaela M; Macas, Jiří; Gundlach, Heidrun; Himmelbach, Axel; Altschmied, Lothar; Mayer, Klaus F X; Houben, Andreas

    2015-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Often, they have been considered as 'junk DNA' or genomic parasites without functional genes. Due to recent advances in sequencing technologies, it became possible to investigate their DNA composition, transcriptional activity and effects on the host transcriptome profile in detail. Here, we review the most recent findings regarding the gene content of B chromosomes and their transcriptional activities and discuss these findings in the context of comparable biological phenomena, like sex chromosomes, aneuploidy and pseudogenes. Recent data suggest that B chromosomes carry transcriptionally active genic sequences which could affect the transcriptome profile of their host genome. These findings are gradually changing our view that B chromosomes are solely genetically inert selfish elements without any functional genes. This at one side could partly explain the deleterious effects which are associated with their presence. On the other hand it makes B chromosome a nice model for studying regulatory mechanisms of duplicated genes and their evolutionary consequences. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.

    Science.gov (United States)

    Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila

    2015-03-01

    Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

  17. Molecular ecophysiology of Antarctic notothenioid fishes.

    Science.gov (United States)

    Cheng, C-H Christina; Detrich, H William

    2007-12-29

    the mechanistic understanding of the dynamics of AFGP gene gain and loss. In humans and most vertebrates, mutations in the alpha- or beta-globin genes or defects in globin chain synthesis are causes of severe genetic disease. Thus, the 16 species of haemoglobinless, erythrocyte-null icefishes are surprising anomalies -- in fact, they could only have evolved and thrived due to relaxed selection pressure for oxygen-binding proteins in the cold, oxygen-rich waters of the Southern Ocean. Fifteen of the sixteen icefish species have lost most of the adult alphabeta-globin locus and retain only a small 3' fragment of the alpha-globin gene. The only exception to this pattern occurs in Neopagetopsis ionah, which possesses a disrupted alphabeta-globin gene complex that probably represents a non-functional intermediate on the evolutionary pathway to near total globin gene extinction. By contrast, six of the icefish species fail to express myoglobin. The absence of myoglobin expression has occurred by several independent mutations and distinct mechanisms. Haemoprotein loss is correlated with dramatic increases in cellular mitochondrial density, heart size, blood volume and capillary bed volume. Evolution of these compensatory traits was probably facilitated by the homeostatic activity of nitric oxide, a key modulator of angiogenesis and mitochondrial biogenesis. These natural knockouts of the red blood cell lineage are an excellent genomic resource for erythroid gene discovery by comparative genomics, as illustrated for the newly described gene, bloodthirsty.

  18. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  19. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  20. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  1. A small molecule for a big transformation: Topical application of a 20-nucleotide-long antisense fragment of the DIAP-2 gene inhibits the development of Drosophila melanogaster female imagos

    Directory of Open Access Journals (Sweden)

    Nyadar Palmah M.

    2018-01-01

    Full Text Available Several genes have been identified to play important roles associated with sex selection in Drosophila melanogaster. An essential part is attributed to the sex-lethal gene that depends on the expression of the X:A (number of chromosomes to autosomes ratio signal controlling both sex selection and dosage compensation processes in D. melanogaster. Interestingly, for sex selection in D. melanogaster there are no documented data addressing the role of the inhibitor of apoptosis (IAP genes and their signaling influence on this biological process. In this study, we found that topical application of a 20-nucleotide-long antisense DNA fragment (oligoDIAP-2 from the death-associated inhibitor of apoptosis (DIAP-2 gene interferes with D. melanogaster development and significantly decreases the number of female imagos and their biomass. We show that the applied antisense oligoDIAP-2 fragment downregulates the target DIAP-2 gene whose normal concentration is necessary for the development of female D. melanogaster. These data correspond to the results on downregulation of the target host IAP-Z gene of Lymantria dispar L. female imagos after topical treatment with an 18-nucleotide-long antisense DNA fragment from the L. dispar multicapsid nuclear polyhedrosis virus IAP-3 gene at the larval stage. The observed novel phenomenon linking the downregulation of insect IAP genes and the low rate of female imago development could have practical application, especially in insect pest control and molecular pathology.

  2. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  3. Cloning of the Bacillus subtilis recE/sup +/ gene and functional expression of recE/sup +/ in B. subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Marrero, R.; Yasbin, R.E.

    1988-01-01

    By use of the Bacillus subtilis bacteriophage cloning vehicle Phi 105J23, B. subtilis chromosomal MboI fragments have been cloned that alleviate the pleiotropic effects of the recE4 mutation. The recombinant bacteriophages Phi 105Rec Phi1 (3.85-kilobase insert) and Phi 105Rec Phi4 (3.3-kilobase insert) both conferred on the recE4 strain YB1015 resistance to ethylmethane sulfonate, methylmethane sulfonate, mitomycin C, and UV irradiation comparable with the resistance observed in recE/sup +/ strains. While strain YB1015 (recE4) and its derivatives lysogenized with bacteriophage Phi105J23 were not transformed to prototrophy by B. subtilis chromosomal DNA, strain YB1015 lysogenized with either Phi 105Rec Phi 1 or Phi 105RecPhi 4 was susceptible to transformation with homologous B. subtilis chromosomal DNA. The heteroimmune prophages Phi 105 and SPO2 were essentially uninducible in strain YB1015. Significantly, both recombinant prophages Phi 105RecPhi 1 and Phi 105Rec Phi 4 were fully inducible and allowed the spontaneous and mitomycin C-dependent induction of a coresident SPO2 prophage in a recE4 host. The presence of the recombinant prophages also restored the ability of din genes to be induced in strains carrying the recE4 mutation. Finally, both recombinant bacteriophages elaborated a mitomycin C-inducible, 45-kilodalton protein that was immunoreactive with Escherichia coli recA/sup +/ gene product antibodies. Collectively, these data demonstrate that the recE/sup +/ gene has been cloned and that this gene elaborates the 45-kilodalton protein that is involved in SOB induction and homologous recombination.

  4. The biofilm-specific antibiotic resistance gene ndvB is important for expression of ethanol oxidation genes in Pseudomonas aeruginosa biofilms.

    Science.gov (United States)

    Beaudoin, Trevor; Zhang, Li; Hinz, Aaron J; Parr, Christopher J; Mah, Thien-Fah

    2012-06-01

    Bacteria growing in biofilms are responsible for a large number of persistent infections and are often more resistant to antibiotics than are free-floating bacteria. In a previous study, we identified a Pseudomonas aeruginosa gene, ndvB, which is important for the formation of periplasmic glucans. We established that these glucans function in biofilm-specific antibiotic resistance by sequestering antibiotic molecules away from their cellular targets. In this study, we investigate another function of ndvB in biofilm-specific antibiotic resistance. DNA microarray analysis identified 24 genes that were responsive to the presence of ndvB. A subset of 20 genes, including 8 ethanol oxidation genes (ercS', erbR, exaA, exaB, eraR, pqqB, pqqC, and pqqE), was highly expressed in wild-type biofilm cells but not in ΔndvB biofilms, while 4 genes displayed the reciprocal expression pattern. Using quantitative real-time PCR, we confirmed the ndvB-dependent expression of the ethanol oxidation genes and additionally demonstrated that these genes were more highly expressed in biofilms than in planktonic cultures. Expression of erbR in ΔndvB biofilms was restored after the treatment of the biofilm with periplasmic extracts derived from wild-type biofilm cells. Inactivation of ethanol oxidation genes increased the sensitivity of biofilms to tobramycin. Together, these results reveal that ndvB affects the expression of multiple genes in biofilms and that ethanol oxidation genes are linked to biofilm-specific antibiotic resistance.

  5. Designer genes. Recombinant antibody fragments for biological imaging

    Energy Technology Data Exchange (ETDEWEB)

    Wu, A.M.; Yazaki, P.J. [Beckman Research Institute of the City of Hope, Duarte, CA (United States). Dept. of Molecular Biology

    2000-09-01

    Monoclonal antibodies (MAbs), with high specificity and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C{sub H}3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering

  6. Designer genes. Recombinant antibody fragments for biological imaging

    International Nuclear Information System (INIS)

    Wu, A.M.; Yazaki, P.J.

    2000-01-01

    Monoclonal antibodies (MAbs), with high specificy and high affinity for their target antigens, can be utilized for delivery of agents such as radionuclides, enzymes, drugs or toxins in vivo. However, the implementation of radiolabeled antibodies as magic bullets for detection and treatment of diseases such as cancer has required addressing several shortcomings of murine MAbs. These include their immunogenicity, sub-optimal targeting and pharmacokinetic properties, and practical issues of production and radiolabeling. Genetic engineering provides a powerful approach for redesigning antibodies for use in oncologic applications in vivo. Recombinant fragments have been produced that retain high affinity for target antigens, and display a combination of rapid, high-level tumor targeting with concomitant clearance from normal tissues and the circulation in animal models. An important first step was cloning and engineering of antibody heavy and light chain variable domains into single-chain Fvs (molecular weight, 25-17 kDa), in which the variable regions are joined via a synthetic linker peptide sequence. Although scFvs themselves showed limited tumor uptake in preclinical and clinical studies, they provide a useful building block for intermediate sized recombinant fragments. Covalently linked dimers or non-covalent dimers of scFvs (also known as diabodies) show improved targeting and clearance properties due to their higher molecular weight (55kDa) and increased avidity. Further gains can be made by generation of larger recombinant fragments, such as the minibody, an scFv-C H 3 fusion protein that self-assembles into a bivalent dimer of 80 kDa. A systematic evaluation of scFv, diabody, minibody, and intact antibody (based on comparison of tumor uptakes, tumor: blood activity ratios, and calculation of an Imaging Figure of Merit) can form the basis for selection of combinations of recombinant fragments and radionuclides for imaging applications. Ease of engineering and

  7. Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB

    DEFF Research Database (Denmark)

    Guardabassi, L.; Christensen, H.; Hasman, Henrik

    2004-01-01

    Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related...

  8. DNA polymorphism of HLA class II genes in primary biliary cirrhosis

    DEFF Research Database (Denmark)

    Morling, Niels; Dalhoff, K; Fugger, L

    1992-01-01

    We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary...... than 0.05, 'corrected' P greater than 0.05). No DNA fragments specific for DRB1*0301 (DR3) could be identified. The frequencies in PBC of other genetic markers including DRw8, DRB1*08, HLA-DP antigens, DPA, and DPB genes did not differ significantly from those in controls. The associations between PBC...

  9. SINGLE CHAIN VARIABLE FRAGMENTS OF ANTIBODIES AGAINST DIPHTHERIA TOXIN B-SUBUNIT ISOLATED FROM PHAGE DISPLAY HUMAN ANTIBODY LIBRARY

    Directory of Open Access Journals (Sweden)

    Oliinyk O. S.

    2014-02-01

    Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.

  10. Purification and crystallization of Vibrio fischeri CcdB and its complexes with fragments of gyrase and CcdA

    International Nuclear Information System (INIS)

    De Jonge, Natalie; Buts, Lieven; Vangelooven, Joris; Mine, Natacha; Van Melderen, Laurence; Wyns, Lode; Loris, Remy

    2007-01-01

    A CcdB homologue from V. fischeri was overexpressed in E. coli and purified. The free protein was crystallized, as were its complexes with fragments of E. coli and V. fischeri gyrase and with the F-plasmid CcdA C-terminal domain. The ccd toxin–antitoxin module from the Escherichia coli F plasmid has a homologue on the Vibrio fischeri integron. The homologue of the toxin (CcdB Vfi ) was crystallized in two different crystal forms. The first form belongs to space group I23 or I2 1 3, with unit-cell parameter a = 84.5 Å, and diffracts to 1.5 Å resolution. The second crystal form belongs to space group C2, with unit-cell parameters a = 58.5, b = 43.6, c = 37.5 Å, β = 110.0°, and diffracts to 1.7 Å resolution. The complex of CcdB Vfi with the GyrA14 Vfi fragment of V. fischeri gyrase crystallizes in space group P2 1 2 1 2 1 , with unit-cell parameters a = 53.5, b = 94.6, c = 58.1 Å, and diffracts to 2.2 Å resolution. The corresponding mixed complex with E. coli GyrA14 Ec crystallizes in space group C2, with unit-cell parameters a = 130.1, b = 90.8, c = 58.1 Å, β = 102.6°, and diffracts to 1.95 Å. Finally, a complex between CcdB Vfi and part of the F-plasmid antitoxin CcdA F crystallizes in space group P2 1 2 1 2 1 , with unit-cell parameters a = 46.9, b = 62.6, c = 82.0 Å, and diffracts to 1.9 Å resolution

  11. Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

    Science.gov (United States)

    Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

    2018-03-01

    β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

  12. Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

    Science.gov (United States)

    Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S

    1999-09-01

    Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.

  13. Roles of bHLH genes in neural stem cell differentiation

    International Nuclear Information System (INIS)

    Kageyama, Ryoichiro; Ohtsuka, Toshiyuki; Hatakeyama, Jun; Ohsawa, Ryosuke

    2005-01-01

    Neural stem cells change their characteristics over time during development: they initially proliferate only and then give rise to neurons first and glial cells later. In the absence of the repressor-type basic helix-loop-helix (bHLH) genes Hes1, Hes3 and Hes5, neural stem cells do not proliferate sufficiently but prematurely differentiate into neurons and become depleted without making the later born cell types such as astrocytes and ependymal cells. Thus, Hes genes are essential for maintenance of neural stem cells to make cells not only in correct numbers but also in full diversity. Hes genes antagonize the activator-type bHLH genes, which include Mash1, Math and Neurogenin. The activator-type bHLH genes promote the neuronal fate determination and induce expression of Notch ligands such as Delta. These ligands activate Notch signaling and upregulate Hes1 and Hes5 expression in neighboring cells, thereby maintaining these cells undifferentiated. Thus, the activator-type and repressor-type bHLH genes regulate each other, allowing only subsets of cells to undergo differentiation while keeping others to stay neural stem cells. This regulation is essential for generation of complex brain structures of appropriate size, shape and cell arrangement

  14. Heavy quark fragmentation functions in the heavy quark effective theory

    International Nuclear Information System (INIS)

    Martynenko, A.P.; Saleev, V.A.

    1996-01-01

    The fragmentation of b-bar-antiquark into polarized B c * -mesons and b-quark into P-wave (c-bar b) states in the Heavy Quark Effective Theory. The heavy quark fragmentation functions in longitudinally and transversely polarized S-wave b-bar c-states and P-wave mesons containing b-, c-quarks also, with the exact account of corrections of first order in 1/m b . 20 refs., 2 figs

  15. Stabilization of apoglobin by low temperature increases yield of soluble recombinant hemoglobin in Escherichia coli.

    Science.gov (United States)

    Weickert, M J; Pagratis, M; Curry, S R; Blackmore, R

    1997-01-01

    Accumulation of soluble recombinant hemoglobin (rHb1.1) in Escherichia coli requires proper protein folding, prosthetic group (heme) addition, and subunit assembly. This served as a new model system for the study of the effects of temperature, protein synthesis rates, and protein accumulation rates on protein solubility in E. coli. Fermentation expression of rHb1.1 at 30 degrees C from cultures containing a medium or high globin gene dosage (pBR-based or pUC-based plasmids with rHb1.1 genes under the control of the tac promoter) was compared. A medium gene dosage resulted in rHb1.1 accumulating to approximately 7% of the soluble cell protein, of which 78% was soluble. A high globin gene dosage resulted in a > or = 3-fold increase in total globin to 23 to 24% of the soluble cell protein, but 70% was insoluble. Accumulation of insoluble rHb1.1 began immediately upon induction. The proportion of rHb1.1 from the high globin gene dosage that accumulated as insoluble globin was affected by reducing (i) the inducer concentration and (ii) the temperature. Reducing the inducer concentration reduced globin synthesis up to eightfold but increased the proportion of soluble rHb1.1 to 93%. In contrast, total globin protein synthesis was barely affected by reducing the temperature from 30 to 26 degrees C, while soluble globin accumulation increased > 2-fold to approximately 15% of the soluble cell protein. The contrast between the effects of reducing rates of protein synthesis and accumulation and those of reducing temperature suggests that lower temperature stabilizes one or more folding intermediates. We propose a simplified physical model which integrates protein synthesis, folding, and heme association. This model shows that temperature-dependent apoglobin stability is the most critical factor in soluble rHb1.1 accumulation. PMID:9361418

  16. Isolation and expression of recombinant antibody fragments to the biological warfare pathogen Brucella melitensis.

    Science.gov (United States)

    Hayhurst, Andrew; Happe, Scott; Mabry, Robert; Koch, Zephyr; Iverson, Brent L; Georgiou, George

    2003-05-01

    Brucella melitensis is a highly infectious animal pathogen able to cause a recurring debilitating disease in humans and is therefore high on the list of biological warfare agents. Immunoglobulin genes from mice immunized with gamma-irradiated B. melitensis strain 16M were used to construct a library that was screened by phage display against similarly prepared bacteria. The selected phage particles afforded a strong enzyme-linked immunosorbent assay (ELISA) signal against gamma-irradiated B. melitensis cells. However, extensive efforts to express the respective single chain antibody variable region fragment (scFv) in soluble form failed due to: (i) poor solubility and (ii) in vivo degradation of the c-myc tag used for the detection of the recombinant antibodies. Both problems could be addressed by: (i) fusing a human kappa light chain constant domain (Ck) chain to the scFv to generate single chain antibody fragment (scAb) antibody fragments and (ii) by co-expression of the periplasmic chaperone Skp. While soluble, functional antibodies could be produced in this manner, phage-displaying scFvs or scAbs were still found to be superior ELISA reagents for immunoassays, due to the large signal amplification afforded by anti-phage antibodies. The isolated phage antibodies were shown to be highly specific to B. melitensis and did not recognize Yersinia pseudotuberculosis in contrast to the existing diagnostic monoclonal YST 9.2.1.

  17. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

    Science.gov (United States)

    Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

    2006-10-01

    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

  18. Heavy-quark fragmentation functions in the effective theory of heavy quarks

    International Nuclear Information System (INIS)

    Martynenko, A.P.; Saleev, V.A.

    1996-01-01

    The effective theory of heavy quarks is used to study b-bar-antiquark fragmentation in polarized Bc* mesons and b-quark fragmentation into P-wave (c-barb) states. The functions of heavy-quark fragmentation into longitudinally and transversely polarized S-wave (b-barc) states and into P-wave mesons containing b and c quarks are calculated. First-order corrections in 1/mb are taken into account exactly in these calculations. The results are shown to be consistent with the corresponding QCD calculations

  19. Neonatal Gene Therapy for Hemophilia B by a Novel Adenovirus Vector Showing Reduced Leaky Expression of Viral Genes.

    Science.gov (United States)

    Iizuka, Shunsuke; Sakurai, Fuminori; Tachibana, Masashi; Ohashi, Kazuo; Mizuguchi, Hiroyuki

    2017-09-15

    Gene therapy during neonatal and infant stages is a promising approach for hemophilia B, a congenital disorder caused by deficiency of blood coagulation factor IX (FIX). An adenovirus (Ad) vector has high potential for use in neonatal or infant gene therapy for hemophilia B due to its superior transduction properties; however, leaky expression of Ad genes often reduces the transduction efficiencies by Ad protein-mediated tissue damage. Here, we used a novel Ad vector, Ad-E4-122aT, which exhibits a reduction in the leaky expression of Ad genes in liver, in gene therapy studies for neonatal hemophilia B mice. Ad-E4-122aT exhibited significantly higher transduction efficiencies than a conventional Ad vector in neonatal mice. In neonatal hemophilia B mice, a single neonatal injection of Ad-E4-122aT expressing human FIX (hFIX) (Ad-E4-122aT-AHAFIX) maintained more than 6% of the normal plasma hFIX activity levels for approximately 100 days. Sequential administration of Ad-E4-122aT-AHAFIX resulted in more than 100% of the plasma hFIX activity levels for more than 100 days and rescued the bleeding phenotypes of hemophilia B mice. In addition, immunotolerance to hFIX was induced by Ad-E4-122aT-AHAFIX administration in neonatal hemophilia B mice. These results indicated that Ad-E4-122aT is a promising gene delivery vector for neonatal or infant gene therapy for hemophilia B.

  20. A novel ion-beam-mutation effect application in identification of gene involved in bacterial antagonism to fungal infection of ornamental crops

    Science.gov (United States)

    Mahadtanapuk, S.; Teraarusiri, W.; Nanakorn, W.; Yu, L. D.; Thongkumkoon, P.; Anuntalabhochai, S.

    2014-05-01

    This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection.

  1. Purification and crystallization of Vibrio fischeri CcdB and its complexes with fragments of gyrase and CcdA

    Energy Technology Data Exchange (ETDEWEB)

    De Jonge, Natalie, E-mail: ndejonge@vub.ac.be; Buts, Lieven; Vangelooven, Joris [Department of Molecular and Cellular Interactions, VIB, Pleinlaan 2, 1050 Brussels (Belgium); Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussels (Belgium); Mine, Natacha; Van Melderen, Laurence [Laboratoire de Génétique des Procaryotes, Institut de Biologie et de Médecine, Université Libre de Bruxelles, Gosselies (Belgium); Wyns, Lode; Loris, Remy [Department of Molecular and Cellular Interactions, VIB, Pleinlaan 2, 1050 Brussels (Belgium); Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel, Pleinlaan 2, 1050 Brussels (Belgium)

    2007-04-01

    A CcdB homologue from V. fischeri was overexpressed in E. coli and purified. The free protein was crystallized, as were its complexes with fragments of E. coli and V. fischeri gyrase and with the F-plasmid CcdA C-terminal domain. The ccd toxin–antitoxin module from the Escherichia coli F plasmid has a homologue on the Vibrio fischeri integron. The homologue of the toxin (CcdB{sub Vfi}) was crystallized in two different crystal forms. The first form belongs to space group I23 or I2{sub 1}3, with unit-cell parameter a = 84.5 Å, and diffracts to 1.5 Å resolution. The second crystal form belongs to space group C2, with unit-cell parameters a = 58.5, b = 43.6, c = 37.5 Å, β = 110.0°, and diffracts to 1.7 Å resolution. The complex of CcdB{sub Vfi} with the GyrA14{sub Vfi} fragment of V. fischeri gyrase crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.5, b = 94.6, c = 58.1 Å, and diffracts to 2.2 Å resolution. The corresponding mixed complex with E. coli GyrA14{sub Ec} crystallizes in space group C2, with unit-cell parameters a = 130.1, b = 90.8, c = 58.1 Å, β = 102.6°, and diffracts to 1.95 Å. Finally, a complex between CcdB{sub Vfi} and part of the F-plasmid antitoxin CcdA{sub F} crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 46.9, b = 62.6, c = 82.0 Å, and diffracts to 1.9 Å resolution.

  2. Frequent gain and loss of introns in fungal cytochrome b genes.

    Directory of Open Access Journals (Sweden)

    Liang-Fen Yin

    Full Text Available In this study, all available cytochrome b (Cyt b genes from the GOBASE database were compiled and the evolutionary dynamics of the Cyt b gene introns was assessed. Cyt b gene introns were frequently present in the fungal kingdom and some lower plants, but generally absent or rare in Chromista, Protozoa, and Animalia. Fungal Cyt b introns were found at 35 positions in Cyt b genes and the number of introns varied at individual positions from a single representative to 32 different introns at position 131, showing a wide and patchy distribution. Many homologous introns were present at the same position in distantly related species but absent in closely related species, suggesting that introns of the Cyt b genes were frequently lost. On the other hand, highly similar intron sequences were observed in some distantly related species rather than in closely related species, suggesting that these introns were gained independently, likely through lateral transfers. The intron loss-and-gain events could be mediated by transpositions that might have occurred between nuclear and mitochondria. Southern hybridization analysis confirmed that some introns contained repetitive sequences and might be transposable elements. An intron gain in Botryotinia fuckeliana prevented the development of QoI fungicide resistance, suggesting that intron loss-and-gain events were not necessarily beneficial to their host organisms.

  3. Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

    Science.gov (United States)

    Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

    2010-01-01

    Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

  4. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    Energy Technology Data Exchange (ETDEWEB)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-11-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

  5. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    International Nuclear Information System (INIS)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-01-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

  6. Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease.

    Science.gov (United States)

    Akinbami, Anthony O; Campbell, Andrew D; Han, Zeqiu J; Luo, Hong-Yuan; Chui, David H K; Steinberg, Martin H

    2016-01-01

    Hereditary persistence of fetal hemoglobin (HPFH) can be caused by point mutations in the γ-globin gene promoters. We report three rare cases: a child compound heterozygous for Hb S (HBB: c.20A > T) and HPFH with a novel point mutation in the (A)γ-globin gene promoter who had 42.0% Hb S, 17.0% Hb A and 38.0% Hb F; a man with Hb SC (HBB: c.19G > A) disease and a point mutation in the (G)γ-globin gene promoter who had 54.0% Hb S, 18.0% Hb C and 25.0% Hb F; a child heterozygous for Hb S and HPFH due to mutations in both the (A)γ- and (G)γ-globin gene promoters in cis [(G)γ(A)γ(β(+)) HPFH], with 67.0% Hb A, 6.5% Hb S and 25.0% Hb F.

  7. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    Jane

    2011-10-05

    Oct 5, 2011 ... the successful construction of a recombinant yeast expression vector containing gene coding L protein and Ag85B ..... the production of memory T cells, promote cytokine secretion and ... Dual DNA vaccination of rainbow trout.

  8. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  9. Detection of genes regulated by Lmx1b during limb dorsalization.

    Science.gov (United States)

    Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

    2012-05-01

    Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. © 2012 The Authors. Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  10. Genome-wide identification and characterization of the bHLH gene family in tomato.

    Science.gov (United States)

    Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing

    2015-01-22

    The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis

  11. Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

    Directory of Open Access Journals (Sweden)

    Ki Young Yoo

    2010-03-01

    Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

  12. A Family with γ-Thalassemia and High Hb A2 Levels.

    Science.gov (United States)

    Parmeggiani, Giulia; Gualandi, Francesca; Selvatici, Rita; Rimessi, Paola; Bigoni, Stefania; Taddei Masieri, Marina; Dolcini, Bernadetta; Venturoli, Anna; Cappabianca, Maria P; Ferlini, Alessandra; Ravani, Anna

    2016-06-01

    We describe a family carrying a γ-globin gene deletion associated with an increase of Hb A2 level beyond the normal range. The family included the proband, his sister and their father, all with increased Hb A2 and normal Hb F levels. The proband and his sister showed borderline values of mean corpuscular volume (MCV) and reduced values of mean corpuscular hemoglobin (Hb) (MCH). The proband was referred to our Medical Genetics Service for preconception counseling together with his partner, a typical β-thalassemia (β-thal) carrier. The results were negative for the most frequent α-thalassemia (α-thal) mutations, and had no significant sequence variations of the coding sequences and promoter of the β- and δ-globin genes. Quantitative analysis by multiplex ligation-dependent probe amplification (MPLA) of the β-globin gene cluster detected a heterozygous deletion, ranging between 2.1 and 4.7 kb, in the proband, his sister and the father. The deletion involved the (G)γ gene and (G)γ-(A)γ intergenic region, whereas the 3' region of the (A)γ gene was preserved. A subsequent gap-polymerase chain reaction (gap-PCR) showed that a hybrid (GA)γ fusion gene was present. The deletion segregated with the elevation of Hb A2. The MLPA analysis of the β-globin gene cluster in 150 control alleles excluded a common polymorphism. Despite stronger evidence being needed, the described family suggests a possible role of this γ-globin gene deletion in contributing to Hb A2 elevation, possibly by altering the transcription regulation of the cluster. We propose γ-globin gene dosage analysis to be performed in patients with unexplained elevated Hb A2 levels.

  13. Gene structure, expression, and DNA methylation characteristics of sea cucumber cyclin B gene during aestivation.

    Science.gov (United States)

    Zhu, Aijun; Chen, Muyan; Zhang, Xiumei; Storey, Kenneth B

    2016-12-05

    The sea cucumber, Apostichopus japonicus, is a good model for studying environmentally-induced aestivation by a marine invertebrate. One of the central requirements of aestivation is the repression of energy-expensive cellular processes such as cell cycle progression. The present study identified the gene structure of the cell cycle regulator, cyclin B, and detected the expression levels of this gene over three stages of the annual aestivation-arousal cycle. Furthermore, the DNA methylation characteristics of cyclin B were analyzed in non-aestivation and deep-aestivation stages of sea cucumbers. We found that the cyclin B promoter contains a CpG island, three CCAAT-boxes and three cell cycle gene homology regions (CHRs). Application of qRT-PCR analysis showed significant downregulation of cyclin B transcript levels during deep-aestivation in comparison with non-aestivation in both intestine and longitudinal muscle, and these returned to basal levels after arousal from aestivation. Methylation analysis of the cyclin B core promoter revealed that its methylation level showed significant differences between non-aestivation and deep-aestivation stages (p<0.05) and interestingly, a positive correlation between Cyclin B transcripts expression and methylation levels of the core promoter was also observed. Our findings suggest that cell cycle progression may be reversibly arrested during aestivation as indicated by the changes in cyclin B expression levels and we propose that DNA methylation is one of the regulatory mechanisms involved in cyclin B transcriptional variation. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Gene expression profiles in BCL11B-siRNA treated malignant T cells

    Directory of Open Access Journals (Sweden)

    Grabarczyk Piotr

    2011-05-01

    Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.

  15. Rrp1b, a new candidate susceptibility gene for breast cancer progression and metastasis.

    Directory of Open Access Journals (Sweden)

    Nigel P S Crawford

    2007-11-01

    Full Text Available A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b, was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis.

  16. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella

    NARCIS (Netherlands)

    Garcia-Fernandez, A.; Fortini, D.; Veldman, K.T.; Mevius, D.J.; Carattoli, A.

    2009-01-01

    The aim of this study was to identify and characterize plasmids carrying qnrS1, qnrB2 and qnrB19 genes identified in Salmonella strains from The Netherlands. The identification of plasmids may help to follow the dissemination of these resistance genes in different countries and environments.

  17. In silico identification of NF-kappaB-regulated genes in pancreatic beta-cells

    Directory of Open Access Journals (Sweden)

    Eizirik Decio L

    2007-02-01

    Full Text Available Abstract Background Pancreatic beta-cells are the target of an autoimmune attack in type 1 diabetes mellitus (T1DM. This is mediated in part by cytokines, such as interleukin (IL-1β and interferon (IFN-γ. These cytokines modify the expression of hundreds of genes, leading to beta-cell dysfunction and death by apoptosis. Several of these cytokine-induced genes are potentially regulated by the IL-1β-activated transcription factor (TF nuclear factor (NF-κB, and previous studies by our group have shown that cytokine-induced NF-κB activation is pro-apoptotic in beta-cells. To identify NF-κB-regulated gene networks in beta-cells we presently used a discriminant analysis-based approach to predict NF-κB responding genes on the basis of putative regulatory elements. Results The performance of linear and quadratic discriminant analysis (LDA, QDA in identifying NF-κB-responding genes was examined on a dataset of 240 positive and negative examples of NF-κB regulation, using stratified cross-validation with an internal leave-one-out cross-validation (LOOCV loop for automated feature selection and noise reduction. LDA performed slightly better than QDA, achieving 61% sensitivity, 91% specificity and 87% positive predictive value, and allowing the identification of 231, 251 and 580 NF-κB putative target genes in insulin-producing INS-1E cells, primary rat beta-cells and human pancreatic islets, respectively. Predicted NF-κB targets had a significant enrichment in genes regulated by cytokines (IL-1β or IL-1β + IFN-γ and double stranded RNA (dsRNA, as compared to genes not regulated by these NF-κB-dependent stimuli. We increased the confidence of the predictions by selecting only evolutionary stable genes, i.e. genes with homologs predicted as NF-κB targets in rat, mouse, human and chimpanzee. Conclusion The present in silico analysis allowed us to identify novel regulatory targets of NF-κB using a supervised classification method based on

  18. PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates

    Directory of Open Access Journals (Sweden)

    Zohreh Ebrahimvandi

    2014-07-01

    Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A total of 30 Salmonella isolates were serotyped by specific antisera. For the PCR-RFLP method based on the fliC gene, extracted DNA was used as the template for amplifying the fliC gene (1500 bp using specific primers. PCR products were subjected to digestion using HhaI restriction endonuclease. Results: This study determined 30 serotypes as Salmonella durban (56.6%, Salmonella uno (23.3%, Salmonella enteritidis (3.3%, Salmonella tinda (3.3%, Salmonella mjimweme (3.3%, Salmonella Thompson (3.3%, Salmonella sIIO8 (3.3 % and Salmonella sIIO7 (3.3%. Observations indicated that HhaI is able to discriminate Salmonella tinda and Salmonella thompson, yet Salmonella enteritidis, Salmonella durban and Salmonella mjimweme had the same pattern with this enzyme. Also Salmonella sIIO8, Salmonella sIIO7 and Salmonella uno showed the same pattern. Thus, regarding the size and the number of resulting fragments from this enzyme, four patterns were obtained for HhaI. Conclusion: A large number of Salmonella serotypes need to be analyzed by the PCR-RFLP method and different enzymes must be used to give reliable results.

  19. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  20. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

    NARCIS (Netherlands)

    Coolen, MJL; Post, E; Davis, CC; Forney, LJ

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

  1. Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

    Science.gov (United States)

    Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2013-05-01

    In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

  2. Candidate luminal B breast cancer genes identified by genome, gene expression and DNA methylation profiling.

    Directory of Open Access Journals (Sweden)

    Stéphanie Cornen

    Full Text Available Breast cancers (BCs of the luminal B subtype are estrogen receptor-positive (ER+, highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs, DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15 and UTRN (6q24, were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype.

  3. Two siblings with immunodeficiency, facial abnormalities and chromosomal instability without mutation in DNMT3B gene but liability towards malignancy; a new chromatin disorder delineation?

    Science.gov (United States)

    Polityko, Anna; Khurs, Olga; Rumyantseva, Natalia; Naumchik, Irina; Kosyakova, Nadezda; Tönnies, Holger; Sperling, Karl; Neitzel, Heidemarie; Weise, Anja; Liehr, Thomas

    2010-03-08

    ICF syndrome (standing for Immunodeficiency, Centromere instability and Facial anomalies syndrome) is a very rare autosomal recessive immune disorder caused by mutations of the gene de novo DNA-methyltransferase 3B (DNMT3B). However, in the literature similar clinical cases without such mutations are reported, as well. We report on a family in which the unrelated spouses had two female siblings sharing similar phenotypic features resembling ICF-syndrome, i.e. congenital abnormalities, immunodeficiency, developmental delay and high level of chromosomal instability, including high frequency of centromeric/pericentromeric rearrangements and breaks, chromosomal fragments despiralization or pulverization. However, mutations in DNMT3B could not be detected. The discovery of a new so-called 'chromatin disorder' is suggested. Clinical, molecular genetic and cytogenetic characteristics are reported and compared to other 'chromatin disorders'.

  4. Targeting human prostate cancer with 111In-labeled D2B IgG, F(ab')2 and Fab fragments in nude mice with PSMA-expressing xenografts.

    Science.gov (United States)

    Lütje, Susanne; van Rij, Catharina M; Franssen, Gerben M; Fracasso, Giulio; Helfrich, Wijnand; Eek, Annemarie; Oyen, Wim J; Colombatti, Marco; Boerman, Otto C

    2015-01-01

    D2B is a new monoclonal antibody directed against an extracellular domain of prostate-specific membrane antigen (PSMA), which is overexpressed in prostate cancer. The potential of D2B IgG, and F(ab')2 and Fab fragments of this antibody for targeting prostate cancer was determined in mice bearing subcutaneous prostate cancer xenografts. The optimal time point for imaging was determined in biodistribution and microSPECT imaging studies with (111)In-D2B IgG, (111)In-capromab pendetide, (111)In-D2B F(ab')2 and (111)In-D2B Fab fragments in mice with PSMA-expressing LNCaP and PSMA-negative PC3 tumors at several time points after injection. All (111)In-labeled antibody formats specifically accumulated in the LNCaP tumors, with highest uptake of (111)In-D2B IgG and (111)In-capromab pendetide at 168 h p.i. (94.8 ± 19.2% injected dose per gram (ID/g) and 16.7 ± 2.2% ID/g, respectively), whereas uptake of (111)In-D2B F(ab')2 and (111)In-D2B Fab fragments peaked at 24 h p.i. (12.1 ± 3.0% ID/g and 15.1 ± 2.9% ID/g, respectively). Maximum LNCaP tumor-to-blood ratios were 13.0 ± 2.3 (168 h p.i.), 6.2 ± 0.7 (24 h p.i.), 23.0 ± 4.0 (24 h p.i.) and 4.5 ± 0.6 (168 h p.i.) for (111)In-D2B IgG, (111)In-F(ab')2, (111)In-Fab and (111)In-capromab pendetide, respectively. LNCaP tumors were clearly visualized with microSPECT with all antibody formats. This study demonstrates the feasibility of D2B IgG, F(ab')2 and Fab fragments for targeting PSMA-expressing prostate cancer xenografts. Copyright © 2014 John Wiley & Sons, Ltd.

  5. Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

    Energy Technology Data Exchange (ETDEWEB)

    Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id; Prima, Alex, E-mail: sony@sith.itb.ac.id; Komalawati, Eli, E-mail: sony@sith.itb.ac.id; Kristianti, Tati, E-mail: sony@sith.itb.ac.id

    2014-03-24

    Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5α. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNA sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.

  6. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  7. A novel ion-beam-mutation effect application in identification of gene involved in bacterial antagonism to fungal infection of ornamental crops

    Energy Technology Data Exchange (ETDEWEB)

    Mahadtanapuk, S. [Faculty of Agriculture and Natural Resources, University of Phayao, Maeka, Muang, Phayao 56000 (Thailand); Teraarusiri, W. [Central Laboratory, University of Phayao, Maeka, Muang, Phayao 56000 (Thailand); Nanakorn, W. [The Crown Property Bureau, 173 Nakhonratchasrima Road, Dusit, Bangkok 10300 (Thailand); Yu, L.D., E-mail: yuld@thep-center.org [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Thongkumkoon, P. [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Anuntalabhochai, S., E-mail: soanu.1@gmail.com [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand)

    2014-05-01

    Highlights: • Ion beam bombardment induced mutation in bacterial B. licheniformis. • A mutant lost antifungal activity. • DNA fingerprint of the mutant was analyzed. • The lost gene was indentified to code for TrxR gene. • TrxR gene from B. licheniformis expressed the flower antagonism to fungi. - Abstract: This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection.

  8. A novel ion-beam-mutation effect application in identification of gene involved in bacterial antagonism to fungal infection of ornamental crops

    International Nuclear Information System (INIS)

    Mahadtanapuk, S.; Teraarusiri, W.; Nanakorn, W.; Yu, L.D.; Thongkumkoon, P.; Anuntalabhochai, S.

    2014-01-01

    Highlights: • Ion beam bombardment induced mutation in bacterial B. licheniformis. • A mutant lost antifungal activity. • DNA fingerprint of the mutant was analyzed. • The lost gene was indentified to code for TrxR gene. • TrxR gene from B. licheniformis expressed the flower antagonism to fungi. - Abstract: This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection

  9. A new social gene in Dictyostelium discoideum, chtB

    Directory of Open Access Journals (Sweden)

    Santorelli Lorenzo A

    2013-01-01

    Full Text Available Abstract Background Competitive social interactions are ubiquitous in nature, but their genetic basis is difficult to determine. Much can be learned from single gene knockouts in a eukaryote microbe. The mutants can be competed with the parent to discern the social impact of that specific gene. Dictyostelium discoideum is a social amoeba that exhibits cooperative behavior in the construction of a multicellular fruiting body. It is a good model organism to study the genetic basis of cooperation since it has a sequenced genome and it is amenable to genetic manipulation. When two strains of D. discoideum are mixed, a cheater strain can exploit its social partner by differentiating more spore than its fair share relative to stalk cells. Cheater strains can be generated in the lab or found in the wild and genetic analyses have shown that cheating behavior can be achieved through many pathways. Results We have characterized the knockout mutant chtB, which was isolated from a screen for cheater mutants that were also able to form normal fruiting bodies on their own. When mixed in equal proportions with parental strain cells, chtB mutants contributed almost 60% of the total number of spores. To do so, chtB cells inhibit wild type cells from becoming spores, as indicated by counts and by the wild type cells’ reduced expression of the prespore gene, cotB. We found no obvious fitness costs (morphology, doubling time in liquid medium, spore production, and germination efficiency associated with the cheating ability of the chtB knockout. Conclusions In this study we describe a new gene in D. discoideum, chtB, which when knocked out inhibits the parental strain from producing spores. Moreover, under lab conditions, we did not detect any fitness costs associated with this behavior.

  10. Polygalacturonase gene pgxB in Aspergillus niger is a virulence factor in apple fruit.

    Science.gov (United States)

    Liu, Cheng-Qian; Hu, Kang-Di; Li, Ting-Ting; Yang, Ying; Yang, Feng; Li, Yan-Hong; Liu, He-Ping; Chen, Xiao-Yan; Zhang, Hua

    2017-01-01

    Aspergillus niger, a saprophytic fungus, is widely distributed in soil, air and cereals, and can cause postharvest diseases in fruit. Polygalacturonase (PG) is one of the main enzymes in fungal pathogens to degrade plant cell wall. To evaluate whether the deletion of an exo-polygalacturonase gene pgxB would influence fungal pathogenicity to fruit, pgxB gene was deleted in Aspergillus niger MA 70.15 (wild type) via homologous recombination. The ΔpgxB mutant showed similar growth behavior compared with the wild type. Pectin medium induced significant higher expression of all pectinase genes in both wild type and ΔpgxB in comparison to potato dextrose agar medium. However, the ΔpgxB mutant was less virulent on apple fruits as the necrosis diameter caused by ΔpgxB mutant was significantly smaller than that of wild type. Results of quantitive-PCR showed that, in the process of infection in apple fruit, gene expressions of polygalacturonase genes pgaI, pgaII, pgaA, pgaC, pgaD and pgaE were enhanced in ΔpgxB mutant in comparison to wild type. These results prove that, despite the increased gene expression of other polygalacturonase genes in ΔpgxB mutant, the lack of pgxB gene significantly reduced the virulence of A. niger on apple fruit, suggesting that pgxB plays an important role in the infection process on the apple fruit.

  11. Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes.

    Science.gov (United States)

    Ranade, Sonali Sachin; García-Gil, María Rosario; Rosselló, Josep A

    2016-04-01

    Many genes have been lost from the prokaryote plastidial genome during the early events of endosymbiosis in eukaryotes. Some of them were definitively lost, but others were relocated and functionally integrated to the host nuclear genomes through serial events of gene transfer during plant evolution. In gymnosperms, plastid genome sequencing has revealed the loss of ndh genes from several species of Gnetales and Pinaceae, including Norway spruce (Picea abies). This study aims to trace the ndh genes in the nuclear and organellar Norway spruce genomes. The plastid genomes of higher plants contain 11 ndh genes which are homologues of mitochondrial genes encoding subunits of the proton-pumping NADH-dehydrogenase (nicotinamide adenine dinucleotide dehydrogenase) or complex I (electron transport chain). Ndh genes encode 11 NDH polypeptides forming the Ndh complex (analogous to complex I) which seems to be primarily involved in chloro-respiration processes. We considered ndh genes from the plastidial genome of four gymnosperms (Cryptomeria japonica, Cycas revoluta, Ginkgo biloba, Podocarpus totara) and a single angiosperm species (Arabidopsis thaliana) to trace putative homologs in the nuclear and organellar Norway spruce genomes using tBLASTn to assess the evolutionary fate of ndh genes in Norway spruce and to address their genomic location(s), structure, integrity and functionality. The results obtained from tBLASTn were subsequently analyzed by performing homology search for finding ndh specific conserved domains using conserved domain search. We report the presence of non-functional plastid ndh gene fragments, excepting ndhE and ndhG genes, in the nuclear genome of Norway spruce. Regulatory transcriptional elements like promoters, TATA boxes and enhancers were detected in the upstream regions of some ndh fragments. We also found transposable elements in the flanking regions of few ndh fragments suggesting nuclear rearrangements in those regions. These evidences

  12. Class B Gene Expression and the Modified ABC Model in Nongrass Monocots

    Directory of Open Access Journals (Sweden)

    Akira Kanno

    2007-01-01

    Full Text Available The discovery of the MADS-box genes and the study of model plants such as Arabidopsis thaliana and Antirrhinum majus have greatly improved our understanding of the molecular mechanisms driving the diversity in floral development. The class B genes, which belong to the MADS-box gene family, are important regulators of the development of petals and stamens in flowering plants. Many nongrass monocot flowers have two whorls of petaloid organs, which are called tepals. To explain this floral morphology, the modified ABC model was proposed. This model was exemplified by the tulip, in which expansion and restriction of class B gene expression is linked to the transition of floral morphologies in whorl 1. The expression patterns of class B genes from many monocot species nicely fit this model; however, those from some species, such as asparagus, do not. In this review, we summarize the relationship between class B gene expression and floral morphology in nongrass monocots, such as Liliales (Liliaceae and Asparagales species, and discuss the applicability of the modified ABC model to monocot flowers.

  13. Expression of a truncated Hmga1b gene induces gigantism, lipomatosis and B-cell lymphomas in mice.

    Science.gov (United States)

    Fedele, Monica; Visone, Rosa; De Martino, Ivana; Palmieri, Dario; Valentino, Teresa; Esposito, Francesco; Klein-Szanto, Andres; Arra, Claudio; Ciarmiello, Andrea; Croce, Carlo M; Fusco, Alfredo

    2011-02-01

    HMGA1 gene rearrangements have been frequently described in human lipomas. In vitro studies suggest that HMGA1 proteins have a negative role in the control of adipocyte cell growth, and that HMGA1 gene truncation acts in a dominant-negative fashion. Therefore, to define better the role of the HMGA1 alterations in the generation of human lipomas, we generated mice carrying an Hmga1b truncated (Hmga1b/T) gene. These mice develop a giant phenotype together with a drastic expansion of the retroperitoneal and subcutaneous white adipose tissue. We show that the activation of the E2F pathway likely accounts, at least in part, for this phenotype. Interestingly, the Hmga1b/T mice also develop B-cell lymphomas similar to that occurring in Hmga1-knockout mice, supporting a dominant-negative role of the Hmga1b/T mutant also in vivo. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. Characterization of transcription factor networks involved in umbilical cord blood CD34+ stem cells-derived erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Biaoru Li

    Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34

  15. Primary structure of the tms and prs genes of Bacillus subtilis

    DEFF Research Database (Denmark)

    Nilsson, Dan; Hove-Jensen, Bjarne; Arnvig, Kirsten

    1989-01-01

    The nucleotide sequence was determined of a 3211 nucleotide pair EcoRI-PvuII DNA fragment containing the tms and prs genes as well as a part of the ctc gene of Bacillus subtilis. The prs gene encodes phosphoribosylpyrophosphate (PRPP) synthetase, whereas the functioning of the tms and ctc gene...... products remains to be established. The prs gene contains an open reading frame of 317 codons resulting in a subunit Mr of 34828. An open reading frame comprising the tms gene contained 456 codons resulting in a putative translation product with an Mr of 49,554. Comparison of the deduced B. subtilis PRPP...

  16. Gene flow rise with habitat fragmentation in the bog fritillary butterfly (Lepidoptera: Nymphalidae).

    Science.gov (United States)

    Nève, Gabriel; Barascud, Bernard; Descimon, Henri; Baguette, Michel

    2008-03-17

    The main components of the spatial genetic structure of the populations are neighbourhood size and isolation by distance. These may be inferred from the allele frequencies across a series of populations within a region. Here, the spatial population structure of Proclossiana eunomia was investigated in two mountainous areas of southern Europe (Asturias, Spain and Pyrenees, France) and in two areas of intermediate elevation (Morvan, France and Ardennes, Belgium). A total of eight polymorphic loci were scored by allozyme electrophoresis, revealing a higher polymorphism in the populations of southern Europe than in those of central Europe. Isolation by distance effect was much stronger in the two mountain ranges (Pyrenees and Asturias) than in the two areas of lower elevation (Ardennes and Morvan). By contrast, the neighbourhood size estimates were smaller in the Ardennes and in the Morvan than in the two high mountain areas, indicating more common movements between neighbouring patches in the mountains than in plains. Short and long dispersal events are two phenomena with distinct consequences in the population genetics of natural populations. The differences in level of population differentiation within each the four regions may be explained by change in dispersal in lowland recently fragmented landscapes: on average, butterflies disperse to a shorter distance but the few ones which disperse long distance do so more efficiently. Habitat fragmentation has evolutionary consequences exceeding by far the selection of dispersal related traits: the balance between local specialisation and gene flow would be perturbed, which would modify the extent to which populations are adapted to heterogeneous environments.

  17. Gene flow rise with habitat fragmentation in the bog fritillary butterfly (Lepidoptera: Nymphalidae

    Directory of Open Access Journals (Sweden)

    Descimon Henri

    2008-03-01

    Full Text Available Abstract Background The main components of the spatial genetic structure of the populations are neighbourhood size and isolation by distance. These may be inferred from the allele frequencies across a series of populations within a region. Here, the spatial population structure of Proclossiana eunomia was investigated in two mountainous areas of southern Europe (Asturias, Spain and Pyrenees, France and in two areas of intermediate elevation (Morvan, France and Ardennes, Belgium. Results A total of eight polymorphic loci were scored by allozyme electrophoresis, revealing a higher polymorphism in the populations of southern Europe than in those of central Europe. Isolation by distance effect was much stronger in the two mountain ranges (Pyrenees and Asturias than in the two areas of lower elevation (Ardennes and Morvan. By contrast, the neighbourhood size estimates were smaller in the Ardennes and in the Morvan than in the two high mountain areas, indicating more common movements between neighbouring patches in the mountains than in plains. Conclusion Short and long dispersal events are two phenomena with distinct consequences in the population genetics of natural populations. The differences in level of population differentiation within each the four regions may be explained by change in dispersal in lowland recently fragmented landscapes: on average, butterflies disperse to a shorter distance but the few ones which disperse long distance do so more efficiently. Habitat fragmentation has evolutionary consequences exceeding by far the selection of dispersal related traits: the balance between local specialisation and gene flow would be perturbed, which would modify the extent to which populations are adapted to heterogeneous environments.

  18. Poemat Parmenidesa. Fragmenty B 9-17, B 19

    Directory of Open Access Journals (Sweden)

    Kazimierz Mrówka

    2012-06-01

    Full Text Available This is a new translation of the Fragments of Parmenides of Elea, the fifth century B.C. thinker. The text includes: a Greek poem with the fragments B 9-17, B 19, a critical apparatus which takes into consideration some new editions and a new English translation.

  19. Expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori

    NARCIS (Netherlands)

    Joosten, V.; Gouka, R.J.; Hondel, C.A.M.J.J. van den; Verrips, C.T.; Lokman, B.C.

    2005-01-01

    We report the expression and production of llama variable heavy-chain antibody fragments (VHHs) by Aspergillus awamori. Fragments encoding VHHs were cloned in a suitable Aspergillus expression vector and transformants secreting VHH fragments were analysed for integrated gene copy-numbers, mRNA

  20. HisB as novel selection marker for gene targeting approaches in Aspergillus niger.

    Science.gov (United States)

    Fiedler, Markus R M; Gensheimer, Tarek; Kubisch, Christin; Meyer, Vera

    2017-03-08

    For Aspergillus niger, a broad set of auxotrophic and dominant resistance markers is available. However, only few offer targeted modification of a gene of interest into or at a genomic locus of choice, which hampers functional genomics studies. We thus aimed to extend the available set by generating a histidine auxotrophic strain with a characterized hisB locus for targeted gene integration and deletion in A. niger. A histidine-auxotrophic strain was established via disruption of the A. niger hisB gene by using the counterselectable pyrG marker. After curing, a hisB - , pyrG - strain was obtained, which served as recipient strain for further studies. We show here that both hisB orthologs from A. nidulans and A. niger can be used to reestablish histidine prototrophy in this recipient strain. Whereas the hisB gene from A. nidulans was suitable for efficient gene targeting at different loci in A. niger, the hisB gene from A. niger allowed efficient integration of a Tet-on driven luciferase reporter construct at the endogenous non-functional hisB locus. Subsequent analysis of the luciferase activity revealed that the hisB locus is tight under non-inducing conditions and allows even higher luciferase expression levels compared to the pyrG integration locus. Taken together, we provide here an alternative selection marker for A. niger, hisB, which allows efficient homologous integration rates as well as high expression levels which compare favorably to the well-established pyrG selection marker.

  1. Gas-phase structure and fragmentation pathways of singly protonated peptides with N-terminal arginine.

    Science.gov (United States)

    Bythell, Benjamin J; Csonka, István P; Suhai, Sándor; Barofsky, Douglas F; Paizs, Béla

    2010-11-25

    The gas-phase structures and fragmentation pathways of the singly protonated peptide arginylglycylaspartic acid (RGD) are investigated by means of collision-induced-dissociation (CID) and detailed molecular mechanics and density functional theory (DFT) calculations. It is demonstrated that despite the ionizing proton being strongly sequestered at the guanidine group, protonated RGD can easily be fragmented on charge directed fragmentation pathways. This is due to facile mobilization of the C-terminal or aspartic acid COOH protons thereby generating salt-bridge (SB) stabilized structures. These SB intermediates can directly fragment to generate b(2) ions or facilely rearrange to form anhydrides from which both b(2) and b(2)+H(2)O fragments can be formed. The salt-bridge stabilized and anhydride transition structures (TSs) necessary to form b(2) and b(2)+H(2)O are much lower in energy than their traditional charge solvated counterparts. These mechanisms provide compelling evidence of the role of SB and anhydride structures in protonated peptide fragmentation which complements and supports our recent findings for tryptic systems (Bythell, B. J.; Suhai, S.; Somogyi, A.; Paizs, B. J. Am. Chem. Soc. 2009, 131, 14057-14065.). In addition to these findings we also report on the mechanisms for the formation of the b(1) ion, neutral loss (H(2)O, NH(3), guanidine) fragment ions, and the d(3) ion.

  2. Analysis of IL12B gene variants in inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Jürgen Glas

    Full Text Available BACKGROUND: IL12B encodes the p40 subunit of IL-12, which is also part of IL-23. Recent genome-wide association studies identified IL12B and IL23R as susceptibility genes for inflammatory bowel disease (IBD. However, the phenotypic effects and potential gene-gene interactions of IL12B variants are largely unknown. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed IL12B gene variants regarding association with Crohn's disease (CD and ulcerative colitis (UC. Genomic DNA from 2196 individuals including 913 CD patients, 318 UC patients and 965 healthy, unrelated controls was analyzed for four SNPs in the IL12B gene region (rs3212227, rs17860508, rs10045431, rs6887695. Our analysis revealed an association of the IL12B SNP rs6887695 with susceptibility to IBD (p = 0.035; OR 1.15 [95% CI 1.01-1.31] including a trend for rs6887695 for association with CD (OR 1.41; [0.99-1.31], p = 0.066 and UC (OR 1.18 [0.97-1.43], p = 0.092. CD patients, who were homozygous C/C carriers of this SNP, had significantly more often non-stricturing, non-penetrating disease than carriers of the G allele (p = 6.8×10(-5; OR = 2.84, 95% CI 1.66-4.84, while C/C homozygous UC patients had less often extensive colitis than G allele carriers (p = 0.029; OR = 0.36, 95% CI 0.14-0.92. In silico analysis predicted stronger binding of the minor C allele of rs6887695 to the transcription factor RORα which is involved in Th17 differentiation. Differences regarding the binding to the major and minor allele sequence of rs6887695 were also predicted for the transcription factors HSF1, HSF2, MZF1 and Oct-1. Epistasis analysis revealed weak epistasis of the IL12B SNP rs6887695 with several SNPs (rs11889341, rs7574865, rs7568275, rs8179673, rs10181656, rs7582694 in the STAT4 gene which encodes the major IL-12 downstream transcription factor STAT4 (p<0.05 but there was no epistasis between IL23R and IL12B variants. CONCLUSIONS/SIGNIFICANCE: The IL12B SNP rs6887695

  3. Predominant porB1A and porB1B genotypes and correlation of gene mutations with drug resistance in Neisseria gonorrhoeae isolates in Eastern China

    Directory of Open Access Journals (Sweden)

    Tang Renxian

    2010-11-01

    Full Text Available Abstract Background Variations of porB1A and porB1B genes and their serotypes exist in Neisseria gonorrhoeae isolates from different geographical areas, and some site mutations in the porB1B gene correlate with drug resistance. Methods The β-lactamase production of N. gonorrhoeae isolates was determined by paper acidometric test and nitrocefin discs. The porB1A and porB1B genes of 315 non-penicillinase-producting N. gonorrhoeae (non-PPNG strains were amplified by PCR for sequencing to determine serotypes and site mutations. A duplex PCR was designed to simultaneously detect both porB1A and porB1B genes. Penicillin and tetracycline resistance was assessed by an in vitro drug sensitivity test. Results Of the N. gonorrhoeae isolates, 31.1% tested positive for porB1A and 68.9% for porB1B genes. All the 98 porB1A+ isolates belonging to IA6 serotype with either no mutation at the 120 and 121 sites (88.8% or a D120G (11.2% mutation and were no resistance to both penicillin and tetracycline. Among the 217 porB1B+ isolates, 26.7%, 22.6% and 11.5% belonged to IB3, IB3/6 and IB4 serotypes, respectively. Particularly, two novel chimeric serotypes, IB3/6-IB2 and IB2-IB4-IB2, were found in 77 and 8 porB1B+ isolates. Two hundred and twelve (97.7% of the porB1B+ isolates were presented G120 and/or A121 mutations with 163 (76.9% at both sites. Interestingly, within the 77 porB1B+ isolates belonging to IB3/6-IB2 serotype, 15 were discovered to possess novel deletions at both A121 and N122 sites. All the replacement mutations at these sites in PorB1B were correlated with resistance and the deletion mutation showed the highest resistance. Conclusion N. gonorrhoeae isolates circulating in Eastern China include a sole PorB1A serotype (IA6 and five PorB1B serotypes. Multiple mutations in porB1B genes, including novel A121 and N122 deletions, are correlated with high levels of penicillin and tetracycline resistance.

  4. The possibility of discriminating within the Bacillus cereus group using gyrB sequencing and PCR-RFLP

    DEFF Research Database (Denmark)

    Jensen, Gert B; Fisker, Niels; Sparsø, Thomas

    2005-01-01

    Based on a combination of PCR and restriction endonuclease (RE) digestion (PCR-RE digestion), we have examined the possibility of differentiating members of the Bacillus cereus group. Fragments of the gyrB gene (362 bp) from pure cultures of 12 B. cereus, 25 B. thuringiensis, 25 B. mycoides and two......, it was not possible to discriminate between the B. cereus and the B. thuringiensis strains using the methods described....

  5. Genome-Wide Identification and Structural Analysis of bZIP Transcription Factor Genes in Brassica napus.

    Science.gov (United States)

    Zhou, Yan; Xu, Daixiang; Jia, Ledong; Huang, Xiaohu; Ma, Guoqiang; Wang, Shuxian; Zhu, Meichen; Zhang, Aoxiang; Guan, Mingwei; Lu, Kun; Xu, Xinfu; Wang, Rui; Li, Jiana; Qu, Cunmin

    2017-10-24

    The basic region/leucine zipper motif (bZIP) transcription factor family is one of the largest families of transcriptional regulators in plants. bZIP genes have been systematically characterized in some plants, but not in rapeseed ( Brassica napus ). In this study, we identified 247 BnbZIP genes in the rapeseed genome, which we classified into 10 subfamilies based on phylogenetic analysis of their deduced protein sequences. The BnbZIP genes were grouped into functional clades with Arabidopsis genes with similar putative functions, indicating functional conservation. Genome mapping analysis revealed that the BnbZIPs are distributed unevenly across all 19 chromosomes, and that some of these genes arose through whole-genome duplication and dispersed duplication events. All expression profiles of 247 bZIP genes were extracted from RNA-sequencing data obtained from 17 different B . napus ZS11 tissues with 42 various developmental stages. These genes exhibited different expression patterns in various tissues, revealing that these genes are differentially regulated. Our results provide a valuable foundation for functional dissection of the different BnbZIP homologs in B . napus and its parental lines and for molecular breeding studies of bZIP genes in B . napus .

  6. Benchmarking of gene prediction programs for metagenomic data.

    Science.gov (United States)

    Yok, Non; Rosen, Gail

    2010-01-01

    This manuscript presents the most rigorous benchmarking of gene annotation algorithms for metagenomic datasets to date. We compare three different programs: GeneMark, MetaGeneAnnotator (MGA) and Orphelia. The comparisons are based on their performances over simulated fragments from one hundred species of diverse lineages. We defined four different types of fragments; two types come from the inter- and intra-coding regions and the other types are from the gene edges. Hoff et al. used only 12 species in their comparison; therefore, their sample is too small to represent an environmental sample. Also, no predecessors has separately examined fragments that contain gene edges as opposed to intra-coding regions. General observations in our results are that performances of all these programs improve as we increase the length of the fragment. On the other hand, intra-coding fragments of our data show low annotation error in all of the programs if compared to the gene edge fragments. Overall, we found an upper-bound performance by combining all the methods.

  7. Inherited Inflammatory Response Genes Are Associated with B-Cell Non-Hodgkin's Lymphoma Risk and Survival.

    Directory of Open Access Journals (Sweden)

    Kaspar René Nielsen

    Full Text Available Malignant B-cell clones are affected by both acquired genetic alterations and by inherited genetic variations changing the inflammatory tumour microenvironment.We investigated 50 inflammatory response gene polymorphisms in 355 B-cell non-Hodgkin's lymphoma (B-NHL samples encompassing 216 diffuse large B cell lymphoma (DLBCL and 139 follicular lymphoma (FL and 307 controls. The effect of single genes and haplotypes were investigated and gene-expression analysis was applied for selected genes. Since interaction between risk genes can have a large impact on phenotype, two-way gene-gene interaction analysis was included.We found inherited SNPs in genes critical for inflammatory pathways; TLR9, IL4, TAP2, IL2RA, FCGR2A, TNFA, IL10RB, GALNT12, IL12A and IL1B were significantly associated with disease risk and SELE, IL1RN, TNFA, TAP2, MBL2, IL5, CX3CR1, CHI3L1 and IL12A were, associated with overall survival (OS in specific diagnostic entities of B-NHL. We discovered noteworthy interactions between DLBCL risk alleles on IL10 and IL4RA and FL risk alleles on IL4RA and IL4. In relation to OS, a highly significant interaction was observed in DLBCL for IL4RA (rs1805010 * IL10 (rs1800890 (HR = 0.11 (0.02-0.50. Finally, we explored the expression of risk genes from the gene-gene interaction analysis in normal B-cell subtypes showing a different expression of IL4RA, IL10, IL10RB genes supporting a pathogenetic effect of these interactions in the germinal center.The present findings support the importance of inflammatory genes in B-cell lymphomas. We found association between polymorphic sites in inflammatory response genes and risk as well as outcome in B-NHL and suggest an effect of gene-gene interactions during the stepwise oncogenesis.

  8. Porcine lung surfactant protein B gene (SFTPB)

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Fredholm, Merete

    2008-01-01

    The porcine surfactant protein B (SFTPB) is a single copy gene on chromosome 3. Three different cDNAs for the SFTPB have been isolated and sequenced. Nucleotide sequence comparison revealed six nonsynonymous single nucleotide polymorphisms (SNPs), four synonymous SNPs and an in-frame deletion of 69...... bp in the region coding for the active protein. Northern analysis showed lung-specific expression of three different isoforms of the SFTPB transcript. The expression level for the SFTPB gene is low in 50 days-old fetus and it increases during lung development. Quantitative real-time polymerase chain...

  9. Effect of Complement Factor B Gene Polymorphisms on Age-Related Macular Degeneration in North-East of Iran Population

    Directory of Open Access Journals (Sweden)

    N. Roshani Pour

    2017-09-01

    Full Text Available Aims: Age-related macular degeneration (AMD is the most prevalent cause of irreversible blindness and debilitating in old stages, in developed and developing countries that engage the central part of the retina or macula. The aim of this study was to evaluate the relationship of the rs4151667 position of the complement factor B gene polymorphism with AMD (dry type with geographic atrophy phenotype in the North East of Iran population. ­Materials & Methods:­ In this descriptive cross-sectional study in 2015-2016, 44 AMD patients (dry type with geographic atrophy phenotype were randomly selected from Gonabad City, Iran, health centers as the patient group. 50 healthy individuals from the same society that have no relative relations with each other or the patients, but were adapted by age and sex to the patient group, were selected as the control group. The ­­polymorphism of rs4151667 (c.26T>A­ position of the complement factor B gene was determined for all samples by Restriction Fragment Length Polymorphism (RFLP. Data was analyzed the Chi-square test in 2x2.Contingency software. Findings: The frequency of TT genotype in AMD patients (95.5% was significantly (p=0.048 more than the control group (88.0%, but the frequency of AT genotype in AMD patients (4.5% was significantly (p=0.025 less than the control group (12.0%. Conclusion: The polymorphism of rs4151667 (c.26T>A position of complement factor B is effective on the development of AMD in North East of Iran population.

  10. Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

    Science.gov (United States)

    Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

    2018-04-01

    The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

  11. Type 1 plaminogen activator inhibitor gene: Functional analysis and glucocorticoid regulation of its promoter

    International Nuclear Information System (INIS)

    Van Zonneveld, A.J.; Curriden, S.A.; Loskutoff, D.J.

    1988-01-01

    Plasminogen activator inhibitor type 1 is an important component of the fibrinolytic system and its biosynthesis is subject to complex regulation. To study this regulation at the level of transcription, the authors have identified and sequenced the promoter of the human plasminogen activator inhibitor type 1 gene. Nuclease protection experiments were performed by using endothelial cell mRNA and the transcription initiation (cap) site was established. Sequence analysis of the 5' flanking region of the gene revealed a perfect TATA box at position -28 to position -23, the conserved distance from the cap site. Comparative functional studies with the firefly luciferase gene as a reporter gene showed that fragments derived from this 5' flanking region exhibited high promoter activity when transfected into bovine aortic endothelial cells and mouse Ltk - fibroblasts but were inactive when introduced into HeLa cells. These studies indicate that the fragments contain the plasminogen activator inhibitor type 1 promoter and that it is expressed in a tissue-specific manner. Although the fragments were also silent in rat FTO2B hepatoma cells, their promoter activity could be induced up to 40-fold with the synthetic glucocorticoid dexamethasone. Promoter deletion mapping experiments and studies involving the fusion of promoter fragments to a heterologous gene indicated that dexamethasone induction is mediated by a glucocorticoid responsive element with enhancer-like properties located within the region between nucleotides -305 and +75 of the plasminogen activator inhibitor type 1 gene

  12. β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

    Science.gov (United States)

    Rivella, Stefano

    2015-04-01

    β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

  13. α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea

    Directory of Open Access Journals (Sweden)

    Abbas Najjari

    2014-05-01

    Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.

  14. A note on convex renorming and fragmentability

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Using the game approach to fragmentability, we give new and simpler proofs of the following known results: (a) If the Banach space admits an equivalent. Kadec norm, then its weak topology is fragmented by a metric which is stronger than the norm topology. (b) If the Banach space admits an equivalent rotund ...

  15. Two siblings with immunodeficiency, facial abnormalities and chromosomal instability without mutation in DNMT3B gene but liability towards malignancy; a new chromatin disorder delineation?

    Directory of Open Access Journals (Sweden)

    Neitzel Heidemarie

    2010-03-01

    Full Text Available Abstract Background ICF syndrome (standing for Immunodeficiency, Centromere instability and Facial anomalies syndrome is a very rare autosomal recessive immune disorder caused by mutations of the gene de novo DNA-methyltransferase 3B (DNMT3B. However, in the literature similar clinical cases without such mutations are reported, as well. Results We report on a family in which the unrelated spouses had two female siblings sharing similar phenotypic features resembling ICF-syndrome, i.e. congenital abnormalities, immunodeficiency, developmental delay and high level of chromosomal instability, including high frequency of centromeric/pericentromeric rearrangements and breaks, chromosomal fragments despiralization or pulverization. However, mutations in DNMT3B could not be detected. Conclusion The discovery of a new so-called 'chromatin disorder' is suggested. Clinical, molecular genetic and cytogenetic characteristics are reported and compared to other 'chromatin disorders'.

  16. B lymphocyte selection and age-related changes in VH gene usage in mutant Alicia rabbits.

    Science.gov (United States)

    Zhu, X; Boonthum, A; Zhai, S K; Knight, K L

    1999-09-15

    Young Alicia rabbits use VHa-negative genes, VHx and VHy, in most VDJ genes, and their serum Ig is VHa negative. However, as Alicia rabbits age, VHa2 allotype Ig is produced at high levels. We investigated which VH gene segments are used in the VDJ genes of a2 Ig-secreting hybridomas and of a2 Ig+ B cells from adult Alicia rabbits. We found that 21 of the 25 VDJ genes used the a2-encoding genes, VH4 or VH7; the other four VDJ genes used four unknown VH gene segments. Because VH4 and VH7 are rarely found in VDJ genes of normal or young Alicia rabbits, we investigated the timing of rearrangement of these genes in Alicia rabbits. During fetal development, VH4 was used in 60-80% of nonproductively rearranged VDJ genes, and VHx and VHy together were used in 10-26%. These data indicate that during B lymphopoiesis VH4 is preferentially rearranged. However, the percentage of productive VHx- and VHy-utilizing VDJ genes increased from 38% at day 21 of gestation to 89% at birth (gestation day 31), whereas the percentage of VH4-utilizing VDJ genes remained at 15%. These data suggest that during fetal development, either VH4-utilizing B-lineage cells are selectively eliminated, or B cells with VHx- and VHy-utilizing VDJ genes are selectively expanded, or both. The accumulation of peripheral VH4-utilizing a2 B cells with age indicates that these B cells might be selectively expanded in the periphery. We discuss the possible selection mechanisms that regulate VH gene segment usage in rabbit B cells during lymphopoiesis and in the periphery.

  17. Putative in vitro expressed gene fragments unique to Mycobacterium avium subspecies para tuberculosis

    DEFF Research Database (Denmark)

    Nielsen, Kirstine Klitgaard; Ahrens, Peter

    2002-01-01

    By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria. The uniquen......By a suppression subtractive hybridization based method, nine novel Mycobacterium avium subsp. para tuberculosis (M. para tuberculosis) fragments of between 318 and 596 bp have been identified and characterized. Database search revealed little or no similarity with other mycobacteria....... The uniqueness and diagnostic potential of seven of these fragments in relation to M. paratuberculosis closest relative Mycobacterium avium subsp. avium (M. avium) was confirmed by species-specific PCR and Southern blot. Furthermore, RT-PCR indicated that eight of the nine fragments originate from areas...

  18. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    The results of SDS-PAGE and Western blot showed that the recombinant protein was induced by methanol and stably expressed in P. pastoris, while it has specific reaction with the serum containing anti-HbsAg or anti-Ag85B. However, the successful construction of a recombinant yeast expression vector containing gene ...

  19. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. Fragmentation reduces regional-scale spatial genetic structure in a wind-pollinated tree because genetic barriers are removed.

    Science.gov (United States)

    Wang, Rong; Compton, Stephen G; Shi, Yi-Su; Chen, Xiao-Yong

    2012-09-01

    Gene flow strongly influences the regional genetic structuring of plant populations. Seed and pollen dispersal patterns can respond differently to the increased isolation resulting from habitat fragmentation, with unpredictable consequences for gene flow and population structuring. In a recently fragmented landscape we compared the pre- and post-fragmentation genetic structure of populations of a tree species where pollen and seed dispersal respond differentially to forest fragmentation generated by flooding. Castanopsis sclerophylla is wind-pollinated, with seeds that are dispersed by gravity and rodents. Using microsatellites, we found no significant difference in genetic diversity between pre- and post-fragmentation cohorts. Significant genetic structure was observed in pre-fragmentation cohorts, due to an unknown genetic barrier that had isolated one small population. Among post-fragmentation cohorts this genetic barrier had disappeared and genetic structure was significantly weakened. The strengths of genetic structuring were at a similar level in both cohorts, suggesting that overall gene flow of C. sclerophylla has been unchanged by fragmentation at the regional scale. Fragmentation has blocked seed dispersal among habitats, but this appears to have been compensated for by enhanced pollen dispersal, as indicated by the disappearance of a genetic barrier, probably as a result of increased wind speeds and easier pollen movement over water. Extensive pollen flow can counteract some negative effects of fragmentation and assist the long-term persistence of small remnant populations.

  2. Glaucoma and Cytochrome P4501B1 Gene Mutations

    Directory of Open Access Journals (Sweden)

    Mukesh Tanwar

    2010-01-01

    Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

  3. Direct Involvement of ombB, omaB and omcB Genes in Extracellular Reduction of Fe(III by Geobacter sulfurreducens PCA

    Directory of Open Access Journals (Sweden)

    Yimo eLiu

    2015-10-01

    Full Text Available The tandem gene clusters orfR-ombB-omaB-omcB and orfS-ombC-omaC-omcC of the metal-reducing bacterium Geobacter sulfurreducens PCA are responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III-citrate and ferrihydrite [a poorly crystalline Fe(III oxide]. Each gene cluster encodes a putative transcriptional factor (OrfR/OrfS, a porin-like outer-membrane protein (OmbB/OmbC, a periplasmic c-type cytochrome (c-Cyt, OmaB/OmaC and an outer-membrane c-Cyt (OmcB/OmcC. The individual roles of OmbB, OmaB and OmcB in extracellular reduction of Fe(III, however, have remained either uninvestigated or controversial. Here, we showed that replacements of ombB, omaB, omcB and ombB-omaB with an antibiotic gene in the presence of ombC-omaC-omcC had no impact on reduction of Fe(III-citrate by G. sulfurreducens PCA. Disruption of ombB, omaB, omcB and ombB-omaB in the absence of ombC-omaC-omcC, however, severely impaired the bacterial ability to reduce Fe(III-citrate as well as ferrihydrite. These results unequivocally demonstrate an overlapping role of ombB-omaB-omcB and ombC-omaC-omcC in extracellular Fe(III reduction by G. sulfurreducens PCA. Involvement of both ombB-omaB-omcB and ombC-omaC-omcC in extracellular Fe(III reduction reflects the importance of these trans-outer membrane protein complexes in the physiology of this bacterium. Moreover, the kinetics of Fe(III-citrate and ferrihydrite reduction by these mutants in the absence of ombC-omaC-omcC were nearly identical, which suggests that absence of any protein subunit eliminates function of OmaB/OmbB/OmcB protein complex. Finally, orfS was found to have a negative impact on the extracellular reduction of Fe(III-citrate and ferrihydrite in G. sulfurreducens PCA probably by serving as a transcriptional repressor.

  4. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  5. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  6. Analysis of IL12B Gene Variants in Inflammatory Bowel Disease

    Science.gov (United States)

    Wagner, Johanna; Olszak, Torsten; Fries, Christoph; Tillack, Cornelia; Friedrich, Matthias; Beigel, Florian; Stallhofer, Johannes; Steib, Christian; Wetzke, Martin; Göke, Burkhard; Ochsenkühn, Thomas; Diegelmann, Julia; Czamara, Darina; Brand, Stephan

    2012-01-01

    Background IL12B encodes the p40 subunit of IL-12, which is also part of IL-23. Recent genome-wide association studies identified IL12B and IL23R as susceptibility genes for inflammatory bowel disease (IBD). However, the phenotypic effects and potential gene-gene interactions of IL12B variants are largely unknown. Methodology/Principal Findings We analyzed IL12B gene variants regarding association with Crohn's disease (CD) and ulcerative colitis (UC). Genomic DNA from 2196 individuals including 913 CD patients, 318 UC patients and 965 healthy, unrelated controls was analyzed for four SNPs in the IL12B gene region (rs3212227, rs17860508, rs10045431, rs6887695). Our analysis revealed an association of the IL12B SNP rs6887695 with susceptibility to IBD (p = 0.035; OR 1.15 [95% CI 1.01–1.31] including a trend for rs6887695 for association with CD (OR 1.41; [0.99–1.31], p = 0.066) and UC (OR 1.18 [0.97–1.43], p = 0.092). CD patients, who were homozygous C/C carriers of this SNP, had significantly more often non-stricturing, non-penetrating disease than carriers of the G allele (p = 6.8×10−5; OR = 2.84, 95% CI 1.66–4.84), while C/C homozygous UC patients had less often extensive colitis than G allele carriers (p = 0.029; OR = 0.36, 95% CI 0.14–0.92). In silico analysis predicted stronger binding of the minor C allele of rs6887695 to the transcription factor RORα which is involved in Th17 differentiation. Differences regarding the binding to the major and minor allele sequence of rs6887695 were also predicted for the transcription factors HSF1, HSF2, MZF1 and Oct-1. Epistasis analysis revealed weak epistasis of the IL12B SNP rs6887695 with several SNPs (rs11889341, rs7574865, rs7568275, rs8179673, rs10181656, rs7582694) in the STAT4 gene which encodes the major IL-12 downstream transcription factor STAT4 (p<0.05) but there was no epistasis between IL23R and IL12B variants. Conclusions/Significance The IL12B SNP rs6887695 modulates

  7. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  8. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  9. Heavy quark fragmentation into polarized quarkonium in the heavy quark effective theory

    International Nuclear Information System (INIS)

    Martynenko, A.P.; Saleev, V.A.

    1996-01-01

    Fragmentation of b-antiquark into polarized B* c -mesons is investigated within the framework of effective theory of heavy quarks. Functions of b fragmentation into longitudinally polarized and transversely polarized S-wave states of b c are calculated with an exact regard tot he first order corrections by 1/m b . Agreement of the results obtained with the corresponding calculations, performed in the quantum chromodynamics, is shown. 17 refs.; 2 figs

  10. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  11. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  12. Frequency of infection with A and B supergroup Wolbachia in ...

    Indian Academy of Sciences (India)

    Previous surveys indicated that it is commonly seen in 16–76% of arthropods. In this paper, using polymerase chain reaction assay based on specific amplification of the ftsZ-A and -B supergroup Wolbachia gene fragments, we found that 30% of insects and pests screened were positive for Wolbachia. Among them 66.7% ...

  13. Production of Active Nonglycosylated Recombinant B-Chain of Type-2 Ribosome-Inactivating Protein from Viscum articulatum and Its Biological Effects on Peripheral Blood Mononuclear Cells

    Directory of Open Access Journals (Sweden)

    Tzu-Li Lu

    2011-01-01

    Full Text Available Type-2 ribosome-inactivating proteins, composed of a toxic A-chain and lectin-like B-chain, display various biological functions, including cytotoxicity and immunomodulation. We here cloned the lectin-like B-chain encoding fragment of a newly identified type-2 RIP gene, articulatin gene, from Viscum articulatum, into a bacterial expression vector to obtain nonglycosylated recombinant protein expressed in inclusion bodies. After purification and protein refolding, soluble refolded recombinant articulatin B-chain (rATB showed lectin activity specific toward galactoside moiety and was stably maintained while stored in low ionic strength solution. Despite lacking glycosylation, rATB actively bound leukocytes with preferential binding to monocytes and in vitro stimulated PBMCs to release cytokines without obvious cytotoxicity. These results implicated such a B-chain fragment as a potential immunomodulator.

  14. Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

    Science.gov (United States)

    Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

    α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

  15. Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

    Energy Technology Data Exchange (ETDEWEB)

    Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1965-07-01

    This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

  16. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  17. Genetic variation of Taenia pisiformis collected from Sichuan, China, based on the mitochondrial cytochrome B gene.

    Science.gov (United States)

    Yang, Deying; Ren, Yongjun; Fu, Yan; Xie, Yue; Nie, Huaming; Nong, Xiang; Gu, Xiaobin; Wang, Shuxian; Peng, Xuerong; Yang, Guangyou

    2013-08-01

    Taenia pisiformis is one of the most important parasites of canines and rabbits. T. pisiformis cysticercus (the larval stage) causes severe damage to rabbit breeding, which results in huge economic losses. In this study, the genetic variation of T. pisiformis was determined in Sichuan Province, China. Fragments of the mitochondrial cytochrome b (cytb) (922 bp) gene were amplified in 53 isolates from 8 regions of T. pisiformis. Overall, 12 haplotypes were found in these 53 cytb sequences. Molecular genetic variations showed 98.4% genetic variation derived from intra-region. FST and Nm values suggested that 53 isolates were not genetically differentiated and had low levels of genetic diversity. Neutrality indices of the cytb sequences showed the evolution of T. pisiformis followed a neutral mode. Phylogenetic analysis revealed no correlation between phylogeny and geographic distribution. These findings indicate that 53 isolates of T. pisiformis keep a low genetic variation, which provide useful knowledge for monitoring changes in parasite populations for future control strategies.

  18. Fragmentation of rotating protostellar clouds

    International Nuclear Information System (INIS)

    Tohline, J.E.

    1980-01-01

    We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

  19. Generation of “LYmph Node Derived Antibody Libraries” (LYNDAL) for selecting fully human antibody fragments with therapeutic potential.

    Science.gov (United States)

    Diebolder, Philipp; Keller, Armin; Haase, Stephanie; Schlegelmilch, Anne; Kiefer, Jonathan D; Karimi, Tamana; Weber, Tobias; Moldenhauer, Gerhard; Kehm, Roland; Eis-Hübinger, Anna M; Jäger, Dirk; Federspil, Philippe A; Herold-Mende, Christel; Dyckhoff, Gerhard; Kontermann, Roland E; Arndt, Michaela A E; Krauss, Jürgen

    2014-01-01

    The development of efficient strategies for generating fully human monoclonal antibodies with unique functional properties that are exploitable for tailored therapeutic interventions remains a major challenge in the antibody technology field. Here, we present a methodology for recovering such antibodies from antigen-encountered human B cell repertoires. As the source for variable antibody genes, we cloned immunoglobulin G (IgG)-derived B cell repertoires from lymph nodes of 20 individuals undergoing surgery for head and neck cancer. Sequence analysis of unselected “LYmph Node Derived Antibody Libraries” (LYNDAL) revealed a naturally occurring distribution pattern of rearranged antibody sequences, representing all known variable gene families and most functional germline sequences. To demonstrate the feasibility for selecting antibodies with therapeutic potential from these repertoires, seven LYNDAL from donors with high serum titers against herpes simplex virus (HSV) were panned on recombinant glycoprotein B of HSV-1. Screening for specific binders delivered 34 single-chain variable fragments (scFvs) with unique sequences. Sequence analysis revealed extensive somatic hypermutation of enriched clones as a result of affinity maturation. Binding of scFvs to common glycoprotein B variants from HSV-1 and HSV-2 strains was highly specific, and the majority of analyzed antibody fragments bound to the target antigen with nanomolar affinity. From eight scFvs with HSV-neutralizing capacity in vitro,the most potent antibody neutralized 50% HSV-2 at 4.5 nM as a dimeric (scFv)2. We anticipate our approach to be useful for recovering fully human antibodies with therapeutic potential.

  20. Spontaneous complement activation on human B cells results in localized membrane depolarization and the clustering of complement receptor type 2 and C3 fragments

    DEFF Research Database (Denmark)

    Løbner, Morten; Leslie, Robert G Q; Prodinger, Wolfgang M

    2009-01-01

    While our previous studies have demonstrated that complement activation induced by complement receptors type 2 (CR2/CD21) and 1 (CR1/CD35) results in C3-fragment deposition and membrane attack complex (MAC) formation in human B cells, the consequences of these events for B-cell functions remain u...

  1. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Kudo, Shinichi; Fukuda, Minoru

    1989-01-01

    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  2. Identification of Differentially Expressed Genes Associated with Prognosis of B Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Idalia Garza-Veloz

    2015-01-01

    Full Text Available Background. Acute lymphoblastic leukemia type B (B-ALL is a neoplastic disorder with high mortality rates. The aim of this study was to validate the expression profile of 45 genes associated with signaling pathways involved in leukemia and to evaluate their association with the prognosis of B-ALL. Methods. 219 samples of peripheral blood mononuclear cells obtained from 73 B-ALL patients were studied at diagnosis, four, and eight weeks after starting treatment. Gene expression was analyzed by quantitative real-time polymerase chain reaction. Results. Normalized delta Cq values of 23 genes showed differences between B-ALL and controls at diagnosis time (P values < 0.05. There were significant associations between B-ALL patients relapse/death and the expression levels of IL2RA, SORT1, DEFA1, and FLT3 genes at least in one of the times evaluated (P values < 0.05 and odds ratio ranges: 3.73–27. The association between FLT3 deregulation and relapse/death was a constant in the times studied and their overexpression significantly increased the odds of relapse/death in a range of 3.73 and 6.05 among study population (P values < 0.05. Conclusions. Overexpression of FLT3 and DEFA1 genes retained independent prognostic significance for B-ALL outcome, reflected as increased risks of relapse/death among the study population.

  3. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  4. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  5. Long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele‐specific MYC expression in HeLa cells

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Lu, Fengmin

    2017-01-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis‐activate the expression of proto‐oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV‐integrated haplotype, and a long‐range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long‐range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence‐associated acidic β‐gal activity in HeLa cells. These data indicate a long‐distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. PMID:28470669

  6. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta Lima

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  8. Evaluation and analysis of geological condition of in-situ fragmentation leaching uranium

    International Nuclear Information System (INIS)

    Yang Jianming; Tan Kaixuan; Huang Xiaonai

    2003-01-01

    The ore geological condition, hydrogeological condition, engineering geological condition and technological mineralogical character of in-situ fragmentation leaching uranium are analyzed, and it is considered that the implementation of in-situ fragmentation leaching uranium technology is decided by different geological factor. Previously prospecting and geological condition evaluation of uranium ore is based on traditional mining method. If in-situ fragmentation leaching uranium method is adopted, one must re-evaluate previously prospected deposits before they are mined, or one must evaluate new prospecting deposits according to geological conditions of in-situ fragmentation leaching uranium method. The feasibility evaluation method of uranium deposit by in-situ fragmentation leaching uranium put forward by B. N. Mociniets is introducd, and it is considered that B. N. Mociniets method has guidable significance for geological condition evaluation before uranium deposits are mined. A feasibility study is done by applying B. N. Mociniets method to a uranium deposit. (authors)

  9. ORF Alignment: NC_004722 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available konkukian str. 97-27] ... gb|AAS40246.1| protozoan/cyanobacterial globin family ... protein [B...tozoan/cyanobacterial globin family protein [Bacillus ... ....1| ... globin family protein [Bacillus thuringiensis serovar ... konkukian str. 97-27] ref|NP_977638.1| ... pro

  10. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  11. Association assessment of platelet derived growth factor B gene ...

    African Journals Online (AJOL)

    Background: Coronary artery disease (CAD) is the most frequent cause of morbidity and mortality in the world and it is known as a multifactorial disorder which is influenced by both genetic and environmental factors. Based on different assays, the platelet derived growth factor B (PDGF-B) gene is shown to be amongst the ...

  12. A Molecular Case-Control Study on the Association of Melatonin Hormone and rs#10830963 Single Nucleotide Polymorphism in its Receptor MTNR1B Gene with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Nadia A Abd El Moneim

    2015-01-01

    Full Text Available Background: The main function of the pineal hormone melatonin which is mediated via its two receptors, MTNR1A and MTNR1B, is to mediate dark signals in addition to anti-oxidation, immune system enhancement, protection from radiation, and anti-cancer functions. A common single nucleotide polymorphism in the MTNR1B gene is rs#10830963, which is well known as a risk factor for type 2 diabetes mellitus. This study intends to figure out the role of melatonin and its receptor MTNR1B gene rs#10830963 polymorphism in breast cancer incidence, diagnosis and prognosis. Methods: This study included 43 females with breast cancer and 45 apparently normal healthy females. Restriction fragment length polymorphism-PCR was used for amplification and genotyping of the MTNR1B gene rs#10830963 polymorphism in whole blood. Serum melatonin levels were measured using a ready-for-use radioimmunoassay kit. Results: For the MTNR1B gene rs#10830963 polymorphism, we observed a significantly higher GG genotype frequency among cases (72.1% than controls (13.3%, with a diagnostic sensitivity of 83.78% and specificity of 76.47%. The cases had a frequency of 11.6% for the CC genotype and 16.3% for the CG genotype which was significantly lower compared to controls that had a 44.4% frequency of the CC genotype and 42.2% frequency of the CG genotype. The GG genotype had a significant association with larger tumor volume (P=0.048. Serum melatonin levels were significantly lower among breast cancer patients than controls. Using the ROC curve analysis, serum melatonin showed a significant AUC (72.6%, P39.5 pg/ml. Conclusion: The risk for breast cancer incidence increased as the serum levels of melatonin decreased and in females homozygous for the G allele (GG genotype of the MTNR1B gene rs#10830963 polymorphism. The GG genotype was found to be associated with increased breast tumor volume as a marker of a poor prognosis breast cancer.

  13. Regulation of gene expression by low levels of ultraviolet-B radiation in Pisum sativum: Isolation of novel genes by suppression subtractive hybridisation

    International Nuclear Information System (INIS)

    Sävenstrand, H.; Brosché, M.; Strid, A.

    2002-01-01

    Suppression subtractive hybridisation was used to isolate genes differentially regulated by low levels (UV-B BE,300 0.13 W m -2 ) of ultraviolet-B radiation (UV-B; 290–320 nm) in Pisum sativum. Six genes were regulated, two of which were novel. The mRNA levels for these two (PsTSDC and PsUOS1) were increased and depressed by UV-B treatment, respectively. Domains in the PsTSDC translation product was similar to TIR (Toll-Interleukin-1 receptor-similar) domains and a NB-ARC domain (nucleotide-binding domain in APAF-1, R gene products and CED-4). The PsUOS1 translation product was similar to an open reading frame in Arabidopsis. Genes encoding embryo-abundant protein (PsEMB) and S-adenosyl-l-methionine synthase (PsSAMS) were induced by UV-B, whereas the transcript levels for genes encoding sucrose transport protein (PsSUT) or ribulose-5-phosphate 3-epimerase (PsR5P3E) were decreased. These regulation patterns are novel, and the PsEMB and PsR5P3E sequences are reported for the first time. The stress-specificity of regulation of these genes were tested by ozone fumigation (100 ppb O 3 ). Qualitatively, the similarity of expression after both UV-B and ozone exposure suggests that, for these genes, similar stress-response pathways are in action. (author)

  14. Projectile rapidity dependence in target fragmentation

    International Nuclear Information System (INIS)

    Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.

    1979-01-01

    The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references

  15. Neutralisation and binding of VHS virus by monovalent antibody fragments

    DEFF Research Database (Denmark)

    Cupit, P.M.; Lorenzen, Niels; Strachan, G.

    2001-01-01

    We have previously reported the cloning and characterisation of the heavy and light chain variable domain genes encoding three monoclonal antibodies (Mabs) that bind viral haemorrhagic septicaemia virus (VHSV). Two of these antibodies, 3F1H10 and 3F1A2 both neutralised the virus though 3F1A2...... appeared to recognise a broader range of virus isolates. The variable domains of these two antibodies differ by only four residues (Lorenzen et al., 2000a. Fish Shellfish Immunol. 10, 129-142). To further study the mechanism of neutralisation, Fab fragments as well as a series of recombinant bacterial...... single chain antibody (scAb) fragments were generated from the three anti-VHSV Mabs and their variable domain genes, respectively. Fabs and scAbs derived from the neutralising Mabs were both able to neutralise the VHSV type 1 isolate DK-F1. In addition, a series of scAb fragments were produced using...

  16. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  17. Evaluation of two endometriosis models by transplantation of human endometrial tissue fragments and human endometrial mesenchymal cells

    Directory of Open Access Journals (Sweden)

    Mina Jafarabadi

    2017-08-01

    Full Text Available Background: The animal models of endometriosis could be a valuable alternative tool for clarifying the etiology of endometriosis. Objective: In this study two endometriosis models at the morphological and molecular levels was evaluated and compared. Materials and Methods: The human endometrial tissues were cut into small fragments then they were randomly considered for transplantation into γ irradiated mice as model A; or they were isolated and cultured up to fourth passages. 2×106 cultured stromal cells were transplanted into γ irradiated mice subcutaneously as model B. twenty days later the ectopic tissues in both models were studied morphologically by Periodic acid-Schiff and hematoxylin and eosin staining. The expression of osteopontin (OPN and matrix metalloproteinase 2 (MMP2 genes were also assessed using real time RT-PCR. 17-β estradiol levels of mice sera were compared before and after transplantation. Results: The endometrial like glands and stromal cells were formed in the implanted subcutaneous tissue of both endometriosis models. The gland sections per cubic millimeter, the expression of OPN and MMP2 genes and the level of 17-β estradiol were higher in model B than model A (p=0.03. Conclusion: Our observation demonstrated that endometrial mesenchymal stromal cells showed more efficiency to establish endometriosis model than human endometrial tissue fragments.

  18. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  19. Characterization of nifB, nifS, and nifU genes in the cyanobacterium Anabaena variabilis: NifB is required for the vanadium-dependent nitrogenase.

    OpenAIRE

    Lyons, E M; Thiel, T

    1995-01-01

    Anabaena variabilis ATCC 29413 is a heterotrophic, nitrogen-fixing cyanobacterium containing both a Mo-dependent nitrogenase encoded by the nif genes and V-dependent nitrogenase encoded by the vnf genes. The nifB, nifS, and nifU genes of A. variabilis were cloned, mapped, and partially sequenced. The fdxN gene was between nifB and nifS. Growth and acetylene reduction assays using wild-type and mutant strains indicated that the nifB product (NifB) was required for nitrogen fixation not only by...

  20. Platelet-derived growth factor (PDGF) B-chain gene expression by activated blood monocytes precedes the expression of the PDGF A-chain gene

    International Nuclear Information System (INIS)

    Martinet, Y.; Jaffe, H.A.; Yamauchi, K.; Betsholtz, C.; Westermark, B.; Heldin, C.H.; Crystal, R.G.

    1987-01-01

    When activated, normal human blood monocytes are known to express the c-sis proto-oncogene coding for PDGF B-chain. Since normal human platelet PDGF molecules are dimers of A and B chains and platelets and monocytes are derived from the same marrow precursors, activated blood monocytes were simultaneously evaluated for their expression of PDGF A and B chain genes. Human blood monocytes were purified by adherence, cultured with or without activation by lipopolysaccharide and poly(A)+ RNA evaluated using Northern analysis and 32 P-labeled A-chain and B-chain (human c-sis) probes. Unstimulated blood monocytes did not express either A-chain or B-chain genes. In contrast, activated monocytes expressed a 4.2 kb mRNA B-chain transcript at 4 hr, but the B-chain mRNA levels declined significantly over the next 18 hr. In comparison, activated monocytes expressed very little A-chain mRNA at 4 hr, but at 12 hr 1.9, 2.3, and 2.8 kb transcripts were observed and persisted through 24 hr. Thus, activation of blood monocytes is followed by PDGF B-chain gene expression preceding PDGF A-chain gene expression, suggesting a difference in the regulation of the expression of the genes for these two chains by these cells

  1. The design of the ZEUS tracking trigger and studies of b quark fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Silvester, I M

    1989-01-01

    This thesis consists of two parts, describing two very different aspects of experimental elementary particle physics. The first part describes, in detail, the design and estimated performance of a hardware track finding trigger processor. This processor is being built as part of the trigger for the ZEUS experiment, one of the two experiments being built to take data at the HERA electron-proton collider, currently under construction at the DESY laboratories in Hamburg. By using information from the main tracking chamber, the CTD, to reject data from events taking place outside the interaction region, this processor should be able to reduce the event rate from a beam crossing rate of 10{sup 6} s{sup -1} to approximately 9500 s{sup -1}. Used in conjunction with a trigger processor processing calorimeter data it should be able to achieve the desired first level trigger rate of 1 kHz. The second part describes two measurements of the fragmentation variable z for b quarks, made using a b enriched sample of 381 jets taken from the 31000 hadronic events with a centre of mass energy of 35 GeV observed with the TASSO detector during 1986. These measurements, obtained from the mean charged multiplicity and the rapidity distribution, have largely independent systematic uncertainties. The values obtained for (z{sub b}) were combined to give a value of 0.87{+-}0.02{+-}0.04. (author).

  2. Thrombosis in Hb Taybe [codons 38/39 (-ACC) (α1)

    DEFF Research Database (Denmark)

    Juul, Maja Bech; Vestergaard, Hanne; Petersen, Jesper

    2012-01-01

    Hb Taybe is a highly unstable hemoglobin (Hb) variant caused by a 3 bp deletion at codons 38/39 (-ACC) on the α1-globin gene. We report for the first time, a patient with a compound heterozygosity for Hb Taybe and a 5 bp deletion at the splice donor site of IVS-I on the α2-globin gene and ischemic...

  3. Analysis of dissimilatory sulfite reductase and 16S rRNA gene fragments from deep-sea hydrothermal sites of the Suiyo Seamount, Izu-Bonin Arc, Western Pacific.

    Science.gov (United States)

    Nakagawa, Tatsunori; Ishibashi, Jun-Ichiro; Maruyama, Akihiko; Yamanaka, Toshiro; Morimoto, Yusuke; Kimura, Hiroyuki; Urabe, Tetsuro; Fukui, Manabu

    2004-01-01

    This study describes the occurrence of unique dissimilatory sulfite reductase (DSR) genes at a depth of 1,380 m from the deep-sea hydrothermal vent field at the Suiyo Seamount, Izu-Bonin Arc, Western Pacific, Japan. The DSR genes were obtained from microbes that grew in a catheter-type in situ growth chamber deployed for 3 days on a vent and from the effluent water of drilled holes at 5 degrees C and natural vent fluids at 7 degrees C. DSR clones SUIYOdsr-A and SUIYOdsr-B were not closely related to cultivated species or environmental clones. Moreover, samples of microbial communities were examined by PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene. The sequence analysis of 16S rRNA gene fragments obtained from the vent catheter after a 3-day incubation revealed the occurrence of bacterial DGGE bands affiliated with the Aquificae and gamma- and epsilon-Proteobacteria as well as the occurrence of archaeal phylotypes affiliated with the Thermococcales and of a unique archaeon sequence that clustered with "Nanoarchaeota." The DGGE bands obtained from drilled holes and natural vent fluids from 7 to 300 degrees C were affiliated with the delta-Proteobacteria, genus Thiomicrospira, and Pelodictyon. The dominant DGGE bands retrieved from the effluent water of casing pipes at 3 and 4 degrees C were closely related to phylotypes obtained from the Arctic Ocean. Our results suggest the presence of microorganisms corresponding to a unique DSR lineage not detected previously from other geothermal environments.

  4. Artificial Synthesis of Conserved Segment S Gene Fragment of Rift ...

    African Journals Online (AJOL)

    Fragment of Rift Valley Fever Virus and Preliminary Study of Its Reverse ... blindness, encephalitis, hemorrhagic hepatitis, and, in serious ... over 30 mosquito species [5] of mosquito. As ..... RVFV, as a mosquito-borne virus for a multitude.

  5. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  6. Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

    Energy Technology Data Exchange (ETDEWEB)

    Serrano, Vesna de; D’Antonio, Jennifer; Franzen, Stefan; Ghiladi, Reza A., E-mail: reza-ghiladi@ncsu.edu [North Carolina State University (United States)

    2010-05-01

    The crystal structure of dehaloperoxidase (DHP) isoenzyme B from the terebellid polychaete A. ornata, which exhibits both hemoglobin and peroxidase functions, has been determined at 1.58 Å resolution. As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHP B refined to 1.58 Å resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distal and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure–function relationships.

  7. Genetic variation of the major histocompatibility complex (MHC class II B gene in the threatened Hume's pheasant, Syrmaticus humiae.

    Directory of Open Access Journals (Sweden)

    Weicai Chen

    Full Text Available Major histocompatibility complex (MHC genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB exon 2 in a wild population of Hume's pheasant (Syrmaticus humiae, which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume's pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume's pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume's pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume's pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume's pheasant MHC after suffering extreme habitat fragmentation.

  8. Enhanced salt tolerance of alfalfa (Medicago sativa) by rstB gene transformation.

    Science.gov (United States)

    Zhang, Wan-Jun; Wang, Tao

    2015-05-01

    Generating salt tolerance forage plant is essential for use of the land affected by high salinity. A salt tolerance gene rstB was used as a selectable marker gene in Agrobacterium-mediated transformation of tobacco under a selective regime of 170mM NaCl. The transgenic plants showed clear improvement in salt tolerance. To improve salt tolerance of alfalfa (Medicago sativa L.), rstB gene was introduced into alfalfa genome by Agrobacterium-mediated transformation. No abnormal phenotype was observed among the transgenic plants when compared with wild type (wt) plants. Significant enhancement of resistance to salt-shock treatment was noted on the rstB transgenic (T0) plants. Transgenic second-generation (T1) seeds showed improved germination rate and seedling growth under salt-stress condition. Hindered Na(+) accumulation, but enhanced Ca(2+) accumulation was observed on the rstB T1 plants when subjected to salt-stresses. Enhanced calcium accumulation in transgenic plants was also verified by cytohistochemical localization of calcium. Under salt-stress of 50mM NaCl, about 15% of the transgenic plants finished their life-cycle but the wt plants had no flower formation. The results demonstrated that the expression of rstB gene improved salt tolerance in transgenic alfalfa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. The Role of TonB Gene in Edwardsiella ictaluri Virulence

    Directory of Open Access Journals (Sweden)

    Hossam Abdelhamed

    2017-12-01

    Full Text Available Edwardsiella ictaluri is a Gram-negative facultative intracellular pathogen that causes enteric septicemia in catfish (ESC. Stress factors including poor water quality, poor diet, rough handling, overcrowding, and water temperature fluctuations increase fish susceptibility to ESC. The TonB energy transducing system (TonB-ExbB-ExbD and TonB-dependent transporters of Gram-negative bacteria support active transport of scarce resources including iron, an essential micronutrient for bacterial virulence. Deletion of the tonB gene attenuates virulence in several pathogenic bacteria. In the current study, the role of TonB (NT01EI_RS07425 in iron acquisition and E. ictaluri virulence were investigated. To accomplish this, the E. ictaluri tonB gene was in-frame deleted. Growth kinetics, iron utilization, and virulence of the EiΔtonB mutant were determined. Loss of TonB caused a significant reduction in bacterial growth in iron-depleted medium (p > 0.05. The EiΔtonB mutant grew similarly to wild-type E. ictaluri when ferric iron was added to the iron-depleted medium. The EiΔtonB mutant was significantly attenuated in catfish compared with the parent strain (21.69 vs. 46.91% mortality. Catfish surviving infection with EiΔtonB had significant protection against ESC compared with naïve fish (100 vs. 40.47% survival. These findings indicate that TonB participates in pathogenesis of ESC and is an important E. ictaluri virulence factor.

  10. A Novel Wheat C-bZIP Gene, TabZIP14-B, Participates in Salt and Freezing Tolerance in Transgenic Plants

    Directory of Open Access Journals (Sweden)

    Lina Zhang

    2017-05-01

    Full Text Available The group C-bZIP transcription factors (TFs are involved in diverse biological processes, such as the regulation of seed storage protein (SSP production and the responses to pathogen challenge and abiotic stress. However, our knowledge of the abiotic functions of group C-bZIP genes in wheat remains limited. Here, we present the function of a novel TabZIP14-B gene in wheat. This gene belongs to the group C-bZIP TFs and contains six exons and five introns; three haplotypes were identified among accessions of tetraploid and hexaploid wheat. A subcellular localization analysis indicated that TabZIP14-B was targeted to the nucleus of tobacco epidermal cells. A transactivation assay demonstrated that TabZIP14-B showed transcriptional activation ability and was capable of binding the abscisic acid (ABA responsive element (ABRE in yeast. RT-qPCR revealed that TabZIP14-B was expressed in the roots, stems, leaves, and young spikes and was up-regulated by exogenous ABA, salt, low-temperature, and polyethylene glycol (PEG stress treatments. Furthermore, Arabidopsis plants overexpressing TabZIP14-B exhibited enhanced tolerance to salt, freezing stresses and ABA sensitivity. Overexpression of TabZIP14-B resulted in increased expression of the AtRD29A, AtCOR47, AtRD20, AtGSTF6, and AtRAB18 genes and changes in several physiological characteristics. These results suggest that TabZIP14-B could function as a positive regulator in mediating the abiotic stress response.

  11. Trends in gastrectomy and ADH1B and ALDH2 genotypes in Japanese alcoholic men and their gene-gastrectomy, gene-gene and gene-age interactions for risk of alcoholism.

    Science.gov (United States)

    Yokoyama, Akira; Yokoyama, Tetsuji; Matsui, Toshifumi; Mizukami, Takeshi; Kimura, Mitsuru; Matsushita, Sachio; Higuchi, Susumu; Maruyama, Katsuya

    2013-01-01

    The life-time drinking profiles of Japanese alcoholics have shown that gastrectomy increases susceptibility to alcoholism. We investigated the trends in gastrectomy and alcohol dehydrogenase-1B (ADH1B) and aldehyde dehydrogenase-2 (ALDH2) genotypes and their interactions in alcoholics. This survey was conducted on 4879 Japanese alcoholic men 40 years of age or older who underwent routine gastrointestinal endoscopic screening during the period 1996-2010. ADH1B/ALDH2 genotyping was performed in 3702 patients. A history of gastrectomy was found in 508 (10.4%) patients. The reason for the gastrectomy was peptic ulcer in 317 patients and gastric cancer in 187 patients. The frequency of gastrectomy had gradually decreased from 13.3% in 1996-2000 to 10.5% in 2001-2005 and to 7.8% in 2006-2010 (P alcoholism-susceptibility genotypes, ADH1B*1/*1 and ALDH2*1/*1, modestly but significantly tended not to occur in the same individual (P = 0.026). The frequency of ADH1B*1/*1 decreased with ascending age groups. The high frequency of history of gastrectomy suggested that gastrectomy is still a risk factor for alcoholism, although the percentage decreased during the period. The alcoholism-susceptibility genotype ADH1B*1/*1 was less frequent in the gastrectomy group, suggesting a competitive gene-gastrectomy interaction for alcoholism. A gene-gene interaction and gene-age interactions regarding the ADH1B genotype were observed.

  12. Effects of gene silencing of CypB on gastric cancer cells.

    Science.gov (United States)

    Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

    2015-04-01

    To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

  13. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  14. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  15. Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Christiansen, Gunna

    1994-01-01

    of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...

  16. Long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region upregulating the allele-specific MYC expression in HeLa cells.

    Science.gov (United States)

    Shen, Congle; Liu, Yongzhen; Shi, Shu; Zhang, Ruiyang; Zhang, Ting; Xu, Qiang; Zhu, Pengfei; Chen, Xiangmei; Lu, Fengmin

    2017-08-01

    Human papillomavirus (HPV) infection is the most important risk factor for cervical cancer development. In HeLa cell line, the HPV viral genome is integrated at 8q24 in one allele of chromosome 8. It has been reported that the HPV fragment integrated in HeLa genome can cis-activate the expression of proto-oncogene MYC, which is located at 500 kb downstream of the integrated site. However, the underlying molecular mechanism of this regulation is unknown. A recent study reported that MYC was highly expressed exclusively from the HPV-integrated haplotype, and a long-range chromatin interaction between the integrated HPV fragment and MYC gene has been hypothesized. In this study, we provided the experimental evidences supporting this long-range chromatin interaction in HeLa cells by using Chromosome Conformation Capture (3C) method. We found that the integrated HPV fragment, MYC and 8q24.22 was close to each other and might form a trimer in spatial location. When knocking out the integrated HPV fragment or 8q24.22 region from chromosome 8 by CRISPR/Cas9 system, the expression of MYC reduced dramatically in HeLa cells. Interestingly, decreased expression was only observed in three from eight cell clones, when only one 8q24.22 allele was knocked out. Functionally, HPV knockout caused senescence-associated acidic β-gal activity in HeLa cells. These data indicate a long-distance interaction of the integrated HPV fragment with MYC gene and 8q24.22 region, providing an alternative mechanism relevant to the carcinogenicity of HPV integration. © 2017 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  17. Diagnostic value of immunoglobulin κ light chain gene rearrangement analysis in B-cell lymphomas.

    Science.gov (United States)

    Kokovic, Ira; Jezersek Novakovic, Barbara; Novakovic, Srdjan

    2015-03-01

    Analysis of the immunoglobulin κ light chain (IGK) gene is an alternative method for B-cell clonality assessment in the diagnosis of mature B-cell proliferations in which the detection of clonal immunoglobulin heavy chain (IGH) gene rearrangements fails. The aim of the present study was to evaluate the added value of standardized BIOMED-2 assay for the detection of clonal IGK gene rearrangements in the diagnostic setting of suspected B-cell lymphomas. With this purpose, 92 specimens from 80 patients with the final diagnosis of mature B-cell lymphoma (37 specimens), mature T-cell lymphoma (26 specimens) and reactive lymphoid proliferation (29 specimens) were analyzed for B-cell clonality. B-cell clonality analysis was performed using the BIOMED-2 IGH and IGK gene clonality assays. The determined sensitivity of the IGK assay was 67.6%, while the determined sensitivity of the IGH assay was 75.7%. The sensitivity of combined IGH+IGK assay was 81.1%. The determined specificity of the IGK assay was 96.2% in the group of T-cell lymphomas and 96.6% in the group of reactive lesions. The determined specificity of the IGH assay was 84.6% in the group of lymphomas and 86.2% in the group of reactive lesions. The comparison of GeneScan (GS) and heteroduplex pretreatment-polyacrylamide gel electrophoresis (HD-PAGE) methods for the analysis of IGK gene rearrangements showed a higher efficacy of GS analysis in a series of 27 B-cell lymphomas analyzed by both methods. In the present study, we demonstrated that by applying the combined IGH+IGK clonality assay the overall detection rate of B-cell clonality was increased by 5.4%. Thus, we confirmed the added value of the standardized BIOMED-2 IGK assay for assessment of B-cell clonality in suspected B-cell lymphomas with inconclusive clinical and cyto/histological diagnosis.

  18. rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

    Science.gov (United States)

    Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

    2018-03-01

    The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  19. Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

    OpenAIRE

    Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

    1981-01-01

    Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

  20. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.