WorldWideScience

Sample records for azufre elemental sobre

  1. ESTUDIO DE LA REDUCCION DE AZUFRE ELEMENTAL Y PRODUCCION DE SULFURO DE HIDROGENO EN BIREACTORES ANAEROBICOS.

    OpenAIRE

    ESCOBAR ANTOINE, CLAUDIO MANUEL

    2009-01-01

    En el presente trabajo de tesis se estudió la reducción de azufre elemental y la producción de sulfuro de hidrógeno en dos diferentes tipos de bioreactores: reactor agitado mecánicamente y reactor gaslft. La importancia de este estudio radica en la compre 128p.

  2. Naturally occurring heavy radioactive elements in the geothermal microcosm of the Los Azufres (Mexico) volcanic complex.

    Science.gov (United States)

    Abuhani, W A; Dasgupta-Schubert, N; Villaseñor, L M; García Avila, D; Suárez, L; Johnston, C; Borjas, S E; Alexander, S A; Landsberger, S; Suárez, M C

    2015-01-01

    The Los Azufres geothermal complex of central Mexico is characterized by fumaroles and boiling hot-springs. The fumaroles form habitats for extremophilic mosses and ferns. Physico-chemical measurements of two relatively pristine fumarolic microcosms point to their resemblance with the paleo-environment of earth during the Ordovician and Devonian periods. These geothermal habitats were analysed for the distribution of elemental mass fractions in the rhizospheric soil (RS), the native volcanic substrate (VS) and the sediments (S), using the new high-sensitivity technique of polarized x-ray energy dispersive fluorescence spectrometry (PEDXRF) as well as instrumental neutron activation analysis (INAA) for selected elements. This work presents the results for the naturally occurring heavy radioactive elements (NOHRE) Bi, Th and U but principally the latter two. For the RS, the density was found to be the least and the total organic matter content the most. Bi was found to be negligibly present in all substrate types. The average Th and U mass fractions in the RS were higher than in the VS and about equal to their average mass fractions in the S. The VS mass fraction of Th was higher, and of U lower, than the mass fractions in the earth's crust. In fact for the fumaroles of one site, the average RS mass fractions of these elements were higher than the averaged values for S (without considering the statistical dispersion). The immobilization of the NOHRE in the RS is brought about by the bio-geochemical processes specific to these extremophiles. Its effectiveness is such that despite the small masses of these plants, it compares with, or may sometimes exceed, the immobilization of the NOHRE in the S by the abiotic and aggressive chemical action of the hot-springs. These results indicate that the fumarolic plants are able to transform the volcanic substrate to soil and to affect the NOHRE mass fractions even though these elements are not plant nutrients. Mirrored back to

  3. Los métodos multivariados para evaluar el efecto de la reducción de azufre en petrolíferos sobre los niveles de bióxido de azufre atmosférico

    OpenAIRE

    Ma. Magdalena Nava; José Luis Bravo; Jorge Raúl Gasca

    2003-01-01

    Se estudia el efecto de la disminución en la concentración de azufre en los petrolíferos utilizados en la Zona Metropolitana de la Ciudad de México (ZMCM), en la concentración del bióxido de azufre (SO2) atmosférico durante el periodo de 1986 a 2001. Para este fin se elaboró una memoria cronológica para identificar la vigencia de las estrategias para mejorar la calidad del aire en este periodo de quince años, en particular, la reformulación y sustitución de diversos petrolíferos para reducir ...

  4. Comentarios críticos de la Norma UNE 7245 sobre "determinación de los compuestos de azufre contenidos en los áridos"

    Directory of Open Access Journals (Sweden)

    Calleja, José

    1982-06-01

    Full Text Available This paper shows some deficiences of the Spanish Standard Method UNE 7245 and the corresponding deficiences of the Spanish Concrete Code EH-SO adopting it. According to the actual Method, erroneous low values may result in determining sulphides and in general sulphur compounds in cocrete aggregates. Attention is drawn to the convenience of revising the limit of 1.2 per cent for the admissible maximum value of such compounds, particularly if they are exclusively formed by pyrites.

    Se ponen de relieve en este trabajo ciertas definiciones de la Norma UNE 7245 y las correspondientes de la Instrucción EH-80 que la adopta, en cuanto que la citada Norma puede dar valores erróneos por defecto en la determinación de sulfures y, en general, de compuestos de azufre en áridos para hormigón. Se llama la atención sobre la conveniencia de revisar el límite de 1,2 por ciento para el contenido máximo tolerable de dichos compuestos, particularmente si están constituidos en exclusiva por piritas.

  5. Efecto del contenido de azufre y del grado de desoxidación sobre la ductilidad en caliente de aceros inoxidables austeníticos resulfurados en estado de solidificación

    Directory of Open Access Journals (Sweden)

    Botella, J.

    1998-05-01

    Full Text Available The manufacture of free machining austenitic stainless steels features a specific drawback derived from their high sulphur content, which is needed for generating, into the austenitic matrix, inclusions to optimize the different machining operations. However, sulphur has a harmful effect on hot workability. This paper deals with assessing the effect of sulphur content and deoxidation level on the hot ductility of resulphurized austenitic stainless steels in as cast condition. Hot tensile tests were conducted on a Gleeble machine, at temperatures between 1,150 and 1,250°C, studying a ductility factor as a function of sulphur content, deoxidation degree, as well as type, size and distribution of sulfides. Results point out the harmful effect of increasing sulphur and oxygen contents on the hot workability of resulphurized austenitic stainless steels, and the need to control carefully the level of oxides of these steels.

    La fabricación de aceros inoxidables austeníticos de alta maquinabilidad presenta una problemática específica derivada de su elevado contenido de azufre; elemento necesario para generar en la matriz austenítica inclusiones que faciliten las diferentes operaciones de mecanizado, pero perjudicial en cuanto al deterioro que produce en la deformabilidad en caliente. Este artículo describe el estudio realizado para evaluar el efecto del contenido de azufre y el grado de desoxidación sobre la ductilidad en caliente de aceros inoxidables austeníticos resulfurados, partiendo de una estructura de solidificación (as cast condition. Se realizaron ensayos de tracción en un sistema Gleeble, a temperaturas entre 1.150 y 1.250°C, analizándose el parámetro de ductilidad en función del contenido de azufre, nivel de desoxidación, y del tipo, tamaño y distribución de los sulfuros presentes. Los resultados ponen de manifiesto el efecto perjudicial de los contenidos de azufre y oxígeno sobre la deformabilidad en

  6. Efecto del contenido de azufre sobre la meteorización del carbón: comparación de dos mantos en Hato de la Virgen (Fm. Carbonera, Venezuela

    Directory of Open Access Journals (Sweden)

    Galarraga, F.

    2000-08-01

    contenido de azufre ≻ 5 %; y la galería G-24, donde está presente el manto 24, cuya abundancia en este elemento no supera el 1,5 %. El objetivo del presente trabajo es evaluar el efecto del azufre en la extensión de la meteorización del carbón. Con fines comparativos, se cuenta con las respectivas muestras totalmente frescas, provenientes de núcleos de perforación. Los carbones fueron sometidos a los siguientes análisis: inmediatos (humedad, materia volátil, carbono fijo, cenizas, poder calórico, Indice de hinchamiento libre (FSI, análisis elemental (C, H, N, O, azufre total y sus formas (pirítico, sulfático y orgánico, y composición mayoritaria de las cenizas (Si, Al, Ca, Mg, Mn, Fe, K, Na, Cl, P. Adicionalmente, se obtuvieron sus espectros de infrarrojo, en el modo de Transformadas de Fourier. Sólo las muestras procedentes de los núcleos de perforación son totalmente frescas; las muestras colectadas dentro de las galerías manifiestan diferentes niveles de oxidación, detectada tanto por parámetros químicos (humedad, poder calórico, composición elemental y de las cenizas como por espectroscopia de infrarrojo (aparición de la banda de carbonilo, disminución de la absorción propia de estiramiento del enlace C-H. La presencia de azufre en alta proporción no modifica de manera apreciable ni el estilo ni la extensión de la oxidación de la matriz orgánica del carbón. Sin embargo, el azufre sí es responsable de variaciones importantes en el estilo de alteración de la matriz inorgánica, modificando el esquema de lixiviación de algunos elementos (principalmente Fe, y en menor extensión Si, P, K, que son removidos preferentemente, e inmovilizando otros (Ca, Mg, Mn mediante precipitación como sulfatos insolubles.

  7. Distribución de nitrógeno, fósforo y azufre en un cultivo de colza: efectos sobre el ciclado de nutrientes Distribution of nitrogen, phosphorus and sulfur in oilseed rape: effects on nutrient cycling

    Directory of Open Access Journals (Sweden)

    Gerardo Rubio

    2007-12-01

    Full Text Available Comparado con otros cultivos, la colza tiene una alta demanda de azufre (S por lo que sería esperable que la inclusión de este cultivo en la rotación agrícola acelere el agotamiento de este nutriente en los suelos de las áreas cultivadas. En este trabajo, se comparan los patrones de partición de biomasa, S, nitrógeno (N y fósforo (P en plantas maduras de colza. La información a obtener es relevante desde el punto de vista del ciclado de nutrientes. Para ello se realizó un experimento de campo que se ajustó a un arreglo factorial con dos factores (N y S. En el momento de la cosecha, se midió la acumulación de biomasa, N, P y S en tres compartimientos: granos, rastrojo (resto de parte aérea y raíces. Aunque el rendimiento fue afectado levemente por la adición individual de N o S, la simultánea adición de ambos nutrientes provocó un incremento del 56%. El N y el P presentaron una distribución semejante entre los órganos de la planta estudiados, sin embargo, el S difirió marcadamente de ambos. Su partición al órgano que se exporta (granos fue de menor magnitud que la observada para N y P. En cambio, su partición al rastrojo en pie fue mayor. Esta característica atenuaría los efectos de la alta demanda de S sobre la exportación del cultivo y permitiría una reutilización del fertilizante agregado por el cultivo siguiente.Oilseed rape poses a higher sulfur (S demand, compared to other crops. This may indicate that the inclusion of this crop in the crop rotation could accelerate soil S depletion. In this work, we compared the allocation of biomass, nitrogen (N, phosphorus (P and S in oilseed rape mature plants. Two factors were analyzed in a field experiment: nitrogen and sulphur (two levels for each factor. At harvest, we measured the accumulation of biomass, N, P and S in three compartments: roots, straw and grains. Yield was little affected by the addition of single nutrients but the simultaneous addition of N and S

  8. Eficiencia agronómica del azufre elemental relativa a una fuente azufrada soluble en trigo en la Región Pampeana Agronomic efficiency of elemental sulphur in wheat relative to a soluble sulphur source in the Pampas Region

    Directory of Open Access Journals (Sweden)

    Martin Torres Duggan

    2010-07-01

    Full Text Available La eficiencia agronómica del azufre elemental (AE en relación a fuentes azufradas solubles y sulfatadas, depende de su reactividad (e.g. tamaño de partícula y de las condiciones edafo-climáticas. Para las condiciones de la Región Pampeana algunas publicaciones sugieren que el AE puede ser una fuente de S tan efectiva como las fuentes solubles, aunque la información no concluyente. Se hipotetiza que en las condiciones de la Región Pampeana, ambas fuentes poseen similar eficiencia agronómica en la mayoría de los años. Los objetivos del trabajo fueron: i. Evaluar la respuesta al agregado de S con una fuente reactiva de AE en relación a un fertilizante azufrado sulfatado, aplicado en trigo en diferentes dosis y en distintas condiciones edafo-climáticas; ii. Comparar, para el conjunto de experimentos, la eficiencia agronómica del S aplicado con las distintas fuentes. iii. Relacionar las respuestas a la fertilización azufrada con variables de suelo y clima. Se realizaron ocho ensayos de campo durante dos años consecutivos en lotes de producción ubicados en la Región Pampeana. Se aplicó un diseño en bloques completos aleatorizados con cuatro o seis repeticiones en un arreglo factorial de tratamientos (factor 1: fuente azufrada, factor 2: dosis de S. Los tratamientos fueron: un testigo absoluto; fertilización con AE micronizado (95% de S en dos niveles de dosis y fertilización con sulfato de amonio granulado (SA, 24% S, también en dos niveles de dosis. Las dosis evaluadas fueron 10 y 30 kg ha-1 de S (año 1 y 15 y 30 kg ha¹ (año 2. La fertilización azufrada afectó significativamente (p0,05 en la mayoría de los sitios. La dosis más baja (10 o 15 kg ha-1 fue suficiente para cubrir el requerimiento de S del cultivo. Se observó una asociación positiva entre las respuestas y el contenido de MO del suelo y las precipitaciones (macollaje y total del ciclo y una relación inversa con el contenido de S-SO4(2- disponibles a la

  9. Thermal extraction analysis of five Los Azufres production wells

    Energy Technology Data Exchange (ETDEWEB)

    Kruger, Paul; Quijano, Luis

    1995-01-26

    Thermal energy extraction from five wells supplying 5-MWe wellhead generators in three zones of the Los Azufres geothermal field has been examined from production and chemical data compiled over 14-years of operation. The data, as annual means, are useful in observing small-scale changes in reservoir performance with continuous production. The chemical components are chloride for quality control and the geothermometer elements for reservoir temperatures. The flowrate and fluid enthalpy data are used to calculate the thermal extraction rates. Integration of these data provides an estimate of the total energy extracted from the zone surrounding the well. The combined production and chemical geothermometer data are used to model the produced fluid as coming from just-penetrating wells for which the annual produced mass originates from a series of concentric hemispheric shells moving out into the reservoir. Estimates are made of the drawdown distance into the reservoir and the far-field conditions.

  10. Environmental protection at the Los Azufres, Michoacan geothermal field; La proteccion ambiental en el campo geotermico de Los Azufres, Michoacan

    Energy Technology Data Exchange (ETDEWEB)

    Mendoza Rangel, Ernesto; Hernandez Ayala, Cuauhtemoc [Comision Federal de Electricidad, Morelia, Michoacan (Mexico)

    2004-12-01

    Geothermal-electric development is a sustainable activity from an environmental viewpoint, as is proved by the operation and management of the Los Azufres geothermal field. Impacts to soil and vegetation can be prevented and adequately mitigated. Liquid residues can be returned to the reservoir avoiding contaminating surface and ground waters and aquifers; and atmospheric emissions can kept bellow allowable limits. The main environmental technical experiences of Comision Federal de Electricidad (CFE) in this field are presented in this paper. [Spanish] El desarrollo geotermoelectrico es una actividad sustentable desde el punto de vista ambiental, como lo prueba el manejo del campo geotermico de Los Azufres. Los impactos al suelo y a la vegetacion pueden prevenirse y mitigarse con las medidas adecuadas. Los desechos liquidos pueden regresarse al yacimiento sin contaminar cuerpos de agua superficiales o acuiferos someros, y las emisiones a la atmosfera pueden controlarse para mantenerlas dentro de limites permisibles. Se presentan las principales experiencias tecnicas de tipo ambiental obtenidas por la Comision Federal de Electricidad (CFE) en ese campo.

  11. Lichens as biological monitors in the Los Azufres geothermal field, Michoacan, Mexico; Liquenes como indicadores biologicos en el campo geotermico Los Azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Gomez Peralta, Marlene; Chavez Carmona, Arturo [Universidad Michoacana de San Nicolas de Hidalgo, Morelia (Mexico)

    1995-09-01

    The results obtained in the monitoring of the atmospheric emissions of the Los Azufres geothermal field in Michoacan State, Mexico utilizing lichens as monitors of the presence of sulphur and arsenic, at the areas near geothermal sites, both under evaluation and production, are presented. The results are based on symptoms which included: chlorosis, necrosis, brown and reddish spots, loss of adherence to substrate, thalli disintegration and disappearance of sensitive species; and also on the amounts of sulphur and arsenic contained in the lichens thallus. [Espanol] Se presentan los resultados obtenidos en el monitoreo de las emisiones atmosfericas del campo geotermico Los Azufres, Michoacan, Mexico en el que se utilizaron liquenes como indicadores de la presencia de azufre y arsenico, en las areas cercanas a los sitios de pozos geotermicos tanto en evaluacion como en produccion. Los resultados estan basados en sintomas que incluyen clorosis, necrosis, manchas cafes y rojizas, perdida de adherencia al sustrato, desintegracion del talo y desaparicion de especies sensibles; asi como en los contenidos de azufre y arsenico en los talos liquenicos.

  12. Development of a numerical hydraulic model of the Los Azufres steam pipeline network

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Gutierrez, Alfonso; Martinez-Estrella, Juan Ignacio; Hernandez-Ochoa, Abel Felipe; Verma, Mahendra P. [Instituto de Investigaciones Electricas, Ave. Reforma 113, Col. Palmira, 62490 Cuernavaca, Mor. (Mexico); Mendoza-Covarrubias, Alfredo; Ruiz-Lemus, Alejandro [Comision Federal de Electricidad, Campo Geotermico Los Azufres, Campamento Agua Fria, Mich. (Mexico)

    2009-09-15

    The development and documentation of a hydraulic model of the steam pipeline network at the Los Azufres geothermal field is presented, as well as the results obtained using one- and two-phase numerical simulators. Flow simulations were performed to determine pressure and heat losses, flow directions and velocities in that network. Computed well pressures agree within {+-}10% with measured values, except in three of the 41 wells in the system where the differences are between 10% and 13%. Computed and measured steam flow rates entering the Los Azufres geothermal power plants agree within 10%, with the exception of one that showed a 26.7% difference. This is most likely due to a mismatch between the reported and actual flow rates delivered by the pipeline network. The computed results are considered highly satisfactory given the complexity of the Los Azufres network. (author)

  13. Origin of rainwater acidity near the Los Azufres geothermal field, Mexico

    Science.gov (United States)

    Verma, M.P.; Quijano, J.L.; Johnson, Chad; Gerardo, J.Y.; Arellano, V.

    2000-01-01

    The chemical and isotopic compositions of rainwater were monitored at Los Azufres geothermal field (88 MWe) and its surroundings during May - September 1995, which is the rainy season. Samples were collected from eight sites: three within the field, three in its surroundings and two sufficiently far from the field such that they have no geothermal input. The concentrations of Cl-, SO42- and NO3- were measured in about 350 samples and found to be generally geothermal wells are in the range -3.4 to 0.0???. The ??34S ranges for the natural and anthropogenic sources for environmental sulfur overlap, making it difficult to differentiate between the contribution of different sources. However, a similarity of values of ??34S at Los Azufres and Morelia (85 km distant) suggest a regional source of sulfate that is not associated with geothermal emissions from Los Azufres. (C) 2000 Published by Elsevier Science Ltd on behalf of CNR.The chemical compositions of rainwater were analyzed at Los Azufres geothermal field in Spain from May-September 1995. The concentrations of Cl-, SO42- and NO3- were measured and found to be generally <5 ppm. Chloride concentrations remained constant with time, but sulfate and nitrate concentrations decreased, suggesting a nearby industrial source. A mixing model for Cl-, SO42-, and ??34S also suggested an industrial source for the rainwater sulfur.

  14. Hydro-geochemical and isotopic fluid evolution of the Los Azufres caldera geothermal field, Central Mexico

    Science.gov (United States)

    González-Partida, E.; Viggiano-Guerra, J. C.; Pérez, R. J.

    2008-10-01

    Hydrothermal alteration at Los Azufres geothermal held is mostly propylitic showing progressive dehydration with depth, and temperature increase. The evolution of this system is inferred to be related to deep liquid water, boiling when ascending through fractures connected to the surface.

  15. Response to exploitation (1982-2002) of the Los Azufres, Michoacan (Mexico) geothermal field. Part II: South Zone; Respuesta a la explotacion (1982-2003) del yacimiento geotermico de Los Azufres, Michoacan (Mexico). Parte II: Zona Sur

    Energy Technology Data Exchange (ETDEWEB)

    Arellano G, Victor Manuel [Instituto de Investigaciones Electricas, Cuernavaca, Morelos, (Mexico); Torres R, Marco Antonio [Comision Federal de Electricidad, Morelia, Michoacan (Mexico); Barragan R, Rosa Maria [Instituto de Investigaciones Electricas, Cuernavaca, Morelos, (Mexico); Sandoval M, Fernando [Comision Federal de Electricidad, Morelia, Michoacan (Mexico)

    2005-06-01

    The paper describes the thermodynamic evolution of fluids in the Los Azufres geothermal field's southern zone reservoir, as a response to exploitation from 1982 to 2002. Thermodynamic conditions for the reservoir fluids were estimated with production data using the WELFLO heat-and-flow well simulator. In the southern zone, initial fluid thermodynamic conditions indicated that compressed liquid, two-phase fluids and vapor occurred in the reservoir, depending on the well depths. The fist response to exploitation consisted in a pressure drop an enthalpy increase. For the long term, the following patterns have been identified: pressure and mass flow-rate drop, boiling, cooling, vapor production and in some wells affected by injection an increase in both pressure and mass flow rate. The isotopic results of well fluids in the southern zone showed the occurrence of two processes. The first, with a positive slope, indicates a mixing of reservoir and injection fluids and mainly affects wells Az-2, Az-16, Az-33, Az-36 and Az-46. The second, with a negative slope, results from the original processes of reservoir steam separation and partial condensation. [Spanish] En este trabajo se presenta un estudio sobre la evolucion termodinamica de los fluidos de la zona sur del yacimiento de Los Azufres, como respuesta a la extraccion e inyeccion de fluidos, desde el inicio de su explotacion en 1982 hasta el ano 2002. Las condiciones termodinamicas de los fluidos del yacimiento se estimaron mediante el simulador de flujo de fluidos y calor en pozos WELFLO, a partir de datos de produccion. Las condiciones termodinamicas iniciales de los fluidos de la zona sur, indicaron la existencia de liquido comprimido, dos fases con liquido dominante y dos fases con vapor dominante, dependiendo de la profundidad de los pozos. La respuesta inicial de la zona sur a la explotacion consistio en una disminucion de la presion y un aumento en la entalpia mientras que a mas largo plazo se han observado

  16. Response to exploitation (1982-2002) of the Los Azufres, Michoacan (Mexico) geothermal field. Part I: North Zone; Respuesta a la explotacion (1982-2003) del yacimiento geotermico de Los Azufres, Michoacan (Mexico). Parte I: Zona Norte

    Energy Technology Data Exchange (ETDEWEB)

    Arellano G, Victor Manuel; Barragan R, Rosa Maria [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico); Torres R, Marco Antonio; Sandoval M, Fernando [Comision Federal de Electricidad, Morelia, Michoacan (Mexico)

    2004-12-01

    This work studies the thermodynamic evolution of the Los Azufres northern zone reservoir fluids as a response of exploitation since 1982 to 2002 is presented. Thermodynamic conditions for reservoir fluids were estimated using the WELFLO heat-and flow-well simulator, using production data as the input. The initial thermodynamic conditions of the north zone wells indicated the presence of compressed liquid; also it was noticed that the first response to exploitation was a pressure drop and an enthalpy increase, while the long term response indicated a very small pressure change but a high enthalpy increment. The analysis of production, chemical and isotopic (d18O, dD) data in this zone showed interference effects of fluids reinjected in well Az-52 on well Az-5; and in well Az-15 on wells Az-13, Az-28 and Az-43. At the present time due to the low injection flow rates, this effect is minimal. [Spanish] En este trabajo se presenta un estudio sobre la evolucion termodinamica de los fluidos de la zona norte del yacimiento de Los Azufres desde el inicio de su explotacion en 1982 hasta el ano 2002, considerando las condiciones de fondo de pozos del campo, como respuesta a la extraccion e inyeccion de fluidos. Las condiciones termodinamicas de los fluidos del yacimiento se estimaron mediante el simulador del flujo de fluidos y calor en pozos {sup W}ELFLO{sup ,} a partir de datos de produccion. Las condiciones termodinamicas iniciales de los fluidos de la zona norte de campo se encontraron en la region de liquido comprimido; la primera respuesta a la explotacion consistio en una disminucion de presion y un incremento en la entalpia. A largo plazo, se observaron cambios muy pequenos en la presion y grandes incrementos en la entalpia. El analisis de datos quimicos, isotopicos (d18O, dD) y de produccion de pozos en la zona norte evidencio la ocurrencia de interferencia de fluidos de reinyeccion del pozo Az-52 con el pozo Az-5 y del pozo Az-15 con los pozos Az-13, Az-28 y Az 43

  17. INITIAL CHEMICAL AND RESERVOIR CONDITIONS AT LOS AZUFRES WELLHEAD POWER PLANT STARTUP

    Energy Technology Data Exchange (ETDEWEB)

    Kruger, P.; Semprini, L.; Verma, S.; Barragan, R.; Molinar, R.; Aragon, A.; Ortiz, J.; Miranda, C.

    1985-01-22

    One of the major concerns of electric utilities in installing geothermal power plants is not only the longevity of the steam supply, but also the potential for changes in thermodynamic properties of the resource that might reduce the conversion efficiency of the design plant equipment. Production was initiated at Los Azufres geothermal field with wellhead generators not only to obtain electric energy at a relatively early date, but also to acquire needed information about the resource so that plans for large central power plants could be finalized. Commercial electric energy production started at Los Azufres during the summer of 1982 with five 5-MWe wellhead turbine-generator units. The wells associated with these units had undergone extensive testing and have since been essentially in constant production. The Los Azufres geothermal reservoir is a complex structural and thermodynamic system, intersected by at least 4 major parallel faults and producing geothermal fluids from almost all water to all steam. The five wellhead generators are associated with wells of about 30%, 60%, and 100% steam fraction. A study to compile existing data on the chemical and reservoir conditions during the first two years of operation has been completed. Data have been compiled on mean values of wellhead and separator pressures, steam and liquid flowrates, steam fraction, enthalpy, and pertinent chemical components. The compilation serves both as a database of conditions during the start-up period and as an initial point to observe changes with continued and increased production. Current plans are to add additional wellhead generators in about two years followed by central power plants when the data have been sufficiently evaluated for optimum plant design. During the next two years, the data acquired at the five 5-MWe wellhead generator units can be compared to this database to observe any significant changes in reservoir behavior at constant production.

  18. Radon studies for extending Los Azufres geothermal energy field in Mexico

    CERN Document Server

    Tavera, L; Camacho, M E; Chavez, A; Pérez, H; Gómez, J

    1999-01-01

    Los Azufres is a 98 MW producing geothermal energy field situated in the Mexican volcanic belt at the west part of the country. Recently, hydrothermal activity and geochemical analysis of geothermal fluids from the north part of the geothermal field gave indications of a possible geothermal-production area, similar to the already producing field. In order to investigate the activity of geological structures, which are considered the means of geothermal fluids transporters, radon mapping was carried out using sets of 240 LR-115 detectors in the area of interest. Radon values higher than 10 kBq m sup - sup 3 were considered anomalous and indicative of geothermal anomalies.

  19. Remote sensing in the study of the perspective of enlargement of the geothermal area of Los Azufres field, Michoacan, Mexico; Utilizacion de la teledeteccion para estudiar las perspectivas de ampliacion de la zona geotermica de Los azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Antaramian H, Eduardo; Garduno M, Victor Hugo [UMSNH, (Mexico)

    1999-12-01

    The results are presented of a remote sensing study in Los Azufres Geothermal field. Data of a volcanological study have been used. Standing out is the importance of a resurgence phenomenon in the volcanic evolution of the caldera of Los Azufres and its observed relationships with thermal anomalies outsides the area of well known geothermal resources in the field. On the basis of these data, we suggest additional remote sensing studies in different geothermal areas to identify blind resources or large thermal anomaly outsides the well know ones in developed geothermal fields. [Spanish] En este trabajo se presentan los resultados de un estudio de teledeteccion en la zona geotermica de Los Azufres, Michoacan, Mexico. En el se han utilizado los datos obtenidos de un estudio volcanologico que resalta la importancia de un fenomeno de resurgencia en la evolucion volcanologica de la Caldera de los Azufres y su relacion con anomalias termicas fuera de la zona de explotacion del campo geotermico. Con base en estos resultados se propone que sean retomados los datos de diferentes campos geotermicos con la finalidad de hacer estudios de exploracion mediante teledeteccion en campos ciegos o bien en aquellos ya desarrollados que presentan anomalias termicas mayores fuera de las ya conocidas.

  20. Chemical and isotopic characterization of rainwater in Los Azufres, Michoacan, Mexico and its surroundings. Caracterizacion quimica e isotopica de las precipitaciones pluviales en el campo geotermico de Los Azufres, Michoacan, Mexico y en zonas de referencia

    Energy Technology Data Exchange (ETDEWEB)

    Verma, Mahendra Pal (Instituto de Investigaciones Electricas, Cuernavaca (Mexico)); Barrera Gonzalez, Victor; Sandoval Medina, Fernando; Tapia Salazar, Ruth; Casimiro Espinoza, Emigdio (Residencia de Los Azufres, Morelia (Mexico)); Fernandez Solorzano, Ma Elena (Departamento de Exploracion, Gerencia de Proyectos Geotermoelectricos de la Comision Federal de Electricidad, Morelia (Mexico)); Rye, Robert; Gent, Carol; Johnson, Craig (USGS, Denver, CO. (United States))

    1998-01-15

    The results obtained from the chemical and isotopic monitoring of rainwater in Los Azufres and its surroundings in the period May to September, 1995 are presented. Eight sampling sites were selected to collect rainwater: six in the Los Azufres and its surroundings and two in the offices of the Comision Federal de Electricidad (CFE) in Morelia and Guadalajara. The anions Cl-, SO[sub 4] [sup 2]- and NO[sub 3]- were analyzed in about 350 samples. The rainwater has very low content of carbonic species (i.e. total dissolved CO[sub 2]). Due to it, it is not possible to analyze alkalinity with traditional titration method. The Gran Titration method was implemented to determine alkalinity (or acidity) and carbonic speciation in the samples. The values of acidity (negative of alkalinity) are in the range of 10[sup -4] to 10[sup -6] eq/l and are positive only for the sites Vivero and Guadalajara. The space and time distribution of the chemical and isotopic species in the rainwater could provide the information about the source of acidity. The species S0[sub 4][sup 2]- and NO[sub 3]- contribute to the acidity. To study the isotopic composition of dissolved sulfate, a system is designed to collect 100 1 of rainwater. The dissolved sulfate ions were extracted in the form of barium sulfate to analyze sulfur-34 and oxygen-18. The values of (d34S are around -1.5% in Los Azufres and its surroundings and in the CFE office in Morelia whereas they are very different in the CFE office in Guadalajara (-0.3%). The same values of d34S in Los Azufres and Morelia indicates a regional source of sulfate and is not related to the Los Azufres geothermal system.

  1. Isotopic Evolution of Wells in the Geothermal Field of Los Azufres, Michoacan, Mexico; Evolucion isotopica de fluidos de pozos del campo geotermico de Los Azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Barragan Reyes, Rosa Maria; Portugal Marin, Enrique; Arellano Gomez, Victor Manel; Aragon Aguilar, Alfonso [Instituto de Investigaciones Electricas (Mexico); Sandoval Medina, Fernando [Comision Federal de Electricidad (Mexico)

    2002-12-01

    Isotopic ({delta}{sup 1}8 O and {delta}D) data from production and reinjection web fluids from the Los Azufres geothermal field were interpreted in order to define reservoir evolution and the occurrence of physical processes as a result of exploitation. The study included data of 30 wells, which were sampled in September, 2000. General results indicate that different phenomena seem to occur in both zones of the field. In the southern zone there are two different trends of behavior: a mixture of fluids evidenced by the {delta}D versus {delta}{sup 1}8 O trend with a positive slope, was interpreted as the result of reservoir vapor separation at a temperature above 220 Celsius degrees, since for temperatures above 220 Celsius degrees deuterium behaves as a volatile component. No well-defined {delta}{sup D} vs {delta}{sup 1}8 O trend was found for the northern zone, but some points seem to fit the same negative slope trend found in the souther zone. The study of reservoir temperatures estimated by different approaches for particular wells through time, as well as temperature results obtained with a heat and flow well simulator, suggest that reservoir boiling occurs in localized areas in both zone of the field. This process is probably due to exploitation. [Spanish] Se interpretaron datos isotopicos ({delta}{sup 1}8 O y {delta}D) de fluidos de pozos productores y de reinyeccion del campo geotermico de Los Azufres, Michoacan, Mexico, para definir la evolucion del yacimiento y la ocurrencia de procesos fisicos como resultado de la explotacion. En el estudio se consideran datos de treinta pozos segun el muestreo realizado en septiembre de 2000. El estudio de la evolucion en el tiempo de las estimaciones de temperatura de yacimiento mediante diferentes tecnicas, asi como la temperatura obtenida de simulacion de pozos, sugiere que ocurre ebullicion en areas localizadas en ambas zonas del campo debido a la explotacion. Los resultados generales indican la existencia de

  2. Fluid behavior in a hydrothermal system, actual case of the Azufres, Michoacan, Mexico; Comportamiento de fluidos en un sistema hidrotermal, actual caso de los Azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Partida, Eduardo [Universidad Nacional Autonoma de Mexico, Mexico, D.F. (Mexico)

    1999-07-01

    The deep fluids found in the field of Los Azufres, State of Michoacan, are of the type known as sodium chloride, with neutral pH and temperatures that vary between 300 and 350 Celsius degrees. The northern sector of Los Azufres (the Maritaro zone) is dominated by the liquid phase, thus presenting a hydrostatic profile with average temperature of 300 Celsius degrees. The southern sector (the Tejamaniles zone) presents three thermodynamic profiles: the most superficial, with steam predominating (within the first 800 m); the intermediate having a phase L+V with predominance of steam (at 1,200 m); and the deepest one being of saturated liquid with a pressure of 180 bars and temperature of 350 Celsius degrees. The gases, which are not condensable, related to the zone of dominant steam, are composed mainly of CO{sub 2}, and they represent between 70 and 90% of the total. The behaviour of certain ions and its activities are found to be balanced within the liquid of the field and they were studied considering different boiling and temperature rates. The ion activity was found to vary according to its nature. Na and K increased in the liquid phase, in a similar manner as occurs with volatiles in the steam phase. The brine, determined by means of fluid inclusions, shows an evolution from the areas of greatest depth to the surface. The deep brine shows fusion temperatures near to zero with salinity ranging from 0.1 to 1% eq. weight of NaCI; it yield similar values to the ones presently measured with homogenisation temperature ranging from 300 to 34 and pressure of 175 bars. Boiling occurs between 1,200 and 1,500 m accompanied by a fall of pressure to P=75 bars, with a temperature of 270{+-}10 Celsius degrees, associated to a change in fusion temperature that range from -0.6 to -3 Celsius degrees. This corresponds to an apparent salinity of 1 to 4% eq. weight of NaCI, as a result of a strong increase of gases towards this zone. The top of the reservoir presents positive fusion

  3. Gas geochemistry for the Los Azufres (Michoacán geothermal reservoir, México

    Directory of Open Access Journals (Sweden)

    N. Segovia

    2005-06-01

    Full Text Available Gas data of the Los Azufres geothermal field were analyzed using a method based on equilibrium of the Fischer- Tropsch (FT reaction: CH4 + 2H2O = 4H2 +CO2 and on the combined pyrite-hematite-magnetite (HSH2 reactions: 5/4 H2 +3/2 FeS2 +3/4 Fe2O3 + 7/4 H2O = 3 H2S +Fe3O4 in order to estimate reservoir temperature and excess steam. The solution of equilibrium equations produces a grid (FT-HSH2. This method is suitable for reservoirs with relatively high H2S but low H2 and NH3 concentrations in the fluid as is the case of the Los Azufres well discharges. Reservoir temperature and reservoir excess steam values were estimated for initial and present conditions in representative wells of the field to study the evolution of fluids, because of exploitation and waste fluids reinjection. This method was very useful in estimating reservoir temperatures in vapor wells, while in two-phase wells it was found that as the well produces a smaller fraction of water, the reservoir temperature estimation agrees qualitatively with results from cationic or silica geothermometers. For liquid-dominated wells the reservoir temperature estimations agree with temperatures obtained from the well simulator WELFLO. This indicates that FT-HSH2 results provide the temperature of the fluid entering the well where the last equilibrium occurs. Results show a decrease in reservoir temperatures in the southern zone of the field where intensive reinjection takes place. With exploitation, it was also noted that the deep liquid phase in the reservoir is changing to two-phase increasing the reservoir steam fraction and the non-condensable gases in well discharges.

  4. Predicting thermal conductivity of rocks from the Los Azufres geothermal field, Mexico, from easily measurable properties

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Alfonso; Contreras, Enrique; Dominquez, Bernardo A.

    1988-01-01

    A correlation is developed to predict thermal conductivity of drill cores from the Los Azufres geothermal field. Only andesites are included as they are predominant. Thermal conductivity of geothermal rocks is in general scarce and its determination is not simple. Almost all published correlations were developed for sedimentary rocks. Typically, for igneous rocks, chemical or mineral analyses are used for estimating conductivity by using some type of additive rule. This requires specialized analytical techniques and the procedure may not be sufficiently accurate if, for instance, a chemical analysis is to be changed into a mineral analysis. Thus a simple and accurate estimation method would be useful for engineering purposes. The present correlation predicts thermal conductivity from a knowledge of bulk density and total porosity, properties which provide basic rock characterization and are easy to measure. They may be determined from drill cores or cuttings, and the procedures represent a real advantage given the cost and low availability of cores. The multivariate correlation proposed is a quadratic polynomial and represents a useful tool to estimate thermal conductivity of igneous rocks since data on this property is very limited. For porosities between 0% and 25%, thermal conductivity is estimated with a maximum deviation of 22% and a residual mean square deviation of 4.62E-3 n terms of the log{sub 10}(k{rho}{sub b}) variable. The data were determined as part of a project which includes physical, thermal and mechanical properties of drill cores from Los Azufres. For the correlation, sixteen determinations of thermal conductivity, bulk density and total porosity are included. The conductivity data represent the first determinations ever made on these rocks.

  5. Spatial analysis of noise emission at the Los Azufres geothermal field, Mich.; Analisis espacial de emision de ruido en el campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Camarena Magana, Emilio; Ordaz Mendez, Christian A. [Comision Federal de Electricidad, Residencia de Los Azufres, Morelia, Michoacan (Mexico)]. E-mail: emilio.camarena@cfe.gob.mx

    2010-01-15

    To verify noise emissions from the usual activities in an operating geothermal field, noise measurements were carried out in a 4.2 km{sup 2} area in the southern zone of the Los Azufres, Mich., geothermal field. There are seven production wells operating here and three abandoned wells. The average noise emission in the southern zone was 36.5 decibels (dB), regarded as the natural reading of environmental-noise emission. In the Christmas (valves) tree for operating production wells, the noise ranges from 70.9 to 91.7 dB, while in open discharging valves for steam-pipes, the noise can reach 118 dB. In Mexico the maximum permissible limit of noise on the periphery of a property is 68 dB in daytime and 65 dB at night. Based on measurements made at the periphery of lots where the geothermal wells are located, four out of seven production wells measured do not exceed the maximum allowable level, while the other three seem to exceed it. However no definite limits exist for the lots. It is recommended that the measurement points as indicated by the official standard in environmental matters be re-established, which will enable noise emissions by several wells that have exceeded the permissible limit, to actually fall within it. [Spanish] Se realizaron mediciones sonicas en un area de 4.2 km{sup 2} localizada en la zona sur del campo geotermico de Los Azufres, Mich., a fin de verificar la emision de ruido asociada a las actividades usuales en un campo geotermico en operacion. En esta area se encuentran siete pozos productores en operacion y tres pozos abandonados. La emision promedio de ruido en estos ultimos fue de 36.5 decibeles (dB), considerandose como la condicion natural de emision de ruido ambiental. En el arbol de valvulas de los pozos productores en operacion el ruido va de los 70.9 a los 91.7 dB, mientras que en valvulas abiertas de descarga de vaporductos la emision puede llegar hasta los 118 dB. En Mexico el limite maximo permisible de ruido en la periferia de

  6. Isotopic Behaviour of fluids from the Los Azufres, Michoacan, (Mexico) Geothermal Wells; Comportamiento isotopico de fluidos de pozos del campo geotermico de Los Azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Barragan R, Rosa Maria; Arellano G, Victor Manuel; Portugal M, Enrique [Instituto de Investigaciones Electricas, Cuernavaca (Mexico); Tello L, Mirna del Rocio; Tello H, Enrique [Gerencia de Proyectos Geotermoelectricos de la Comision Federal de Electricidad, Morelia (Mexico)

    1997-01-01

    Isotopics data (oxygen-18 and deuterium) from production and reinjection well fluids from the Los Azufres geothermal field were interpreted in order to define the reservoir evolution and the occurrence of physical processes as a consequence of exploitation. The study included data for 25 wells for 1994-1996. Chemical and production data were also studied in order to explain the isotopic characteristics of the fluids. General results indicated that different phenomena seem to occur for both field zones. In the southern zone (Tejamaniles), a mixture of fluids was evidenced by the deuterium vs oxygen-18 tendency which provides a positive slope. The isotopically enriched fluid is constituted by the reinjection fluid. In the northern zone, (Maritaro) there was no evidence that the reinjection fluid is appearing in well discharges. For this zone the dominant process seems to be the reservoir vapour separation at a temperature above 220 degrees Celsius. This was suggested by the deuterium vs oxygen-18 tendency for which a negative slope was found. This trend is characteristics of a vapour separation process since for temperatures above 220 degrees Celsius deuterium behaves as a volatile component. The study of the reservoir temperatures estimated by different approaches for particular wells through time and the results obtained with a heat and fluid flow well simulator, suggest that reservoir boiling occurs in localized areas for both zones of the field. This process is probably due to exploitation. [Espanol] En este trabajo se presenta una interpretacion de datos de composicion isotopica (oxigeno-18 y deuterio) de fluidos de pozos productores y de reinyeccion del campo geotermico de Los Azufres. Estos datos se obtuvieron entre 1994 y 1996 con el proposito de definir la evolucion del yacimiento e identificar los procesos dominantes surgidos como consecuencia de la explotacion del campo. El estudio comprendio un numero de 25 pozos productores y de reinyeccion. La

  7. Study with liquid and steam tracers at the Tejamaniles area, Los Azufres, Mich., geothermal field; Estudio con trazadores de liquido y vapor en el area Tejamaniles del campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Iglesias, Eduardo R. [Instituto de Investigaciones Electricas, Gerencia de Geotermia, Cuernavaca, Morelos (Mexico)]. E-mail: iglesias@iie.org.mx; Flores Armenta, Magaly [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico); Torres, Rodolfo J. [Instituto de Investigaciones Electricas, Gerencia de Geotermia, Cuernavaca, Morelos (Mexico); Ramirez Montes, Miguel [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico); Reyes Picasso, Neftali [Instituto de Investigaciones Electricas, Gerencia de Geotermia, Cuernavaca, Morelos (Mexico); Reyes Delgado, Lisette [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico)

    2011-01-15

    The Mexican Federal Commission for Electricity injects brines produced by nearby geothermal wells into well Az-08, located in the Tejamaniles area, in the southwestern portion of Los Azufres, Mich., geothermal field. The main goals of this study are to determine whether or not the injected fluid recharges nine producing wells in the area, and if so, to estimate the fraction of the injected fluid recharging each producing well. Five of the selected wells produce mixes of liquid and steam and the rest produce only steam. For this reason, we designed this study with simultaneous injections of liquid- and steam-tracers. The nine selected producing wells detected the steam-tracer, and the five wells producing mixes detected the liquid-phase tracer. The residence curves of both tracers present a series of peaks reflecting the known fractured nature of the reservoir. The results show the feeding areas of the nine selected wells are recharged by the fluid injected into well Az-08. When this paper was written, the arrival of steam-tracers in all wells was completed, but the wells producing mixes of liquid and steam continued to record the arrival of the liquid-tracer. Until 407 days after injecting the tracer, the total percentage recovery of liquid phase tracer in the five wells producing mixes of liquid and steam was 3.5032%. The arrival of the steam tracer ended in all nine wells 205 days after the tracer was injected, with an overall recovery rate of 2.1553 x 10-2%. The recovery rates imply the recharge rates of the monitored wells by the injector Az-08 are modest, but it appears the amounts of the recovered liquid-phase tracer will increase significantly. The modest recovery rates suggest most of the fluid injected into the well Az-08 disperses in the reservoir, contributing to recharge and maintaining the pressure. Results reveal that: (i) the injected fluid is heated at depths from 700 to over 1000 m, where it boils and rises to reach the feeding areas of the

  8. Análisis de las concentraciones de azufre en agua, alimento y gas sulfúrico ruminal de rebaños bovinos de carne de las regiones de La Araucanía, Los Ríos y Los Lagos de Chile Determination of sulphur contents in water, forage and ruminal hydrogen sulphide concentrations in beef cattle herds from La Araucanía, Los Ríos y Los Lagos regions of Chile

    Directory of Open Access Journals (Sweden)

    M Gómez

    2011-01-01

    Full Text Available El azufre es un macroelemento esencial en rumiantes. Niveles elevados de azufre y sulfatos consumidos por rumiantes a través de las plantas, agua y otros alimentos pueden reducir el apetito y la tasa de crecimiento en los animales, afectar la absorción de otros elementos y causar afecciones respiratorias y/o neurológicas. El propósito de este estudio fue medir los niveles de azufre en la dieta, analizando las praderas (3 muestras por predio y el agua (1 muestra por predio en 45 predios dedicados a la producción de carne, de las regiones de La Araucanía, Los Ríos y Los Lagos de Chile durante los períodos de primavera 2008 y verano 2009. Adicionalmente, se obtuvieron muestras de gas ruminal de 5 animales por predio, muestreándose un total de 225 animales por período. Posteriormente, se analizaron las diferencias en las concentraciones de azufre en agua y pradera y H2S en gas ruminal de los predios provenientes de las zonas de la costa, depresión intermedia y precordillera. Los resultados obtenidos indican que las concentraciones promedios de azufre en la pradera fueron de 1.482 ± 592 ppm y de 1.472,1 ± 448 ppm en el periodo primavera y verano respectivamente, no evidenciándose diferencias significativas. La concentración de azufre en agua fue de 1,12 ± 0,1 y 1,14 ± 0,09 ppm durante el período de primavera y de verano, respectivamente. Los resultados de los análisis por región y zona geográfica (costa, depresión intermedia y precordillera no mostraron diferencias significativas. La concentración de H2S en gas ruminal en los animales en estudio fueron de 273,1 ± 187,5 y de 245,4 ± 180 ppm en primavera y en verano, respectivamente. El análisis de correlación entre variables indicó una asociación positiva entre los niveles de azufre en alimento y H2S en gas ruminal para el período de primavera y verano. El consumo promedio total de azufre estimado considerando las fuentes de pradera y agua en 45 predios durante ambos per

  9. Determinación complexométrica de trióxido de azufre en el cemento Portland

    Directory of Open Access Journals (Sweden)

    Calleja, J.

    1960-12-01

    Full Text Available Not availableSe describe un método volumétrico (complexométrico para la determinación cuantitativa del trióxido de azufre en el cemento portland, basado en el ataque de la muestra con ácido nítrico, precipitación del trióxido de azufre con nitrato de plomo, redisolución del precipitado con tartrato sodopotásico amortiguamiento de la disolución a pH = 10 y valoración del plomo por complexometría con EDTA (complexonsa III utilizando como indicador negro de eriocromo T. Los resultados concuerdan con los obtenidos por el método gravimétrico clásico (precipitación del trióxido de azufre con cloruro bárico. La diferencia entre dos valores obtenidos por un mismo operador con la misma muestra, aplicando el método propuesto, están dentro de la tolerancia admitida por las normas A. S. T. M. para el método gravimétrico. La diferencia entre valores volumétricos y gravimétricos correspondientes a una misma muestra también entran dentro de dicha tolerancia. El método descrito tiene la ventaja de ser más rápido, no requerir calcinación y poder ser aplicado por cualquier operador con los medios ordinarios de un laboratorio.

  10. Aprendiendo sobre el Método de los Elementos Finitos. // Learning on the Method of the Finite Elements.

    Directory of Open Access Journals (Sweden)

    L. L. Otero Pereiro

    2006-09-01

    Full Text Available El Método de los Elementos Finitos ha demostrado las amplias posibilidades que posee como herramienta para la soluciónde problemas de ingeniería y para el análisis de problemas de investigación. Como resultado de ello su empleo tiene unagran difusión en la comunidad de ingenieros, tanto en centros de estudio como en centros de investigación y en empresas deproducción. Si esto es así, entonces: ¿Cuál es la razón por la cual se tiene una dependencia tan elevada de los softwareprofesionales aun cuando los costos de adquisición de estos están en el orden de las decenas de miles de dólares y loscentros de investigación o las universidades no dedican tiempo y esfuerzos al desarrollo de estos?Según el punto de vista del autor la realidad es que las habilidades en el uso de un software pueden ser adquiridas por lamayoría de los profesionales en la materia, pero la teoría sobre el método es aun poco entendida por la mayoría, aun cuandohayan aprendido a usar uno de estos programas profesionales. ¿Cuál es la causa? La mayoría no ha alcanzado lacomprensión del problema físico y mucho menos separar la herramienta matemática que se emplea para su instrumentaciónno confundiéndola con el problema físico en sí. Esto se debe en primera instancia a que los textos que se encuentran alalcance de la mayoría no dejan claro ambos aspectos y en segundo lugar porque para lograrlo se requiere del trabajo de ungrupo multidisciplinario con dedicación casi exclusiva para esta tarea.En este trabajo se presentará el problema físico fundamental relacionado con el tema, con una proposición sobre el ordennecesario para transmitir el problema físico, separándolo de la herramienta matemática, de tal manera que puedancomprenderse cada uno de ellos por separado.Palabras claves: Elementos finitos, Matriz de rigidez, Nodos, Grados de libertad.______________________________________________________________________________Abstract.The Finite Element

  11. Microbial diversity in Los Azufres geothermal field (Michoacán, Mexico) and isolation of representative sulfate and sulfur reducers.

    Science.gov (United States)

    Brito, Elcia M S; Villegas-Negrete, Norberto; Sotelo-González, Irene A; Caretta, César A; Goñi-Urriza, Marisol; Gassie, Claire; Hakil, Florence; Colin, Yannick; Duran, Robert; Gutiérrez-Corona, Felix; Piñón-Castillo, Hilda A; Cuevas-Rodríguez, Germán; Malm, Olaf; Torres, João P M; Fahy, Anne; Reyna-López, Georgina E; Guyoneaud, Rémy

    2014-03-01

    Los Azufres spa consists of a hydrothermal spring system in the Mexican Volcanic Axis. Five samples (two microbial mats, two mud pools and one cenote water), characterized by high acidity (pH between 1 and 3) and temperatures varying from 27 to 87 °C, were investigated for their microbial diversity by Terminal-Restriction Fragment Length Polymorphism (T-RFLP) and 16S rRNA gene library analyses. These data are the first to describe microbial diversity from Los Azufres geothermal belt. The data obtained from both approaches suggested a low bacterial diversity in all five samples. Despite their proximity, the sampling points differed by their physico-chemical conditions (mainly temperature and matrix type) and thus exhibited different dominant bacterial populations: anoxygenic phototrophs related to the genus Rhodobacter in the biomats, colorless sulfur oxidizers Acidithiobacillus sp. in the warm mud and water samples, and Lyzobacter sp.-related populations in the hot mud sample (87 °C). Molecular data also allowed the detection of sulfate and sulfur reducers related to Thermodesulfobium and Desulfurella genera. Several strains affiliated to both genera were enriched or isolated from the mesophilic mud sample. A feature common to all samples was the dominance of bacteria involved in sulfur and iron biogeochemical cycles (Rhodobacter, Acidithiobacillus, Thiomonas, Desulfurella and Thermodesulfobium genera).

  12. Sobre os nomes dos elementos químicos, inclusive dos transférmios About the names of the chemical elements, including the transfermium elements

    Directory of Open Access Journals (Sweden)

    Romeu C. Rocha-Filho

    1999-09-01

    Full Text Available The names of the chemical elements in Brazilian portuguese are presented, including a discussion of corresponding Brazilian nomenclature rules and translation of some parts of the pertinent IUPAC rules. The rules for naming groups of elements in the periodic table, as well as those for the symbolic indication of atomic number, mass number and electric charge of atoms, are also presented.

  13. ANÁLISIS DE LA DISTRIBUCIÓN DE AZUFRE EN PRODUCTOS, EMISIONES DE SOx Y LA RECUPERACIÓN DEL MISMO EN EL SISTEMA NACIONAL DE REFINACIÓN

    OpenAIRE

    Alcántar González, Fabiola Selene; M. Javier CRUZ GÓMEZ

    2011-01-01

    El objetivo principal de este trabajo fue identificar la distribución de azufre (S) en el Sistema Nacional de Refinación (SNR) mediante la realización de un balance de materia del azufre con los datos proporcionados por la solicitud número 1857600066308 requerido a Pemex Refinación mediante el Instituto Federal de Acceso a la Información (IFAI) para determinar el cumplimento de la NOM-148-SEMARNAT-2006 Contaminación atmosférica. Recuperación de azufre proveniente de los procesos de refinació...

  14. Eruptive History of the Rhyolitic Guangoche Volcano, Los Azufres Volcanic Field, Central Mexico

    Science.gov (United States)

    Rangel Granados, E.; Arce, J. L.; Macias, J. L.; Layer, P. W.

    2014-12-01

    Guangoche is a rhyolitic and polygenetic volcano with a maximum elevation of 2,760 meters above sea level. It is situated to the southwest of the Los Azufres Volcanic Field (LAVF), in the central sector of the Trans-Mexican Volcanic Belt. Guangoche volcano is the youngest volcano described within the LAVF. It shows a horseshoe shaped crater open to the south, with a central lava dome. Its eruptive history during late Pleistocene has been intense with six explosive eruptions that consists of: 1) A southwards sector collapse of the volcano that generated a debris avalanche deposit with megablocks of heterogenous composition; 2) A plinian-type eruption that generated a pumice fall deposit and pyroclastic density currents by column collapse at 30.6 ka; 3) A plinian-type eruption "White Pumice Sequence" (29 ka) that developed a 22-km-high eruptive column, with a MDR of 7.0 x 107 kg/s (vol. = 0.53 km3); 4) A dome-destruction event, "Agua Blanca Pyroclastic Sequence" at 26.7 ka, that deposited a block-and-ash flow deposit; 5) A subplinian-plinian type eruption "Ochre Pyroclastic Sequence" (<26 ka) with an important initial phreatomagmatic phase, that generated pyroclastic density currents and pumice fallouts. The subplinian-plinian event generated a 16-km-high eruptive column, with a MDR of 1.9 x 107 kg/s, and magma volume of 0.38 km3; 6) The eruptive history ended with a subplinian eruption (<<26 ka), that generated a multilayered fall deposit, that developed a 11-km-high eruptive column, with a MDR of 2.9 x 106 kg/s and a magma volume of 0.26 km3. Volcanic activity at Guangoche volcano has been intense and future activity should not be discarded. Unfortunately, the last two events have not been dated yet. Guangoche rhyolitic magma is characterized by low-Ba contents suggesting crystal mush extraction for their genesis.

  15. Susceptibilidad y síntomas respiratorios asociados a la exposición a dióxido de carbono y dióxido de azufre provenientes del volcán Turrialba, Costa Rica

    Directory of Open Access Journals (Sweden)

    Marisol Yglesias-González

    2014-01-01

    Full Text Available El volcán Turrialba ha mantenido en los últimos años una actividad de desgasificación, y paulatinamente se han mostrado los efectos de este dinamismo sobre la vegetación e infraestructuras de las comunidades aledañas. Entre las sustancias que conforman esta actividad de desgasificación se encuentra el dióxido de carbono y el dióxido de azufre que se han ido incrementando y son capaces de afectar la salud respiratoria de quienes se exponen a ellas. El objetivo de esta investigación es analizar la proclividad de las poblaciones aledañas de desarrollar síntomas respiratorios ante las exposiciones vía aérea de dióxido de carbono y dióxido de azufre provenientes del volcán Turrialba. La investigación consistió en un estudio transversal, descriptivo, analítico y cuantitativo. Se trabajó con ocho comunidades, y se obtuvo una muestra de 502 personas. Las comunidades estudiadas fueron: Hacienda La Fuente, La Central, La Silvia, Miravalles, Finca El Retiro, Guayabo Arriba, Las Virtudes y La Alegría. Esta última fue la comunidad control. Los estratos con mayor riesgo de presentar molestias en la garganta cuando hay exposición a gases volcánicos fueron los niños y adultos mayores (OR=1,93, mujeres (OR=1,86, personas que emplean varios tipos de cocina (OR=2,07, individuos con ocupaciones al aire libre (OR=1,51 y personas con ingresos iguales o mayores a los USD $475 (OR=2,09. Los estratos con mayor riesgo de presentar molestias en la nariz fueron los niños y adultos mayores (OR=1,37, mujeres (OR=1,83, personas que emplean cocina eléctrica (OR=2,23, individuos con ocupaciones dentro de edificaciones (2,12 y personas con ingresos inferiores a los USD $475 (OR=2,30.

  16. Susceptibilidad y síntomas respiratorios asociados a la exposición a dióxido de carbono y dióxido de azufre provenientes del volcán Turrialba, Costa Rica

    Directory of Open Access Journals (Sweden)

    Marisol Yglesias-González

    2014-07-01

    Full Text Available El volcán Turrialba ha mantenido en los últimos años una actividad de desgasificación, y paulatinamente se han mostrado los efectos de este dinamismo sobre la vegetación e infraestructuras de las comunidades aledañas. Entre las sustancias que conforman esta actividad de desgasificación se encuentra el dióxido de carbono y el dióxido de azufre que se han ido incrementando y son capaces de afectar la salud respiratoria de quienes se exponen a ellas. El objetivo de esta investigación es analizar la proclividad de las poblaciones aledañas de desarrollar síntomas respiratorios ante las exposiciones vía aérea de dióxido de carbono y dióxido de azufre provenientes del volcán Turrialba. La investigación consistió en un estudio transversal, descriptivo, analítico y cuantitativo. Se trabajó con ocho comunidades, y se obtuvo una muestra de 502 personas. Las comunidades estudiadas fueron: Hacienda La Fuente, La Central, La Silvia, Miravalles, Finca El Retiro, Guayabo Arriba, Las Virtudes y La Alegría. Esta última fue la comunidad control. Los estratos con mayor riesgo de presentar molestias en la garganta cuando hay exposición a gases volcánicos fueron los niños y adultos mayores (OR=1,93, mujeres (OR=1,86, personas que emplean varios tipos de cocina (OR=2,07, individuos con ocupaciones al aire libre (OR=1,51 y personas con ingresos iguales o mayores a los USD $475 (OR=2,09. Los estratos con mayor riesgo de presentar molestias en la nariz fueron los niños y adultos mayores (OR=1,37, mujeres (OR=1,83, personas que emplean cocina eléctrica (OR=2,23, individuos con ocupaciones dentro de edificaciones (2,12 y personas con ingresos inferiores a los USD $475 (OR=2,30.

  17. Results of exploratory drilling at the western portion of Los Azufres, Michoacan, Mexico, geothermal field; Resultados de la perforacion exploratoria en la porcion occidental del campo geotermico de Los Azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Casarrubias Unzueta, Zenon [Gerencia de Proyectos Geotermoelectricos de la Comision Federal de Electricidad, Morelia (Mexico)

    1996-09-01

    The geological characteristics of the western portion of the Los Azufres, Michoacan, Mexico geothermal field were defined on the basis of EAZ-1 and EAZ-2 exploratory wells. A maximum temperature of 187 degrees celsius at 1995 m depth, with a pressure of 188 kg/cm{sup 2} were registered at EAZ-1 well. A permeable zone was detected at 1333 m with a measured temperature of 133 degrees celsius. The presence of laumontite at 1450 m depth, corresponds to a forming temperature similar to the measured one. Well EAZ-2 is also situated in the western sector of Los Azufres. During drilling, at 2197 m depth, a temperature of 222 degrees celsius and a pressure of 188 kg/cm{sup 2} were measured. Seventeen days later, 243 degrees celsius were registered at the same depth. The presence of a thermal anomaly, initially interpreted as an interest area by the existence of a low resistivity zone, was confirmed with the results above mentioned. The mineralogical analysis from 1400 m depth to the bottom of well EAZ-2 detected the existence of epidote, epidote+chlorite, epidote+amphybole, epidote+zoisite, quartz and unidentified clay+epidote, this assemblage suggest temperatures over 230 degrees celsius with a pressure of 85 bar at this interval. The temperatures estimated by fluid inclusions confirmed this interpretation. The results suggest the continuity of the Los Azufres hydrothermal system to the west, between AZ-3 and EAZ-2 wells. However, the NW sector is not connected to permeable zones associated with producing faults. [Espanol] Los resultados de la perforacion de los pozos exploratorios EAZ-1 y EAZ-2, permitieron definir las condiciones geologicas del yacimiento geotermico de Los Azufres, Michoacan, Mexico hacia la extension occidental del campo. En el pozo EAZ-1, localizado al NW del campo, se midio una temperatura maxima de 187 grados celsius, a una profundidad de 1995 m, con una presion de 188 kg/cm{sup 2}. Se registro una zona permeable a 1333 m, con una temperatura de 131

  18. Steam saving during maintenance of the 50-MW Unit 7 at Los Azufres geothermal field, Michoacan; Ahorro de vapor durante el mantenimiento de la Unidad 7 de 50 MW en el campo geotermico de Los Azufres, Michoacan

    Energy Technology Data Exchange (ETDEWEB)

    Medina Barajas, Elvia Nohemi; Ruiz Lemus, Alejandro [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Residencia de Los Azufres, Morelia, Michoacan (Mexico)]. E-mail: elvia-medina@cfe.gob.mx

    2011-07-15

    Commercial-steam production in the southern area of Los Azufres, Mich., Mexico, Geothermal Field began in 1982 with the operation of Unit 2, the backpressure 5-MW unit, and continued in 1988 when the 50-MW condensing Unit 7 was commissioned. Today to supply steam to Unit 7, it is necessary to gather steam from 15 production wells, amounting 450 tons per hour (t/h) under operating conditions. During maintenance periods for Unit 7, production wells are removed from the steam-supply system but continue producing steam that is discharged to the atmosphere-a loss affecting the economic life of the geothermal reservoir. Therefore several actions have been proposed and tried to save the steam and preserve the geothermal resource. This paper presents the results of the actions and the technical and economic benefits obtained from them. [Spanish] La produccion de vapor con fines comerciales en la zona sur del campo geotermico de Los Azufres, Mich., Mexico, empezo en 1982 con la puesta en marcha de la Unidad 2 de 5 MW a contrapresion, para continuar en 1988 con la Unidad 7 de 50 MW a condensacion. Para cumplir con el suministro de vapor a la U-7, a la fecha es necesario integrar la produccion de 15 pozos productores, que producen un total de 450 toneladas por hora (t/h) a condiciones de operacion. Durante los periodos de mantenimiento de la U-7 los pozos son desintegrados del sistema de suministro, pero continuan produciendo vapor, el cual es descargado a la atmosfera sin ningun provecho, lo que representa una perdida que afecta la vida util del yacimiento geotermico. Por ello se han propuesto y aplicado diversas acciones operativas en cada uno de esos pozos con el objetivo de ahorrar vapor y preservar el recurso geotermico. En este trabajo se presentan los resultados de esas acciones y los beneficios tecnicos y economicos obtenidos.

  19. Evolution of the geothermal fluids at Los Azufres, Mexico, as traced by noble gas isotopes, δ18O, δD, δ13C and 87Sr/86Sr

    Science.gov (United States)

    Pinti, D. L.; Castro, M. C.; Shouakar-Stash, O.; Tremblay, A.; Garduño, V. H.; Hall, C. M.; Hélie, J.-F.; Ghaleb, B.

    2013-01-01

    Isotopes of noble gases, CO2, H2O and Sr were measured in 10 geothermal wells and 8 hot springs, fumaroles and mud volcanoes at Los Azufres, the second most important geothermal field in Mexico. The aim of this study is to provide additional information on fluid circulation in the field and surrounding areas (Araró hot springs), as well as on physical processes such as boiling, steam separation and invasion of re-injected brines following over 25 years of geothermal fluid exploitation. Mantle helium dominates in fluids from the northern production zone of Marítaro, with measured 3He/4He ratios up to 7 Ra (where Ra is the atmospheric ratio of 1.386 × 10- 6). 3He/4He ratios are positively correlated with 87Sr/86Sr ratios and with δD and δ18O. These relationships suggest that Los Azufres fluids represent a mixing between primary magmatic 3He-rich fluids and groundwater currently discharging at Araró hot springs and enriched in radiogenic 4He acquired from Miocene andesites. Unusually high He ratios together with radiogenic Sr isotopic ratios suggest that thermal waters acquired mantle He from deep-seated parent magmas and radiogenic Sr possibly during their uprising through the metamorphic basement. 40Ar/36Ar ratios of 366 to 429 measured in two wells indicate either mantle-derived argon or a radiogenic 40Ar in situ component, suggesting the local presence of an older crustal fluid component in the northern part of the field. Ne, Kr and Xe are entirely of atmospheric origin, but processes of boiling, steam separation and re-injection of used brines have led to fractionation of their elemental abundances. Comparison with previous studies suggests that the boiling zone in the northern production zone is currently extending further north (Marítaro hot springs). In the southwestern productive zone, re-injected brines might account for more than 90% of the exploited fluids.

  20. Nuevos métodos complexométricos para la determinación de trióxido de azufre en el cemento portland

    Directory of Open Access Journals (Sweden)

    Calleja, J.

    1962-09-01

    Full Text Available Not availableComo alternativas de un procedimiento volumétrico (complexométrico para la determinación cuantitativa del trióxido de azufre en el cemento Portland, anteriormente publicado (1, los autores exponen los detalles de dos nuevos métodos, también complexométricos, encaminados al mismo fin y basados en el empleo de indicadores distintos del negro de eriocromo T. Uno de ellos, llamado "de la ditizona", consiste en el ataque de la muestra de cemento con ácido nítrico; precipitación de los iones sulfato con nitrato de plomo; disolución del precipitado de sulfato de plomo en un sistema amortiguado de pH = 4.5 (ácido acético-aceto amónico}; adición de disolución patrón de complexona III en exceso y determinación del exceso de ésta con disolución patrón de zinc, empleando como indicador ditizona (difeniltiocarbazona en medio alcohólico. El otro, llamado "del dicromato", es paralelo al anterior, del que se diferencia únicamente en que el exceso de disolución de complexona III se determina con disolución de plomo, empleando como indicador dicromato potásico. Los resultados encontrados por ambos métodos, en comparación con los hallarlos por el procedimiento clásico basado en la gravimetría de sulfato bárico, efectuado paralelamente y tornarlo como referencia, ponen de manifiesto que cualquiera de los dos es equiparable al gravimétrico, ya que las diferencias entre dos valores obtenidos por un mismo operador con una misma muestra están dentro de la tolerancia admitida por las Normas "A. S. T. M." para la gravimetría clásica. lo mismo sucede con las diferencias entre valores volumétricos y gravimétricos correspondientes a una misma muestra. Los métodos descritos, aparte de sus ventajas sobre el gravimétrico en cuanto a rapidez, sencillez o supresión de la calcinación, tienen sobre el complexométrico basado en el empleo del negro de eriocromo T como indicador, la ventaja adicional de poder ser practicados

  1. Geochemistry and isotopic characterization of rain in the zones of Los Azufres, Michoacan and Los Humeros, Puebla and its relation with geothermal fluids; Caracterizacion geoquimica e isotopica de lluvia en las zonas de Los Azufres, Michoacan y Los Humeros, Puebla y su relacion con fluidos geotermicos

    Energy Technology Data Exchange (ETDEWEB)

    Verma, Mahendra P; Santoyo, Socrates; Aragon, Alfonso [Instituto de Investigaciones Electricas, Temixco, Morelos (Mexico); Fernandez, Ma. Elena [Comision Federal de Electricidad Morelia, Michoacan (Mexico); Tovar, Rigoberto [Comision Federal de Electricidad, Los Azufres (Mexico); Casimiro, Emigdio; Sandoval, Fernando [Comision Federal de Electricidad, Los Humeros, Puebla (Mexico); Johnson, Craig [USGS, Denver, Colorado, (United States); Gerardo-Abaya, Jane [IAEA, Viena (Austria)

    1999-12-01

    This work presents the preliminary results of chemical and isotopic monitoring of rainwater in Los Humeros and Los Azufres geothermal fields and their surrounding during 1995-1998. The rainwater samples were collected in seven and eight sites in Los Humeros and Los Azufres, respectively. The alkalinity values of rainwater were positive in all Los Humeros sites, which indicates that there is no acid rain in the region. There were some samples with negative alkalinity at two sites in case of Los Azufres, Vivero and Guadalajara, but the values were very small. This means that there is some acidity in the rain. In case of Los Humeros a good correlation was observed between alkalinity and the concentration of calcium, which indicates that the samples were probably affected by dust. The concentration of anions Cl, SO{sub 4} {sup 2} and NO{sub 3} was very low in the rainwater samples in both fields, but there is a clearly defined trend. The concentration of NO{sub 3} and SO{sub 4}{sup 2} at Los Azufres dicreased with advance in the rainy season. There is no NO{sub 3} in the rain at Los Humeros. The values of NO{sub 3} in the rain of Mexico City were higher than 10 ppm. This indicates that NO{sub 3} in rainwater is related with the industrial contamination. This evidence suggests that the clouds formed in the Gulf of Mexico bring rain to the Central part of Mexico. Los Humeros is located east of any big industrial site, therefore the rainwater has less anthropogenic SO{sub 4} {sup 2} and NO{sub 3}. Rainwater at Los Azufres contains contaminants from industrial sites located to the east. It can be concluded that there is no discernible influence of geothermal emissions on rainwater acidity. The concentration of Cl{sup -} was very low and constant for all the rainy seson. The origin of Cl{sup -} is considered as marine. A mixing model for Cl{sup -}/SO{sub 4} {sup 2-} versus {delta}{sup 3}4S suggests that there is 10-25% sulfate from sea spray in rainwater at Los Humeros

  2. Mineralogical-chemical composition and environmental risk potential of pond sediments at the geothermal field of Los Azufres, Mexico

    Science.gov (United States)

    Birkle, P.; Merkel, B.

    2002-01-01

    Since 1982, estimated amounts of 9,400 t, 15,000 kg, 720 kg and 105 kg of Si, Fe, As and Cs respectively have accumulated at the bottom of 18 evaporation ponds as part of the geothermal production cycle at Los Azufres. This accumulation is caused by precipitation of brine solutes during the evaporation of 10% of the total pond water volume before its re-injection into the reservoir. Extraction experiments with pond precipitates and geochemical simulations with the PHREEQC program indicate the high solubility of most precipitates under natural environmental conditions. The comparisons with the primary brine composition indicate that less than 1% of most dissolved brine solutes, except for Co, Cu, Mn, Pb, Ag, Fe and Si, are accumulated at the pond bottom. Arsenic has maximum values of 160 mg/kg in the pond sediments, and Mo, Hg and Tl also exceed international environmental standards for contaminated soils. Elevated concentrations and the mobility potential of several metals and non-metals require the application of remediation techniques for the final disposal of the sediments in the future.

  3. Improvement in using steam for electric generation at the Los Azufres, Mich., geothermal field; Mejora en el aprovechamiento del vapor para generar energia electrica en el campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Torres Rodriguez, Marco A.; Flores Armenta, Magaly; Mendoza Covarrubias, Alfredo [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico)]. E-mail: magaly.flores@cfe.gob.mx

    2010-01-15

    Commercial exploitation in the Los Azufres geothermal field, Michoacan, Mexico, started in 1982 when the first five backpressure-power units of 5-MW each were commissioned. Nowadays the installed capacity is 188 MW from 14 units: five in the South Zone fed by steam produced from 18 production wells plus two binary-cycle power units fed by residual brines; and seven in the North Zone with steam supplied by 22 production wells. There are seven backpressure-power units with high specific consumption [between 14.5 and 13.6 tons per hour of steam (t/h) per MW]. Three operate in the South Zone and four in the North Zone. This paper shows a way to achieve more efficient use of the geothermal resource by replacing the seven backpressure units, which have completed their useful lifetime-or are close to do it-with two, new condensing power units with lower specific consumption: one unit of 50 MW to be located in the North Zone and the other of 25 MW to be placed in the South Zone. No new wells need be drilled. In this way, the average specific consumption would be reduced to 8.8-7.2 t/h per MW (saving 47% of the steam), the income for electric generation would be increased and the steam-extraction rate would remain the same. [Spanish] En 1982 empezo la explotacion comercial del campo geotermico de Los Azufres, Mich., Mexico, con la instalacion y puesta en servicio de las primeras cinco unidades turbogeneradoras a contrapresion de 5 MW cada una. Actualmente la capacidad instalada es de 188 MW, con catorce unidades: cinco en la zona sur, alimentadas por el vapor de 18 pozos productores, mas dos unidades de ciclo binario que utilizan salmuera residual, y siete unidades en la zona norte, alimentadas por 22 pozos. Hay siete unidades a contrapresion con un consumo especifico elevado [entre 14.5 y 13.6 toneladas por hora (t/h) de vapor por MW], tres de las cuales se localizan en la zona sur y cuatro en la zona norte. En este documento se presenta un proyecto para hacer mas

  4. Estimation of the Energy Content in Maritaro; Northern Sector of the Los Azufres, Michoacan, Mexico Geothermal Field; Estimacion de la energia contenida en Maritaro, sector norte del campo geotermico de Los Azufres, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Suarez Arriaga, Mario Cesar [Gerencia de Proyectos Geotermoelectricos de la Comision Federal de Electricidad, Morelia (Mexico)

    1997-05-01

    The methodology, the conceptual synthetic model and results obtained during the modeling and numerical simulation of Maritaro, northern sector of the Los Azufres, Michoacan, Mexico hydrothermal system, are reported. A Central objective of this work, was to carry out an updated evaluation of the reservoir`s energy content and to estimate, between tolerable margins of error, the longevity and approximate amount of useful energy that could be transformed in electricity. The probable initial state and the period of exploitation 1980-1996 were satisfactorily reproduced by the numerical model. The natural thermodynamic state, estimated for the reservoir before its commercial exploitation begun, corresponds to the compressed liquid region, at 92 bar of average pressure, an average temperature of 301 degrees celsius, with an enthalpy of 1 344 kj/kg. The hottest zones are located toward the center and eastern portions of the field, and the colder regions, at the western periphery. It was considered a minimum volume of exploitable reservoir equal to 49 km{sup 3}, and a maximum volume, including a possible western reserve zone, of 74 km{sup 3}. Several scenarios were numerically studied, including the installation from 75 MWe up to 400 MWe. The 280 MWe power is considered to be the maximum feasible capacity to be installed in the minimum presently known volume. The 400 MWe power characterize the upper, hypothetical limit capacity, assuming that the reserve zone is variable. This last stage having the highest risk. [Espanol] En este documento se reporta la metodologia sintetico conceptual y los resultados obtenidos mediante el modelado matematico y la simulacion numerica de Maritaro, sector norte del sistema hidrotermal de Los Azufres, Michoacan, Mexico. El objetivo central del trabajo fue realizar una evaluacion actualizada de la capacidad energetica contenida en este reservorio y estimar, dentro de margenes tolerables de error, la longevidad y cantidad aproximada de energia

  5. Modification of the water-level control system at the Unit 12 of Los Azufres, Mich., geothermal field; Modificacion del sistema de control de nivel de agua en la Unidad 12 del campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Tello Hinojosa, Raul; Aburto Huerta, S. Ramon; Mendoza Covarrubias, Hector M [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico)]. E-mail: raul.tello@cfe.gob.mx

    2007-01-15

    Unit 12 of the Los Azufres, Mich., geothermal field is a binary cycle unit of 1.45 MW, installed at the pad of production well Az-22. There are two separators on this pad. One separates the mix extracted from well Az-22 and the other from adjacent wells. The separated brine from both separators is gathered in a horizontal tank and sent to Unit 12. The steam is sent to Unit 7, which generates 50 MW. Once some interference occurred affecting the power generation of Unit 7 when Unit 12 was off line. This was caused by the original flow arrangement and water-level control system. To avoid interference, a water-level control system was designed and installed in the separators. The system operates independently of Unit 12, with tanks in each separator connected by a pipe. Regulation of the water level is accomplished by three motor valves and a level sensor. To ensure permanent feeding of electrical power to the valves, an automatic system was installed from transmission lines of 23 and 115 kV. In case both lines fail, there is an uninterrupted power supply (UPS) unit. At the beginning of 2005, Unit 12 was again online with a modified water-level control system that has operated satisfactorily since then. Its short periods offline have not affected Unit 7. [Spanish] La Unidad 12 del campo geotermico de Los Azufres, Mich., es una unidad de ciclo binario de 1.45 MW, instalada en la plataforma del pozo productor Az-22. En esta plataforma hay dos separadores, uno de los cuales separa la mezcla extraida del pozo Az-22 y el otro la de varios pozos aledanos. El agua separada de ambos se concentra en un tanque horizontal y de este pasa a la Unidad 12, mientras que el vapor se envia a la Unidad 7, de 50 MW. Por el tipo de arreglo original de flujo y control de nivel de agua en los equipos, ocurrian interferencias que provocaban que cuando la Unidad 12 se disparaba se afectara la generacion en la Unidad 7. Para evitar esta interferencia se diseno e instalo un sistema de control de

  6. Study of liquid and steam tracers at the Maritaro - La Cumbre area of the Los Azufres geothermal field, Mich.; Estudio con trazadores de liquido y vapor en la zona Maritaro - La Cumbre del campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Iglesias, Eduardo R [Instituto de Investigaciones Electricas, Cuernavaca, Morelos, (Mexico)]. E-mail: iglesias@iie.org.mx; Flores Armenta, Magaly; Quijano Leon, Jose Luis; Torres Rodriguez, Marco A [Comision Federal de Electricidad, Morelia, Michoacan (Mexico); Torres, Rodolfo J; Reyes Picasso, Neftali [Instituto de Investigaciones Electricas, Cuernavaca, Morelos, (Mexico)

    2008-01-15

    We ran two simultaneous tracer tests in the Maritaro-La Cumbre area of the Los Azufres geothermal field in Mexico. We wished to determine whether or not fluids injected in well Az-15 recharged the productive areas of six production wells and to estimate the fractions of injected fluid recovered in them, if any. Because only three of the wells produce water and all of them produce steam, two tracers were used, sulfur hexafluoride (SF{sub 6}) for the gas phase and 1,3,6 naphthalene trisulfonate (1,3,6-nts) for the liquid phase. All of the observation wells recorded SF{sub 6}, and the three water-producing wells recorded 1,3,6-nts, proving that fluids injected in well Az-15 do recharge the area of interest. When sampling was suspended, the three water-producing wells were still producing 1,3,6-nts at significant rates. The total recovery of 1,3,6-nts at wells Az-65D, Az-04 and Az-28, 279 days after injection when sampling was halted, were, respectively, 6.1%, 0.90% y 0.16%, for a total of 7.61%. We concluded that these quantities constitute the lower boundaries for the respective recovery factors. When sampling was halted, wells Az-65D, Az-66D and Az-30 were still producing some SF{sub 6} at lower rates, and the rest of the wells were no longer recording the gas phase tracer. The total recovery of SF{sub 6} at wells Az-65D, Az-04, Az-41, Az-30, Az-28 and Az-66D were, respectively, 4.82 e-02%, 1.37 e-03%, 1.48 e-03%, 6.38 e-04%, 1.38 e-03% y 4.31 e-04%, for a total of 5.35 e-02%. The liquid recharge occurred in orders of magnitude greater than the steam. [Spanish] Se efectuaron dos pruebas simultaneas en la zona Maritaro-La Cumbre del campo geotermico de Los Azufres, Mich., Mexico. Los objetivos de estas pruebas fueron determinar si la salmuera de desecho inyectada en el pozo Az-15 recarga las zonas de alimentacion de seis pozos productores designados por CFE, y estimar que fraccion de lo inyectado recarga dichos pozos productores. Debido a que solo tres de los pozos

  7. Efecto de la aplicación directa e indirecta de azufre en los cultivos de cebolla y papa bajo condiciones de campo e invernadero.

    OpenAIRE

    Tello Peramas, Lilly Denise

    1999-01-01

    Universidad Nacional Agraria La Molina. Escuela de Posgrado. Maestría en Suelos El trabajo se realizo a nivel de laboratorio en el Laboratorio de Fertilidad de Suelos de la UNALM y los experimentos de campo en el departamento de Arequipa en las localidades de Bajo Cural y Revuelta-Perdida-Vitor-Cailloma. En los experimentos de invernadero se evaluó el efecto de la fertilización con azufre en forma directa e indirecta en 26 tratamientos con 3 repeticiones; estos tratamientos se realizaron s...

  8. Derivados quirales de azufre y de fósforo: síntesis y aplicaciones en catálisis asimétrica

    OpenAIRE

    Chelouan, Ahmed

    2014-01-01

    El trabajo presentado en esta Tesis Doctoral forma parte de un proyecto de investigación más amplio desarrollado a lo largo de los últimos años por nuestro grupo de investigación, que tiene por objeto la síntesis estereoselectiva de compuestos quirales de azufre de interés sintético y/o farmacológico. En concreto, en esta Tesis Doctoral nos hemos propuesto extender el uso de diversos sulfinilderivados quirales a aquellos campos en los que su aplicación ha sido menos explorada, como es la ...

  9. Application of ethanol as a geothermal tracer: a field-test in the Los Azufres geothermal field, Michoacan, Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Tello Hinojosa, Enrique [Comision Federal de Electricidad, Morelia, Michoacan (Mexico); Pal Verma, Mahendra [Comision Federal de Electricidad, Morelia, Michoacan (Mexico); Suarez Arriaga, Mario C. [Universidad Michoacana de San Nicolas de Hidalgo, Morelia, Michoacan (Mexico); Barrera Conzalez, Victor; Sandoval Medina, Fernando [Comision Federal de Electricidad, Morelia, Michoacan (Mexico)

    2005-12-01

    The thermal decomposition rate of ethanol, rhodamine WT and fluoroscein was determined from laboratory data obtained under conditions of temperature and pressure that simulated a geothermal reservoir. It was found that ethylic alcohol had better thermal stability rhodamine and fluoroscein. Using data obtained from de-ionized water experiments after 168 hours and 200 degree centigrade of temperature, the rhodamine WT and fluoroscein presented a degradation of 99.4% and 99.7%, respectively, while for the ethanol the degradation percentage under the same conditions was only of 44.6%. According to this, ethylic alcohol can be used as a conservative tracer up to about 250 degree centigrade, while rhodamine WT and fluoroscein can be used only at less than 200 degree centigrade, and only where the transit return time is expected to be less than 7 days. Ethanol was used as a conservative tracer in a field test in the southern zone of the Los Azufres geothermal field. The highest concentration was detected in a monitoring well in the steam phase 15 days after the injection, and in the liquid phase, or brine, 34 days after the injection. This suggests that alcohol fractionates preferentially in the steam phase and moves or migrates twice as fast than it does in the liquid phase. The tracer speed can be calculated in 176 m/day in the steam phase and 77.5 m/day in the brine. The ethanol presents good enough characteristics to be used as a tracer in both phases in geothermal environments. [Spanish] Se determino la velocidad de descomposicion termica del etanol, la rodamina y la fluoresceina a partir de datos de laboratorio obtenidos bajo condiciones de presion y de temperatura que simulan las de un yacimiento geotermico. Se encontro que el alcohol etilico presenta una mayor estabilidad termica que la rodamina y la fluoresceina. Empleando los datos obtenidos de experimentos con agua de-ionizada despues de 168 horas y a 200 grados centigrados de temperatura, la rodamina y la

  10. Disponibilidad de agua, nitrógeno y azufre en barbechos con y sin control de malezas en distintos niveles de residuos Water, nitrogen and sulphur availability in fallows with and without weed control and different residue levels

    Directory of Open Access Journals (Sweden)

    Romina Fernández

    2009-06-01

    Full Text Available Con el fin de evaluar el efecto de los residuos vegetales sobre la eficiencia de almacenamiento de agua, la dinámica de nitrógeno y azufre disponible durante el barbecho con y sin presencia de malezas, se realizaron 10 ensayos con distintos niveles de residuos (A: 10.000 kg MS ha-1, M: 5.000 kg MS ha-1, B: menor a 2.000 kg MS ha-1 en Haplustoles de las regiones planicie con tosca y planicie medanosa de La Pampa y Sur de Córdoba. En cada tratamiento de residuos se dividieron las parcelas en dos subtratamientos de manejo de malezas: tratamiento con malezas (malezas y sin malezas (barbecho. Se realizaron determinaciones de: textura, densidad aparente, punto de marchitez permanente, materia orgánica total. Al inicio y al final del barbecho se midió el contenido de agua en el suelo, nitratos (N, azufre de sulfatos solubles y adsorbidos (S en 0-0,2 m de profundidad. Al comienzo del barbecho todos los sitios presentaron altos contenidos de agua útil (entre 51 y 100%. A pesar de ello, nuestros resultados mostraron que al finalizar el barbecho el nivel de residuos tuvo un efecto positivo en los contenidos de agua con una diferencia entre A y B de 33%. Con presencia de las malezas, no se pudo comprobar una ventaja por parte de los residuos y la diferencia entre A y B fue de 10%. El factor que más influyó en los contenidos de agua fue la presencia de malezas. Los contenidos de N y de S disponible no fueron influenciados por los distintos niveles de residuos, constatándose un mayor efecto de malezas. En el tratamiento con malezas se vería comprometida la siembra del cultivo de girasol por menor disponibilidad de agua y además se afectaría el rendimiento en 200 kg ha-1 por la menor disponibilidad de N y en 600 kg ha-1 por menor disponibilidad de S disponible en el nivel A de residuos.In order to study the effect of crop residues on the efficiency of water storage, available nitrogen and sulphate dynamics during fallow with and without weed

  11. Evolution evidence of a basic fluid to an acid based in the analysis of hydrothermal alteration of the geothermic field of the Azufres, Michoacan; Evidencias de evolucion de un fluido basico a acido a partir del analisis de la alteracion hidrotermal del campo geotermico de los Azufres, Michoacan

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Partida, Eduardo [Universidad Nacional Autonoma de Mexico, Mexico, D.F. (Mexico)

    2000-07-01

    Hydrothermal alteration at the Los Azufres geothermal field is mostly composed of calc-silicate minerals that define a propylitic alteration zone, which shows progressive dehydration with depth and temperature increase. A generalized zoning of the calc-silicate zone can be observed, with zeolites in the upper part and epidote-clinozoisite at the deepest levels. An argillic alteration zone overlies the calc-silicate zone and is the dominant surface manifestation of the hydrothermal alteration. In some parts, there is a mineral assemblage composed of kaolinite-alunite-native sulfur-quartz (advanced argillic zone) formed by the interaction of vapor and shallow groundwater. The proto-fluid at the Los Azufres geothermal system is related to a neutral sodium chlorine brine, which favors deep propyllitic alteration (productive zone). This zone is characterized by secondary permeability due to fracturing. At depth the geothermal field is dominated by a pressurized liquid, yielding to vapor at more shallow zone. The gradual change from a liquid to a vapor phase occurs through boiling at depths between 1,200 and 1,500 m, and is accompanied by changes in the hydrothermal alteration mineralogy. The type of alteration passes from proylitic to argillic by means of an oxidation-acidification process, which includes the participation of a gas, particularly CO{sub 2}. Considering the physicochemical characteristic of the brine and the evolution of the paragenetic sequence, the Los Azufres geothermal field could de considered a model for hydrothermal behavior at ore deposits which develop by boiling and oxidation of low sulfidation fossil hydrothermal fluids. [Spanish] En el campo geotermico de Los Azufres la zona de alteracion hidrotermal esta formada en su mayor parte por calcosilicatos (que definen una zona paragenetica del tipo propilitico), los cuales muestran una deshidratacion progresiva conforme se va profundizando e incrementandose la temperatura. Se puede generalizar un

  12. Impacto en la salud ambiental por efecto de emisiones de dióxido de azufre del Volcán Arenal, en la población de la Fortuna de San Carlos

    Directory of Open Access Journals (Sweden)

    Xinia Alvarado Zeledón

    2006-12-01

    Full Text Available Introducción: Las emisiones de dióxido de azufre (SO2del volcán Arenal representan un riesgo para la salud ambiental en La Fortuna. Se realizó un análisis teórico de las diferentes variaciones en las concentraciones de SO2 del volcán, con posible impacto a la salud de sus pobladores. Estudios teóricos sobre emisión y dispersión de gases volcánicos, así como su impacto potencial a la salud en el país, han sido realizados en 1999 por Morales &Liao (1. Material y métodos: Basados en datos de máxima emisión de SO2 del Arenal (1, se presumen escenarios de diferentes volúmenes de emisión de SO2, a diferentes velocidades de salida, y aplicados a las diferentes clases de condiciones atmosféricas. Para determinar el mecanismo de dispersión del SO2 y sus concentraciones en La Fortuna, se utilizó el modelo Gaussiano con cálculo de penacho y dispersión horizontal a nivel de piso. Resultados: Emisiones de SO2 con caudales inferiores a 190 ton/día no representan riesgo para la salud humana en La Fortuna. Emisiones superiores a 800 ton/día, con velocidades de salida superiores a 40 km/h provocan concentraciones de SO2 cercanas a los 365 µg/m³, (máxima concentración para un período de 24 horas de exposición, para atmósferas tipo A y B. Emisiones de SO2 mayores a 12.000 ton/día, en atmósferas tipos A y B, alcanzan concentraciones entre 1.417 µg/m³ y 4.869 µg/m³. Discusión y conclusiones: Emisiones de SO2 superiores a 800 ton/día, implican un riesgo a la salud de los pobladores de La Fortuna, incluyendo características fatales. Se recomienda implementar monitoreos constantes de las emisiones de SO2, para tomar medidas de protección en La Fortuna en caso de emisiones iguales o mayores a 800 ton/día.

  13. Síntesis de nuevas sondas cromogénicas a partir de heterociclos de azufre y nitrógeno

    OpenAIRE

    2009-01-01

    El estudio de los sistemas heterocíclicos ocupa un lugar destacado dentro del campo de la Química Orgánica, y es quizá una de las áreas que mejor reflejan la interrelación entre investigación básica y aplicada, debido al gran número de aplicaciones que se han encontrado para este tipo de sistemas. En la memoria de la tesis titulada “Síntesis de nuevas sondas cromogénicas a partir de heterociclos de azufre y nitrógeno” se expone la importancia de los sistemas 1,2-ditiol-3-tionas en el desarrol...

  14. Utilización de azufre micronizado en la corrección del pH de compost de residuos de poda Correction of the pH of pruning waste compost with micronized sulphur

    Directory of Open Access Journals (Sweden)

    L.A. Barbaro

    2010-12-01

    Full Text Available Los compost actualmente son muy utilizados como componentes de sustratos, aunque en algunos casos presentan pH alcalinos y causan problemas nutricionales. Por ello se recomienda hacer una corrección previa a su utilización o luego de elaborar el sustrato. Algunas alternativas para bajar el pH es mezclando el compost con materiales ácidos o mediante la adición de azufre, sulfato ferroso u otros compuestos azufrados. El objetivo de este trabajo fue corregir el pH de un compost de residuos de poda con azufre micronizado y hallar la dosis adecuada para el pH deseado. Se conformaron siete tratamientos, incorporando al compost de poda diferentes dosis de azufre micronizado: 0, 1, 2, 3, 4, 6 y 8 g/litro. Al compost de cada tratamiento se le midió el pH semanalmente y una vez estabilizados se analizó la conductividad eléctrica, concentración de nitrato, calcio, magnesio, potasio y sodio. Para un pH entre 5,3 y 6,2 se necesitaron 2 a 3 g de azufre/litro. El pH del compost disminuyó con el incremento de la dosis de azufre, y la CE aumentó. El azufre micronizado es una alternativa viable para corregir el pH del compost de restos de poda a los valores deseados.Nowadays, composts are widely used for incorporation into substrates and in some cases they present alkaline pH, causing nutritional problems. Therefore, it is suggested that a correction should be made prior to its use or after its preparation. Some alternatives to decrease pH values are mixing compost with acid materials or adding sulphur, ferrous sulphate or other sulphur compounds. The aim of this work was to correct the pH of pruning waste compost with micronized sulphur and find the appropriate dose for the desired pH. Seven treatments were performed incorporating different doses of micronized sulphur: 0, 1, 2, 3, 4, 6 and 8 g per liter of compost. Compost pH was measured weekly in each treatment. Once stabilized, electrical conductivity and concentration of nitrate, calcium, magnesium

  15. Comentarios críticos de la Norma UNE 7245 sobre "determinación de los compuestos de azufre contenidos en los áridos"

    OpenAIRE

    Calleja, José

    1982-01-01

    This paper shows some deficiences of the Spanish Standard Method UNE 7245 and the corresponding deficiences of the Spanish Concrete Code EH-SO adopting it. According to the actual Method, erroneous low values may result in determining sulphides and in general sulphur compounds in cocrete aggregates. Attention is drawn to the convenience of revising the limit of 1.2 per cent for the admissible maximum value of such compounds, particularly if they are exclusively formed by pyrites.

  16. Efecto de la adición de caliza sobre el metal depositado por arco sumergido

    Directory of Open Access Journals (Sweden)

    Amado Cruz-Crespo

    2012-12-01

    Full Text Available Se evaluó el efecto del incremento de las adiciones de caliza en laobtención de un fundente al manganeso sobre la composición delmetal depositado por arco sumergido (proceso SAW. La adición decaliza se realizó manteniendo constante la relación porcentualMnO/SiO2 del sistema de óxidos del fundente. Con el aumento de labasicidad se logró intensificar la actividad termodinámica del MnO ydisminuir la del SiO2, favoreciéndose la transferencia del manganeso al metal depositado, a la vez que se atenúa la del silicio, el azufre, el fósforo y el carbono permanece prácticamente inalterable. Esto posibilita el empleo de un alambre de bajo manganeso durante lasoldadura de aceros de baja aleación con proceso SAW.

  17. Research and technological development on heat pumps in Mexico operating with geothermal energy; Investigacion y desarrollo tecnologico sobre bombas de calor en Mexico operando con energia geotermica

    Energy Technology Data Exchange (ETDEWEB)

    Garcia Gutierrez, Alfonso; Barragan Reyes, Rosa Maria; Arellano Gomez, Victor Manuel [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2008-07-01

    The Instituto de Investigaciones Electricas (IIE) and the Comision Federal de Electricidad (CFE) carried out in the past an extensive work of research and development (R&D) on heat pumps (HP). The systems tried on include heat pumps by mechanical compression, thermal absorption and thermal transformers. This paper briefly describes the main aspects of R&D on heat pumps and presents a more detailed description of three of the main studies: a) a Heat Pump (HP) by mechanical compression water-water type, designed for brine purification, operating with low pressure geothermal steam at the geothermal field Los Azufres, Michoacan, Mexico; b) a HP by absorption for cooling and refrigeration, operating with ammoniac/water and low enthalpy geothermal energy, which was tested in the geothermal fields of Los Azufres, Michoacan and Cerro Prieto, Baja California, and c) a thermal transformer by absorption, named Heat Pump by Absorption Type 2, which was tested to evaluate the behavior of diverse ternary solutions as working fluids. To date, there are plans to install and test a geothermal heat pump (connected to the subsoil), in Cerro Prieto, Mexicali, Baja California, Mexico. [Spanish] El Instituto de Investigaciones Electricas (IIE) y la Comision Federal de Electricidad (CFE) realizaron un trabajo extenso de investigacion y desarrollo (I&D) sobre bombas de calor (BC) en el pasado. Los sistemas que se probaron incluyen bombas de calor por compresion mecanica, absorcion y transformadores termicos. Este trabajo describe brevemente los principales aspectos de I&D sobre bombas de calor y se da una descripcion mas detallada de tres de los principales estudios: a) una Bomba de Calor (BC) por compresion mecanica tipo agua-agua, disenada para purificacion de salmueras, operando con vapor geotermico de baja presion en el campo geotermico de Los Azufres, Michoacan; b) una BC por absorcion para enfriamiento y refrigeracion, operando con amoniaco/agua y energia geotermica de baja entalpia

  18. Research on heat pumps in Mexico operating with geothermal energy and waste heat; Investigacion sobre bombas de calor en Mexico operando con energia geotermica y calor de desecho

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Gutierrez, A; Barragan-Reyes, R.M; Arellano-Gomez, V [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)]. E-mail: aggarcia@iie.org.mx

    2008-01-15

    The Instituto de Investigaciones Electricas and the Comision Federal de Electricidad have done research and development (R&D) on heat pumps (HP) in past years. Tested systems include mechanical compression, absorption and heat-transformers. The main R&D aspects on HP are briefly described, and also a more detailed description about three of the main studies is presented: (a) a mechanical compression HP of the water-water type operated with low-pressure geothermal steam at the Los Azufres; Mich., geothermal field, and designed for purification of brine; (b) an absorption HP for cooling and refrigeration operating with ammonia-water and low-enthalpy geothermal energy, which was tested in the Los Azufres and Cerro Prieto, BC, geothermal fields; and (c) a heat-transformer by absorption-Absorption Heat Pump Type II-tested to assess the performance of several ternary solutions as work fluids. Plans exist to install and test a geothermal heat pump at Cerro Prieto or Mexicali, BC. [Spanish] El Instituto de Investigaciones Electricas y la Comision Federal de Electricidad han realizado trabajo de investigacion y desarrollo (I&D) sobre bombas de calor (BC) en el pasado. Los sistemas probados incluyen compresion mecanica, absorcion y transformadores termicos. Este trabajo describe brevemente los principales aspectos de I&D sobre bombas de calor en forma general, y se da una descripcion mas detallada de tres de los principales estudios: (a) una BC por compresion mecanica tipo agua-agua disenada para purificacion de salmueras operando con vapor geotermico de baja presion en el campo geotermico de Los Azufres, Mich.; (b) una BC por absorcion para enfriamiento y refrigeracion operando con amoniaco-agua y energia geotermica de baja entalpia, la cual fue probada en los campos geotermicos de Los Azufres y Cerro Prieto, BC; y (c) un transformador termico por absorcion -llamado Bomba de Calor por Absorcion Tipo II--, el cual fue probado para evaluar el comportamiento de diversas

  19. Application of the Gauss theorem to the study of silicic calderas: The calderas of La Primavera, Los Azufres, and Los Humeros (Mexico)

    Science.gov (United States)

    Campos-Enríquez, J. O.; Domínguez-Méndez, F.; Lozada-Zumaeta, M.; Morales-Rodríguez, H. F.; Andaverde-Arredondo, J. A.

    2005-10-01

    We explored applications (including limitations) of Gauss's theorem to the study of silicic calderas. First it enables us to determine the mass deficiency from calderas. Mass deficiency itself has also other potential applications. It enables to make qualitative comparisons between calderas. We can use the mass deficiency to test, in a quick way and as a preliminary step to a formal gravity inversion, for the feasibility of caldera types of simple geometry (i.e., piston subsidence and funnel models). This application can be done in a straightforward way, once the mass deficiency has been determined. For this purpose the mass deficiency is converted to the volume of material missing at the caldera. Subsequently, for example, this volume and the respective caldera diameter enable us to estimate the height of the cylinder fitting the piston subsidence model. If the obtained parameters are congruent with the known geology and geophysical information then the model may be considered further in the inversion of the gravity data for the detailed structure. Other simple models (i.e., the funnel model) can also be analyzed in this way. In particular, when working with a piston subsidence caldera type, the Gauss theorem enables us to estimate the caldera collapse (very difficult to obtain based on geologic information alone). These possible uses of Gauss's theorem are illustrated with the calderas of La Primavera, Los Azufres, and Los Humeros caldera (Mexico). The obtained mass deficiency from these calderas follow the linear mass deficiency-diameter trend observed for other calderas. In particular, because of their diameters and mass deficiencies, La Primavera and Krakatau calderas can be considered equiparable. This comparison is of the most importance considering that La Primavera is located in the neighbourhood of a metropolis (Guadalajara City). Since geophysical studies have already established a piston subsidence model for these calderas, we assessed Gauss's theorem

  20. Condensers for measuring steam quality at the inlet of back-pressure units of the Los Azufres, Mich., geothermal field; Condensadores para medir la calidad del vapor a la entrada de las turbinas a contrapresion del campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Sandoval Medina, Fernando; Gonzalez Gonzalez, Rubi; Reyes Delgado, Lisette; Medina Martinez, Moises [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Residencia de Los Azufres (Mexico)]. E-mail: fernando.sandoval@cfe.gob.mx

    2007-01-15

    Electrical conductivity is an indirect measurement of the quality of the steam supplied to power units. In the Los Azufres, Mich., geothermal field, the electrical conductivity once was measured in a discrete and periodic way by condensing steam samples through a water-cooled condenser. In an attempt to continuously measure conductivity, conductivity meters were installed where the units discharged, but the values proved unstable and unrepresentative. Thereafter, taking into account that steam quality should be measured at the steam delivery-reception point, equipment was designed and tested for continuously condensing steam. Finally it was possible to get an air-cooled condenser able to condense 500 milliliters per minute, enough to collect a representative flow of the steam and to measure its electrical conductivity. The equipment was installed in all seven back-pressure units operating in the field and to date has been operating in an optimal manner. [Spanish] La conductividad electrica es una medida indirecta de la calidad del vapor que se suministra a las unidades turbogeneradoras. En el campo geotermico de Los Azufres, Mich., la conductividad electrica se media en forma puntual y periodica, condensando muestras de vapor por medio de un serpentin enfriado con agua. Despues, ante la necesidad de medirla en forma continua, se instalaron conductivimetros en las descargas de las unidades, pero los valores resultaron muy inestables y poco representativos. Considerando, ademas, que la calidad del vapor debe medirse en el punto de entrega-recepcion, se disenaron y probaron equipos para condensar vapor de manera continua, lograndose construir un condensador enfriado por aire que logra condensar un flujo de 500 mililitros por minuto, cantidad suficiente para tener un flujo representativo del vapor que alimenta a las turbinas y medirle su conductividad electrica. Se instalaron estos equipos en las siete unidades turbogeneradoras a contrapresion que funcionan en el campo

  1. Experimental study on fuel oil combustion in circulating fluidized bed; Estudio experimental sobre la combustion de combustoleo en lecho fluidizado circulante

    Energy Technology Data Exchange (ETDEWEB)

    Diaz Rangel, Ricardo [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1996-12-31

    The Instituto de Investigaciones Electricas (IIE) developed a circulating fluidized bed combustor of 0.5 thermal MW unique in its type in Latin America. The Bachelor`s thesis entitled ``Experimental Study on Fuel Oil Combustion in Circulating Fluidized Bed`` was performed operating this combustor with the purpose of determining the feasibility of burning heavy fuel oil in a stable and sustained form, as well as the effect of the addition of calcium carbonate to the combustor. The results of the experimental trials showed heavy fuel oil can be burned in a circulating fluidized bed, with low sulfur dioxide emissions. During the conduction of the experiments a sulfur retention of 43% was achieved with a Ca/S relationship of 4.5. [Espanol] El Instituto de Investigaciones Electricas (IIE) desarrollo un combustor de lecho fluidizado circulante de 0.5 MW termicos de potencia, unico en su tipo en Latinoamerica. La tesis de licenciatura titulada Estudio Experimental sobre la Combustion de Combustoleo en Lecho Fluidizado Circulante se realizo operando dicho combustor, con el proposito de determinar la factibilidad de quemar combustoleo pesado en forma estable y autosostenida, asi como la influencia que tiene la adicion de carbonato de calcio al lecho. Los resultados de los ensayos experimentales mostraron que se puede quemar combustoleo pesado en un lecho fluidizado circulante, con bajas emisiones de bioxido de azufre. Durante la experimentacion se logro una retencion de azufre del 43%, con una relacion Ca/S de 4.5.

  2. Estudo sobre os elementos de uma interpretação invasiva na abordagem psicanalítica winnicottiana Estudio sobre los elementos de una interpretación invasiva en el abordaje psicoanalítico winnicottiano Study on the elements of an invasive interpretation in the Winnicott psychoanalytical approach

    Directory of Open Access Journals (Sweden)

    Conceição Aparecida Serralha

    2012-04-01

    Full Text Available Partindo dos textos freudianos, este estudo reapresenta brevemente a técnica da interpretação em psicanálise e, baseando-se na obra de Winnicott, discute os elementos de uma interpretação sentida de forma invasiva pelo analisando. São identificados, nomeados e discutidos os elementos apontados por este autor: tempo, modo, graus de confiabilidade, objetividade e conhecimento, sendo ilustrados por alguns fragmentos de sessão de casos de Winnicott e de um caso da autora. O estudo evidencia a importância da capacidade de o analista se identificar com o analisando para interpretar, recebendo e entendendo a comunicação deste sobre a adequação de todos esses elementos ao seu caso.Partiendo de los textos freudianos, este estudio reapresenta brevemente la técnica de la interpretación en psicoanálisis y, basándose en la obra de Winnicott, discute los elementos de una interpretación sentida de forma invasiva por el analizando. Son identificados, nombrados y discutidos los elementos apuntados por este autor: tiempo, modo, grados de confiabilidad, objetividad y conocimiento, siendo ilustrados por algunos fragmentos de sesión de casos de Winnicott y de un caso de lo autor. El estudio evidencia la importancia de la capacidad de el analista identificarse con el analizando para interpretar, recibiendo y entendiendo la comunicación de este sobre la adecuación de todos esos elementos a su caso.From the Freudian texts, this study reintroduces briefly the technique of interpretation in psychoanalysis and, based on the Winnicott's works, discusses the elements of an interpretation felt invasive by the patient. The elements pointed out by this author and identified, named and discussed include: time, manner, degrees of trustworthiness, objectiveness and knowledge. They are illustrated with fragments of session of Winnicott's cases and one case of the author. The study highlights the importance of the analyst's capacity of identifying him

  3. Validación de dos métodos analíticos: calor de combustión y azufre, en materiales combustibles que pueden ser quemados en hornos de clinker

    Directory of Open Access Journals (Sweden)

    Karen Hooker

    2010-10-01

    Full Text Available Se validaron dos métodos para llevar a cabo la evaluación fisicoquímica de materiales de desecho de diferentes empresas interesadas en tratar sus residuos, para utilizarlos como combustible alternativo para un horno de cemento, que calcina estos materiales a una temperatura máxima de 2000°C. Con este fin se optimizaron las figuras de mérito de la determinación del calor de combustión y del porcentaje de azufre.

  4. Technologies for the treatment of the sulfur dioxide and nitrogen oxides generated by the combustion in open chamber; Tecnologias para el tratamiento de dioxido de azufre y oxidos de nitrogeno generados por la combustion en camara abierta

    Energy Technology Data Exchange (ETDEWEB)

    Salazar Villalpando, Maria Dolores [Instituto Mexicano del Petroleo, Mexico, D. F. (Mexico)

    1992-12-31

    In general terms, there are only three ways of avoiding the sulfur dioxide and the nitrogen oxides, generated by the combustion in open chamber, from contaminating the air; the first one is utilizing low sulfur and nitrogen content fuels, the second one is by controlling the parameters that affect the combustion and the third one to treat and/or clean the gases before exhausting them to the air. In this document, some of the treatments for diminishing the pollutant emissions generated by the combustion in open chamber, are presented. [Espanol] En terminos generales, solo existen 3 maneras de evitar que el dioxido de azufre y oxidos de nitrogeno generados por la combustion en camara abierta sigan contaminando el aire, la primera es utilizar un combustible de bajo contenido de azufre y nitrogeno, la segunda es controlar los parametros que afectan la combustion, y la tercera es tratar y/o limpiar los gases antes de emitirlos a la atmosfera. En este documento se presentan algunos tratamientos para disminuir las emisiones de contaminantes generados por la combustion en camara abierta.

  5. Study with a steam tracer in a zone near well Az-64, in the Los Azufres geothermal field, Mich.; Estudio con un trazador de vapor en la zona aledana al pozo Az-64, en el campo geotermico de Los Azufres, Mich.

    Energy Technology Data Exchange (ETDEWEB)

    Iglesias, Eduardo R. [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)]. E-mail: iglesias@iie.org.mx; Flores Armenta, Magaly; Quijano Leon, Jose Luis; Torres Rodriguez, Marco A. [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico); Torres, Rodolfo J.; Reyes Picasso, Neftali [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico); Sandoval Medina, Fernando [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Morelia, Michoacan (Mexico)

    2009-01-15

    A previous tracer study in the Maritaro-La Cumbre area of the Los Azufres, Mich., geothermal field concluded that injection in well Az-15 recharges a group of producing wells located east of the injector to a maximum distance of about 2000 m. The study also indicated injection in Az-15 either does not recharge wells farther east in the neighborhood of the Laguna Verde fault, or does so at very low rates over a long period. Because it is important to recharge this zone, it was decided to explore the possibility of doing it by injecting in well Az-64, located in the area. Thus the present study was designed. Six producing wells were chosen to monitor tracer arrivals. Because all the chosen wells produce steam (several also produce water) and for economic reasons, it was decided to use a steam-phase tracer. We chose sulfur hexafluoride (SF6), a tracer successfully used before in the field. On October 24, 2006, we injected 96.4 kg of SF6 into well Az-64. All six chosen wells were sampled for 156 days, starting the day of injection. The tracer was detected in all six wells and for every well the shape of the residence curve clearly depicted the fractured nature of the corresponding permeability. Again in every case, the recovery curves indicated recovery was completed within the 156-day sampling period. The largest recoveries were in wells Az-05 (48.5%) and Az-43 (1.27%), those closest to the injection well and on the same side of the Maritaro fault as Az-64. Well Az-51, lying at 848 m from the injector and farthest away, registered the third-highest recovery percentage (1.01 x 10-5%), significantly higher than well Az-19 (6.95 x 10-6%), located 490 m from the injector; the two wells are on the same side of the Maritaro fault as Az-64. Well Az-32, located 423 m from the injector, but on the other side of the Maritaro fault, recovered 5.6 x 10-7% of the injected tracer, comparable to 8.67 x 10-7%, the amount recovered in well Az-13 on the same side of the Maritaro fault

  6. Efecto de la aplicación de azufre para el control de oidiosis “leveillula taurica” en el cultivo de alcachofa (Cynara scolymus L. var. imperial star

    Directory of Open Access Journals (Sweden)

    L. Mauricio

    2011-01-01

    Full Text Available Una de las causas importantes para el decaimiento de la producción de alcachofa es por la enfermedad conocida con el nombre de oídium u oidiosis o ceniza, “ Leveillula taurica” , la q ue provoca formaciones pulverulentas en el envés de las hojas, y luego invaden el haz.; induciendo a una pérdida de masa foliar, muerte de la planta y reducción en rendimiento. Con la finalidad de poder contrarrestar el efecto de infección y avance del hon go se planteo el trabajo de investigación la cuál fue determinar la dosis adecuada del azufre para el control de oidiosis ( Leveillula taurica en el cultivo de alcachofa Cynara scolymus L var. imperial star. El experimento fue llevado a cabo en el Distrit o de Víctor Larco, Trujillo, La Libertad; suelo de textura franco arcilloso, empleándose un sistema de riego por gravedad cuya frecuencia de riego es quincenal para la conducción del cultivo. Se empleó un Diseño de Bloques Completos al Azar, con cuatro tr atamientos y un testigo, y con cuatro repeticiones. Fue realizado un análisis de varianza y la prueba de Duncan con un nivel de significancia de 5 %. Los resultados mostraron que los tratamientos aplicados de azufre reducen y controlan el avance del hongo , siendo el mejor el T2, con dosis 1 kg/cil. Se concluye que estos tratamientos son adecuados para ser aplicados en el cultivo de alcachofa para el control de oídium ( Leveillula taurica.

  7. El hastial sur de la catedral de León: patología existente derivada de la utilización de azufre en el retacado de grapas y tochos en las obras de restauración realizadas en el siglo XIX

    Directory of Open Access Journals (Sweden)

    Diez García-Olalla, J.

    2015-12-01

    Full Text Available During the restorations carried out in the nineteenth century in the cathedral of Leon, the architect-restorers Juan de Madrazo and Demetrio de los Rios proposed in their projects the use of liquid sulphur to caulk iron or bronze staples, or billets that linked edge elements and solids from the masonry. This solution, not previously used, has produced important construction pathology in the south gable today: cracks in a large number of blocks and partial detachment of them. Some of these detachments have been falling to the court of the temple with the risk to cause harm to people and things. It is worth to point out that this unpublished work has a great importance because, according to the content of the projects of both architects, this practice spread to more parts of the monument, so this localized pathology is expected to manifest itself in other areas with the consequent risk.Durante las restauraciones efectuadas en el siglo xix en la catedral de León, los arquitectos restauradores Juan de Madrazo y Demetrio de los Ríos propusieron en sus proyectos el empleo de azufre líquido para retacar los tochos y engrapados de hierro o bronce que enlazaban los elementos de remate y los sólidos de las fábricas. Esta solución, no utilizada con anterioridad, ha dado lugar a la aparición hoy en día de una importante patología en el hastial sur: la fractura de un gran número de sillares y el desprendimiento parcial de éstos, cayendo al atrio del templo con el consecuente peligro. Este trabajo es una contribución inédita que reviste gran importancia porque, según el contenido de los proyectos de ambos arquitectos, esta práctica se extendió a más partes del monumento, por lo que esta patología localizada es previsible que se manifieste en otras zonas del mismo con el consecuente riesgo.

  8. Behavior patterns of chemical and isotopic species (2006-2007) in the Los Azufres, Mich., geothermal field, as a response to reinjection; Patrones de comportamiento de especies quimicas e isotopicas (2006-2007) en el campo geotermico de Los Azufres, Mich., en respuesta a la reinyeccion

    Energy Technology Data Exchange (ETDEWEB)

    Barragan R, Rosa Maria; Arellano G, Victor Manuel; Martinez E, Ignacio; Aragon A, Alfonso [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)]. E-mail: rmb@iie.org.mx; Reyes D, Lisette; Gonzalez, Rubi [Comision Federal de Electricidad, Gerencia de Proyectos Geotermoelectricos, Residencia de Los Azufres, Morelia, Michoacan (Mexico)

    2009-07-15

    Chemical and isotopic ({delta}18 O y {delta}D) data from the Los Azufres geothermal field fluids for 2006 and 2007 were analyzed to investigate changes in their behavior patterns and their relation to reinjection. Total discharge chlorides, reservoir temperatures, excess steam in well feeding fluids, CO{sub 2} concentrations at reservoir and total discharge conditions, and liquid saturations were calculated. Contour lines of certain parameters were obtained for 2006 and 2007 to relate them to the contours obtained for 2005 and to the reinjection histories. Fluid isotopic compositions, including injection fluids, were correlated to estimate fluid mixing effects between the reservoir and reinjection fluids. Results suggest chemical parameters respond to the mass flow rate injected and to the isotopic composition of injection fluids. {delta}D vs {delta}18 O relationships show a number of wells produce different proportions of reinjection returns. In the northern zone, wells AZ-65D, AZ-13, AZ-32, AZ-9A, AZ-9AD, AZ-28A, AZ-69D and AZ-44 produce relatively high proportions, while wells AZ-5, AZ-28 and AZ-19, among others, produce lower proportions. Wells AZ-2A, AZ-16AD, AZ-46 and AZ-33 from the southern field zone produce higher proportions of reinjection returns while wells AZ-34, AZ-36 and AZ-37 produce lower proportions. The liquid saturation distribution in 2007 shows the maximum saturation zones have decreased compared with 2005 and 2006 data. In 2007, maximum liquid saturations were found around wells AZ-22 and AZ-23 (southern zone) and AZ-28, AZ-32, AZ-45 and AZ-48 (northern zone). Minimum saturations were found around wells AZ-6 and AZ-16 (southern zone) and AZ-56 (northern zone). The CO{sub 2} levels for the reservoir liquid were used to trace paths of reinjection fluids, considering these fluids are depleted in this gas. Thus the minimum CO{sub 2} contour lines indicate the movement of the reinjection fluids in the reservoir. [Spanish] Se analizaron datos

  9. Impuesto sobre la renta

    OpenAIRE

    Universitat de Barcelona. Grup d'Innovació Docent en Economia dels Impostos (GIDEI)

    2016-01-01

    Tema 7. Esquema de presentación del tema "Impuesto sobre la renta". Incorpora datos actuales, gráficos, cuadros y tablas. Esquema de presentació del tema "Impuesto sobre la renta". Incorpora dades actuals, gràfics, quadres i taules.

  10. Impuesto sobre sociedades

    OpenAIRE

    Universitat de Barcelona. Grup d'Innovació Docent en Economia dels Impostos

    2016-01-01

    Tema 8. Esquemas de la presentación del tema "Impuesto sobre sociedades". Incorpora datos actuales, gráficos, cuadros y tablas. Esquemes de la presentació del tema "Impuesto sobre sociedades". Incorpora dades actuals, gràfics, quadres i taules

  11. Digital signage sobre IP

    OpenAIRE

    Casademont Filella, Albert

    2012-01-01

    Projecte que versa sobre el disseny i la implementació d'un sistema de Digital Signage (Cartelleria Digital) sobre IP, creant un gestor que permeti controlar de forma remota tot un conjunt de petits dispositius connectats a pantalles que emeten continguts multimèdia com vídeos, imatges, feeds rss...

  12. Comparison between two plant nitrogen and sulphur determination methods: impact on wheat sulphur diagnostics Comparación de métodos de determinación de nitrógeno y azufre en planta: implicancia en el diagnóstico de azufre en trigo

    Directory of Open Access Journals (Sweden)

    Nahuel I Reussi Calvo

    2008-12-01

    Full Text Available The nitrogen and sulphur ratio (N:S in plants is often used as a sulphur diagnostics tool in wheat. This ratio requires two different analyses results for its calculation, and thus involves two sources of analytical error. The objective of this work was to compare the accuracy and reliability of the Dumas dry combustion method for N and S determination in plant, compared to traditional methods of wet digestion, and its use as a sulphur diagnostics tool in wheat. The N and S determination was carried out in wheat plant samples from four experiments carried out in the 2006 growing season in the southwestern Buenos Aires province. A highly significant correlation was obtained between both methods (r = 0.99 and r = 0.74 for N and S, respectively. The quantity of N recuperated by the Dumas method was not significantly different to the Kjeldahl method, however, the reliability of the former was higher (low variability coefficient. The method of turbidimetry with wet digestion underestimated (20% the sulphur concentration compared to the Dumas method. Moreover, the sulphur percent recovered from standard samples was 83 % and 96 % for the turbidimetry and Dumas methods, respectively. The underestimation of plant sulphur concentration by the turbidimetry method resulted in a low percentage of samples correctly diagnosed (25, 18.7 and 50% for Z22, Z24 and Z31, respectively. However, the percent of samples correctly diagnosed was high by the Dumas method (94, 94 and 100% for Z22, Z24 and Z31, respectively. The results of this work indicate that the reliability of the N:S ratio is limited by the S analysis accuracy. On the other hand, the N recovery for both methods was similar.La relación nitrógeno (N: azufre (S total es utilizada frecuentemente para el diagnóstico de deficiencias de S en trigo. Para determinar este índice es necesario la realización de dos análisis diferentes, y por lo tanto, es afectada por dos errores analíticos. El objetivo fue

  13. Relaciones cuantitativas entre los contenidos de azufre y de sulfuros en los aceros inoxidables tipo AISI 303: influencia de la composición química de los sulfuros

    Directory of Open Access Journals (Sweden)

    Botella, J.

    1999-06-01

    Full Text Available The work has been done with ten AISI 303 stainless steel rods which have similar chemical compositions, except for sulphur which varies between 0.25 and 0.36%. These steels are studied by Scanning Electron Microscopy (SEM and Energy Dispersive X-Ray Spectrometry (EDX. The sulphides are chemically microanalysed and the occupied volume determined by automatic image analysis. It can be inferred that the chemical composition of sulphides in AISI 303 steels is variable to some extent even though the steel chemistry is almost invariable. This could mean that solidification conditions and thermomechanical transformations are able to affect resulting in variations of sulphide compositions. Quantitative relations between sulphur and sulphide contents are established and the influence of sulphide chemical compositions on those relations is studied. The experimental results are compared with those obtained from theoretical calculations. A good approach is obtained when the difference between chemical compositions of real sulphides and the theoretical one, MnS, is taken into account.

    Se trabaja con una serie de diez redondos de aceros inoxidables tipo AISI 303 de composiciones químicas prácticamente iguales a excepción del azufre que varía entre 0,25 y 0,36%. Se examinan los aceros mediante Microscopía Electrónica de Barrido (MEB y Espectrometría de Dispersión de Energías de Rayos X (EDX acoplada al MEB, analizándose químicamente los sulfuros y determinando, mediante análisis automático de imágenes, los volúmenes ocupados por los sulfuros. Parece deducible que la composición química de los sulfuros en el AISI 303 puede ser discretamente variable aún siendo prácticamente invariable la composición química del acero. Ello podría significar que las condiciones de solidificación y las transformaciones termomecánicas pueden influir, dando como resultado variaciones en la composición química de los sulfuros. Se establecen

  14. Aplicación de diferentes fuentes de azufre en soya (Glycine max (L. Merrill en tres ordenes de suelos del Valle del río Cauca, Colombia, en condiciones de invernadero

    Directory of Open Access Journals (Sweden)

    Gómez L. Jairo A.

    1989-06-01

    Full Text Available Se utilizaron cuatro fuentes portadoras de S (sulfato de amonio, yeso, ácido sulfúrico y azufre micronizado en dosis de 20 y 40 kg de S/ha, aplicado en pre y al momento de la siembra , en tres órdenes de suelos (Vertisol, Inceptisol y Entisol del Valle geográfico del río Cauca, con la variedad ICA Tunía, como cultivo indicador. La unidad experimental estuvo constituida por bolsas de polietileno con dos kilos de suelo seco al aire, utilizando el horizonte Ap. El diseño experimental fue completamente al azar, el diseño de tratamientos fueron dos factoriales entrelazados con dos tratamientos adicionales, testigo absoluto (To, testigo comercial (Te. Este llevó fertilización basal con N, P, K, y doce tratamientos con fertilización basal más S (N, P, K +S. Al período de floración se cuantificó peso de materia seca, peso de nódulos, % S, % N Y N/S, a final de cosecha se determinó en el grano de soya % S, % N, N/ S, número de vainas, de granos, peso seco de grano y % de aceite. Los tres suelos respondieron a la fertilización de S. La fuente que presentó diferencias significativas con mayor incremento en producción de grano de soya, fue el azufre micronizado, en la dosis de 20 kg S/ha aplicado con anterioridad a la siembra.In order to fertilize, four sources of sulphur, ammonicum sulfate, gyppum, sulfuric acid and micronized sulphur, were used. Sulphur dose of 20 and 40 kg per hectare were applied before sowing and at the seeding moment, on three soils orders (Vertisol, Inceptisol and Entisol of the geographic Valley of the Cauca river, with the soybeam variety ICA Tunía. The experimental units were made of polyethilen bags with two kilograms of air dry soil, using the Ap. horizon. The experimental design was completyly ramdom. The treatment designs were two factorial s interlaced with two additional treatments, absolute indicator (To commercial indicator (Te. This carried basal fertilization with N, P, K and twelve treatments with

  15. La composición isotópica del azufre y del plomo en las mineralizaciones de Zn-Pb del Valle de Arán (Pirineo central y su significado metalogenético

    Directory of Open Access Journals (Sweden)

    Pujals, I.

    1996-12-01

    Full Text Available The sulfur isotopic composition of sulfides from sedex-type deposits enclosed within Upper Ordovician rocks in the valle de Arán (Central Pyrenees ranges from +3.5 to +15.1 ‰ in mineralizations enclosed in carbonates and from -2.7 ‰ to +5.5 in mineralizations enclosed in detritic rocks. These values suggest two different sources of sulfur: a heavy source of crustal origin, probably related to the reduction of seawater sulfate, and a lighter one, resulting from leaching of underlying detritic and/or volcanic rocks of cambro-ordovician age. Hercynian metamorphism has not significantly altered the original sulfur isotopic composition of sulfides and their variation at the deposit scale can be explained by changes in T, pH or f02 during sulfide deposition. Lead isotope composition of 6 galena samples have the following ratios: 18,02≤ 206Pb/204Pb≤ 18,08; 15,66≤ 207Pb204Pb≤ 15,70and 38,16 ≤ 208Pb/ 204Pb≤ 38,29 , similar to those reported by Marcoux (1987 in the Pierrefitte deposits (Central Pyrenees, France. These values are very homogeneous and suggest alead source situated within the upper crust. Calculated ages based on Cumming and Richards (1975 lead evolution model range from 422 to 452 m.a. (Upper Ordovician, which is the age of the enclosing rocks. These data confirm the hypothesis of a sedimentary-exhalative origin of the deposits.La composición isotópica del azufre en sulfuros (δ34S de las mineralizaciones tipo sedimentario-exhalativo del Ordovícico superior del valle de Arán (Pirineos Centrales varía entre +3,5 y +15,1 ‰ en los encajados en carbonatos y entre -2,7 y +5,5 ‰ en los encajados en materiales detríticos. Estos valores sugieren que dichos depósitos se formaron a partir de dos fuentes de azufre distintas: una originada por reducción de sulfato de origen marino y otra por lixiviación de materiales detríticos y/o volcánicos de edad cambro-ordovícica. El metamorfismo

  16. Análisis térmico de soldadura GTAW sobre placa de acero AISI 316L empleando el método de elementos finitos GTAW welding thermal analysis on AISI 316L steel plate using the finite elements method

    Directory of Open Access Journals (Sweden)

    Juan A. Pozo-Morejón

    2011-09-01

    Full Text Available En el presente trabajo se realiza la modelación térmica de soldadura GTAW sobre placa de acero inoxidable AISI 316L. Se analizan los aspectos teóricos más relevantes a considerar durante la ejecución de un análisis de este tipo. En la simulación se emplea un software de análisis por elementos finitos de uso general y se enriquece una metodología, previamente desarrollada, para la modelación en 3D no lineal transitoria del proceso de soldeo. En dicha metodología se implementa una subrutina en lenguaje APDL, programada con el modelo volumétrico de fuente calor de doble elipsoide, en un sistema de coordenadas cartesiano. Se analiza la influencia del paso de tiempo seleccionado sobre los resultados de la simulación. Finalmente se valida la metodología enriquecida, en base a la correlación de los resultados del modelo respecto a los resultados experimentales.In the present work, thermal modeling of GTAW welding on AISI 316L stainless steel plate is presented. More relevant theoretical aspects to be considered during the implementation of an analysis of this type are discussed. For the simulation a general purpose finite element analysis software has been used. A previously developed methodology for 3D nonlinear transient modeling of welding process has also been improved. In this methodology a subroutine in APDL language is implemented, programmed with the double ellipsoid volumetric heat source model, in a Cartesian coordinated system. The influence of the selected time step on the simulation results is analyzed. The good correlation obtained among the results calculated by means of the model and the experimental data validates this improved methodology.

  17. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  18. Todo sobre el neobarroco

    Directory of Open Access Journals (Sweden)

    Arturo Carrera

    2007-07-01

    Full Text Available Lo que hemos escuchado y atendido hasta aquí, hoy, ayer, sobre todo en la propuesta poética esbozada por Sergio Raimondi en su ensayo sobre Aldo Oliva, demuestra que las singularidades, su pasión, anulan subrepticiamente las nominaciones.Anoche en la televisión una orquesta sinfónica y un coro numeroso. Súbitamente, me hubiera gustado ser uno de esos intérpretes solitarios para sí, a pesar de la armonía, anónimos, a pesar del brillo sonoro… un violín, un triángulo… apenas… tres grillos… como ...

  19. Sobre el empleo de las categorías "elemento compositivo" y "prefijo" en los diccionarios de la RAE ON THE USE OF THE 'COMPOUND ELEMENT' AND 'PREFIX' CATEGORIES IN THE RAE DICTIONARIES

    Directory of Open Access Journals (Sweden)

    Marta Torres Martínez

    2011-01-01

    throughout the 18th, 19th and 20th centuries. Our starting point is the Diccionario de la lengua española (DRAE 2001, which classifies the prefixes extracted from a previous study (Varela and Martín García 1999 under two major grammatical categories: prefix and compounding element . We aim at determining why units of an apparently similar nature are labelled in two different ways in DRAE (2001: prefixes and composite / compounding elements (a case in point is that of the prefixes inter- and super- , which come from the Latin prepositions INTER and SUPER, also described as prefixes. Besides, this study briefly reviews the historical categorial treatment given to a selection of prefixes in from several editions of this academic dictionary (Diccionario de autoridades, 1726-39, and DRAE 1803, 1884, 1925 and 1970. Finally, it is our belief that a morphological description is essential for an accurate grammatical description, we additionally offer an overview of the treatment of prefixes in the grammars of the Real Academia de la Lengua (GRAE published between 1771 and 1931. The present study also examines the ideas underlying the Esbozo de una nueva gramática de la lengua española (1973 and the Nueva gramática de la lengua española (NGRAE 2009.

  20. Resumen estudios sobre tabaquismo

    OpenAIRE

    Gónzalez, M.M. (M.)

    2009-01-01

    Este documento se realizó para publicar en la página Web de la Gerencia de Atención primaria del Área III. Este documento es una recopilación de estudios sobre tabaquismo. Gerencia de Atención Primaria Área III

  1. Caracterización mineralógica de los productosde oxidación del sistema pirita-esfalerita por bacterias nativas oxidantes de Fe

    Directory of Open Access Journals (Sweden)

    DIONI MABEL ZAPATA AGUIRRE

    2008-01-01

    Full Text Available La biooxidación de esfalerita y pirita fue evaluada a nivel de shaker utilizando microorganismos acidófilos compatibles con Acidithiobacillus ferrooxidans, a diferentes porcentajes de pulpa y temperatura de 35ºC. Análisis por SEM evidenciaron morfologías y mecanismos de oxidación diferentes para los dos sulfuros. La esfalerita presenta una capa de azufre elemental que bordea núcleos remanentes, los cuales a su vez muestran golfos de corrosión, evidenciando la actividad oxidante del medio. Las capas de azufre muestran morfologías típicas de precipitación a partir de soluciones generadas por la lixiviación de los sulfuros presentes. De otro lado, en la pirita la oxidación se ve reflejada en los golfos y pits de corrosión, sin que se observen películas de azufre. Además del azufre elemental, el principal producto generado durante el proceso fue jarosita. La secuencia de formación de estas fases, así como la oxidación preferencial de la esfalerita sobre la pirita fueron evidenciadas.

  2. Tesis sobre municipalismo libertario

    OpenAIRE

    Bookchin, Murray

    2014-01-01

    Históricamente, la teoría y la práctica social radical se han centrado sobre dos campos de la actividad social humana: el lugar de trabajo y la comunidad. A partir de la creación del Estado-nación y de la Revolución Industrial, la economía ha ido adquiriendo una posición predominante sobre la comunidad; y no sólo en la ideología capitalista, sino también en los diferentes socialismos, libertarios y autoritarios, que han ido apareciendo en el último siglo. Este cambio de posición del socialism...

  3. Escrito sobre el cuerpo

    Directory of Open Access Journals (Sweden)

    Antonio Malalana Ureña

    2013-09-01

    Full Text Available El catálogo, en una edición bilingüe español-inglés, es una pequeña guía de la exposición Shirin Neshat. Escrito sobre el cuerpo, muestra que se integra dentro de los actos de PHOTOESPAÑA13, el festival internacional de fotografía y artes visuales. El esquema del libro es sencillo y los textos son extremadamente divulgativos. El primero de ellos, Escrito sobre el cuerpo (pp. 10-15, cuyo autor es Octavio Zaya, comisario de la exposición, resume la trayectoria de esta intelectual, que "interactúa" con la fotografía y los formatos audiovisuales, y nos presenta la argumentación narrativa de los documentos expuestos, contextualizando la obra recopilada.

  4. Inferencias sobre Grafos

    Directory of Open Access Journals (Sweden)

    Sira M. Allende

    2002-05-01

    Full Text Available El estudio de un juego puede ser modelado asumiendo que solo algunas partidas son observadas. Entonces el árbol del juego debe ser estimado utilizando información muestral. Similarmente ocurre al obtener información sobre el comportamiento de las decisiones tomadas por individuos muestreados sobre un árbol de decisión teórico. Al considerar una medida de probabilidad que caracterice el comportamiento de redes aleatorias se puede obtener un estimado del árbol asociado. Este problema es el analizado en este trabajo. Algunos resultados experimentales obtenidos usando Recocido Simulado ilustran el procedimiento. Su papel en el estudio de modelos económicos y de mercadeo es discutido.

  5. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  6. Concepções do profissional farmacêutico sobre a assistência farmacêutica na unidade básica de saúde: dificuldades e elementos para a mudança Conceptions of the pharmaceutical professional about the pharmaceutical assistance in basic health care units: difficulties and elements for change

    Directory of Open Access Journals (Sweden)

    Aílson da Luz André de Araújo

    2006-03-01

    Full Text Available No presente estudo foi feita avaliação da Assistência Farmacêutica em farmácias de Unidades de Saúde do município de Ribeirão Preto, no Estado de São Paulo, Brasil. Partindo-se do referencial de avaliação tecnológica em saúde e suas interfaces, foram realizadas entrevistas com os profissionais farmacêuticos, procurando-se conhecer as concepções desses atores sobre a assistência farmacêutica. Os resultados obtidos mostram um trabalho baseado na gestão burocrática dos medicamentos com objeto no controle de estoque do medicamento. Alguns elementos emergentes que poderão contribuir para a alteração deste quadro foram detectados: voluntarismo, busca pela valorização profissional, iniciativa de integração com a equipe de saúde, percepção do paciente como objeto de trabalho e formação profissional complementar.In the present study we evaluated the Pharmaceutical Assistance in pharmacies of Basic Health Care Units in Ribeirão Preto, State of São Paulo, Brazil. Considering the technological evaluation reference in health and its interfaces, pharmaceutical professionals were interviewed in a way to find out their conceptions about pharmaceutical assistance. The results showed a work based on the bureaucratic management of medicines specially the control of medicine supplies. Some emergent elements were thought to contribute to change this system: voluntarism, professional valorization, integration of the health team, perception of the patient as object of the work and complementary professional formation.

  7. Fertilización con azufre en el cultivo de papa (Solanum tuberosum L. para la industria en el Sudeste Bonaerense Effect of sulfur fertilization on potato for the processing industry in southeastern Buenos Aires

    Directory of Open Access Journals (Sweden)

    Claudia Marcela Giletto

    2012-07-01

    Full Text Available Los incrementos en los rendimientos de los últimos años aumentaron la demanda de azufre (S en papa y los niveles de materia orgánica en el suelo han bajado. Estos factores podrían favorecer la aparición de deficiencias de S. Por lo tanto, el objetivo de este trabajo fue determinar la incidencia de la fertilización con S en papa para la industria en el sudeste bonaerense. Se realizaron dos ensayos (Sitio 1 y 2 con tres dosis de S: S0 (testigo; S10 (10 kg S ha-1 y S20 (20 kg S ha-1. La producción de materia seca total y la cantidad de S acumulado en planta no fueron afectadas por la aplicación de S. La relación N:S total disminuyó a lo largo del ciclo de cultivo en ambos sitios y fue inferior al umbral crítico de 15:1 e indicó que el cultivo no presentó deficiencias de S. El rendimiento, la concentración de S y la relación N:S en los tubérculos no fueron afectados por el agregado de S en ningún sitios. La cantidad máxima de S acumulado en los tubérculos a cosecha fue en promedio de 18,8 y 14,2 kg ha-1 en el Sitio 1 y 2; respectivamente, mientras que los aportes de S por la aplicación de funguicida y del agua de riego alcanzaron valores de 14 y 17 kg ha-1, respectivamente. A partir del balance de masa de S se determinó que el S residual fue el principal destino del nutriente en el sistema suelo-planta. Se recomienda conocer los aportes de S en los funguicidas y en el agua de riego al diseñar un plan de fertilización con S en papa.In recent years, sulfur (S requirements in potato crops have been increasing due to increasing yields. Soil organic matter contents have been decreasing in Southeastern Buenos Aires thereby limiting the capacity of the soils in this area to meet the higher requirements. The aim of this study was to determine the effect of S fertilization on potato for the processing industry in southeastern Buenos Aires. Two experiments were carried out (Site 1 and 2 involving three different S rates: S0 (control, S

  8. Puente sobre el Rin

    Directory of Open Access Journals (Sweden)

    Gortz, Wilhelm

    1961-12-01

    Full Text Available Del total de 35 proyectos presentados al concurso del puente para carretera sobre el Rin, entre Duisburg-Ruhrort y Homberg, sólo dos proposiciones de la Demag fueron consideradas: Una con tablero suspendido por vientos que parten de dos torres, y otra, con suspensión por cables flexibles que se apoyan en dos torres y anclaje en la misma estructura. Por razones netamente estéticas fue elegida la propuesta Demag de puente suspendido por cables, aunque la solución con vientos hubiera sido la más económica, teniendo en cuenta las condiciones existentes.

  9. Saber sobre la radio

    OpenAIRE

    Mata, María Cristina; Universidad Nacional de Córdoba. Argentina

    1998-01-01

    La autora propone en este artículo repensar los fundamentos sobre los cuales se estructuran las asignaturas y talleres de radio en las escuelas de Comunicación Social en Latinoamérica, con el proposito de romper la escisión  entre teoría/práctica y de no violentar su complejidad: en la radio, entendida como práctica comunicativa, se juega en primer lugar una "red de vinculaciones e intercambios" en condiciones privilegiadas para la dialoguicidad. En un segundo lugar, asociado al desarrollo de...

  10. Excertos sobre o sedentarismo

    OpenAIRE

    Alexandre Palma; Murilo Mariano Vilaça; Monique Ribeiro de Assis

    2014-01-01

    O sedentarismo tem sido tratado como algo perfeitamente determinável, objetivo e, portanto, que pode ser apreendido. Por outro lado, o conceito de sedentarismo ainda permanece questionável e, por conseguinte, os instrumentos mostram-se inconsistentes. Neste sentido, o objetivo do presente estudo foi mostrar que diferentes discursos de verdade vêm concorrendo por esse conceito, o que nos motiva a pensar qual é a verdade ou, até mesmo, se há alguma verdade sobre ele. Após apresentarmos diferent...

  11. Sobre historia mundial hoy

    Directory of Open Access Journals (Sweden)

    Vera Weiler

    2010-08-01

    Full Text Available Los procesos de globalización son una realidad; su enorme impacto sobre la vida humana los ha convertido en un tema recurrente sobre el que se escribe y se comenta a diario también en Colombia. Los libros que de ellos tratan, ante todo los que 10 hacen en tono crítico, baten records en la industria editorial en todo el mundo. Las expectativas que acerca del futuro abrigan cientos de millones de personas se relacionan con 10 que ellas esperan, para bien o para mal, de la globalización. Las posturas que los gobernantes ocupan al respecto en el mundo son, cuando menos de aceptación, generalmente de activa participación en pos de la globalización. Por un lado, crece la preocupación y se multiplican las protestas; por el otro, dominan los razonamientos de los especialistas en materia de maximización de los rendimientos de los capitales que presentan la globalización, al estilo que se viene imponiendo, como el camino ineludible del gobierno universal de la eficiencia. ¿Tienen que decir algo los historiadores frente a todo esto?.

  12. Sobre la tragedia griega

    Directory of Open Access Journals (Sweden)

    Mauricio Vélez Upegui

    2015-01-01

    Full Text Available Luego de caracterizar la tragedia griega clásica como expresión de un arte ciudadano que participa por igual de un carácter festivo, cierto régimen discursivo y una clara inscripción físico-espacial, el texto se demora en considerar tres aspectos fundamentales de esta forma dramática inventada por los griegos, a saber: una exposición sobre las fuentes orales míticas de las que los autores echan mano para componer la historia de cada una de las piezas que son llevadas a escena al amparo de un espíritu agonal; una explicación del funcionamiento formal de la tragedia, basado en la alternancia de partes cantadas (coro y partes recitadas (héroe; y, finalmente, una acotación sobre el sentido –interno y externo– que la acción dramática posee, en tanto elemento articulador de la trama.

  13. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  14. Excertos sobre o sedentarismo

    Directory of Open Access Journals (Sweden)

    Alexandre Palma

    2014-09-01

    Full Text Available O sedentarismo tem sido tratado como algo perfeitamente determinável, objetivo e, portanto, que pode ser apreendido. Por outro lado, o conceito de sedentarismo ainda permanece questionável e, por conseguinte, os instrumentos mostram-se inconsistentes. Neste sentido, o objetivo do presente estudo foi mostrar que diferentes discursos de verdade vêm concorrendo por esse conceito, o que nos motiva a pensar qual é a verdade ou, até mesmo, se há alguma verdade sobre ele. Após apresentarmos diferentes possibilidades de compreender o sedentarismo, através do uso de aforismos, entendemos que postular um discurso como verdade talvez apenas signifique que as pessoas nele creem e que há uma vontade de verdade como uma vontade voltada para o poder.

  15. Sobre el Portugal ilustrado

    OpenAIRE

    Santolaya Heredero, Laura

    1992-01-01

    El mismo título invita a preguntarse, a modo de introducción, en qué consistió la Ilustración en Portugal. Me refiero a las prácticas, sin pretender entrar en un debate filosófico. Desde luego, las prácticas políticas y económicas de los Estados del XVIII poco tuvieron que ver con las ideas de los filósofos de la Ilustración. El fenómeno de la Ilustración se aprovechió de una propaganda anecdótica para hacer suponer a los lectores de libros sobre ella que en los diversos ...

  16. Sobre multifunciones Fuzzy

    Directory of Open Access Journals (Sweden)

    Renato César Scarparo

    2002-01-01

    Full Text Available En este trabajo se presentan y demuestran algunos resultados de D.T. Luc y C, Vargas referentes a multifunciones con dominio y blanco en espacios vectoriales topológicos de Hausdorff sobre R, como así mismo se explícita el concepto de multifunción fuzzy de acuerdo a Papageogiou, y se demuestran dos teorema de S. S. Chag, con respecto a las multifunciones fuzzy, proposiciones todas estas, que integran una línea de resultados necesarios para la demostración de desigualdades variacionales para multifunciones fuzzy, a su vez necesarias, para la extensión fuzzy de conocido teorema de Walras.

  17. Element Research.

    Science.gov (United States)

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  18. Sobre la muerte voluntaria

    Directory of Open Access Journals (Sweden)

    Juan Álvarez-Cienfuegos Fidalgo

    2012-03-01

    Full Text Available El problema de cómo morir en nuestra sociedad se ha convertido en una inquietud para los ciudadanos y la reflexión moral. Especialmcnte por dos razones: por el desarrollo de la tecnología médica y por el hecho de que la mayor parte de los fallecimientos tienen lugar fuera del hogar, donde tradicionalmente ocurra el deceso. El presente artículo tiene como objetivo acercarse a esta cuestión. Para ello, se parte de la autonomía del ciudadano, con derecho a decidir sobre lo que considera cuál sea su manera de vivir y de morir. A tal fin, se hace una breve introducción sobre el dolor, el suicidio y la muerte, desde un punto de vista antropológico, pasando, después, a mostrar las cuestiones relacionadas con el problema de la eutanasia, donde la atención se dirigirá, ante todo, al enjuiciamiento crítico del tenso equilibrio en el que se mantienen dos principios fundamentales de la bioética: el de no maleficencia y el de autonomía del ciudadano.The problem of how to die in modern society has become a concern for both the citizen and moral reflection for two reasons in particular: due to developments in medical technology, and because most deaths occur outside the honre, where they traditionaÍlY took place. This paper addresses this issue, starting from citizen autonomy, the right to decide on what s/he considers to be his or her way of living and dying. To this end, a brief introduction considers pain, suicide and death from an anthropological viewpoint. Questions related to the problem of euthanasia are then exposed, with particular attention to, above all the critical judgement of the tense balance in which two fundamental principies of bioethics are held, the principle of non-maleficence and that of citizen autonomy.

  19. Debate sobre el parto (normal).

    OpenAIRE

    Vidal Puèrtolas, Adela

    2008-01-01

    El artículo pretende una reflexión sobre la asistencia al parto, desde el punto de vista de una comadrona. A raíz de la apuesta oficial sobre el cómo para humanizar la asistencia obstétrica hospitalaria, se plantea un análisis de las implicaciones profesionales y los matices culturales que influyen sobre la vivencia de la experiencia del parto. La importancia de la psico-profilaxis en la preparación al parto como vehículo terapéutico de acercamiento a la realidad y de ...

  20. Debate internacional sobre pobreza

    Directory of Open Access Journals (Sweden)

    Neritza Alvarado Chacín

    2016-01-01

    Full Text Available El objetivo del artículo es organizar la proliferación de ideas en torno de la pobreza, a menudo dispersas, difusas y confusas en la literatura, bosquejando sistematizadamente un marco teórico referencial útil al abordaje científico de este fenómeno, en investigaciones teóricas y aplicadas, así como en la enseñanza y discusión de tales temas en el ámbito universitario. Para ello, se compendian, organizan y clasifican diversos enfoques sobre la pobreza, según los criterios presentes en los planteamientos de autores e instituciones relevantes que han contribuido a la reflexión desde distintas lecturas, teniendo en cuenta que no existe consenso en torno a una definición. La investigación es exploratoria-documental. Se aplican las técnicas del arqueo electrónico y físico de la información, el fichaje computarizado y la reducción de la misma en tablas de contenido. Se precisa el alcance de las mismas en el tiempo, según la evolución conceptual que han experimentado en el debate internacional. Se señalan algunas ventajas y desventajas de los principales enfoques, que han sido reconocidas en el mismo debate.

  1. Efectos a corto plazo de la contaminación atmosférica sobre la mortalidad: resultados del proyecto EMECAM en Pamplona, (1991-95

    Directory of Open Access Journals (Sweden)

    Aguinaga Ontoso Inés

    1999-01-01

    Full Text Available FUNDAMENTO: evaluar el impacto a corto plazo de la contaminación atmosférica sobre la mortalidad diaria de la ciudad de Pamplona MÉTODO: Estudio ecológico con una población de 212.000 habitantes. Se realiza análisis de datos de series temporales, mediante regresión lineal múltiple y regresión de Poisson, con la información de datos de mortalidad diaria, niveles de contaminación atmosférica para Partículas y SO2, parámetros meterológicos de temperatura y humedad media diarios y número de casos semanales de gripe, en los años 1991 a 1995 RESULTADOS: La media de muertes diarias por causas no externas es de 4,15 muertos con un rango de cero a 13 muertes. La ciudad de Pamplona tiene una temperatura media anual de 12,7ºC (-2,3ºC a 31.6ºC y una humedad relativa del 68.5%. En el modelo, la temperatura (con retardo de un día y retardo de 6 días temperatura al cuadrado y la humedad (con retardo de un día esta relacionada con la mortalidad por todas las causas. Pero la mortalidad por causas no externas sólo se relaciona en el modelo con la temperatura (retardo un día, P: 0.035 y cinco días con temperatura al cuadrado (p: 0.028 Las estimaciones puntuales del riesgo relativo de partículas muestran que el máximo riesgo de morir se produce en las causas respiratorias con un riesgo relativo de 1.13. Sin embargo ninguna de estas asociaciones es estadísticamente significativa. En el caso de Dióxido de Azufre las estimaciones están muy próximas al valor nulo y ninguna de ellas es significativa. CONCLUSIONES: la Temperatura tiene efecto sobre la mortalidad por todas las causas tanto externas como no externas y la humedad solo tienen efecto sobre la mortalidad por causas no externas. No se ha podido demostrar una influencia de los niveles diarios de contaminación ambiental sobre la mortalidad diaria.

  2. Reforma catalítica do metano sobre 1,5%Ni/α-Al2O3 dopado com elementos metálicos diferentes Catalytic reforming of methane over 1.5%Ni/α-Al2O3 doped with different metallic elements

    Directory of Open Access Journals (Sweden)

    L. S. Neiva

    2012-06-01

    Full Text Available O objetivo deste trabalho é desenvolver catalisadores de Ni suportados em α-Al2O3 dopada com os seguintes elementos metálicos: ferro, zinco, cério e zircônio. Os suportes catalíticos de α-Al2O3 dopada foram obtidos por meio do método de síntese da reação de combustão e o níquel, na condição de espécie ativa catalítica, foi depositado sobre os suportes por meio do método de impregnação úmida. As caracterizações estruturais, bem como, a avaliação dos desempenhos catalíticos destes materiais cerâmicos na reação de reforma a vapor do metano fazem parte dos objetivos deste trabalho. Os suportes catalíticos sintetizados apresentaram estruturas cristalinas com dimensão de suas porosidades na faixa da microporosidade associada à presença de mesoporos. A avaliação catalítica das amostras obtidas neste trabalho, na reação de reforma a vapor do metano, revelou que o desempenho catalítico deste tipo de material é influenciado por suas características físicas, tais como, valor da área superficial das partículas que compõem a estrutura, como também, o valor médio dos diâmetros de poros da mesma. Dentre as quatro amostras desenvolvidas neste trabalho, a amostra de α-Al2O3 dopada com zinco contendo 1,5% de Ni como espécie ativa catalítica, apresentou valores percentuais de conversão do metano mais elevados que as demais amostras.The aim this work is to develop Ni catalysts supported on α-Al2O3 doped with the following metallic elements: iron, zinc, cerium and zirconium. The catalytic supports composed by α-Al2O3 doped were obtained by means method of synthesis of the combustion reaction and the nickel in the active catalytic species condition, was deposited over the supports by the method of wet impregnation. The structural characterizations, as well as the evaluation of performance of these ceramic materials in catalytic reaction of steam reforming of methane are among the objectives of this work. The

  3. Materia seca nodular y nitrógeno acumulado en el cultivo de soja en función de la disponibilidad de agua y azufre, y del sistema de labranza Nodular dry matter and accumulated nitrogen in soybean as a function of water and sulfur availability and tillage system

    Directory of Open Access Journals (Sweden)

    Pablo Cicore

    2005-12-01

    Full Text Available La material seca nodular (MSN y el nitrógeno acumulado (N-acum. en el cultivo de soja fueron evaluados en función del sistema de labranza [siembra directa (SD y labranza convencional (LC] y la disponibilidad de azufre (S. Para ello, se realizaron en Balcarce durante la campaña 2002-03 dos experimentos, uno conducido bajo riego (Ri y otro en secano (Se. La MSN determinada en R5 no fue afectada por la aplicación de S (P>0.10, sin embargo fue mayor bajo SD en Se (PNodular dry matter (NDM and accumulated nitrogen (AN in a soybean crop were evaluated as a function of tillage system [no-tillage (NT and conventional tillage(CT] and sulfur (S availability in two experiments carried out under irrigation (Ri and rainfed conditions (Se. The experiment was carried out at Balcarce in the 2002-2003 growing season. The NDM, determined at R5 stage, was not affected by S fertilization (P>0.10 but was higher under NT in Se (P< 0.05. Under Ri NDM was higher under NT but this difference was not significant. The AN was not affected by S fertilization, and under rainfed conditions, it was significantly lower (P<0.05 under CT. The AN was positively related with NDM but the r² value was low (36%, suggesting that NDM was not the only factor regulating biological N2-fixation.

  4. Efecto a corto plazo de la contaminación atmosférica sobre la mortalidad. Resultados del proyecto ENECAM en la ciudad de Vigo, 1991-1994

    Directory of Open Access Journals (Sweden)

    Taracido Trunk Margarita

    1999-01-01

    Full Text Available FUNDAMENTOS: En la Comunidad Autónoma Gallega no se ha realizado ningún estudio sobre las repercusiones de la contaminación atmosférica en la salud, a pesar de que hay varias ciudades grandes, con niveles de contaminación moderados. Por ello, nos hemos planteado la necesidad de realizar este estudio en la ciudad de Vigo. El objetivo principal de este trabajo es analizar el impacto a corto plazo de la contaminación atmosférica sobre la mortalidad diaria por todas las causas en la ciudad de Vigo durante los años 1991 a 1994, utilizando el protocolo de análisis del proyecto EMECAM. MÉTODO: Se relacionan las variaciones diarias del número de muertes por todas las causas, excepto las externas, con las variaciones diarias de dióxido de azufre y partículas, por medio de modelos de regresión de Poisson. Se utiliza también un modelo no paramétrico para ver si controla mejor las variables de confusión. RESULTADOS: Con el modelo de regresión de Poisson no se observan relaciones significativas entre los contaminantes y la mortalidad. En el modelo no paramétrico se observa relación entre la concentración de partículas del día anterior a la fecha de defunción y la mortalidad, efecto que se mantiene al incluir los términos autorregresivos. CONCLUSIONES: La contaminación atmosférica por partículas representa un riesgo para la salud, a pesar de que los niveles medios de este contaminante en la ciudad de Vigo están dentro de los niveles guía de calidad del aire.

  5. Efectos a corto plazo de la contaminación atmosférica sobre la mortalidad: resultados del proyecto EMECAM en Valencia, 1994-96

    Directory of Open Access Journals (Sweden)

    Tenías Burillo José María

    1999-01-01

    Full Text Available FUNDAMENTO: Estimar el efecto a corto plazo de la contaminación atmosférica sobre la mortalidad en la ciudad de Valencia, durante el periodo 1994-1996, utilizando la metodología de análisis del estudio multicéntrico español sobre la relación entre la contaminación atmosférica y la mortalidad (proyecto EMECAM. MÉTODOS: De la red de vigilancia de la contaminación atmosférica de Valencia se obtuvieron los niveles diarios de humos negros, dióxido de azufre (SO2, dióxido de nitrógeno (NO2, monóxido de carbono (CO y ozono (O3. Los indicadores de mortalidad analizados fueron el número diario de defunciones por todas las causas, menos las externas, la mortalidad en mayores de 70 años, y la ocurrida por enfermedades respiratorias y del aparato circulatorio. Siguiendo la metodología del proyecto EMECAM se construyeron modelos de regresión autoregresiva de Poisson controlando por los diferentes factores de confusión (estacionalidad, tendencia, calendario, variables meteorológicas e incidencia de gripe. RESULTADOS: Para la mortalidad por todas las causas menos las externas se halló un efecto significativo de los humos negros (RR 10 µg/m3: 1,013; IC95% 1,003 a 1,023 y del CO 24 h (RR 1 mg/m3: 1,024; IC95% 1,003 a 1,046. Para la mortalidad en mayores de 70 años el efecto estimado fue algo mayor para humos negros (RR 10 µg/m3: 1,017; IC95% 1,005 - 1,029, así como para SO2 1h (RR 10µg/m3: 1,010; IC95% 1,002 - 1,018 y NO2 1h (RR 10 µg/m3: 1,007; IC95% 1,001 - 1,013. No se encontró una asociación significativa con la mortalidad por enfermedades respiratorias y del aparato circulatorio para todo el período. CONCLUSIONES: Los niveles actuales de contaminación en la ciudad de Valencia presentan un efecto significativo sobre la mortalidad diaria. Estos resultados son consistentes con los de investigaciones anteriores y coherentes con los obtenidos al analizar la relación entre contaminación atmosférica e indicadores de morbilidad.

  6. Efectos de la contaminación atmosférica sobre la mortalidad diaria en la ciudad de Zaragoza, España, 1991-1995

    Directory of Open Access Journals (Sweden)

    Arribas-Monzón Federico

    2001-01-01

    Full Text Available Objetivo. Analizar posibles efectos a corto plazo de la contaminación atmosférica sobre la mortalidad diaria en la población de Zaragoza (España. Material y métodos. Estudio ecológico realizado en Zaragoza, España, en los años 1991 a 1993. Mediante modelos de regresión de Poisson autorregresiva se estudió la asociación entre exposición a partículas en suspensión y dióxido de azufre (SO2, y defunciones diarias de 1991 a 1995. Se consideraron por separado cuatro variables respuesta: mortalidad total para toda la población (excluidas las causas externas, mortalidad en mayores de 69 años, mortalidad específica por enfermedades respiratorias y mortalidad por enfermedades cardiovasculares. Resultados. No se utiliza muestra. Se utilizaron los paquetes estadísticos EGRET y SPSS. Se encontraron asociaciones entre niveles de SO2 y mortalidad por enfermedades cardiovasculares, riesgo relativo (RR=1.018 IC 95%: 1.001-1.036, así como entre partículas en suspensión y mortalidad por enfermedades respiratorias (RR=1.028 IC 95%: 1.006-1.051. Durante épocas cálidas, se observó un efecto significativo de las partículas en suspensión sobre la mortalidad por enfermedades cardiovasculares (RR=1.020 IC 95%: 1.001-1.040. Conclusiones. A pesar de los bajos niveles de contaminación existentes, se han detectado efectos significativos de incrementos en la concentración de contaminantes atmosféricos sobre la mortalidad por enfermedades cardiovasculares y respiratorias, especialmente en los meses cálidos. El texto completo en inglés de este artículo está disponible en: http://www.insp.mx/salud/index.html

  7. Estudio de casos Aislamiento de bacterias del hierro y azufre como productoras de biodeterioro o corrosión anaeróbica en tuberías y daño a otros materiales

    Directory of Open Access Journals (Sweden)

    Virginia Montero Campos

    Full Text Available Los procesos de biodeterioro son reconocidos actualmente como una de las mayores causas de deterioro en superficies de diversos materiales, queafectan a una gran cantidad y diversos tipos de industrias. Una superficie metálica en contacto con agua o tierra experimenta una serie de cambios biológicos e inorgánicos que constituyen el fouling. La posterior secuencia de cambios biológicos es debido a la adherencia irreversible de diferentes tipos de microorganismos sobre el metal a través del material polimérico extracelular, constituyendo ello, el biofouling. La biocorrosión y el biofouling de las superficies se deben a procesos biológicos y electroquímicos que ocurren mediante la participación de microorganismos adheridos a las superficies a través de biofilmes. Estas películas biológicas modifican las condiciones de la interfase metal/solución, formando una barrera al contacto entre el metal o material y el medio circundante, se considera que la corrosión microbiológica transcurre entonces sobre una superficie modificada con características fisicoquímicas y biológicas muy particulares y condicionadas, donde no se puede interpretar con los mismos parámetros de un proceso de corrosión inorgánica.

  8. Razonamiento algebraico elemental: propuestas para el aula

    Directory of Open Access Journals (Sweden)

    Walter F. Castro G

    2014-09-01

    Full Text Available En este artículo se aborda el problema de la enseñanza de álgebra en la escuela primaria. Se discute lo que se entiende como “early álgebra” y se presentan varios enfoques sobre la introducción del álgebra en la escuela elemental. En correspondencia con los enfoques, se discuten tanto algunas tareas de razonamiento algebraico elemental que pueden ser implantadas en el aula, como algunas de las características algebraicas atribuidas. Finalmente, se presenta una propuesta para asignar niveles o grados de algebrización a algunas tareas.

  9. Sobre Humanismo y Medicina

    Directory of Open Access Journals (Sweden)

    Adolfo de Francisco Zea

    2000-12-01

    Full Text Available

    En esta disertación sobre “Humanismo y Medicina”, título del libro que tuve ocasión de publicar hace un par de años, destacaré algunas de las relaciones que existen entre la medicina y las bellas artes, concretamente la música y la pintura. La Medicina tiene como objeto de su acción al Hombre. Definida como la ciencia y el arte de prevenir, curar o aliviar la enfermedad, no tiene como meta la simple prolongación de la vida biológica.

    Su tarea consiste en postergar la muerte, prevenir o reducir los padecimientos y las deformidades, curar las enfermedades, ampliar las capacidades biológicas y psicológicas de los seres humanos y ocuparse de los sufrimientos de las personas. Para Tristam Engelhardt, es la Medicina de las personas.

    Se concibe a la persona humana como el individuo de conciencia reflexiva normal que es a la vez miembro pleno de la comunidad, con los deberes y derechos que presuponen su pertenencia a ella. A esta acepción de carácter moral de la persona humana, que corresponde a lo que se llama persona “en sentido estricto”, se agrega la acepción social, que hace relación con aquellas personas a las que se otorgan prácticamente los mismos derechos, como es el caso de los niños, de los individuos que perdieron el carácter de personas por padecer de lesiones cerebrales o demencia, y de aquellos que nunca llegarán a serlo como los retrasados mentales profundos.

    Al sostener que no todos los seres humanos son personas “en sentido estricto”, la Bioética que expone Engelhardt impone, sin embargo, como obligación moral, tratar a estos últimos con pleno respeto y comprensión. Lo que es importante acerca de nosotros mismos como seres humanos, es el hecho real de que seamos personas; no simplemente nuestra pertenencia al género Horno sapiens como tal.

    Para Víctor Frankl, la persona humana es de carácter espiritual y en tal virtud, es diferente del organismo psicofísico cuya

  10. Acueducto pretensado sobre el Holme

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1958-04-01

    Full Text Available Breve descripción del paso de una canalización de 0,60 m de diámetro, destinada al abastecimiento de aguas, sobre el río Holme (Inglaterra. El puente formado tiene dos vigas de hormigón pretensado, cuyas armaduras se componen de barras McCall.

  11. Breve informe sobre la coca

    Directory of Open Access Journals (Sweden)

    Lauro Hinostroza García

    1985-12-01

    Full Text Available El presente informe se integra en la investigación dirigida por el doctor Juan Ossio, por encargo de la Organización de los Estados Americanos (O.E.A. sobre “EFECTOS SOCIALES, CULTURALES, MÉDICOS Y ECONÓMICOS DEL USO TRADICIONAL DE LA COCA EN POBLACIONES DEL ANTIPLANO Y SIERRA DEL PERÚ, EN ESPECIAL DE LAS POBLACIONES INDÍGENAS”. Expone tópicos sobre la hoja de coca en la cultura andina: criterios clasificatorios, mitos, canciones y una muestra de qatipay o seguimiento. Este último es una práctica ritual importante para el campesinado andino, orienta el presente, pasado y futuro de toda su actividad. Cada hoja, por su forma, posición y tamaño, develará los roles sociales que ha de asumir, es decir los misterios del tiempo.

  12. Sobre la verdad en periodismo

    Directory of Open Access Journals (Sweden)

    Julio Estremadoyro Alegre

    2011-05-01

    Full Text Available Cuando un periodista informa sobre un desastre natural, con granpérdida de vidas, las autoridades y las fuentes de primera manodan cifras que son difundidas como verdades del suceso. Sinembargo, y la experiencia lo confirma, al día siguiente la cifraspueden haber cambiado y, por lo tanto, la verdad informativa esotra. Y así, sucesivamente, cada día habrá novedades y nuevas cifras verdaderas.

  13. Puente sobre el Rin Dusseldorf, Alemania Federal

    Directory of Open Access Journals (Sweden)

    Modemann, H. J.

    1980-05-01

    Full Text Available The bridge over the Rhine, in Dusseldorf- Flehe — one of whose most important jobs is to alleviate traffic from the other bridges in the town of Dusseldorf — consists of three clearly diferentiated parts: — a metal part 368 m. in length; — another in prestressed concrete, 780 m. long, and — an A-shape pylon, acting as element joining both. This bridge has the span clearance record in West Germany, and its metal part constitutes the longest corbel in the world.

    El puente sobre el Rin, en Düsseldorf- Flehe —una de cuyas funciones más Importantes es la de aliviar el tráfico a los demás puentes existentes en la ciudad de Dusseldorf—, consta de tres partes claramente diferenciadas: — una metálica de 368 m de longitud; — otra de hormigón pretensado de 780 m de largo, y — un pilono, en forma de A, que sirve como elemento de unión entre ambas. Este puente ostenta el récord de luz libre en la República Federal Alemana, y su parte metálica constituye el voladizo de mayor longitud del mundo.

  14. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  15. Sobre el Kelsen de Ferrajoli

    OpenAIRE

    Ruiz Manero, Juan

    2015-01-01

    El objeto de este trabajo es el de dar cuenta de las críticas a Kelsen contenidas en el último libro, todavía inédito, de Luigi Ferrajoli, Diritto e lógica. Dieci aporie nell'opera di Hans Kelsen, y formular algunas críticas a las tesis sostenidas en él por el propio Ferrajoli. Entre las críticas que el autor considera que cabe dirigir a este respecto a Ferrajoli, las principales afectan al carácter exclusivamente interno de la mirada ferrajoliana sobre el derecho, al carácter siempre opinabl...

  16. Manual de lecciones sobre objetos

    OpenAIRE

    2010-01-01

    Pautas para la enseñanza inicial con niños, apoyado con Objetos. Traducido por S. Bond (Profesor de la Universidad Nacional). Contiene: Desarrollo de la observación - Desarrollo de las ideas de forma - Ejercicios preliminares para enseñar a los niños a observar formas - Desarrollo de las ideas de dibujo -  de color - de número - de tamaño - de peso -  de sonido -  sobre el cuerpo humano - de lugar - morales

  17. Sobre el contenido del despertar

    OpenAIRE

    Badr, Marisa

    2013-01-01

    El presente trabajo tiene como propósito situar algunas referencias, sobre lo que Freud denomina “la perturbación” en los sueños. De este modo, intentaremos situar algunas consideraciones respecto a los sueños de angustia como principal antecedente del fracaso de la función del sueño y del principio del placer como principio rector del aparato anímico. Tomaremos como punto de partida los sueños de angustia, en “La interpretación de los sueños” de Sigmund Freud.

  18. Generalidades sobre las fibras artificiales

    OpenAIRE

    González Salcedo, Luis Octavio

    2012-01-01

    Las fibras han sido utilizadas como materia prima en la elaboración de otros productos, como telas, papel, artesanías, entre otros, y como material de refuerzo en diversas matrices cerámicas y metálicas, con el fin mejorar o ganar propiedades, en materiales compuestos denominados composites. Las fibras pueden ser clasificadas de acuerdo con su origen, en fibras naturales y fibras artificiales. Una amplia exploración sobre el uso de fibras vegetales ha sido realizada, sin embargo su uso ...

  19. Prototipo de RINA sobre Ethernet

    OpenAIRE

    Bergesio, Leonardo

    2013-01-01

    Este PFM se enmarca dentro del trabajo a realizar por el proyecto IRATI. IRATI es un proyecto STReP (Specific Targeted Research Project) financiado por la Unión Europea dentro del programa FP7 (Seventh Framework Programme for Research and Technological Development). El objetivo general de IRATI es conseguir una mayor compresión y exploración de RINA. El trabajo que se reportará en este PFM es (aproximadamente) la primera fase del diseño y desarrollo de un prototipo de RINA sobre Ethernet en e...

  20. Algunas conjeturas sobre fracciones egipcias

    OpenAIRE

    Mora, Lyda Constanza; Lima, Isaac

    2003-01-01

    A continuación se presentan algunas conjeturas sobre las fracciones, con base en el tratamiento que los Egipcios hacían en antigüedad. En la primera parte se hace una introducción a las fracciones unitarias, y la representación de fracciones con numerador dos por medio de la suma de fracciones unitarias distintas. En la segunda parte, se presentan algunas de las conjeturas halladas a partir de la determinación de regularidades presentes en adiciones entre fracciones cuya suma es una fracción ...

  1. Desarrollo de aplicaciones sobre SCTP

    OpenAIRE

    López Aragoneses, Jorge

    2009-01-01

    En el año 2000, el grupo SIGTRAN definió un nuevo protocolo de capa de transporte conocido como Stream Control Transmission Protocol (SCTP) pensado, inicialmente, para transportar señalización telefónica SS7 sobre IP. La intención fue proveer en IP algunas de las características de confiabilidad de SS7. Por su versatilidad, más tarde, se ha propuesto utilizarlo en otras áreas. Para tal fin, se ha realizado este proyecto fin de carrera, en el cual se estudiarán las características del protocol...

  2. Blanco sobre blanco sobre blanco: Oiticica / Malevich / Nietzsche

    Directory of Open Access Journals (Sweden)

    Sérgio Martins

    2014-09-01

    Full Text Available El blanco sobre blanco, de Malevich, es una presencia fuerte en los escritos de Hélio Oiticica durante los setenta. Este artículo investiga los diferentes momentos del enlace de Oiticica con Malevich y el papel de esa noción en su pensamiento, articulándola a la referencia igualmente importante de Oiticica a John Cage y a la filosofía de Nietzsche. Así, es posible percibir tanto la centralidad del escrito para Oiticica en esta década, como la singularidad del modo de enunciación en él contenido, que puede ser descrito como aquel de un escrito manifiesto.

  3. Recursos y enlaces sobre comunidades de aprendizaje

    OpenAIRE

    Ferrer Esteban, Gerard

    2005-01-01

    Obras y artículos sobre el proyecto Comunidades de Aprendizaje desarrollado en el Estado español. Tesis doctorales sobre comunidades de aprendizaje. Fundamentación teórica de las comunidades de aprendizaje. Sitios en Internet relacionados con las comunidades de aprendizaje y proyectos afines de desarrollo comunitario en contextos escolares.

  4. As monografias sobre plantas medicinais

    Directory of Open Access Journals (Sweden)

    Valdir F. Veiga Junior

    2008-09-01

    Full Text Available As monografias sobre plantas medicinais ou drogas vegetais contêm informações para atender não somente aos órgãos de regulamentação, mas também às empresas industriais farmacêuticas e farmácias, e mesmo ao público consumidor. Este artigo revê as monografias da Comissão E, do American Botanical Council, ESCOP, PDR e da Organização Mundial de Saúde em suas origens, objetivos e formatos. Duas publicações recentemente organizadas pela FIOCRUZ do Rio de Janeiro e as contribuições da Farmacopéia Brasileira também são avaliadas.

  5. Puente sobre el rio Lay

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1959-11-01

    Full Text Available El puente sobre el río Lay, salva el río formando un ángulo de 69° con la dirección de éste. Situado en el término municipal de la Reorthe (Francia, sus características principales se concentran en sus tres vigas pretensadas, de 30 m de longitud, prefabricadas, siguiendo los procedimientos Preyssinet, proyectadas por la Société Technique pour l'Utilisation de la Précontrainte, que también se encargó de la redacción del proyecto general de ejecución, cuya realización se encomendó a la empresa constructora Dodin, y de los métodos empleados para la colocación de las vigas en obra.

  6. Escenarios sobre el orden internacional

    Directory of Open Access Journals (Sweden)

    Luis Dallanegra Pedraza

    2012-01-01

    Full Text Available Luego de las grandes cambios que se dieron con la caída del Muro de Berlín y la desintegración en la URSS, se analizan, desde una perspectiva realista-sistémicaestructural, los componentes que intervienen en la generación del orden mundial, qué factores intervienen y cuáles son las diferentes aspiraciones respecto de las características que debería tener. Se tiene en especial consideración la creciente heterogeneización del sistema y la manera en que actores transnacionales operan como motores del futuro orden, predominando por sobre las posibilidades del actor históricamente dominante: el Estado-Nación. Se estudian las características principales del funcionamiento del sistema internacional y el significado de su marco institucional.

  7. Historicismo: notas sobre um paradigma

    Directory of Open Access Journals (Sweden)

    José D’Assunção Barros

    2012-08-01

    Full Text Available Este artigo tem por objetivo desenvolver algumas considerações sobre o Historicismo e sua possibilidade de ser examinado como um dos paradigmas que concorrem para o estabelecimento de uma história científica no século XIX. O primeiro ponto tratado é relativo às origens do paradigma Historicista na transição do século XVIII para o século XIX. Na sequência, aproximamo-nos da apropriação conservadora do paradigma historicista no novo contexto no qual a burguesia européia está assentada no Poder, combinando-se com a consolidação dos modernos estados-nações. A especificação das características deste paradigma constituem o principal ponto de análise

  8. Constitucional sobre la justicia ordinaria

    Directory of Open Access Journals (Sweden)

    José Luis Cea Egaña

    2005-01-01

    Full Text Available El artículo analiza el efecto vinculante y de irradiación de las sentencias del Tribunal Constitucional sobre el conjunto del ordenamiento jurídico y de sus órganos. El autor toma partido por la consideración de la ratio decidendi del fallo como vinculante junto al dictum de la sentencia respectiva. Se plantea la necesidad que la LOC del Tribunal Constitucional explicite los efectos vinculantes de los fallos respecto de los tribunales ordinarios y especiales. Finalmente analiza los efectos de la res iudicata en el ámbito del control reparador de constitucionalidad de preceptos legales en control concreto y en control abstracto.

  9. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  10. On Element SDD Approximability

    CERN Document Server

    Avron, Haim; Toledo, Sivan

    2009-01-01

    This short communication shows that in some cases scalar elliptic finite element matrices cannot be approximated well by an SDD matrix. We also give a theoretical analysis of a simple heuristic method for approximating an element by an SDD matrix.

  11. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  12. Puente sobre el rio Medway

    Directory of Open Access Journals (Sweden)

    Freeman, Fox, Ingenieros

    1963-02-01

    have been prestressed both longitudinally and transversally. Between the two circulation roadways an elastic barrier has been placed, supported on metal posts.El puente sobre el río Medway tiene la misión de salvar dicho río en el nuevo trazado de carretera necesario para aliviar el denso tráfico estival entre Dower y Londres. Está situado en las proximidades de la ciudad de Rochester. La estructura se ha construido utilizando las vías de concurso. De todos los tipos presentados se eligió una estructura de hormigón armado. La longitud total de la obra es de 1.000 m. Los tres tramos principales de la obra salvan el río. El central es de 152 m de luz, y los dos adyacentes son de 103 m cada uno. Los accesos tienen un total de 18 tramos, que arrojan una longitud de 654 m. La anchura del puente es de 34 m, y la calzada se ha subdividido en dos direcciones de tráfico de 7,30 m cada una y, además, se han dejado dos espaldones laterales de 2,40 m de anchura. En planta se puede admitir que el puente tiene una alineación recta con una ligerísima curva, y que en el plano vertical presenta una pendiente de desagüe entre las pilas 9 y 10. Los estribos son de hormigón armado: tipo celular el del este y de hormigón en masa el del oeste. Los estribos se apoyan sobre pilotes hexagonales de hormigón armado cuya circunferencia circunscrita tiene 55 cm de radio y de 12 a 20 m de longitud. Cuando el firme se hallaba a profundidades inferiores a 6 m, los estribos se cimentaban directamente sobre el firme. Las pilas constituyen pórtico y tienen una altura variable de 9 a 30 m sobre el nivel del suelo. Los tramos de acceso forman una estructura continua simplemente apoyada. Cada tramo se compone de ocho vigas longitudinales de 30 a 41 m de longitud y de 190 toneladas cada una. Estas vigas son del tipo pretensado y prefabricado. El tramo central es del tipo cantilever, constituido por dos brazos, de 30 m de longitud, formados por vigas cajón. Cada una de estas vigas consta

  13. Impuesto sobre el Valor Añadido. Apuntes

    OpenAIRE

    2013-01-01

    Apuntes sobre las siguientes cuestiones relacionadas con el Impuesto sobre el Valor Añadido: deducciones; exportaciones e importaciones; operaciones intracomunitarias; prorrata y sectores diferenciados.

  14. Puente sobre el Oosterschelde, Holanda

    Directory of Open Access Journals (Sweden)

    Hoving, H. T.

    1967-03-01

    Full Text Available This new bridge, forming part of the Delta project, is made of concrete, and was built by successive overhangs. Precast units were mainly used. The bridge is 5,000 m long, and is 11.85 m wide. The main spans are 95 m in length, except one, which can be opened up to sea traffic, which is 40 m long. The free height of the bridge over the sea is 15 m, which is insufficient for large ships. This required that one of the spans, in deep water, should open up, on hinges, and provide free passage to large ships. The intermediate bridge supports are of special interest. They rest on piles which go down to 38 m. They are hollow, cylindrical, of 4.35 m external diameter, and are driven into the ground in several stages, as they penetrate through the sands at the bottom of the Oosterschelde. To drive them in, an excavating device, inside the pile, was utilised, and also a dredging and suction mechanism, to clean out the bottom, and allow the piles to sink by gravity. But when external friction did not allow this to happen, the piles were weighed down with up to 500 tons of ballast. A series of three of these piles, in a row, makes up each bridge support. A cross member over the pile heads supports, in turn, the bridge deck. The bridge was built in successive sections, overhanging from each support, and then finally connected with a central portion. Use of precast units has been very extensive, so that the bridge can be justiaflably regarded as being prefabricated.Este nuevo puente, que forma parte del Plan de obras denominadas del Delta, es de hormigón y se ha construido por el procedimiento de voladizos sucesivos, utilizando, en su mayor parte, elementos prefabricados. Tiene una longitud total de 5.000 m; una anchura de 11,85 m; tramos principales de 95 m de luz, salvo uno, levadizo, que tiene 40 m. La altura libre sobre las ag^uas del mar es de 15 m, que es insuficiente para las naves de gran tonelaje; esto exigió que uno de sus tramos, en aguas

  15. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  16. Musikalske elementer i musikaler

    OpenAIRE

    Jensen, Linnea Reitan

    2014-01-01

    Denne masteroppgaven undersøker hvordan musikalske elementer kan bli brukt i musikaler for å påvirke den dramaturgiske helheten. Gjennom både musikalsk og dramaturgisk analyse viser jeg hvordan elementer i musikk kan ha innvirkning på forestillingens dramaturgi. In this master thesis I am aiming to examine the musical elements used in the songs in musicals. Music is an important element in the musical, and therefore I want to look at how some musical elements can contribute to the musical'...

  17. Trace elements in the Prestige fuel-oil spill: Levels and influence on Laxe Ria sediments (NW Iberian Peninsula); Elementos traza en el combustible vertido por el Prestige: Niveles e impacto sobre el sedimento de la Ria de Laxe (noroeste de Espana)

    Energy Technology Data Exchange (ETDEWEB)

    Prego, R; Cobelo-Garcia, A; Santos-Echeandia, J [Instituto de Investigaciones Marinas CSIC, Vigo, (Spain); Marmolejo-Rodriguez, J [Centro Interdisciplinario de Ciencias Marinas-Instituto Politecnico Nacional, La Paz, (Mexico)

    2006-03-15

    Trace elements have been determined in sediments from the Laxe Ria (NW Iberian Peninsula) one year before and one year after the Prestige fuel-oil spill (November 2002; 42 degrees 11 minutes North, 12 degrees 02 minutes West). The elements analyzed (Cd, Cu, Mo, Ni, Se and V) were chosen because they appeared to represent a potential contaminant from the deposited oil in the sediments. Enrichment factors, based on Al-normalized background concentrations, did not indicate metal contamination in the sediments from most of the ria; however, a severe contamination by Cu, Mo, Ni and V was found in the area of Corme Inlet, where the fuel oil could have accumulated as a result of the ria's hydrodynamic pattern. [Spanish] Se cuantifico la concentracion de 19 elementos quimicos en el combustible pesado derramado al mar desde los tanques del petrolero Prestige (noviembre de 2002; 42 grados 11 minutos Norte, 12 grados 02 minutos Este). Entre ellos, se investigo la presencia de Cd, Cu, Mo, Ni, Se y V en el sedimento superficial de la Ria de Laxe (NO de Espana) en los anos anterior y posterior al vertido debido a que sus niveles son similares tanto en el fuel como en el sedimento. Los factores de enriquecimiento, obtenidos tras normalizacion de las concentraciones con el aluminio, no indican contaminacion del sedimento en la ria. No obstante, se detecto una severa contaminacion por Cu, Mo, Ni y V en la ensenada de Corme donde el vertido podria haberse acumulado como resultado de la hidrodinamica de la propia ria.

  18. PERSPECTIVAS INFANTILES SOBRE LA TERRITORIALIDAD

    Directory of Open Access Journals (Sweden)

    Noelia Enriz

    2009-12-01

    Full Text Available En este trabajo nos proponemos un acercamiento a las diversas ideas infantiles sobre el territorio habitado, en el contexto particular de la población mbyá guaraní de Misiones. La fragilidad territorialidad a la que es expuesta la población indígena en Argentina se manifiestan cotidianamente en diversas áreas. La población mbyá, ha sido surcada por los límites de los estados nacionales de Paraguay, Brasil y Argentina. La sedentarización y los cercamientos de tierras en los diferentes estados, han impulsado transformaciones de las lógicas de subsistencia, de habitación y organización comunitaria. En el caso de la provincia de Misiones la acreditación burocrática de los títulos de tierras se encuentra aplazada, el estado no se compromete con la concreción de este derecho.

  19. Sobre a psicopatologia dos atos

    Directory of Open Access Journals (Sweden)

    Roberto Calazans

    2015-07-01

    Full Text Available Este artigo pretende apresentar a psicopatologia dos atos a partir do esquema de Jacques Lacan sobre a angústia. Diferenciamos os acting-out, a passagem ao ato, os sintomas, as inibições e a angústia fazendo uma duplicação do esquema de Lacan levando em consideração os registros do simbólico, do real e do imaginário. Esse esquema permite uma abordagem da questão dos atos do sujeito sem cair em uma perplexidade do clínico, nem na confusão entre os atos e a ação. Permite também uma melhor orientação do clínico em relação às diversas modalidades de respostas subjetivas que não se restringem à questão sintomática, que é o campo inaugural da clínica psicanalítica desde a sua fundação por Sigmund Freud. Acreditamos contribuir, assim, para um maior esclarecimento desse esquema no ensino de Lacan e para que ele possa servir de orientação para o tratamento dos atos do sujeito na clínica.

  20. Puente colgante sobre el Lillebaelt

    Directory of Open Access Journals (Sweden)

    Ostenfeld, Chr.

    1971-09-01

    Full Text Available This bridge, which was opened to traffic in October 1970 over the Lillebaelt, is the first of its kind in Denmark. It consists of a central span of 600 m, and two lateral ones of 240 m length each. The suspension cables, each 1,500 m, are the world's largest prefabricated cables. The bridge has original features, such as flaps on the main box girder, and new design of the anchorage blocks. These and other details are described in the article.Inaugurado en octubre de 1970, el puente colgante sobre el Lillebselt es el primer puente danés de este tipo. Consta de un tramo central de 600 m y dos tramos laterales de 240 m. Los cables sustentantes son, con sus 1.500 m de longitud, los mayores cables prefabricados del mundo. El puente presenta características origínales —empleo de «flaps» en la vigacajón de la superestructura, concepción nueva de los macizos de anclaje...— que, junto con el sistema de ejecución y las demás particularidades de la obra, son descritas en el artículo.

  1. Estudo multicasos sobre atividades inovativas

    Directory of Open Access Journals (Sweden)

    Sonia Regina Hierro Parolin

    2013-09-01

    Full Text Available Em estudos sobre competitividade argumenta-se que as empresas necessitam de estratégias baseadas em inovações e de capacidades internas em constantes e intensas transformações, não somente nos padrões tecnológicos, mas também no encadeamento do processo de gestão das atividades inovativas, como processos dinâmicos, não lineares e diversificados, em função de múltiplos fatores dos ambientes interno e externo. Para contribuir com essas discussões, neste artigo apresenta-se um estudo multicasos em quatro indústrias de médio e grande portes, de segmentos, densidades tecnológicas e históricos com inovações diferentes entre si. Como principais resultados, salientam-se o encadeamento das atividades inovativas como parte de uma estratégia organizacional para obter resultados com inovação e a afluência de todas as pessoas, e não somente as alocadas em pesquisa e desenvolvimento, para o cumprimento dessa estratégia.

  2. Elementos extra-musicais na obra de K-ximbinho: questões sobre iconografia musical em suas capas de disco entre 1950 e 1960 Extra-musical elements in the work of K-Ximbinho: questions about musical iconography in their record covers between 1950s and 1960s

    Directory of Open Access Journals (Sweden)

    Pablo Garcia da Costa

    2011-06-01

    Full Text Available K-ximbinho participou juntamente com outros músicos entre as décadas de 1950 e 1960 de um processo que visava modernizar o samba e o choro pela introdução dos elementos diversos do jazz. Esse processo de mistura entre gêneros musicais distintos, compreendido entre os músicos da época como "samba-jazz" ou "choro jazzístico", não se limitava em misturar elementos rítmicos harmônicos e melódicos, mas também negociar a presença de termos, imagens e vestimentas da cultura estadunidense no Rio de Janeiro pré Bossa Nova. É possível verificar nas capas de discos gravados por K-ximbinho que essa negociação entre duas culturas se manifestava em forma de imagens e textos e visavam informar ao consumidor a que cada obra se destinava, ressaltando a inovação do samba e choro e propondo a criação desse novo estilo musical.K-Ximbinho participated along with other musicians from the 1950s and 1960s in a process aimed at modernizing the samba and choro in the introduction of various jazz.elements into Brazilian traditional styles. This blending of different musical genres, known at the time as "samba-jazz" or "choro jazz" was not limited to mixing rhythmic, harmonic and melodic elements, but also in the negotiation of present expressions, images and ways from North-American culture in Rio de Janeiro in a pre Bossa Nova era. It's possible to verify on the covers of albums recorded by K-Ximbinho that the negotiation between these two cultures is manifested in the form of images and texts meant to inform the consumer how each work was intended, highlighting the innovation of samba and choro and proposing the creation of this new musical style.

  3. Comentarios y reflexiones sobre las operaciones financieras

    OpenAIRE

    Pavón Bautista, María Mercedes

    1995-01-01

    En este trabajo se hacen comentarios y reflexiones sobre los tipos de operaciones financieras simples, operaciones financieras de constitución de capitales y operaciones financieras de amortización.

  4. Los derechos de autor sobre obtenciones vegetales

    Directory of Open Access Journals (Sweden)

    Rosario Silva Gilli

    2015-01-01

    Full Text Available Contenido: Las creaciones en la agricultura. Los derechos de autor sobre obtenciones vegetales. El Convenio Internacional para la protección de las obtenciones vegetales (París 1961 y sus revisiones de Ginebra 1972, 1978,1991 Objeto de la protección legal. Condiciones del cultivar. Alcance de la protección. La protección de obtenciones vegetales en el Mercosur. Los Derechos de autor en el Mercosur. El Protocolo de Armonización de normas sobre Propiedad Intelectual en el Mercosur. El Acuerdo de Cooperación y facilitación sobre la protección de las obtenciones vegetales en los Estados Partes del Mercosur.  Alcance de la normativa Mercosur. Los Derechos sobre cultivares en Uruguay. Los Derechos de autor como derechos humanos. ¿Derechos de autor vs. derecho de propiedad intelectual? Reflexión final

  5. Reflexiones sobre pedagogías intensivas

    Directory of Open Access Journals (Sweden)

    Vizcaíno Pinilla Mercedes

    1996-06-01

    Full Text Available

    En el presente artículo se pretende recoger los conceptos filosóficos y los principios pedagógicos que orientan las pedagogías intensivas. Como valor primordial se encuentra la acción comunicativa como el eje sobre el cual se construyen las pedagogías intensivas orienta sobre las calidades que debe tener el maestro para desarrollarlas

  6. PERSPECTIVAS INFANTILES SOBRE LA TERRITORIALIDAD

    Directory of Open Access Journals (Sweden)

    NOELIA ENRIZ

    2009-12-01

    Full Text Available In this paper we propose a different approach to children's ideas about the geographical area in the particular context of the Mbyá Guarani population, from Misiones (Argentine. The territorial fragility, that is exposed to the indigenous people in Argentina aremanifested daily in several areas. Mbyá population, has been crossed by the boundaries of national states of Paraguay, Brazil and Argentina. The sedentary and enclosures land processes in different states, have prompted changes in the logic of subsistence, housing and community organization. In Misiones province case, bureaucratic accreditation of land titles is postponed, the state is not committed to the realization of this right.RESUMEN: En este trabajo nos proponemos un acercamiento a las diversas ideas infantiles sobre el territorio habitado, en el contexto particular de la población mbyá guaraní de Misiones. La fragilidad territorialidad a la que es expuesta la población indígena en Argentina se manifiestan cotidianamente en diversas áreas. La población mbyá, ha sido surcada por los límites de los estados nacionales de Paraguay, Brasil y Argentina. La sedentarización y los cercamientos de tierras en los diferentes estados, han impulsado transformaciones de las lógicas de subsistencia, de habitación y organización comunitaria. En el caso de la provincia de Misiones la acreditación burocrática de los títulos de tierras se encuentra aplazada, el estado no se compromete con la concreción de este derecho.

  7. Consideraciones preliminares sobre la credibilidad

    Directory of Open Access Journals (Sweden)

    Fernando Verdugo

    2004-01-01

    Full Text Available A modo de introducción al Seminario Interno de Profesores de la Facultad de Teología de la PUC, el autor recuerda, en primer lugar, lo que suele entenderse por "credibilidad" y, también, algunos de los criterios generales por los cuales algo o alguien adquiere la calidad de creíble (el que sea razonable, relevante o significativo, capaz de producir gozo estético, etc.. Luego, en la parte más extensa, el autor vuelve a llamar la atención sobre la necesidad de atender a los condicionamientos culturales de la fe cristiana. La fe, al igual que toda experiencia humana, está culturalmente mediada. Tomar conciencia de ese hecho y asumir las consecuencias metodológicas es indispensable para una teología que quiere poner atención a los desafíos actuales y contribuir así a la credibilidad del cristianismoThis article reprints the introductory session to the internal seminar of lecturers from the Faculty of Theology of the UC. In the first place, the author sums up what is usually understood by `credibility' and the general criteria through which something or someone gains credibility (being reasonable, relevant or significant, capable of producing aesthetic pleasure. Then the author deals at length with the need to take notice of the cultural conditionings of the Christian faith. The faith, the same as any other human experience, is culturally mediated. It is crucial for theology to become aware of this fact and come to terms with its methodological consequences, if it wants to face current challenges and so contribute to the credibility of Christianity

  8. Sobre sujeitos racionais e apaixonados

    Directory of Open Access Journals (Sweden)

    Dílson Ferreira da Cruz

    2009-12-01

    Full Text Available

    Desde seu nascimento, a Retórica convive com um cisma insuperável: de um lado, Platão afirma que o orador deve buscar o bom e o verdadeiro; tem de seguir a lógica e sustentar-se com um discurso sóbrio, no qual prevalece a razão, o logos, e para o qual as coisas interessam pelo que são em si mesmas. No outro extremo da ágora está Cícero, para quem a Retórica não tem que procurar pela essência de nada, mas fazer com que a opinião do orador, seja ela verdadeira ou não, passe a ser também a do auditório. Para tanto, a lógica, tão acalentada por Platão, é de bem pouca valia, pois o orador, se quiser ter sucesso, deve levar os corações da cólera à doçura ou desta àquela. Como se vê, é uma retórica alicerçada sobre o pathos, ou, como diriam os semioticistas, no estado das almas. Este artigo se propõe a pensar essa questão utilizando o instrumental da semiótica dita tensiva com o objetivo de mostrar que, no discurso do grego, predominam as valências ligadas à extensidade, ao inteligível, às características dos objetos; ao passo que, nos ensinamentos do romano, são as valências relacionadas à intensidade, ao sensível, que se destacam.

  9. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  10. Main: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT S000122 11-May-2006 (last modified) kehi Present upstream of the promot...er from the B-hordein gene of barley and the alpha-gliadin, gamma-gliadin, and low molecular weight glutenin... genes of wheat; See S000001 -300CORE; See S000002 -300MOTIF; -300 element; hordein; gliadin; glutenin; seed; wheat (Triticum aestivum) TGHAAARK ...

  11. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  12. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  13. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  14. Perspectivas sobre la comunicación

    Directory of Open Access Journals (Sweden)

    Naranjo Pereira, María Luisa

    2005-12-01

    Full Text Available Existen diversas teorías, enfoques y modelos de comunicación; de cada uno de ellos pueden rescatarse aspectos de gran valor para el logro de una comunicación eficaz. Este documento presenta una revisión de esos aspectos, para que se pueda comprender mejor y enriquecer uno de los procesos más importantes para el ser humano: el proceso de comunicación. Este es un ensayo en el cual se da a conocer la posición de la autora sobre el tema abordado. Se rescata el acento del enfoque humanista en la relación humana y en las etapas donde se desarrolla. A partir de la comunicación pragmática, se analizan los axiomas comunicacionales en que se fundamenta y lo que se conoce como patologías de esos axiomas. Además se revisan las principales características que distinguen la asertividad en la comunicación y las distintas formas de manipulación que la entorpecen. Del enfoque de Virginia Satir, se presentan los diversos aspectos de la comunicación, tanto funcional como disfuncional y los modelos de comunicación propuestos por esta autora. Se revisan aspectos importantes del enfoque de la comunicación educativa, tales como el control de la distancia, la voz y el cuerpo, las palabras y el situacional; así como los elementos que bloquean el proceso de comunicación y las sugerencias acerca de formas correctas de escuchar. Además, se hace referencia a la necesidad de emplear procesos educativos más holísticos y constructivistas y una comunicación-interrelación horizontal y con equidad. Each of the diverse theories, approaches, and models of communication can provide valuable elements for the attainment of effective communication. This article presents a review of those elements with the goal of providing a better understanding and enhancement of one of the most important processes for human beings: the process of communication. This essay presents the author´s position on the topic. The importance given to human relationships and the stages

  15. Impacto psicosocial del Downsizing sobre los trabajadores

    Directory of Open Access Journals (Sweden)

    CRISTÓBAL JIMÉNEZ JIMÉNEZ

    2006-01-01

    Full Text Available El presente trabajo intenta ahondar en lo expuesto en un trabajo anterior sobre el downsizing como fenómeno psicosociolaboral, analizando su impacto psicosocial. En primer lugar, se exponen los diferentes niveles de comprensión de este fenómeno, para pasar al análisis de los efectos y consecuencias sobre las personas, diferenciando entre dos tipos de víctimas: a los que se van de la organización (despedidos y b los que se quedan en la organización (supervivientes, prestando especial atención a lo que se conoce ya como el "síndrome del superviviente", para lo que se aporta información sobre sus características, las variables moderadoras que intervienen y los modelos explicativos del mismo. Se termina con algunas consideraciones sobre la actualidad y relevancia de dicho síndrome sugiriendo la idea de que el fenómeno del downsizing y sus consecuencias sobre las personas nos enfrenta a lo que podríamos ya considerar como un nuevo síndrome de la Psicopatología Laboral: el síndrome del superviviente.

  16. DISERTACIÓN SOBRE JUSTICIA Y EQUIDAD

    Directory of Open Access Journals (Sweden)

    Sayuri P. Tamura M.

    2001-01-01

    Full Text Available «Disertación sobre equidad y justicia» es básicamente una respuesta a una inquietud en particular que yo tenía sobre las distintas posiciones que existen sobre estos dos temas y cómo definir cuál es la más acertada. Hice una descripción del punto de vista de Amartya Sen –la violación de los derechos sobre la propiedad privada es justificable si evitan las hambrunas2– frente al de Robert Nozick –la propiedad privada es un derecho fundamental y como tal debe ser respetado3–, sin embargo, aunque ambos enfoques son totalmente contrarios tienen mucho sentido, por lo cual es bastante difícil decidirse por uno en particular. Fue de esta forma, enfrentando sus opiniones, que yo logré desarrollar una posición frente a estas dos perspectivas, y así dar mi opinión al DISERTACIÓN SOBRE JUSTICIA Y EQUIDAD SAYURI P. TAMURA M. Estudiante de Economía y Negocios Internacionales de la Universidad ICESI. respecto. Al final, llegué a una conclusión, que aunque no es la más original y tampoco es la única, tiene mucho sentido y seguramente de ser posible, la situación del país podría cambiar para bien.

  17. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  18. Finite element mesh generation

    CERN Document Server

    Lo, Daniel SH

    2014-01-01

    Highlights the Progression of Meshing Technologies and Their ApplicationsFinite Element Mesh Generation provides a concise and comprehensive guide to the application of finite element mesh generation over 2D domains, curved surfaces, and 3D space. Organised according to the geometry and dimension of the problem domains, it develops from the basic meshing algorithms to the most advanced schemes to deal with problems with specific requirements such as boundary conformity, adaptive and anisotropic elements, shape qualities, and mesh optimization. It sets out the fundamentals of popular techniques

  19. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  20. Sobre a incerteza About uncertainness

    Directory of Open Access Journals (Sweden)

    Ivo Assad Ibri

    2000-01-01

    Full Text Available Este artigo expõe elementos da doutrina epistemológica de Charles S. Peirce (1839-1914, denominada Falibilismo. Procura-se evidenciar como tal doutrina se desenvolve do interior de teorias metafísicas do autor, a exemplo de seu Evolucionismo e da estrutura categorial da Realidade, formando um dueto com sua concepção ontológica de Acaso. Em verdade, o Falibilismo configurar-se-á como a doutrina que é conseqüência do indeterminismo de dupla face de Peirce, a saber, simultaneamente ontológico e epistemológico.This paper intends to expose elements of a Charles S. Peirce's epistemological doctrine, called by him Falibilism. The aim is to show how this doctrine emerge itself from the author's metaphysical theories, like his Evolutionism and categorical structure of Reality, forming a duet with his ontological conception of Chance. In fact, the Falibilism will be considered as the doctrine that is consequence of the Peirce's doble face indeterminism, i.e., at same time ontological and epistemological.

  1. New functionalities in abundant element oxides: ubiquitous element strategy.

    Science.gov (United States)

    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi

    2011-06-01

    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements.

  2. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  3. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  4. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  5. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  6. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  7. Sobre la sublimación

    OpenAIRE

    2007-01-01

    Este documento presenta un trabajo de investigación realizado sobre un concepto clave para la producción teórica y la enseñanza en psicología, como es la noción de sublimación. La investigación indaga la sublimación en el marco de la teoría psicoanalítica, con el objeto de profundizar su explicación conceptual y decidir sobre la pertinencia de tomarlo como noción clave para explicar la producción social del saber.

  8. Principios sobre semáforos

    OpenAIRE

    Valencia Alaix, Víctor Gabriel

    2000-01-01

    Debido a la ausencia de una publicación que reuniese los aspectos más relevantes sobre semáforos y en el marco académico sobre ingeniería de tránsito de los cursos de pregrado y posgrado en Vías y Transporte de la Universidad Nacional de Colombia - Sede Medellín, se ha preparado este documento como guía introductoria a dicho tema. En su preparación se han recogido los tópicos principales de varias publicaciones internacionales y nacionales, además, su desarrollo ha considerado la experi...

  9. Debate sobre estudios postcoloniales y subalternos

    OpenAIRE

    David Morris; McLean, Ian S.; Hillel Eyal; Ivette Hernández; Richard W. Slata; Betsy Campisi; Jackson, Robert H; William Patterson; Kathryn Lehman; Chad Black; Michelle Molina; Ann Twinam; Dennis Hidalgo

    2001-01-01

    A partir de los comentarios a la reseña elaborada por Ian S. Mclean sobre el libro: Cuerpos incas y el cuerpo de Cristo. El Corpus Christi en Cuzco colonial, Perú, escrito por Carolyn Dean, surge un debate sobre los Estudios Postcoloniales y Subalternos, que se desarrolló entre el 12 de agosto y el 3 de septiembre de 2001, a través de la lista de correo electrónico de H-Latam, grupo de discusión dedicado a la historia latinoamericana. En él participaron destacados especial...

  10. Jose carlos mariategui: sus articulos sobre arte

    OpenAIRE

    Henríquez, Cecilia

    2014-01-01

    En la prolífica obra que colma la corta vida del pensador latinoamericano,se encuentran profundas reflexiones sobre el arte que valela pena recordar en e1 año del centenario de su nacimiento. Los juiciosque propone sobre el arte están n1ediados por su pensamiento marxista.Aunque gran conocedor del arte de sus contemporáneos, sucompromiso socialista, cada vez mayor, reduce el espacio del análisisestilístico.Un punto de partida para observar el pensamiento estético deJosé Carlos Mariátegui es s...

  11. Impacto psicosocial del Downsizing sobre los trabajadores

    OpenAIRE

    CRISTÓBAL JIMÉNEZ JIMÉNEZ; JOSÉ LUIS SÁNCHEZ LAGUNA

    2006-01-01

    El presente trabajo intenta ahondar en lo expuesto en un trabajo anterior sobre el downsizing como fenómeno psicosociolaboral, analizando su impacto psicosocial. En primer lugar, se exponen los diferentes niveles de comprensión de este fenómeno, para pasar al análisis de los efectos y consecuencias sobre las personas, diferenciando entre dos tipos de víctimas: a) los que se van de la organización (despedidos) y b) los que se quedan en la organización (supervivientes), prestando especial atenc...

  12. Consideraciones sobre los ensayos de laboratorio

    Directory of Open Access Journals (Sweden)

    José Gabriel Gómez Cortés

    2013-12-01

    Full Text Available Texto de la conferencia dictada por el autor en el Instituto de la Construcción y del Cemento en Madrid. Eduardo Torroja, España, como asistente al IX Curso de Estudios Mayores de la Construcción sobre "LA EDIFICACION Y SU PATOLOGÍA". Se analizan aspectos sobre: los criterios para solicitar ensayos, muestreo, variabilidad de resultados y reproducibilidad de ensayos, criterios de aceptación e importancia de la retroalimentación.

  13. Generalidades sobre el 68 en la narrativa

    OpenAIRE

    Ocampo, Aurora M.

    2013-01-01

    Es mucho lo que se ha escrito sobre el movimiento estudiantil de 1968, según mis registros, cerca de un centenar de libros, además de innumerables artículos, ensayos, narraciones, poemas, teatro y reseñas a los libros como a los grandes ensayos, aparecidos en publicaciones periódicas. Por otro lado, muchos de los libros, ya sean testimoniales, de reflexión sobre lo sucedido, antologías de poesías, ensayos, cuentos, teatro y narrativa en general se han reeditado varias veces; ahora, con motivo...

  14. Trace elements in dialysis.

    Science.gov (United States)

    Filler, Guido; Felder, Sarah

    2014-08-01

    In end-stage chronic kidney disease (CKD), pediatric nephrologists must consider the homeostasis of the multiple water-soluble ions that are influenced by renal replacement therapy (RRT). While certain ions such as potassium and calcium are closely monitored, little is known about the handling of trace elements in pediatric dialysis. RRT may lead to accumulation of toxic trace elements, either due to insufficient elimination or due to contamination, or to excessive removal of essential trace elements. However, trace elements are not routinely monitored in dialysis patients and no mechanism for these deficits or toxicities has been established. This review summarizes the handling of trace elements, with particular attention to pediatric data. The best data describe lead and indicate that there is a higher prevalence of elevated lead (Pb, atomic number 82) levels in children on RRT when compared to adults. Lead is particularly toxic in neurodevelopment and lead levels should therefore be monitored. Monitoring of zinc (Zn, atomic number 30) and selenium (Se, atomic number 34) may be indicated in the monitoring of all pediatric dialysis patients to reduce morbidity from deficiency. Prospective studies evaluating the impact of abnormal trace elements and the possible therapeutic value of intervention are required.

  15. Puente pretensado sobre el Guadarrama. Villalba

    Directory of Open Access Journals (Sweden)

    Páez, A.

    1958-12-01

    Full Text Available En este artículo se describe y comenta la solución dada al puente de hormigón pretensado sobre el río Guadarrama, primero de los construidos mediante dovelas prefabricadas y solidarizadas después, mediante el pretensado de la armadura longitudinal.

  16. Un nuevo libro sobre Juan de Castellanos

    Directory of Open Access Journals (Sweden)

    Alberto Miramón

    1979-02-01

    Full Text Available El Centro de Historia del Táchira ha auspiciado la publicación, por la Editorial Kelly de Bogotá, del segundo libro que monseñor Mario Germán Romero ha escrito sobre la vida y obra, tan apasionante ambas, de don Joan de Castellanos

  17. O pensamento de Marx sobre a subjetividade

    Directory of Open Access Journals (Sweden)

    Eduardo F. Chagas

    2013-08-01

    Full Text Available O pensamento de Karl Marx sobre a subjetividade humana é pouco conhecido e divulgado na língua portuguesa, e, no Brasil, particularmente, carece ainda de um estudo amplo, explícito e sistemático. Meu artigo pretende esboçar uma reflexão mais completa de sua filosofia sobre a subjetividade humana, insistindo não somente na crítica, mas também, e especialmente, na compreensão da referida questão, a partir de uma leitura imanente e estrutural de suas obras, no original. Vale ainda ressaltar que minha investigação se apoia na conexão entre subjetividade e objetividade, entre sujeito e objeto, inquirindo se há um determinismo da objetividade sobre a subjetividade, ou seja, se essas duas determinações são contraditórias no interior do pensamento marxiano, comprometendo, pois, as suas reflexões acerca da crítica à filosofia especulativa de Hegel e ao empirismo da economia clássica, ou se, na verdade, tal conexão é o segredo recôndito de sua filosofia sobre a subjetividade humana.

  18. Los derechos reales sobre cosa ajena

    OpenAIRE

    Panero Oria, Patricia

    2011-01-01

    Esta presentación cierra la serie de presentaciones que sa han realizado sobre los Derechos reales, según el Plan Docente seguido en la Facultad de Derecho de la Universidad de Barcelona, y que sirven de guía para el estudio de la materia.

  19. Las fuentes cristianas sobre Jesús

    Directory of Open Access Journals (Sweden)

    Melero Martínez, J.M.

    2010-01-01

    Full Text Available El artículo es una presentación de las fuentes históricas sobre Jesús de Nazaret: fuentes sinópticas, fuente Q, fuentes afines a la gnosis, fragmentos de evangelio con material sinóptico o joánico, evangelios judeocristianos y otras fuentes.

  20. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  1. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  2. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  3. Creativity Management Key Elements

    Directory of Open Access Journals (Sweden)

    Rosa María Fuchs Ángeles

    2015-09-01

    Full Text Available Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotion, and performance evaluation, long term orientation and the organizational life cycle. Having the analysis of those elements as a basis, the indispensable pillars on management creativity are identified. The proposed model is based on 5 pillars: the alignment between strategic, culture and organizational structure, called by the authors 'Holy Trinity'; intern publicity; customer’s voice; recognition and a look towards future. Finally, the case of an innovative Peruvian enterprise is presented from the model’s perspective and the study conclusions.

  4. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  5. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  6. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  7. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  8. Annihilators of nilpotent elements

    Directory of Open Access Journals (Sweden)

    Abraham A. Klein

    2005-01-01

    Full Text Available Let x be a nilpotent element of an infinite ring R (not necessarily with 1. We prove that A(x—the two-sided annihilator of x—has a large intersection with any infinite ideal I of R in the sense that card(A(x∩I=cardI. In particular, cardA(x=cardR; and this is applied to prove that if N is the set of nilpotent elements of R and R≠N, then card(R\\N≥cardN.

  9. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  10. Elements of social security

    DEFF Research Database (Denmark)

    Hansen, Hans

    (Alte Länder). This is the 9th and last edition of the publication,covering income levels and rules for social security and personal taxation for 1999. Basis for the projections to 1999 income levels is the 1998 data (in some cases 1999 data)for OECD's Taxing Wages as reported by national experts.......Elements of Social Security is a comparative study of important elements of the social security systems in Denmark (DK), Sweden (S), Finland (FIN), Austria (A), Germany (D), the Netherlands (NL), Great Britain (GB) and Canada (CAN). It should be emphasized that Germany is the former West Germany...

  11. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  12. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali

    2015-01-01

    SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes, such as spind......SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes...

  13. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  14. EJERCICIO DE EPISTEMOLOGÍA ELEMENTAL SOBRE UN CUENTO DE CARL SAGAN

    OpenAIRE

    Edison Otero Bello

    2011-01-01

    En su libro El Hombre y sus demonios, subtitulado La ciencia como una luz en la oscuridad, el astrónomo Carl Sagan, incluye el siguiente cuento, probable-mente inventado por él mismo y que nosotros recreamos aquí con ligeras y no sustanciales modificaciones, con el propósito de oponer el gesto científico y el pensamiento ilusorio.

  15. EJERCICIO DE EPISTEMOLOGÍA ELEMENTAL, SOBRE UN CUENTO DE CARL SAGAN

    Directory of Open Access Journals (Sweden)

    Edison Otero Bello

    2011-07-01

    Full Text Available En su libro El Hombre y sus demonios, subtitulado La ciencia como una luz en la oscuridad, el astrónomo Carl Sagan, incluye el siguiente cuento, probable-mente inventado por él mismo y que nosotros recreamos aquí con ligeras y no sustanciales modificaciones, con el propósito de oponer el gesto científico y el pensamiento ilusorio.

  16. Sobre la enseñanza de algunos teoremas fundamentales del cálculo elemental

    OpenAIRE

    Lleras, Francisco

    2012-01-01

    Es casi regla general el que los estudiantes de ciertas carreras en cuyos estudios está incluido el Cálculo I (Cálculo Diferencial y elementos de Cálculo Integral, tengan mucha dificultad con los razonamientos previos al estudio de la Regla de L'Hôpital, tales como el Teorema de Rolle y el Teorema del valor medio, veremos a continuación formas sencillas de presentar estos dos Teoremas y la regla de L'Hôpital en una forma de mas fácil comprensión para este tipo de estudiantes, que las que encu...

  17. A PROCEDURE TO CALIBRATE AND PERFORM THE BENDER ELEMENT TEST

    Directory of Open Access Journals (Sweden)

    JAVIER FERNANDO CAMACHO-TAUTA

    2012-01-01

    Full Text Available El método de ensayo bender element es utilizado en laboratorio para obtener la velocidad de la onda cortante de suelos. A pesar de su aparente simplicidad, aún no existe una norma para este ensayo. Existen factores que pueden tener alguna incidencia sobre el resultado. Estos factores son tenidos en cuenta para diseñar y construir un sistema de ensayo en una cámara triaxial. Se propone un método para calibrar el sistema mediante la utilización de barras de aluminio de diferente longitud y se hacen recomendaciones para la ejecución del ensayo, en lo relacionado con la selección de la frecuencia del pulso sinusoidal utilizado para producir la perturbación. Finalmente, se presentan ensayos efectuados sobre dos muestras de arena.

  18. It is elemental

    DEFF Research Database (Denmark)

    Delgado-Baquerizo, Manuel; Reich, Peter B.; Khachane, Amit N.

    2017-01-01

    It is well established that resource quantity and elemental stoichiometry play major roles in shaping below and aboveground plant biodiversity, but their importance for shaping microbial diversity in soil remains unclear. Here, we used statistical modeling on a regional database covering 179 loca...

  19. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  20. Reference: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT Kreis M, Williamson MS, Forde J, Schmitz D, Clark J, Buxton B, Pywell J..., Marris C, Henderson J, Harris N, Shewry PR, Forde BG, Miflin BJ Differential gene expression in the developing barley endosperm. Philos Trans R Soc Lond B314:355-365 (1986) ...

  1. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  2. Light element ceramics

    OpenAIRE

    Rao, KJ; Varma, KBR; Raju, AR

    1988-01-01

    An overview of a few structually important light element ceramics is presented. Included in the overview are silicon nitide, sialon, aluminium nitride, boron carbide and silicon carbide. Methods of preparation, characterization and industrial applications of these ceramics are summarized. Mechanical properties, industrial production techniques and principal uses of these ceramics are emphasized.

  3. Water, the intangible element

    NARCIS (Netherlands)

    Schotting, R.J.

    2009-01-01

    Water is the key to life. No living creature can survive without water. Too much water or polluted water are serious threats to mankind. Managing this intangible element is complex, not only in wet deltaic regions but also in the (semi-)arid regions of the world. Combined efforts of the hydro(geo)lo

  4. CEDS Addresses: Rubric Elements

    Science.gov (United States)

    US Department of Education, 2015

    2015-01-01

    Common Education Data Standards (CEDS) Version 4 introduced a common data vocabulary for defining rubrics in a data system. The CEDS elements support digital representations of both holistic and analytic rubrics. This document shares examples of holistic and analytic project rubrics, available CEDS Connections, and a logical model showing the…

  5. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  6. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  7. Element-topology-independent preconditioners for parallel finite element computations

    Science.gov (United States)

    Park, K. C.; Alexander, Scott

    1992-01-01

    A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.

  8. Observaciones sobre didáctica

    Directory of Open Access Journals (Sweden)

    Alfonso Tamayo Valencia

    2014-02-01

    Full Text Available  En el presente artículo, a partir de la conceptualización sobre didáctica y enseñanza, se plantean sus posibilidades en la educación superior, especialmente cuando reflexionamos en las prácticas de enseñanza desde un saber hacer que supere el hacer de esquemas tácitos y espontáneos que caracteriza en buena parte docencia universitaria. Desde esta perspectiva se aboga por la renovación de la concepción de la didáctica desde una postura epistemológica y psicológica sobre la manera como se construye el conocimiento.

  9. Sobre lectura y escritura en Chile

    Directory of Open Access Journals (Sweden)

    Grínor Rojo

    2011-11-01

    Full Text Available Los estudios de los últimos años realizados en Chile sobre lectura, competencia de lectura y lectura de noticias sobre política, revelan valores negativos que rondan el 50. Estos datos, a los que se suman los cuarenta millones de analfabetos en América Latina, están en la base del rechazo en este artículo de la afirmación de la muerte del libro y de la frívola fe en el reemplazo del libro por el uso de las tecnologías de la información y la comunicación (llenar de computadoras las escuelas, insistiendo en cambio en atender seriamente a los lazos entre razón, libro y lectura en el desarrollo individual y de la sociedad

  10. Representaciones sociales juveniles sobre la democracia

    Directory of Open Access Journals (Sweden)

    Álvaro Díaz Gómez

    2005-01-01

    Full Text Available El presente artículo da cuenta de una parte de los resultados obtenidos en la investigación “representaciones sociales juveniles sobre la democracia y la multiculturalidad”. Se desarrolló desde la perspectiva metodológica de la Investigación Acción Participante, proceso dentro del cual, se aplicó un cuestionario conformado por nueve preguntas, divididas en tres bloques temáticos que permitieron conocer las representaciones sociales de un grupo de veinticinco jóvenes, sobre la democracia –aspecto que se reporta en este texto– la ciudadanía y la multiculturalidad a partir de tres dimensiones: significado, vivencias y condiciones de la democracia.

  11. Sobre lectura y escritura en Chile

    OpenAIRE

    Grínor Rojo

    2011-01-01

    Los estudios de los últimos años realizados en Chile sobre lectura, competencia de lectura y lectura de noticias sobre política, revelan valores negativos que rondan el 50. Estos datos, a los que se suman los cuarenta millones de analfabetos en América Latina, están en la base del rechazo en este artículo de la afirmación de la muerte del libro y de la frívola fe en el reemplazo del libro por el uso de las tecnologías de la información y la comunicación (llenar de computadoras las escuelas), ...

  12. Radiaciones ionizantes y efectos sobre la materia

    Directory of Open Access Journals (Sweden)

    Sandra Magaly Medina Araujo

    2002-01-01

    Full Text Available Las radiaciones ionizantes, además, de tener muchas aplicaciones benéficas tanto en el campo industrial como en los organismos vivientes, presentan también muchos efectos nocivos que se deben evitar, sobre todo cuando se trata de fuentes artificiales con las que pueden presentarse abusos en su utilización, especialmente en la parte clínica. Este artículo, el primero de una serie de divulgaciones acerca del tema, pretende dar a conocer las características y efectos sobre la materia, de las mencionadas radiaciones, así como algunas recomendaciones acerca del manejo y tralAS, tamiento de dichas radiaciones

  13. Monografía FOMIN sobre Remesas

    OpenAIRE

    Inter-American Development Bank; Analistas Financieros Internacionales (AFI)

    2009-01-01

    Consultoria realizada por Analistas Financieros Internacionales para Fondo Multilateral de Inversiones sobre: Flujos de remesas a América Latina: Características del mercado de remesas y sus actores principales. Aspectos regulatorios relevantes para facilitar el rol de las remesas como instrumento de desarrollo. Descripción de la cartera de proyectos FOMIN y su nueva estrategia en el Cluster de Remesas.

  14. Cumbre Mundial sobre Desarrollo Social. Copenhague

    OpenAIRE

    Abellán García, Antonio

    1995-01-01

    La Asamblea General de Naciones Unidas adoptó en 1992 la decisión De convocar una Cumbre Mundial sobre Desarrollo Social para afrontar los problemas de pobreza, desempleo e integración social. La Cumbre tuvo lugar en marzo de 1995, en Copenhague, y se desarrolló en tres partes: Plenario, Comité Principal y Cumbre de Jefes de Estado o Gobierno

  15. Reflexiones sobre el concepto de justicia

    Directory of Open Access Journals (Sweden)

    Víctor C. Pascual Planchuelo

    2005-06-01

    Full Text Available Este ensayo constituye una reflexión sobre el concepto de Justicia. No se centra, como tantos estudios al respecto, en el plano teórico y metafísico, sino que atiende problemas de mayor actualidad: la opinión de los ciudadanos, la postura de los profesionales y otros asuntos controvertidos del ámbito del Derecho.

  16. Sobre la felicidad y la ataraxia

    Directory of Open Access Journals (Sweden)

    Alberto Londoño Alvarez

    1969-09-01

    Full Text Available Muy pocos lectores, seguramente, no han tomado en momentos de crisis nerviosas, de desarreglos emocionales, de intranquilidad y angustia, alguna de las tantas drogas que se conocen con el mote genérico de "ataráxicos", de "tranquilizantes". Pues bien, hablemos un poco sobre este tema, sus antecedentes históricos y filosóficos y lo que para los griegos clásicos significaba el vocablo "ataraxia".

  17. Elements of quantum optics

    CERN Document Server

    Meystre, Pierre

    2007-01-01

    Elements of Quantum Optics gives a self-contained and broad coverage of the basic elements necessary to understand and carry out research in laser physics and quantum optics, including a review of basic quantum mechanics and pedagogical introductions to system-reservoir interactions and to second quantization. The text reveals the close connection between many seemingly unrelated topics, such as probe absorption, four-wave mixing, optical instabilities, resonance fluorescence and squeezing. It also comprises discussions of cavity quantum electrodynamics and atom optics. The 4th edition includes a new chapter on quantum entanglement and quantum information, as well as added discussions of the quantum beam splitter, electromagnetically induced transparency, slow light, and the input-output formalism needed to understand many problems in quantum optics. It also provides an expanded treatment of the minimum-coupling Hamiltonian and a simple derivation of the Gross-Pitaevskii equation, an important gateway to rese...

  18. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  19. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  20. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  1. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  2. New Aperture Partitioning Element

    Science.gov (United States)

    Griffin, S.; Calef, B.; Williams, S.

    Postprocessing in an optical system can be aided by adding an optical element to partition the pupil into a number of segments. When imaging through the atmosphere, the recorded data are blurred by temperature-induced variations in the index of refraction along the line of sight. Using speckle imaging techniques developed in the astronomy community, this blurring can be corrected to some degree. The effectiveness of these techniques is diminished by redundant baselines in the pupil. Partitioning the pupil reduces the degree of baseline redundancy, and therefore improves the quality of images that can be obtained from the system. It is possible to implement the described approach on an optical system with a segmented primary mirror, but not very practical. This is because most optical systems do not have segmented primary mirrors, and those that do have relatively low bandwidth positioning of segments due to their large mass and inertia. It is much more practical to position an active aperture partitioning element at an aft optics pupil of the optical system. This paper describes the design, implementation and testing of a new aperture partitioning element that is completely reflective and reconfigurable. The device uses four independent, annular segments that can be positioned with a high degree of accuracy without impacting optical wavefront of each segment. This mirror has been produced and is currently deployed and working on the 3.6 m telescope.

  3. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  4. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  5. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  6. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  7. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  8. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  9. Elements of real analysis

    CERN Document Server

    Sprecher, David A

    2010-01-01

    This classic text in introductory analysis delineates and explores the intermediate steps between the basics of calculus and the ultimate stage of mathematics: abstraction and generalization.Since many abstractions and generalizations originate with the real line, the author has made it the unifying theme of the text, constructing the real number system from the point of view of a Cauchy sequence (a step which Dr. Sprecher feels is essential to learn what the real number system is).The material covered in Elements of Real Analysis should be accessible to those who have completed a course in

  10. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  11. Elements of Architecture

    DEFF Research Database (Denmark)

    Elements of Architecture explores new ways of engaging architecture in archaeology. It conceives of architecture both as the physical evidence of past societies and as existing beyond the physical environment, considering how people in the past have not just dwelled in buildings but have existed...... and affective impacts, of these material remains. The contributions in this volume investigate the way time, performance and movement, both physically and emotionally, are central aspects of understanding architectural assemblages. It is a book about the constellations of people, places and things that emerge...

  12. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  13. ESTUDO SOBRE O IMPACTO DOS PROCESSADORES HOSPEDEIROS

    Directory of Open Access Journals (Sweden)

    Alba S. B. Lopes

    2008-05-01

    Full Text Available Arquiteturas reconfiguráveis são dispositivos de hardware capazes de modificar sua estrutura de hardware de acordo com a aplicação a ser executada. Tais dispositivos surgiram como uma alternativa às soluções de hardware tradicionais na tentativa de equilibrar flexibilidade e desempenho. Uma das principais formas de utilização de arquiteturas reconfiguráveis corresponde a um bloco reconfigurável anexado a um processador hospedeiro. Esse processador é responsável por executar diversas tarefas críticas, incluindo o particionamento hardware/software e indicar o momento do bloco reconfigurável executar. Apesar de existirem diversas propostas de arquiteturas reconfiguráveis na literatura, pouco se estudou sobre o impacto do processador hospedeiro na arquitetura. Nesse contexto, esse artigo apresenta um estudo sobre o impacto do processador hospedeiro no desempenho da arquitetura reconfigurável híbrida. Como estudo de caso foi realizada uma avaliação sobre o uso dos processadores SPARC V8 da Sun Microsystems e Nios II da Altera como processadores hospedeiros da arquitetura reconfigurável híbrida RoSA. O objetivo deste estudo é realizar a comparação entre o desempenho desses processadores e identificar qual deles é o mais adequado para anexar a arquitetura em questão. Os resultados mostraram que foi possível alcançar até 47% de ganho de desempenho com o uso do processador Nios II em comparação ao SPARC V8, indicando o primeiro como mais adequado para a arquitetura RoSA. PALAVRAS-CHAVE: arquiteturas reconfiguráveis, processador hospedeiro, desempenho.

  14. Algunas consideraciones sobre la arquitectura maya

    OpenAIRE

    Cejudo Collera, Mónica; DEPFA UNAM

    2013-01-01

    Con la finalidad de definir las variantes regionales y estilísticas que utilizaron los cons- tructores de la sociedad maya a lo largo de las varias etapas de su desarrollo, se estu- dian, en este artículo, los elementos que conforman las estructuras de la arquitectura maya. El resultado de este proceso de análisis permite ver cómo, a partir de una con- cepción global de la arquitectura y el urbanismo mayas, cada sitio se desarrolló sobre la base de su singularidad.

  15. Debate sobre el agua : punto de partida

    OpenAIRE

    2013-01-01

    A lo largo de este número de la revista encontrarás artículos concretos sobre el uso del agua en la agricultura, las bondades e inconvenientes de diferentes sistemas agrícolas y advertencias a los riesgos de privatización del agua, entre otros. Son temas que, desde la perspectiva de la Soberanía Alimentaria, debemos abordar contestando una pregunta fundamental: para que las y los agricultores puedan alimentar al Planeta y mantenerlo fértil, ¿qué uso y gestión hacemos del Agua?

  16. II Jornadas sobre Emprendimiento Social y Colectivo

    OpenAIRE

    Centro de Investigación en Gestión de Empresas

    2013-01-01

    La línea temática principal del encuentro es el emprendimiento social y colectivo así como las diferentes líneas de investigación de los institutos y centros de la Red relacionadas, como: responsabilidad social, empleo y reincorporación al trabajo, inserción laboral, servicios sociales y dependencia, género, cambios legislativos, utilidad social, medio ambiente, desarrollo local,... Centro de Investigación en Gestión de Empresas (2013). II Jornadas sobre Emprendimiento Social y Colectivo. ...

  17. Modelos mentales sobre el concepto de medida

    OpenAIRE

    Osorio, Andrea Milena

    2009-01-01

    Esta tesis de maestría presenta los resultados de una investigación que tuvo como pretensión comprender la estructura de los modelos mentales sobre el concepto de medida que poseen estudiantes de segundo grado de la educación básica y los estudiantes de formación complementaria (estudiantes que inician la formación docente). Para recoger la información, se emplearon técnicas de recolección de información, la observación y la entrevista semiestructurada, que fueron aplicadas a 8 estudiant...

  18. Modelos mentales sobre el concepto de medida

    OpenAIRE

    Osorio, Andrea Milena; García, Ligia Inés

    2011-01-01

    El objetivo de esta investigación ha sido comprender la estructura de los modelos mentales sobre el concepto de medida que caracteriza a un grupo de estudiantes de segundo grado de básica primaria y de primer año de formación complementaria. En efecto, el interés es identificar los elementos que se dan en los modelos y analizar las posibles relaciones entre dichos elementos. El informe de investigación se encuentra presentado en 7 apartes. La primera parte comprendida por los numerales ...

  19. Apuntes sobre el cultivo del cacao

    OpenAIRE

    Chavarriaga, Eduardo; Ochoa, Horacio

    2013-01-01

    El sombrío constituye uno de los problemas que se presentan en el cultivo del cacao, de necesaria resolución para ayuda del agricultor en su labor al producir tan importante grano. Contribuye a la economía del cultivo un conocimiento amplio de la cuestión que debe preocupar al productor inquiriendo no solamente por lo acostumbrado en la región, sino por lo que en otras partes se conoce sobre el particular, para abandonar un poco el emperismo y hacer una industria cada día más próspera. Co...

  20. Conceptos fundamentales sobre el mantenimiento de edificios

    OpenAIRE

    Juan Miguel Arencibia Fernández

    2007-01-01

    En esta investigación se realiza una profunda búsqueda sobre el tema del Mantenimiento de Edificios donde se abundan diferentes conceptos y criterios de la misma, encontrándose de esta forma los más utilizados métodos a emplear. Luego teniendo en cuenta las clasificación del Mantenimiento de Edificio según los tipos de obras, propietarios del inmueble y el momento que éste se realiza, como los costos de una edificación y su equipamiento a utilizar. Otros de los aspectos a tener en cuenta es l...

  1. Ensayo sobre la melancolía

    Directory of Open Access Journals (Sweden)

    Marta Chacón Salinas

    2013-07-01

    Full Text Available Este trabajo es un intento de delimitar la melancolía del conjunto de los trastornos depresivos y de reflexionar sobre sus características tal como aparecen en el discurso de los melancólicos. Se consideran algunas hipótesis en la línea psicoanalítica freudiana y lacaniana (Lambottc, Kristeva para entender cómo se va constituyendo en sus características principales: la intolerancia a la pérdida del objeto y el desfallecimiento del símbolo que le impide elaborar este duelo.

  2. Sobre Wittgenstein y la ética

    OpenAIRE

    García Soto, Luis

    2010-01-01

    El objeto de este trabajo es analizar y discutir la visión que de la ética da Wittgenstein en su “Conferencia sobre Ética” (1930). En nuestra opinión, la visión de la ética dada por el filósofo está más próxima de la religión o de la literatura que de otros sistemas normativos, como el derecho, la política e incluso la economía. De acuerdo con esto, intentamos ofrecer otra visión de la ética.

  3. Literatura infantil sobre problemas infantiles: la diabetes

    OpenAIRE

    Lázaro Fernández, Patricia

    2015-01-01

    Debido al creciente número de casos de diabetes infantil que se está dando en la sociedad actual, no es raro encontrarse en las aulas cada vez más casos de esta enfermedad. Por esta razón, he decidido analizar dos libros sobre esta temática, para hacer un acercamiento del material seleccionado a las aulas y poder desarrollar junto con los niños un aprendizaje colectivo y cooperativo. En este trabajo se expone la importancia de la literatura y la literatura infantil como una ...

  4. Comentarios sobre dibujo analítico

    OpenAIRE

    Mata Botella, Elena

    2004-01-01

    Cuaderno de apoyo a la docencia del DIBUJO DE ARQUITECTURA que pretende hacer reflexionar al alumno (de primero o segundo de carrera) sobre un tipo de dibujo que aquí se ha llamado “dibujo analítico”. Un dibujo que a través de operaciones gráficas y conceptuales como la esquematización y la selección de información, tiende a alejarse de la descripción del objeto arquitectónico para adentrarse en determinados aspectos o dimensiones que subyacen en el proyecto arquitectónico. Unas notas intr...

  5. Nuevas tecnologias: sobre computadores y brujas

    OpenAIRE

    Buenaventura, Juan Guillermo

    1987-01-01

    No soy ingeniero, ni experto en nuevas tecnologías. Cualquier comentario que haga no puede ser más que o bien el comentario de un ciudadano preocupado por su país o bien el acercamiento personal al tema, por parte de un comunicador interesado en los impactos y potencialidades, que tienen estas tecnologías en el ejercicio profesional y en nuestra cultura. A mi modo de ver la literatura conocida sobre las nuevas tecnologías oscila entre dos polos, dentro de los cuales se encuentran los diferent...

  6. Efecto del Diazepam sobre el desarrollo fetal

    OpenAIRE

    2001-01-01

    El diazepam se absorbe rápida y completamente después de la administración oral y atraviesa la barrera placentaria; su tasa de penetración en el tejido placentario es de 31,5% a las 4 horas, su vida media es prolongada y la existencia de metabolitos activos hace que su efecto sea acumulativo. Este trabajo se realizó en un modelo in vivo, usando 10 mg/Kg/día de diazepam intramuscular, en donde se estudió el efecto del diazepam sobre el desarrollo fetal, utilizando un modelo experimental en el ...

  7. Perspectivas sobre la comunicación

    OpenAIRE

    Naranjo Pereira, María Luisa

    2011-01-01

    Existen diversas teorías, enfoques y modelos de comunicación; de cada uno de ellos pueden rescatarse aspectos de gran valor para el logro de una comunicación eficaz. Este documento presenta una revisión de esos aspectos, para que se pueda comprender mejor y enriquecer uno de los procesos más importantes para el ser humano: el proceso de comunicación. Este es un ensayo en el cual se da a conocer la posición de la autora sobre el tema abordado. Se rescata el acento del enfoque humanista en la ...

  8. Apuntes Sobre el Cultivo del Cacao.

    Directory of Open Access Journals (Sweden)

    Ochoa Horacio Ochoa

    1940-12-01

    Full Text Available En el presente artículo se hablara del proceso de fermentación del cacao, pero antes de entrar a detallar este proceso, es conveniente dar algunas anotaciones sobre los sistemas de recolección o “cosecha” empleados en distintos lugares, pues ellos tienen sus diferencias y en ocasiones no se efectúan con todo el cuidado necesario tanto para el árbol como para el producto que irá a los depósitos de fermentación.

  9. Soportes apoyados sobre vigas pretensadas (EE. UU.

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1965-12-01

    Full Text Available This work has been awarded a prize by the Prestreesed Concrete Institute. It refers to a number of flyovers on the Arroyo Seco, of California. This river has been canalized, to help drainage in case of heavy rainfall. The canal runs through a highly populated zone, and a motor road and accessory ramps had to cross the canal. The resulting design involves three prestressed girders, lightly arched in a parabolic outline, resting on each river shore, running along the line of the bridge, over the canal. It was decided that the bridge piles should not rest on the river bed, in order not to reduce its flow capacity. The girders of a maximum length of 39 ms, are box shaped, and stiffened with thin diaphragms. The cylindrical pile, 1.50 m in diameter, is an integral part of the girder, and applies to it a concentrated load of about 4000 tons. The girders rest on reinforced concrete cubes, which in turn are supported by concrete slabs and piles driven into the soil.Esta obra ha sido premiada por el Prestressed Concrete Institute y se refiere a una serie de pasos superiores sobre el Arroyo Seco, en California, que se ha canalizado para servir de desagüe en el caso de avenidas torrenciales. El canal se halla en una zona de edificación densa y se trata del paso—sobre aquél—de una autopista y rampas de acceso. La solución adoptada consistió en tres vigas pretensadas, ligeramente arqueadas con perfil parabólico, apoyadas en las dos márgenes y situadas en correspondencia con los tres soportes, sobre el propio canal, ya que ninguno de aquéllos debía apoyarse en el lecho de este último al objeto de no disminuir su capacidad de desagüe. Las vigas—de unos 39 m de longitud la mayor—son del tipo cajón, rigidizadas con unos diafragmas de pequeño espesor. El soporte cilíndrico, de 1,50 m de diámetro, se solidariza con la viga y le transmite una notable carga concentrada, del orden de 4.000 toneladas. Los apoyos de estas vigas son simples dados

  10. Efectos del tabaquismo sobre el desarrollo prenatal

    OpenAIRE

    Carnero Cartujo, Sonia

    2014-01-01

    El tabaquismo es un problema de salud pública, causa enfermedad, incapacidad y muerte. El porcentaje de mujeres fumadoras mundialmente, alcanza el 22%. Si este porcentaje se mantiene durante el embarazo, debería tenerse en cuenta que la placenta humana es particularmente permeable a muchos de los compuestos en el humo del tabaco, y que existe suficiente evidencia científica de que los componentes del humo de un cigarrillo tienen efectos muy negativos sobre la vida intrauterina. La mayor parte...

  11. Hipótesis sobre la abducción en el enredo de las argumentaciones

    Directory of Open Access Journals (Sweden)

    Ferreira, Jairo

    2010-01-01

    Full Text Available [es] En este artículo, presento mi formulación sobre el concepto de abducción. A partir de este concepto, analizo una investigación en curso, movilizando las hipótesis que desarrollo, buscando elementos en la investigación experimental para la reflexión sobre el método. Finalmente, ubico el concepto en un lugar operatorio-interpretativo ampliado, colocándolo en juegos, cuando éste está interpuesto por cuestiones sobre el conocimiento que producimos. [en] In this paper I show my formulation on the concept of abduction. From this concept on, I analyse an investigation in progress, mobilizing the hypothesis I develop, searching elements in the experimental research for the reflection on the method. Finally, I localize the concept in an operatory-interpretative broadened place, settling it in games, when settled, regarding questions on the knowledge we make. Finally, I set the concept in an operatory-interpretative broadened place, putting it in games(sets when settled (placed regarding questions on the knowledge we produce.

  12. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new 12-parameter rectangular plate element is presented by useof the double set parameter method. The error in the energy norm is of order O(h2), one order higher than the commonly used Adini nonconforming element.

  13. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  14. Tributos sobre a folha ou sobre o faturamento? Efeitos quantitativos para o Brasil

    Directory of Open Access Journals (Sweden)

    Tiago V Cavalcanti

    2008-09-01

    Full Text Available Este artigo estuda os impactos alocativos e de bem-estar de uma reforma tributária que substitui os impostos sobre a folha de salários por outro que incide sobre a receita. Para isso, desenvolve-se um modelo neoclássico de crescimento econômico com impostos sobre a receita e sobre a folha de salários. As simulações com parâmetros da economia brasileira mostram que tal reforma tributária tem um efeito negativo no bem-estar, no estoque de capital de longo prazo e consequentemente no produto per capita de longo prazo. Contudo, o emprego aumenta.This paper studies the impacts of a tax reform which substitutes taxes on labor income by taxes on total revenue. In order to accomplish that, we construct and solve a general equilibrium neoclassical growth model with taxes on labor income and total revenue. The numerical simulations with Brazilian parameters show that such tax reforms would negatively affect welfare, the capital stock, and consequently per capita output. However, employment would increase. Such effects are quantitatively important.

  15. Nuevas operaciones binarias sobre los conjuntos borrosos de tipo 2

    OpenAIRE

    Hernández Varela, Pablo Ramón; Cubillo Villanueva, Susana; Torres Blanc, Carmen

    2013-01-01

    Walker et al. ([19], [20]) definieron dos familias de operaciones binarias sobre M (conjunto de las funciones de [0,1] en [0,1]), y determinaron que, bajo ciertas condiciones, estas operaciones son tnormas (normas triangulares) o t-conormas sobre L (subconjunto de las funciones normales y convexas de M). En este trabajo se introducen dos operaciones binarias sobre M, diferentes a las dadas por Walker et al., y se estudian varias propiedades de las mismas, con el objeto de de...

  16. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  17. Consideraciones criminológicas sobre las bandas juveniles

    OpenAIRE

    Medina, Juanjo

    2010-01-01

    Este artículo ofrece una serie de reflexiones originales sobre la definición de las bandas juveniles y resume algunos de los debates claves en el campo de investigación sobre bandas. En particular, se presta especial atención a los estudios sobre la relación entre bandas y delincuencia, las teorías que explican la formación de las bandas y los factores que empujan a los jóvenes a vincularse a las mismas, los estudios sobre respuestas de política criminal a este fenómeno, ...

  18. Nivel de conocimientos del personal de salud sobre cuidados paliativos

    OpenAIRE

    2012-01-01

    Antecedentes: la medicina paliativa no figura en las prioridades de salud de México; en las instituciones existe un gran desconocimiento sobre las necesidades físicas, psicológicas, sociales y espirituales del paciente en estado terminal y sobre las de su familia; se reconoce que los profesionales de la salud carecen de conocimientos sobre cuidados paliativos. Objetivo: evaluar el nivel de conocimientos que sobre cuidados paliativos tiene el personal de salud de los tres niveles de atención m...

  19. Módulo educativo sobre emergencias escolares

    Directory of Open Access Journals (Sweden)

    Ana María Fajardo-Maldonado

    2009-01-01

    Full Text Available Con el fin de conocer el comportamiento ante emergencias escolares de niñas y adolescentes, se realizó una investigación descriptiva sobre el impacto de un proceso educativo de un programa de salud al colegio. El estudio se adelantó entre el 2007 y el 2008, en la localidad de Suba, en Bogotá, con un grupo de 120 estudiantes, de 6 a 18 años, de estratos cero, uno y dos. Mediante una metodología lúdica, pedagógica y de experiencias se evaluaron los conocimientos impartidos a esta población, en la que se observaron cambios en los estilos de vida y hábitos individuales y grupales. El 95% de las niñas validaron los conocimientos en salud sobre el manejo de emergencias escolares, el 100% de la población participó en la construcción del plan y trabajó en las prácticas, lo que crea conciencia acerca de la importancia del programa de salud escolar con el desarrollo de este tipo de planes.

  20. Debate sobre estudios postcoloniales y subalternos

    Directory of Open Access Journals (Sweden)

    David Morris

    2001-01-01

    Full Text Available A partir de los comentarios a la reseña elaborada por Ian S. Mclean sobre el libro: Cuerpos incas y el cuerpo de Cristo. El Corpus Christi en Cuzco colonial, Perú, escrito por Carolyn Dean, surge un debate sobre los Estudios Postcoloniales y Subalternos, que se desarrolló entre el 12 de agosto y el 3 de septiembre de 2001, a través de la lista de correo electrónico de H-Latam, grupo de discusión dedicado a la historia latinoamericana. En él participaron destacados especialistas en el tema, quienes analizaron, entre otras cuestiones, el uso de la jerga y las formas de escritura, la novedad de sus planteamientos, sus influencias filosóficas y epistemológicas, su pretensión de captar el punto de vista de los vencidos y subordinados, la pertinencia de unas ideas originalmente desarrolladas para el estudio del colonialismo inglés y luego aplicadas al colonialismo español en América Latina.

  1. sobre la representatividad democrática

    Directory of Open Access Journals (Sweden)

    Adriana Gallo

    2008-01-01

    Full Text Available En este trabajo se evalúan los efectos que reviste la aplicación de tres instrumentos sugeridos o implementados, a partir de las últimas reformas político-institucionales –primarias abiertas, sistema de doble vuelta, y reelección inmediata– sobre la representatividad partidaria en Argentina, Chile y Uruguay. La relevancia del análisis de estos mecanismos en conjunto se debe a que, por un lado, cada uno concierne a una de las tres instancias del proceso electivo trifásico –selección, elección y reelección, respectivamente–; y, por otro, los tres comparten objetivos similares que sintéticamente son: dotar de más herramientas de discernimiento político a los ciudadanos, proveer de mejores condiciones democráticas a los partidos e incrementar la legitimidad electoral del presidente. Luego del análisis comparativo de tres países con trazos diferenciados, se concluye que los costos ocultos que pueden suscitarse con cada mecanismo analizado superan a los beneficios potenciales de alguno de ellos, operando negativamente sobre la representatividad democrática.

  2. COLOR- SENSITIZED SOLAR ELEMENTS

    Directory of Open Access Journals (Sweden)

    Gish R. A.

    2016-05-01

    Full Text Available Photovoltaic devices are a promising solution to the energy crisis, because they generate electricity directly from sunlight, without producing CO2. While color-sensitized batteries are the most studied element, mainly due to its low cost and high efficiency solar energy conversion into electricity. Until recently, the color-sensitized solar cells performance was less than 1%, however, the use of titanium dioxide as the anode material have greatly raised their efficiency. The advantages of titanium dioxide is primarily in the low cost, but its use provides high light capture efficiency, with external quantum efficiency (efficiency incident photon - charge, usually in the range of 60-90% using nanocrystal forms in comparison with

  3. Ucla, escuela elemental

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1962-03-01

    Full Text Available La Escuela Elemental de Preparación de la Universidad de California, en Los Angeles, está dedicada a la educación e investigación y preparación del profesorado de la infancia. Se ha construido en un paraje maravilloso, de frondosa vegetación, frente a un terreno bastante quebrado, circunstancia que presta mayor encanto al conjunto, construido con gran pericia y adaptación al paisaje a base de una dominante horizontalidad, con materiales sencillos (ladrillos, hierro y madera y gran comunicación con la naturaleza mediante grandes cristaleras correderas que ensanchan las clases y las suplementan hacia el jardín de acuerdo con las nuevas normas y prácticas docentes.

  4. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  5. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  6. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  7. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  8. Puente sobre el río Ain

    Directory of Open Access Journals (Sweden)

    Editorial, Equipo

    1963-02-01

    Full Text Available Owing to the construction of the new dam on the river Ain. the water of the river level has risen considerably above the earlier level of flow at the suspension bridge in the neighbourhood of Serrieres sur Ain. Hence it became necessary to substitute this structure by a more modern one, suitable to present day traffic demands. This paper summarises the main features of this new bridge. The new bridge spans the river by means of a reinforced concrete arch of 120 m span. The arch is circular, and the deck rests on a palissade supported by the arch. The maximum rise is 30 ms at the crown. The deck carries a roadway 7 ms wide and two sidewalks of 1 m width each, for pedestrians. The deck is supported by by four longitudinal beams, and the arch has a box section and 4 longitudinal stiffners. In the crown zone the stiffners, the deck and the cylindrical surfaces become integrated and enclose three hollow chambers. This structure has great stiffness. The depth of the arch is constant, except at the crown, and is 2.40 ms. This depth gives the arch a pleasing and slender aspect. The palissade consist of four rows of columns, of 0.80x0.20 ms section, at intervals of 12.50 ms. The radius of the arch is 78.80 ms, and its transversal box section has a total width of 8.60 ms. The thickness of the inner cylindrical surface is 0.20 ms. The springers consist of two large reinforced concrete blocks, of approximately 10 ms length and 4.70 ms height. The construction of the bridge was done with the aid of a Blondin cable, of 5 tns capacity, spanning 290 ms. The main constructional aid was a. wooden scaffolding, cantilevered from the sides, consisting of 10 trusses. The timber elements were nailed and bolted together. The top part of the framework supports a formwork, made with a double layer of boards, 27 mm in thickness, crossing each other at 45°. The scaffolding was erected in successive phases and a number of guy cables were employed to stabilise the structure

  9. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models.

  10. Vesta's Elemental Composition

    Science.gov (United States)

    Prettyman, T. H.; Beck, A. W.; Feldman, W. C.; Lawrence, D. J.; McCoy, T. J.; McSween, H. Y.; Mittlefehldt, D. W.; Peplowski, P. N.; Raymond, C. A.; Reedy, R. C.; Russell, C. T.; Titus, T. N.; Toplis, M. J.; Yamashita, N.

    2014-01-01

    Many lines of evidence (e.g. common geochemistry, chronology, O-isotope trends, and the presence of different HED rock types in polymict breccias) indicate that the howardite, eucrite, and diogenite (HED) meteorites originated from a single parent body. Meteorite studies show that this protoplanet underwent igneous differentiation to form a metallic core, an ultramafic mantle, and a basaltic crust. A spectroscopic match between the HEDs and 4 Vesta along with a plausible mechanism for their transfer to Earth, perhaps as chips off V-type asteroids ejected from Vesta's southern impact basin, supports the consensus view that many of these achondritic meteorites are samples of Vesta's crust and upper mantle. The HED-Vesta connection was put to the test by the NASA Dawn mission, which spent a year in close proximity to Vesta. Measurements by Dawn's three instruments, redundant Framing Cameras (FC), a Visible-InfraRed (VIR) spectrometer, and a Gamma Ray and Neutron Detector (GRaND), along with radio science have strengthened the link. Gravity measurements by Dawn are consistent with a differentiated, silicate body, with a dense Fe-rich core. The range of pyroxene compositions determined by VIR overlaps that of the howardites. Elemental abundances determined by nuclear spectroscopy are also consistent with HED-compositions. Observations by GRaND provided a new view of Vesta inaccessible by telescopic observations. Here, we summarize the results of Dawn's geochemical investigation of Vesta and their implications.

  11. EAF optimal managing elements

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Electric Arc Furnaces (EAF) is an important and complex aggregate. We present elements of EAF operating efficiency. The reliability of the EAF is mainly determined by electric circuit reliability and especially of the transformator of the furnace. This due to the fact that, in an electric steel plant, the objective „24 tapping/day” involves. Due to the complexity of the process, the EAF operation needs a computer usage and, in his componence, it must have two independent calculation units (UC1) and (UC2). Based on these two input sets (Σi1) and ((Σi2), the calculation unit (UC1) builds the general operation procedure based on mathematical methods. For that purpose, there are used the results of the 5 mathematical methods: the mathematical model to write-off the function objective (M.F.O.); the mathematical model of calculating the charge (M.C.C.); the mathematical model of conducting the effective melt (M.C.M.); the mathematical model of reheating the charge (M.R.C.); the mathematical model of blasting the reactive dusts (M.B.R.D.).

  12. Hábitos de consumo sobre la cerveza

    OpenAIRE

    Velasco Matilla, Débora

    2015-01-01

    Estudio de los hábitos de consumo de cerveza en un pueblo determinado situado en la provincia de Segovia, Cantalejo. Contiene un resumen sobre la historia de la cerveza y su tipología y un estudio de mercado sobre la cerveza partiendo de una encuesta. Grado en Comercio

  13. Violência sobre Crianças

    OpenAIRE

    Sacadura, Catarina Brito; Aragão, Maria José

    2014-01-01

    Trata-se de um estudo de revisão sobre a violência exercida sobre crianças, os agentes da violência, os sujeitos da violência, os factores de risco, as consequências na idade adulta e a recidividade de violência sexual.

  14. Generalizaciones y creencias sobre el autismo: estudio descriptivo

    OpenAIRE

    Rodríguez Fernández, Patricia

    2015-01-01

    La autora propone una investigación sobre las creencias más generalizadas en diferentes aspectos del autismo: etiología, características, escolarización y pronóstico en diferentes grupos de edades con distinta familiaridad sobre este trastorno y con distinto nivel educativo general.

  15. Neruda e Drummond: um olhar sobre Stalingrado

    Directory of Open Access Journals (Sweden)

    Moacir Lopes de Camargos

    2015-07-01

    Full Text Available Este artigo tem por objetivo promover uma aproximação entre dois expoentes da lírica latino-americana do século XX, a saber: Pablo Neruda e Carlos Drummond de Andrade, a partir da análise dos poemas Canto a Stalingrado (1942 e Carta a Stalingrado (1943. Apresentaremos a visão histórica desses poetas sobre a Batalha de Stalingrado, considerada um dos principais eventos da Segunda Guerra Mundial. Ademais, será abordada a questão do engajamento político, que envolve a produção poética dos referidos autores.

  16. Zubiri et alii sobre la consciencia

    Directory of Open Access Journals (Sweden)

    Solari, Enzo

    2016-08-01

    Full Text Available In recent literature on science and philosophy related to consciousness, the description and analysis are not always appropriate for the phenomenical consciousness that one wants to explain. From this one can sustain, contrary to some approaches to neuroscience and analytic philosophy, that the fact of consciousness previously requires a better phenomenological description and a more precise conceptual analysis.En la reciente literatura científica y filosófica sobre la consciencia no siempre se describe ni analiza adecuadamente cuál es esa consciencia fenoménica que se desea explicar. De ahí que se argumente, contra ciertas aproximaciones de la neurociencia y la filosofía analítica, que el hecho de la consciencia necesita previamente de una mejor descripción fenomenológica y de una más ajustada analítica conceptual.

  17. Algunas reflexiones sobre el turismo cultural

    Directory of Open Access Journals (Sweden)

    Claudia Toselli

    2006-01-01

    Full Text Available El presente artículo, si bien no pretende hacer un análisis exhaustivo sobre el turismo cultural, tiene por objetivo presentar algunas reflexiones acerca de esta modalidad turística desde diferentes aspectos. En primer lugar se abordará la relación entre turismo cultural y globalización, para luego centrarse en la incidencia de esta actividad como factor de desarrollo local y regional, haciendo referencia a algunos ejemplos de Argentina. Intentará también introducir acerca de los aspectos positivos y negativos, o puntos fuertes y débiles del turismo cultural. Y por último, esbozará algunas consideraciones acerca del rol de las organizaciones internacionales y de las principales agencias de cooperación internacional, incluyendo las resoluciones, declaraciones y recomendaciones más significativas en este campo del turismo.

  18. NOTAS SOBRE A LÓGICA ESTOICA

    OpenAIRE

    Valter Duarte Moreira Júnior

    2014-01-01

    Diante do grande desenvolvimento da Lógica e do cálculo proposicional no século XX, estudiosos do assunto em todo o mundo se concentraram em um rigoroso estudo dessa disciplina e sua história. Nesse processo, o eminente lógico polonês Jan Lukaziewicz descobriu em sua pesquisa sobre história da lógica a Lógica Estoica, que, já em III a. C., havia antecipado diversos métodos e conceitos da Lógica Moderna. Nossa intenção neste artigo é fazer um breve esboço da lógica desenvolvida pelos Estoicos....

  19. Sobre el Boletín

    Directory of Open Access Journals (Sweden)

    Andrés Arias

    2007-04-01

    Full Text Available En la página de Internet de la Biblioteca Luis Ángel Arango se indica que una de la funciones principales del Boletín es la de reseñar la novedades bibliográfica que van apareciendo en el país. "Novedades": de lo nuevo, tanto en las publicaciones como en las reseñas. Es decir, si lo que asegura la página de la Biblioteca es cierto, quien se acerca al Boletín debe encontrarse con comentarios recientes sobre libros recientes. Con guía que le ayuden a elegir entre las mil ofertas que hay en el mercado bibliográfico. Pero bien sabemos que este objetivo no se cumple.

  20. Conceptos fundamentales sobre el mantenimiento de edificios

    Directory of Open Access Journals (Sweden)

    Juan Miguel Arencibia Fernández

    2007-01-01

    Full Text Available En esta investigación se realiza una profunda búsqueda sobre el tema del Mantenimiento de Edificios donde se abundan diferentes conceptos y criterios de la misma, encontrándose de esta forma los más utilizados métodos a emplear. Luego teniendo en cuenta las clasificación del Mantenimiento de Edificio según los tipos de obras, propietarios del inmueble y el momento que éste se realiza, como los costos de una edificación y su equipamiento a utilizar. Otros de los aspectos a tener en cuenta es la organización del Mantenimiento su planificación y responsabilidad, las ventajas que puede traer tanto para la economía y para el mismo usuario, como su vida útil, para el cual fueron ejecutadas las edificaciones.

  1. Refletindo sobre as redes sociais digitais

    Directory of Open Access Journals (Sweden)

    Sônia Cristina Vermelho

    2014-03-01

    Full Text Available Este artigo apresenta os resultados da primeira etapa da investigação realizada pelo grupo de pesquisa Ciência, Tecnologia e Sociabilidade do Mestrado em Promoção da Saúde. Nele situamos a área da Promoção da Saúde; em seguida apresentamos uma discussão em torno do conceito de "redes sociais digitais" e, finalmente, apresentamos alguns resultados da pesquisa bibliográfica realizada nesta etapa. Os dados bibliográficos encontrados (artigos, teses e dissertações indicaram um aumento de trabalhos publicados sobre o tema a partir de 2005, bem como uma concentração nas áreas de Comunicação e Educação.

  2. NOTAS SOBRE A LÓGICA ESTOICA

    Directory of Open Access Journals (Sweden)

    Valter Duarte Moreira Júnior

    2014-02-01

    Full Text Available Diante do grande desenvolvimento da Lógica e do cálculo proposicional no século XX, estudiosos do assunto em todo o mundo se concentraram em um rigoroso estudo dessa disciplina e sua história. Nesse processo, o eminente lógico polonês Jan Lukaziewicz descobriu em sua pesquisa sobre história da lógica a Lógica Estoica, que, já em III a. C., havia antecipado diversos métodos e conceitos da Lógica Moderna. Nossa intenção neste artigo é fazer um breve esboço da lógica desenvolvida pelos Estoicos.

  3. Reflexiones sobre el tratamiento ambulatorio de drogodependientes.

    Directory of Open Access Journals (Sweden)

    Juan Carlos González García

    1989-01-01

    Full Text Available Intentamos plantear algunas de las innumerables contradicciones, paradojas y mitos que se presentan en relación con las demandas y con las necesidades terapéuticas de los consumidores de drogas, desde el nivel de atención extrahospitalaria pública y dentro de una Unidad de Salud Mental. Se intenta reflexionar sobre los conocimientos teóricos y la realidad práctica, su interdependencia, complementariedad y divergencia, con la finalidad de evitar la huida asistencial o la omnipotencia terapéutica. Se valoran las diferencias existentes entre la farmacología teórica, anclada en el paradigma lewiniano, y la realidad clínica.

  4. Documentos sobre aniversarios, reparticiones y capellanes

    Directory of Open Access Journals (Sweden)

    José Luis Martín Rodríguez

    1989-01-01

    Full Text Available En el Cómpoto o Arte de contar del cabildo segoviano  se habla de la mayordomía de Reparticiones que administra los bienes dejados para la celebración de aniversarios por el alma de los benefactores de la iglesia, y es de suponer que el volumen alcanzado por este tipo de donaciones llevaría a los demás cabildos peninsulares a individualizar estas rentas y a incluir en los libros de Obituarios o Aniversarios las obligaciones contraías por el cabildo, es decir por las dignidades o personas, canónigos y racioneros, que forman el cabildo en sentido estricto, y por los auxiliares de éstos: capellanes, sochantre, mozos de coro, organista, portero, campanero, refitolero, barrendero, perrero... sobre cuyas obligaciones y situación estamos mal informados.

  5. Sobre a moralidade do direito em Kant

    Directory of Open Access Journals (Sweden)

    Joãosinho Beckenkamp

    2009-07-01

    Full Text Available http://dx.doi.org/10.5007/1677-2954.2009v8n1p63Na atual literatura sobre a fi losofi a prática de Kant há uma tendência a negligenciar a distinção feita na Metaphysik der Sitten entre direito (Jus e ética (Ethica, a ponto de ser a doutrina do direito de Kant vista como uma mera aplicação do imperativo categórico. Este artigo procura mostrar que Kant apresenta em sua doutrina do direito uma série de argumentos que logram estabelecer o direito de modo inteiramente independente da ética.

  6. Apuntes sobre el Cultivo del Cacao

    Directory of Open Access Journals (Sweden)

    Ochoa Horacio

    1940-03-01

    Full Text Available Por muchos años permaneció el cultivo del cacao en nuestro país, en un deplorable atraso técnico; el agricultor a duras penas si tenía conocimientos generales de su explotación y, de una industria que tuvo su auge debido a la extensividad de las plantaciones, hoy sólo resta una reducida porción de ella. ¿Qué factores operaron esa tan notoria reducción hasta el punto de que exportadores en otros tiempos nos convertimos en importadores obligados de ese producto? Hay muchas razones de orden técnico y de orden económico. Los cacaotaleros obtenían halagadoras retribuciones cuando el jornal consistía en la alimentación que se le daba a la peonada y cuando, generoso, añadía una sobretasa en dinero. Bajo ese sistema de explotación, el descuadre que pudiera ocasionar tanto las enfermedades criptogámicas como los plagas, no era suficiente como para provocar el pesimismo en el hacendado y por tanto inducirlo al abandono de la plantación. A medida que las condiciones sociales del campesino se fueron modificando y su standard de vida aumentaba, cambió fundamentalmente el mecanismo de la industria Se observó entonces que los árboles morían y que era pobre la producción; que lo que en tiempos pasados fuera un negocio lucrativo, se les había convertido en una actividad improductiva y, para controlar estos fenómenos que se generalizaban en todas las zonas cacaotaleras, opusieron la ignorancia, el rutinarismo y la desidia. Lentamente se han ido modificando los conceptos antiguos sobre el trabajo cultural y los cuidados que con relación a las enfermedades y plagas requiere este delicado cultivo; la rutina está echando paso atrás y las experiencias científicas que procuran la prosperidad del plantío, se ponen en práctica en algunas zonas . Esto da esperanza para la reconstitución de la industria cacaotalera en nuestro país, que cuenta con inmensas regiones de óptima calidad para hacerla florecer sobre bases nuevas, con

  7. Aspectos da pesquisa sobre tipologia textual

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Travaglia

    2014-03-01

    Full Text Available Este artigo chama a atenção dos pesquisadores sobre tipologiatextual, na área da Linguística Textual, sobre aspectos que sãoimportantes para que estas pesquisas gerem conclusões egeneralizações mais confiáveis. Os pontos comentados são: a anecessidade de uma teoria tipológica geral de textos que inclusivedetermine se as categorias de texto são todas da mesma natureza. Oautor propõe uma teoria geral; b a necessidade de estudos maishorizontalizados ou amplos que estabeleçam campos de pesquisa ede estudos mais verticalizados, que aprofundam o conhecimentode pontos específicos; c os aspectos metodológicos para superarproblemas no levantamento das categorias de texto existentes emuma sociedade e cultura, em suas diversas comunidades discursivase esferas de ação social; d a questão dos parâmetros e critérios paraconsiderar uma categoria de texto como sendo uma categoria e seela é de determinada natureza; e a questão dos critérios e parâmetrospara a caracterização das categorias de texto; f a necessidade deestudar as diversas relações de diferentes tipos que podem ocorrerentre as categorias de texto (de diferentes naturezas, tanto em suacomposição quanto em seu funcionamento sociodiscursivo; e g aatenção que merece a questão teminológica.

  8. Composición elemental y contenido de metales en sedimentos marinos de la bahía Mejillones del Sur, Chile: evaluación ambiental de la zona costera Elemental composition and metal contents in the marine sediments of Mejillones del Sur Bay, Chile: an environmental assessment of the coastal zone

    Directory of Open Access Journals (Sweden)

    Jorge Valdés

    2009-01-01

    Full Text Available Se midió la concentración de carbono total, nitrógeno total, azufre total, materia orgánica, Ni, Cd, Pb, Cu y Zn en sedimentos costeros (10 m de profundidad de columna de agua de ocho sectores de la bahía Mejillones. La composición elemental de los sedimentos sería el resultado de la abundante materia orgánica autóctona presente en este sistema costero. El orden de abundancia de los metales analizados fue: Zn > Cu > Ni > Pb > Cd. La concentración de metales no se explicaría por el contenido de materia orgánica ni la composición granulométrica de los sedimentos costeros. La evaluación del contenido de metales en los sedimentos, mostró que el Ni, Zn y Pb estarían levemente enriquecidos en la actualidad, aún cuando los valores se mantienen dentro de un rango cercano a los niveles preindustriales. El análisis del dendrograma de similitud de los sectores de estudio separó la línea de costa de Mejillones en dos grandes zonas; una asociada a la actividad industrial desarrollada en la bahía, y otra correspondiente al área de desarrollo urbano de Mejillones con características similares a aquellos ambientes libres de actividad antrópica directa.The total carbon, total nitrogen, total sulphur, organic matter, Ni, Cd, Pb, Cu, and Zn concentrations were measured in coastal sediments (10 m water depth at eight stations in Mejillones Bay. The elemental composition of these sediments is a function of the autochthonous organic matter generated in this coastal system. The order of abundance for the metals was: Zn > Cu > Ni > Pb > Cd. The metal content is not explained by the organic matter content or grain size of these coastal sediments. The evaluation of the concentration metals in the sediments showed that Ni, Zn, and Pb are slightly enriched at the present, although with values that are similar to preindustrial concentrations. A cluster analysis of the similarity in the study area separated the Mejillones coast into two main zones

  9. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  10. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  11. Gamification Elements for Learning Applications

    Directory of Open Access Journals (Sweden)

    Firas Layth Khaleel

    2016-12-01

    Full Text Available Gamification technique is getting popular to be implemented in learning or training application. It is referred to the use of game elements or game thinking in a non-game context in order to increase engagement between students and learning application. Since there are many elements of games that are identified from previous works, this study focuses on game elements from Gamification technique that positively affect learning when applied to a learning application. Therefore, the objectives of this research are to identify game elements that can be gamified in a learning application; and to verify those elements by multiple users (gamers, students, and experts. Suitable game elements are identified through literature reviews. Two approaches are used to verify these elements; interview experts and administer a survey to gamers and students. The finding of this study suggests the use of a group of game elements with three aims, (1 increase the level of fun and entertainment; (2 motivate students to challenge each other; and (3 improve gaming and learning skills. In a further study, these elements will be implemented in a learning application and its effectiveness shall be tested.

  12. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  13. SNTP program fuel element design

    Science.gov (United States)

    Walton, Lewis A.; Ales, Matthew W.

    1993-06-01

    The SNTP program is evaluating the feasibility of utilizing a particle bed reactor to develop a high-performance nuclear thermal rocket engine. The optimum fuel element arrangement depends on the power level desired and the intended application. The key components of the fuel element have been developed and are being tested.

  14. RESEARCH METHODS OF LOCATIVE ELEMENT

    Directory of Open Access Journals (Sweden)

    SULAYMANOVA N.J.

    2012-01-01

    Full Text Available The article is devoted to the methods of investigation of locative elements. Sentence analysis with locative elements is taken according to the results of component analysis in the system of contradicting – opposition. More over the article is full of examples related to the description of various syntactic units.

  15. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  16. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  17. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  18. Chemical experiments with superheavy elements.

    Science.gov (United States)

    Türler, Andreas

    2010-01-01

    Unnoticed by many chemists, the Periodic Table of the Elements has been extended significantly in the last couple of years and the 7th period has very recently been completed with eka-Rn (element 118) currently being the heaviest element whose synthesis has been reported. These 'superheavy' elements (also called transactinides with atomic number > or = 104 (Rf)) have been artificially synthesized in fusion reactions at accelerators in minute quantities of a few single atoms. In addition, all isotopes of the transactinide elements are radioactive and decay with rather short half-lives. Nevertheless, it has been possible in some cases to investigate experimentally chemical properties of transactinide elements and even synthesize simple compounds. The experimental investigation of superheavy elements is especially intriguing, since theoretical calculations predict significant deviations from periodic trends due to the influence of strong relativistic effects. In this contribution first experiments with hassium (Hs, atomic number 108), copernicium (Cn, atomic number 112) and element 114 (eka-Pb) are reviewed.

  19. Reflexiones sobre la crisis. Vidas y Memorias

    Directory of Open Access Journals (Sweden)

    Estela Vázquez

    2009-11-01

    Full Text Available El artículo se plantea analizar la deslegitimación de la política y de los políticos, así como del acto de votar. Encuadrado en el marco del contexto de la crisis argentina de los últimos años, quiere responder, por medio de la entrevista oral y la historia de vida, a cómo se ve desde la ciudadanía el ejercicio de la democracia, las prácticas políticas, la alternancia en el poder y de qué forma todo esto influye en las vidas personales de los entrevistados. Asimismo, se entrelaza el análisis del espectáculo político con el público que ofrecen los medios de comunicación y de entretenimiento, con lo que se viene a concluir que es cada vez más difícil distinguir en el debate social la ficción de los hechos y personajes verdaderamente reales. Para este trabajo se analizan tres trayectorias laborales de ex-empleados de la administración pública, y sus apreciaciones sobre el despido, vinculando estas experiencias de vida a la formación de sus ideas sobre la política y los políticos.. Sus lugares de trabajo eran el Registro Civil, la Secretaría de Educación y la Legislatura, respectivamente.__________________ABSTRACT:This article tries to analyse the discredit of politics and politicians along with the act of voting. Placed in the context of the Argentine crisis, it wants to determinate through oral interview and life story how citizens see the exercise of democracy, the political practices and the power switching, to establish how they have influenced in the lifes of the persons being interviewed. At the same time, it interlaces an analysis of he political spectacle shown to the public by the media, to conclude that is becoming more a more difficult to distinguish the fiction from the real characters in the social debate.

  20. El puente Bendorf sobre el Rin (Alemania

    Directory of Open Access Journals (Sweden)

    Hirschfeld, Kurt

    1966-03-01

    Full Text Available This recently completed bridge over the Rhine is 524 m long, and is a reinforced concrete structure, built by successive overhangs, without the aid of formwork or scaffolding. The centre span is 208 m in length, and the other six vary between 43 and 71 m. The deck consists of two independent parts, including a continuous box girder, with a hinge at the crown of the main span. It is stiffened with transversal diaphragms, spaced every 34 m. The piles rest on pneumatic caissons, which go down to 16 m below the river bed. The attachment between the piles and the caissons is rigid, at the central pile, and at the other piles it operates through a roller bearing. The central span was constructed without intermediate supports for the first 40 m, and beyond that stage, for greater safety, a provisional movable tower was built, as a temporary point of support for the free overhang. The various sections were concreted and post-tensioned with 32 mm bars, by the Dywidag procedure. Account was taken of the varying deformations that took place at each section, so as to add the necessary counter-deflection that finally enabled the two sides of the arch to meet at the crown at the calculated point.Este puente, recientemente construido, sobre el Rin, tiene una longitud total de 524 m, es de hormigón armado y se ha realizado por el procedimiento de voladizos sucesivos, sin entramado auxiliar ni cimbras. La luz del tramo central es de 208 m, y las de los otros seis oscilan entre 43 y 71 m. La estructura del tablero se compone de dos partes independientes, formadas por una viga tipo cajón, continua, con una articulación en la clave del tramo central y rigidizada con diafragmas transversales espaciados a 34 m. Las pilas centrales se apoyan sobre cajones neumáticos que descienden 16 m debajo del fondo del río. La unión entre estas pilas y la estructura cajón es rígida, y de tipo rodillo en las otras pilas. El tramo central se ha construido por voladizos

  1. Algunas reflexiones sobre el poder itinerante almohade.

    Directory of Open Access Journals (Sweden)

    Maribel FIERRO

    2009-12-01

    Full Text Available La primera parte del artículo consiste en la presentación de dos estudios sobre el poder itinerante en el Magreb: Jocelyne Dakhlia (1988 para las épocas hafsí y posteriores; Manuela Marín (2005 sobre el caso almohade. En la segunda parte, primeramente se analiza la convergencia del itinerario de Ibn Tumart con las conquistas de ‘Abd al-Mu’min: el movimiento –real o legendario– del fundador mesiánico del imperio marca el territorio conquistado por su sucesor el califa y su presencia inserta el espacio en la memoria, la geografía y el poder imperiales. A continuación, se plantea la compleja cuestión de la «capitalidad» almohade: se puede hablar de una capital sagrada (Tinmal, una capital central (Marrakech, capitales regionales (Sevilla, Túnez y de una nueva capital inacabada (Rabat. Pero es la presencia (hadar del propio califa la que determina dónde está el centro del imperio.La première partie de cet article présente deux études sur le pouvoir itinérant au Mahgreb : celle de Jocelyne Dakhlia (1986 sur la période hafside et les suivantes, celle de Manuela Marín (2005 sur le cas almohade.Dans la seconde partie, on analyse d’abord la convergence de l’itinéraire d’Ibn Tumart avec les conquêtes d’‘Abd al-Mu’min : le  trajet – réel ou légendaire – du fondateur messianique de l’empire marque le territoire conquis par son successeur le calife et sa présence ancre l’espace dans la mémoire, la géographie et le pouvoir impériaux. Ensuite, on examine la question complexe de la « capitalité » almohade : on peut parler d’une capitale sacrée (Tinmal, d’une capitale centrale (Marrakech, de capitales régionales (Séville, Tunis et d’une nouvelle capitale inachevée (Rabat. Mais c’est la présence (hadar du calife lui-même qui détermine où est le centre de l’empire.

  2. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  3. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  4. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  5. Cassirer e Sartre sobre o esclarecimento

    Directory of Open Access Journals (Sweden)

    Vinicius de Figueiredo

    2005-12-01

    Full Text Available O presente ensaio levanta alguns aspectos da estética no século XVIII. Partindo da apresentação de duas interpretações hoje clássicas sobre o assunto (a de Cassirer e a de Sartre, busca rever o pressuposto analítico comum a ambas, para, em seguida, apontar as conseqüências que a relação entre autor e público trazem para a compreensão de aspectos estilísticos que nos parecem centrais para a literatura do Esclarecimento.This paper aims at throwing some light on the Eighteenth-Century aesthetics. After examining two classical interpretations - Cassirer e Sartre's - concerning this subject, I argue that both authors share a common analytical pressupposition. My main purpose is to show that without taking account of the the relationship between author and public, we cannot understand some essential characteristics of the literature in the Enlightenment.

  6. Considerações sobre Agamben

    Directory of Open Access Journals (Sweden)

    Luiz Hebeche

    2012-12-01

    Full Text Available http://dx.doi.org/10.5007/1677-2954.2012v11n3p329Giorgio Agamben em pequenos artigos, entrevistas e baixo-assinados tem chamado a atenção para o estado de abandono do povo palestino, mas curiosamente esse assunto não é tratado em suas obras mais importantes. Em Homo sacer, por exemplo, ele retoma o termo “muçulmano”, comumente empregado pelos prisioneiros dos campos de concentração como a expressão do maior abandono possível da existência humana, mas não reflete suficientemente sobre a origem dessa palavra, isto é, de que nessa expressão já se encontrava o ódio e o desprezo do sionismo, não só entre os próprios prisioneiros, mas pelo povo palestino e pelos árabes em geral. A seguir comentaremos brevemente algumas obras desse autor que, dando continuidade à ideologia da vitimação, faz com que, mais uma vez, o passado inominável acabe encobrindo o presente abominável.

  7. NOTAS SOBRE A IRRACIONALIDADE DA GUERRA

    Directory of Open Access Journals (Sweden)

    Edilene Leal

    2014-08-01

    Full Text Available Nesse artigo, procedemos a uma análise sobre a irracionalidade da guerra em tempos cada vez mais caracterizados pela evolução da racionalidade técnica, ou seja, em tempos contemporâneos. Esse é o ponto a partir do qual traçamos, aqui, um percurso argumentativo dividido em duas partes. Na primeira, reconstituímos elementos da concepção de guerra de filósofos como Maquiavel, Clausewitz e Kant, destacando, nos dois primeiros pensadores, a prerrogativa de que a guerra é racional quando se configura meio para fins políticos. Na segunda parte, confrontamos essa racionalidade política da guerra com a dupla dimensão técnica que a guerra assumiu: de um lado, a guerra como um fim em si mesmo e não mais como meio da ação política; de outro, a dimensão racionalizante da guerra como resultado do progresso técnico e científico, atualizada como guerra do terror.

  8. Sobre a "conveniência" da escola

    Directory of Open Access Journals (Sweden)

    Marisa Vorraber Costa

    2009-01-01

    Full Text Available El artículo pretende mostrar un nuevo "uso" para la escuela, vinculado a la lógica de la etapa actual de la globalización en la que la cultura ocupa una posición singularmente importante, entrelazándose en la vida social, en los circuitos económicos y en los regímenes políticos. Recurriendo a la teorización de George Yúdice sobre los usos de la cultura en la era global, se analizan tres proyectos sociales - Você Apita, Tim Música nas Escolas y Escola Aberta - considerados expresivos de la forma como empresas, organizaciones públicas e iniciativas de la sociedad civil se articulan con la cultura y con la educación para hacer con que los mercados globalizados se muevan, pero no sólo en sus propios intereses, aunque ellos persistan en la cima de las prioridades. Hay indicios de que la "conveniencia" de la escuela sobrepasa el interés mercantil inmediato, y se proyecta como estrategia dirigida hacia una variada gama de propósitos socio-políticos, económicos y culturales. Entre ellos, la posibilidad de gobernar la vida de las personas, forjando visiones de mundo y de sociedad.

  9. Consideraciones sobre de la ética

    Directory of Open Access Journals (Sweden)

    Enrique Cantolla Bernal

    2005-12-01

    Full Text Available El presente ensayo muestra como el hombre, a través de la historia, a estado constantemente buscando beneficios para su vida y ha debido cumplir con varias tareas, que con el tiempo han dado origen a costumbres y comportamientos que han llevado a constituir la moral y la ética. Esta última, nos permite definir y determinar los principales fines de la vida del hombre y cuales son los principios y normas que lo rigen. Así, el estudio de la ética nos plantea la interrogante sobre "los fines de la vida en este mundo" y cuales son las conductas para conseguirlos. Sin embargo, el autor plantea que el hombre se enfrenta a la elección de valores alternativos y ante la interrogante de ¿cuál es el sumo bien del ser humano y de la sociedad?, han surgido diversas teorías que muestran como, casi todas las sociedades, han elegido la búsqueda de la felicidad como "el sumo bien", pero este concepto de "la felicidad" ha variando producto de las diversas teorías y doctrinas, que han emergido a lo largo de su historia.

  10. sobre la población

    Directory of Open Access Journals (Sweden)

    Mauricio Schoijet

    2005-01-01

    Full Text Available En este artículo se analizan varios elementos de la obra de Thomas Malthus sobre población, en particular la recepción de su teoría y su posición política. Se resumen las críticas políticas, ideológicas y científicas que ha recibido, y se examinan asuntos hasta ahora no tratados por otros comentaristas, como es el caso de las excepciones admitidas por Malthus respecto al papel de las relaciones sociales feudales en la agricultura de Polonia y Rusia. Se sugiere que pese a que su teoría tendía a reforzar la pesada represión social y sexual existente, Malthus no fue apoyado por la burguesía británica (contrariamente a la apreciación de Marx. Se deduce que Malthus no percibió cabalmente los avances de la agricultura, y se refuta la tesis de Donald Winch de que habría sido un liberal de izquierda en política pues si bien en algunos aspectos se le puede considerar progresista, en otros, esenciales, conservador extremadamente represivo o protofascista, incluso precursor de la teoría de los golpes de Estado.

  11. SOBRE UNA NUEVA PROPUESTA DEL PROCESO EVOLUTIVO

    Directory of Open Access Journals (Sweden)

    LUIS ALVARO CADENA MONROY

    2009-01-01

    Full Text Available Se mencionan algunas debilidades de tres propuestas alrededor del proceso de evolución de los organismos: gradualismo, neutralismo y equilibrio puntuado. Aunque dos de ellas hacen referen- cia a tasas de cambio, y la otra (neutralismo se refiere a la ausencia de la selección a nivel mi- croscópico, se toman estas tres propuestas debido a la relevancia que tienen en el contexto de la bibliografía sobre la evolución. Se hace una propuesta en la que se busca integrar estos puntos de vista, resolviendo las debilidades de cada propuesta. Para ello, se sugiere que el proceso evolutivo fundamentalmente tiene dos etapas: en la primera etapa, los organismos crean sus nichos ecoló- gicos. En este período, la iniciativa selectiva es de los organismos (“selección invertida”. Posterior- mente, el proceso puede invertirse, y será el nuevo nicho el que seleccione las variantes de los organismos que se le adaptan (“selección normal”. Este último proceso será posible, solamente si la “selección invertida” puede inscribirse en una tendencia de cambio evolutivo más general. Se discuten dos ejemplos en que se aplica la noción de “selección invertida”: el origen de los cordados y la evolución hacia el Homo sapiens.

  12. Apuntes sobre el Cultivo del Cacao

    Directory of Open Access Journals (Sweden)

    Chavarriaga. Eduardo

    1940-09-01

    Full Text Available El sombrío constituye uno de los problemas que se presentan en el cultivo del cacao, de necesaria resolución para ayuda del agricultor en su labor al producir tan importante grano. Contribuye a la economía del cultivo un conocimiento amplio de la cuestión que debe preocupar al productor inquiriendo no solamente por lo acostumbrado en la región, sino por lo que en otras partes se conoce sobre el particular, para abandonar un poco el emperismo y hacer una industria cada día más próspera. Como razón a favor del sombrío, tenemos los países en donde se produce cacao de fina calidad; Trinidad, Venezuela. Nicaragua, siempre acostumbran la sombra; y sin ir muy lejos, en el Valle del Cauca, donde no se cultiva a pleno sol y se obtienen plantaciones de larga duración y producto superior, es bien conocido el beneficio de ella; allí, los agricultores conocen los desastrosos efectos que ocasiona la falta de sombra, cuando por cualquier causa mueren los árboles que la suministran. Por tanto, en este estudio indicaremos el uso de la sombra para el cacao, como el medio de conservar la fertilidad y buenas condiciones del suelo, obtener buenos rendimientos y asegurar larga vida a la plantación.

  13. Sobre a diversidade de sentidos de comunidade

    Directory of Open Access Journals (Sweden)

    Silva, Rosalina Carvalho da

    2005-01-01

    Full Text Available Nosso objetivo neste trabalho foi realizar algumas reflexões sobre as implicações da expansão do uso do termo comunidade e sua diversidade de sentidos. Pretendemos discutir os usos indiscriminados do termo nem sempre acompanhados da devida reflexão e crítica. A partir das perspectivas da sociologia, saúde e psicologia social identificamos que o termo ainda permanece arraigado aos ideais de comunidades naturais próprios aos períodos do feudalismo e do pós-revolução industrial. Esta concepção pode camuflar formas impositivas de trabalho em muitos dos quais o termo comunidade é empregado praticamente como sinônimo de população-alvo e participação comunitária é vista meramente como freqüência às atividades propostas por profissionais que determinam quem são as comunidades. Comprometem-se assim, as práticas emancipatórias. Para repensarmos comunidades, hoje, consideramos necessário relevar os aspectos processuais relacionais, dialógicos e identitários em constantes mudanças. Assim, a condição de comunidade extrapola a delimitação geográfica para as possibilidades de pertencimento e participação através dos espaços simbolicamente delimitados

  14. Representaciones sociales sobre riesgo y vulnerabiidad

    Directory of Open Access Journals (Sweden)

    Pedro Humberto Faria CAMPOS

    2012-08-01

    Full Text Available O artigo traz uma reflexão teórica sobre a importância da Teoria das Representações Sociais para explicar fenômenos sociais na área da saúde e seu papel metodológico na compreensão de comportamentos e práticas relacionadas ao campo da saúde assim como o potencial transformador das representações para prevenção e o cuidado com a saúde das coletividades humanas. Revisitando os conceitos de práticas sociais e analisando o papel normativo que designa as representações sociais, se discute a mudança social e os fatores sócio-cognitivos a ela associados. Do ponto de vista heurístico destaca a necessidade de identificar a estrutura de uma representação, condição essencial para a comparabilidade.

  15. Kriging-Based Finite Element Method: Element-By-Element Kriging Interpolation

    Directory of Open Access Journals (Sweden)

    W. Kanok-Nukulchai

    2009-01-01

    Full Text Available An enhancement of the finite element method with Kriging shape functions (K-FEM was recently proposed. In this method, the field variables of a boundary value problem are approximated using ‘element-by-element’ piecewise Kriging interpolation (el-KI. For each element, the interpolation function is constructed from a set of nodes within a prescribed domain of influence comprising the element and its several layers of neighbouring elements. This paper presents a numerical study on the accuracy and convergence of the el-KI in function fitting problems. Several examples of functions in two-dimensional space are employed in this study. The results show that very accurate function fittings and excellent convergence can be attained by the el-KI.

  16. Imaging techniques for elements and element species in plant science.

    Science.gov (United States)

    Wu, Bei; Becker, J Sabine

    2012-05-01

    Revealing the uptake, transport, localization and speciation of both essential and toxic elements in plants is important for understanding plant homeostasis and metabolism, subsequently, providing information for food and nutrient studies, agriculture activities, as well as environmental research. In the last decade, emerging techniques for elemental imaging and speciation analysis allowed us to obtain increasing knowledge of elemental distribution and availabilities in plants. Chemical imaging techniques include mass spectrometric methods such as secondary ionization mass spectrometry (SIMS), laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) and synchrotron-based techniques such as X-ray fluorescence spectroscopy (SRXRF), and so forth. On the other hand, X-ray absorption spectroscopy (XAS) based on synchrotron radiation is capable of in situ investigation of local atomic structure around the central element of interest. This technique can also be operated in tandem with SRXRF to image each element species of interest within plant tissue. In this review, the principles and state-of-the-art of these techniques regarding sample preparation, advantages and limitations, and improvement of sensitivity and spatial resolution are discussed. New results with respect to elemental distribution and speciation in plants revealed by these techniques are presented.

  17. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  18. Finite element computational fluid mechanics

    Science.gov (United States)

    Baker, A. J.

    1983-01-01

    Finite element analysis as applied to the broad spectrum of computational fluid mechanics is analyzed. The finite element solution methodology is derived, developed, and applied directly to the differential equation systems governing classes of problems in fluid mechanics. The heat conduction equation is used to reveal the essence and elegance of finite element theory, including higher order accuracy and convergence. The algorithm is extended to the pervasive nonlinearity of the Navier-Stokes equations. A specific fluid mechanics problem class is analyzed with an even mix of theory and applications, including turbulence closure and the solution of turbulent flows.

  19. Evaluación de las Consecuencias de la Nueva Regulación de la OMI sobre Combustibles Marinos

    OpenAIRE

    Manuel López, Francisco de

    2015-01-01

    El 10 de octubre de 2008 la Organización Marítima Internacional (OMI) firmó una modificación al Anexo VI del convenio MARPOL 73/78, por la que estableció una reducción progresiva de las emisiones de óxidos de azufre (SOx) procedentes de los buques, una reducción adicional de las emisiones de óxidos de nitrógeno (NOx), así como límites en las emisiones de dióxido de Carbono (CO2) procedentes de los motores marinos y causantes de problemas medioambientales como la lluvia ácida y efecto invernad...

  20. Sobre manhãs, humor e atos de fala

    Directory of Open Access Journals (Sweden)

    Joana Plaza PINTO

    Full Text Available RESUMO Este ensaio apresenta uma trajetória de leituras de Frege a Austin, intermediadas pela interpretação independente e ousada de Kanavillil Rajagopalan. Ao argumentar sobre uma gama de aproximações teóricas entre Frege e Austin, este ensaio narra a importância da interpretação de Rajagopalan para o debate sobre Austin no Brasil.

  1. Recursos sobre emergencias y ayuda humanitaria en internet.

    OpenAIRE

    López Miguel, Daniel

    2007-01-01

    Dada la enorme cantidad de organismos, agentes y personas que llegan a participar en las emergencias, la información y documentación es muy dispersa y diversa, desde organismos oficiales y gubernamentales hasta servicios de noticias, pasando, por supuesto, por organizaciones no gubernamentales. Con el presente artículo pretendemos aportar unas pinceladas sobre los recursos que pueden encontrarse en Internet sobre los conflictos y crisis humanitarias. Peer Reviewed

  2. Liberalismo versus republicanismo: notas sobre o conceito de liberdade.

    Directory of Open Access Journals (Sweden)

    Felipe Nunes

    2007-01-01

    Full Text Available Este artigo tem como objetivo contrastar as perspectivas liberal e republicana sobre o conceito de liberdade. Através da comparação feita entre os dois modelos tecemos considerações sobre a realidade brasileira tendo como foco o atual estado de crises advindas dos casos de corrupção no país.

  3. Bibliografía comentada sobre la historia de Guanacaste

    OpenAIRE

    Solano-Muñoz, Edgar

    2010-01-01

    El texto presenta una bibliografía comentada relacionada con Guanacaste. El propósito del texto es hacer una valoración desde la óptica de la historia regional sobre los textos escritos sobre historia de Guanacaste considerando cuatro aspectos: 1. representaciones sociales, 2. estudios coloniales, 3. historia regional y 4. historia local. Universidad de Costa Rica- Sede Guanacaste

  4. Reflexiones sobre Enfermería

    Directory of Open Access Journals (Sweden)

    Inés Durana Samper

    1992-12-01

    Full Text Available

    agosto 6 de 1992

    Presentación ante la Academia Nacional de Medicina
    Señores miembros de la Junta Directiva, académicos, enfermeras, señores, señoras:

    Introducción
    Para ingresar como Miembro Asociado de esta ilustre Academia Nacional de Medicina, quiero exponer algunas reflexiones sobre la evolución en Colombia de la enfermería, mi profesión, ejercida ininterrumpidamente en estos últimos cuarenta años. Amanera de colofón, me referiré a la función esencial de la enfermera, es decir a su consagración al arte de cuidar.

    La metodología aplicada en este trabajo incluye la revisión de archivos, la lectura de publicaciones y, además, algunas entrevistas con personas que pacientemente escucharon mis preguntas y ampliaron mi información con valiosos comentarios.

    Mis agradecimientos van, en primer término, al académico Fernando Serpa Flórez, quien ha tenido la iniciativa de presentarme a la Academia Nacional de Medicina; también va para aquellos académicos que respaldaron mi aceptación en esta prestigiosa sociedad científica. Igualmente expreso mi reconocimiento al académico Héctor Pedraza Mendoza, autor del primer libro conocido sobre reseña histórica de la enfermería en el país, y a quien correspondió, como funcionario de la administración pública, la orientación y control de la profesión en su cargo de Jefe de la División Infantil y Materna del entonces Ministerio de Trabajo, Higiene y Previsión Social. Libro citado con frecuencia’ durante el trabajo.

    Mis agradecimientos también a mis profesores, y entre ellos, en especial, al académico Alberto Albornoz- Plata. No puedo pasar por alto la memoria de los siempre recordados, doctores Jorge Boshell Manrique y José Pablo Leyva, quienes, desde la Escuela Superior de Higiene, supieron orientarme en la transformación académica del

  5. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  6. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    SHI; Zhongci

    2001-01-01

    [1]Shi Zhong-ci, On the accuracy of the quasi-conforming and generalize conforming finite elements, Chin. Ann. Math., 1990, 11B: 148.[2]Shi Zhong-ci, Chen Shao-chun, Huang Hong-ci, Plate elements with high accuracy, Collec. Geom. Anal. Math. Phys. (ed. Li Ta-Tsien), Singapore: World Scientific, 1997, 155—164.[3]Chen Shao-chun, Shi Zhong-ci, Double set parameter method for the construction of the element stiffness matrix, Mathematica Numerica Sinica (in Chinese), 1991, 13: 286.[4]Ciarlet, P., The Finite Element Method for Elliptic Problems, Amsterdam: North-Holland, 1978.

  7. Contando historias sobre contadores de historias

    Directory of Open Access Journals (Sweden)

    Tomás Ibáñez Gracia

    2002-06-01

    Full Text Available Hay personas que nos han dejado como legado un texto. Su texto. A veces, una obra ingente, fecunda, imprescindible. Hay otras que nos han dejado además la palabra, su palabra, su vida. Rex Stainton-Rogers es una persona del segundo tipo. Un ser humano excesivo, brillante, emprendedor, vivo. Su palabra es su herencia. Su legado, algunos y algunas de los más relevantes científicos sociales de la emergente generación, sobre todo en Gran Bretaña, que han sido personas educadas, entrenadas, formadas por esta figura excepcional. Su trabajo, más allá de los textos que nos ha legado, ha consistido especialmente en mostrar la vida, el laboratorio donde se forja realmente el conocimiento. Y así, quienes pudieron compartir una parte de su vida con él, han tenido el privilegio de estar en contacto con todo aquello que hace apasionante el saber, aquello que lo hace útil, aquello que te emborracha de placer. Rex murió en febrero de 1999 del mismo modo en que vivió, libre, espléndido. Un año más tarde, su compañera Wendy Stainton-Rogers organizó junto con algunas de las personas que más deben a la vida de Rex, un simposium para conmemorarle a él, a su vida y a su palabra. Ésta es la contribución que nosotros hicimos a ese homenaje.

  8. Puente sobre el Rhin – Suiza

    Directory of Open Access Journals (Sweden)

    Bänziger, D. J.

    1972-10-01

    Full Text Available In the brief period of two months a new bridge over the Rhine has been constructed to substitute one which collapsed on August 1970, because of the undermining of one of its pillars. On November 28 1970 the new bridge was opened to the traffic, including trucks of up to 3.5 Kp, and on December 7th of the same year vehicles of up to 26 Kp could use it. In the construction of this bridge, for the first time, use has been made of cylindrical, prefabricated, precast thin shells. This project is of special significance because of its operational importance, since it connects Lichtenstein and Switzerland; the exceptionally short time of its construction; and the new type of deck used.Para sustituir un puente sobre el Rhin, hundido el 14 de agosto de 1970 por socavación de uno de sus pilares, se ha construido un nuevo puente en el escaso plazo de dos meses. El 28 de noviembre de 1970, este nuevo puente se abrió al tráfico de vehículos de hasta 3,5 Mp, y el 7 de diciembre del mismo año, a los vehículos de hasta 26 Mp. En la construcción de este puente se han utilizado, por vez primera, láminas cilíndricas de cubierta, prefabricadas y pretensadas. La importancia del puente, que sirve para el enlace entre el Principado de Liechtenstein y Suiza, el nuevo tipo de tablero utilizado, así como el plazo de construcción, extraordinariamente breve, dan un interés especial a esta obra.

  9. Considerações sobre o Mercosul

    Directory of Open Access Journals (Sweden)

    Ricardo Seitenfus

    1992-12-01

    Full Text Available Após traçar as origens históricas e conjunturais do processo de integração na Bacia do Prata, o autor analisa as características do Tratado de Assunção, através de um organograma detalhado. Na segunda parte, três questões sem resposta são colocadas aos leitores, ou seja, o processo de institucionalização envolvendo a constituição de um espaço supranacional que estará diretamente vinculado aos objetivos do processo; as relações do Mercosul com o Nafta e a definição de um quadro de cooperação e, finalmente, coloca a questão sobre o nível de participação do Estado no processo integracionista sob a ótica da necessidade de reconversão de certos setores econômicosIn the first part of this article, the author, after delineating the historical and circumstancial sources regarding the process of integration in the Prata Basin, analyses the characteristics of the Traty of Asunción (Paraguay through a detailed organizational chart. In the second part, three open questions are discussed: (a the process of institutionalization which involves the constitution of some supranationalization which invoves the constitution of some supranational space which will be closely related to the objectives of the process; (b the relationships between the Mercosul and the Nafta and the definition of a cooperative program; (c the level of participation of the State into the integrationist process under the dear need of a reconversion of some economic sectors.

  10. Reflexión sobre Rubem Fonseca

    Directory of Open Access Journals (Sweden)

    Marco Martos Carrera

    2011-05-01

    Full Text Available El día de hoy la Universidad Nacional Mayor de San Marcos honra a sustradiciones recibiendo a Rubem Fonseca, el representante más conspicuode la cultura del Brasil contemporáneo, y haciéndolo rinde homenaje a supaís originario y a la lengua portuguesa hermana de la española que esla lengua franca en nuestra nación. Expresa también el deseo evidente denuestra Facultad de Letras y Ciencias Humanas de abordar la Literatura deBrasil como parte sustancial de la Literatura Latinoamericana y no comoalgo ajeno, pero vecino, cuando decimos profesar un interés por la LiteraturaHispanamericana.Dos cuestiones de fondo en el estudio de la obra de un escritor tienensuma importancia: la cultura en la que se forma y otra, su propia biografía.La cultura del Brasil, sobre todo en el plano literario se formó en vínculo estrechocon la cultura de Portugal, pero pronto la tierra americana, las gentesnacidas aquí fueron dejando su impronta en eso nuevo que nacía y que estádejando honda huella en la cultura universal. En ese sentido un narradorcomo Machado de Assís, aludido irónicamente por uno de los personajesde los cuentos recientes de Rubem Fonseca, es en el siglo XIX, la mejor manifestaciónde talento literario de América del Sur. Su nombre se pronunciacon respeto al lado de otros grandes escritores de diferentes latitudes queson los fundadores del cuento contemporáneo: Poe, Chejov, Maupassant.

  11. Estudio sobre encofrados de madera modernos

    Directory of Open Access Journals (Sweden)

    de la Peña Aznar, Juan M.

    1980-12-01

    Full Text Available The author continues the development of the subject «Modern Timber Formwork», by summing up the comparative examination —already carried out in Part III of this Study— of the different types of glued timber existing on the market. In addition, the loads and stresses allovk/able for coniferous timber and the proposal for establishing Regulations for the Timber Section of the Research and Experimental Forestry Institute of Spain are given. In part V of the author's Study, published in this article, the important subject of the glues used for joining timber, a truly vital point in order to obtain louvered timber beams which are simply glued together, is approached.

    El autor continúa el desarrollo del tema sobre «Encofrados de madera modernos», resumiendo el estudio comparativo —ya hecho en la Parte III de este Estudio— de las diferentes vigas de madera encolada existentes en el mercado dando, además, las cargas y tensiones admisibles para maderas coníferas y la propuesta de Reglamentación de la Sección de Maderas del Instituto Forestal de Investigaciones y Experiencias de España. En la parte V del Estudio del autor, publicada en este artículo, se aborda el importante tema de las colas empleadas para las uniones de madera, algo realmente vital para la obtención de vigas de madera en celosía simplemente encoladas.

  12. Perspectivas sobre la comunicación

    Directory of Open Access Journals (Sweden)

    María Luisa Naranjo Pereira

    2005-01-01

    Full Text Available Existen diversas teorías, enfoques y modelos de comunicación; de cada uno de ellos pueden rescatarse aspectos de gran valor para el logro de una comunicación eficaz. Este documento presenta una revisión de esos aspectos, para que se pueda comprender mejor y enriquecer uno de los procesos más importantes para el ser humano: el proceso de comunicación. Este es un ensayo en el cual se da a conocer la posición de la autora sobre el tema abordado. Se rescata el acento del enfoque humanista en la relación humana y en las etapas donde se desarrolla. A partir de la comunicación pragmática, se analizan los axiomas comunicacionales en que se fundamenta y lo que se conoce como patologías de esos axiomas. Además se revisan las principales características que distinguen la asertividad en la comunicación y las distintas formas de manipulación que la entorpecen. Del enfoque de Virginia Satir, se presentan los diversos aspectos de la comunicación, tanto funcional como disfuncional y los modelos de comunicación propuestos por esta autora. Se revisan aspectos importantes del enfoque de la comunicación educativa, tales como el control de la distancia, la voz y el cuerpo, las palabras y el situacional; así como los elementos que bloquean el proceso de comunicación y las sugerencias acerca de formas correctas de escuchar. Además, se hace referencia a la necesidad de emplear procesos educativos más holísticos y constructivistas y una comunicación-interrelación horizontal y con equidad.

  13. Sobre el genio de las mujeres

    Directory of Open Access Journals (Sweden)

    Valcárcel, Amelia

    1992-11-01

    Full Text Available Not available.

    A los varones, desde Tácito a Schopenhauer, nunca les ha parecido que las verdaderas mujeres son las que tienen en casa, sino las que tienen los otros varones (los germanos, los orientales. Por su parte, Wojtyla ha hecho profesión de fe «en el genio de las mujeres», reclutando enternecidos agradecimientos como el de Macciochi. La autora del presente artículo adopta una perspectiva histórica y una actitud analítica para aclarar qué es ese genio que como genérico nos adjudican. En primer lugar, la idea de genio es romántica y va emparejada con la de destino, sobre todo en el caso de los genios colectivos. Se trata de nociones que se construyen estipulativamente con fines pragmáticos y no admiten, por definición, contraejemplos. En el caso del genio de las mujeres, los llamados «valores femeninos» que lo constituyen pertenecen al ámbito de la Siulichkeit, y su eventual convalidación en el de la Moralitiit no puede obviar el proceso consistente en la crítica y el desmarcarse de una Sittlichkeit adjudicada como estereotipia que se contrasta, no con otra estereotipia simétrica, sino con lo universal, que se solapa con el genérico masculino. La autora, por último, nos recuerda que la fabricación de este genio que, a título de colectivo, se nos atribuye a las mujeres tiene lugar a costa de la usurpación de nuestra individualidad y de la ausencia de esquemas pragmáticos de reconocimiento de la genialidad individual que pueda producirse en el genérico femenino. Ahora bien: es esta última la que las mujeres necesitamos para poder romper con las tradiciones establecidas e instituir nuevos relatos.

  14. Sobre o campo da Psicologia Social

    Directory of Open Access Journals (Sweden)

    Belinda Mandelbaum

    2012-03-01

    Full Text Available O campo da Psicologia Social é apresentado como território fértil, na contemporaneidade, para constituir-se como um laboratório para a produção em Ciências Humanas, uma vez que, no século XX, cada vez mais o social foi em direção ao psicológico. Neste campo, nosso embate dá-se no modo como entendemos o hífen pressuposto na integração psicossocial. A autora propõe que, entre o psicológico e o social, o hífen domina, pois ele é a própria essência relacional que é inerente a cada um dos elementos. Sugere que o modelo para entender o homem e suas circunstâncias proposto por Freud imbrica de forma indissociável o psicológico e o social, a ontogênese e a filogênese, com uma potência que teve impacto sobre todo o campo das Ciências Humanas. A Psicanálise é um instrumento hermenêutico para colaborar na elucidação dos fenômenos sociais. A autora utiliza imagens construídas por Freud e Walter Benjamin e poemas de Carlos Drummond de Andrade para fortalecer o entendimento do hífen psicossocial tanto em sua ação multidimensional quanto em sua organização.

  15. Sobre o Classicismo de Goethe (Caracter

    Directory of Open Access Journals (Sweden)

    Júlio César Mioto

    2009-10-01

    Full Text Available Este artigo mostra certo descompasso entre as orientações positivas da estética de Goethe, como aparecem nos seus Escritos sobre arte, e a realização efetiva de sua obra artística, tomando o caso exemplar de Ifigênia em Táuris. Tal ocorre, conforme sustentamos, por uma exigência interna à obra, que de algum modo já era compreendida por sua estética anterior. Pelo tratamento do problema clássico do “caracter”, veremos como se realiza sua concepção do procedimento maneira. Também como se dá uma superação em relação às prescrições clássicas por meio de uma particular resolução do drama.

  16. Construcciones en yeso proyectado sobre vegetales

    Directory of Open Access Journals (Sweden)

    Martínez, Hubert

    1986-07-01

    Full Text Available A construction method developed in early 1981 in Senegal, whose main objective is the evaluation of natural and human sources, specially those of wild vegetables and the phosphogypsum (a waste of chemical industry in Senegal. The introduction of the mechanical projection allows a noticeably growth in work performances and an improvement of the quality. The projection reduces de number of trades intervening in the work, doing away with plasters, watertightness systems and paintings, and simplifying the setting of technical installations and of carpentry. The acquisition of this projecting material is not very expensive, so, it is easy for small and medium enterprises to reach an expertness in gypsum work. Its finantial rentability is assured for a prize of the gypsum of 180% of the prize of the cement.Procedimiento de construcción desarrollado al comienzo de 1981 en el Senegal, teniendo como objetivo la valoración de las fuentes naturales y humanas, especialmente los vegetales en estado silvestre y el fosfoyeso, residuo de la industria química del Senegal. La introducción de la proyección mecánica permite aumentar sensiblemente el rendimiento del trabajo y mejorar la calidad. La proyección reduce el número de oficios que intervienen en la obra por la supresión de enlucidos, sistemas de estanquidad y pinturas sobre la gruesa obra y simplifica la colocación de las instalaciones técnicas y de carpintería. La adquisición del material de proyección, necesitando un capital relativamente modesto, se encuentra al alcance de pequeñas y medianas empresas que deseen especializarse en los trabajos de yeso. La rentabilidad financiera del procedimiento está asegurada para un precio del yeso de hasta el 180% del precio del cemento.

  17. Sobre el estado evolutivo de β Pictoris

    Science.gov (United States)

    Brunini, A.; Benvenuto, O. G.

    Desde el descubrimiento de fuertes excesos infrarrojos en β Pictoris, esta estrella ha sido muy estudiada y es considerada candidata a poseer un sistema planetario propio. β Pic está rodeada de un disco asimétrico de polvo que se observa de canto y que esta vacío a distancias <= 40 AU. Esto se considera una fuerte evidencia en favor de la presencia de (al menos) un planeta gigante. Recientemente se han observado líneas de material circunestelar que se han interpretado como consecuencia de la caída de objetos cometarios sobre esta estrella. Recientemente se ha utilizado la existencia del disco de polvo para atribuir una edad corta (pre - secuencia principal) a βPic. Sin embargo, la evaporación de estos cometas provee suficiente polvo como para explicar la presencia del disco observado sin necesidad de edades cortas. En este trabajo mostramos que la comparación entre la tasa de impactos cometarios estimada en el Sistema Solar para diferentes etapas de su evolución y los datos observados en β Pic indica edades avanzadas para β Pic. Esta estimación debe tomarse con cautela ya que depende de la estructura de los sistemas planetarios. Además mostramos que, desde el punto de vista de la evolución estelar y con las incertezas presentes en la luminosidad y la temperatura efectiva, existe un continuo de edades posible para β Pic. Sin embargo, empleando los datos provenientes de los flujos cometarios encontramos que una edad prolongada es consistente con ambos tratamientos.

  18. Caminando sobre huevos: Una reflexión construccionista sobre la investigación

    Directory of Open Access Journals (Sweden)

    Mary Jane Spink

    2006-05-01

    Full Text Available ¿Cuál es la noción de acción que guía a la investigación construccionista? Tomando esta pregunta como base, se recurre a una investigación realizada para evaluar el papel de la Comisión Nacional de SIDA (CNAIDS del Ministerio de Salud de Brasil como punto de partida para formular un concepto de acción compatible con la postura construccionista. Se comienza problematizando la noción clásica de acción, pasando a continuación a proponer alternativas, explorando las implicaciones de nociones tales como la de en-acción, discutida por Varela, para la investigación construccionista. La investigación sobre la CNAIDS se usa como ejemplo de las maneras posibles de conducir la investigación-intervención. La expresión investigación-intervención se usa en este artículo como estrategia discursiva para enfatizar que toda investigación tiene consecuencias, siendo necesariamente un proceso de producción de sentidos sobre los actos de nuestras vidas.

  19. PROTOCOLO DE KYOTO: DEBATE SOBRE AMBIENTE Y DESARROLLO EN LAS DISCUSIONES SOBRE CAMBIO CLIMÁTICO

    Directory of Open Access Journals (Sweden)

    Rodríguez S. Liliana

    2008-07-01

    Full Text Available El comportamiento climático del planeta y sus consecuencias han propiciado debates sobre los modelos de desarrollo de los países responsables del deterioro acelerado del ambiente y de los fenómenos naturales por estos días recurrentes. Sin embargo, países como Estados Unidos, luego de firmar compromisos como la Convención sobre Cambio Climático, rehúsan adquirir las obligaciones del Protocolo de Kyoto, por temor a sufrir deterioro en sus economías. En este escenario, donde la nación responsable de la emisión de aproximadamente 36% de los gases efecto invernadero resultado de la acción humana en el planeta no se compromete a adoptar políticas restrictivas tendientes a hacer sus modelos de producción más amigables con la naturaleza a pesar de que dichas medidas empiezan a ser impuestas a otras naciones como condicionantes en las negociaciones comerciales internacionales, parece ser que la adopción del Protocolo de Kyoto para países en desarrollo como Colombia no es del todo benéfica.

  20. Estudos sobre a Esquistosomose em Pernambuco, Brasil

    Directory of Open Access Journals (Sweden)

    Aggeu Magalhães

    1940-01-01

    Full Text Available Os autores referem os resultados dos estudos sobre esquistosomose realisados, em Pernambuco, de Novembro de 1938 a Dezembro de 1939. Não se extendem em discussão, nem comentarios, tampouco, relacionam suas verificações com o que já foi relatado sobre o assunto em trabalhos nacionais e estrangeiros, pelo fato de que, não se trata de um resultado definitivo e sim de atividades que irão proseguir. Os estudos sistematicos em torno da endemia esquistosomica foram executados em duas localidades diversas pela população e pela situação geografica e ecologica. Pontezinha é uma povoação de 1200 habitantes localizada proximo a um conjunto de charcos e lagõas de agua dôce onde pululam caramujos do tipo olivaceus de Spix, e apresenta uma taxa de infestação de 21,4% para individuos do sexo masculino, e de 14,7% para os do sexo feminino. A distribuição por grupos de idade mostra que a incidencia cresce até o grupo de 16 a 20 anos de idade, quando atinge a percentagem de 37,8%, para decrescer em seguida. Em Vitoria a incidencia foi maior nos indivíduos do sexo feminino, atingindo a taxa de 41,4%, dando o sexo masculino a taxa de 36,9%. Por idade a percentagem maxima é atingida pelo grupo de 11 a 15 anos. Vitoria é uma cidade de 1500 habitantes, construida á margem do rio Tapacurá, onde se encontram numerosos caramujos do tipo centimetralis Lutz. A divergencia de incidencia corre por conta dos habitos da população e pela utilização que ela faz do rio, sendo maior em Vitoria porque a proximidade do rio facilita o uso de suas aguas para banho e serviços domesticos, condicionando este ultimo fato, a maior infestação das mulheres. O estudo da frequencia da infestação dos caramujos por cercarias de diversos trematodios, permite suspeitar uma relação inversa entre a taxa de infestação e o diametro maximo atingido pelos caramujos, parecendo este fato confirmar os trabalhos de Vianna Martins sobre a identidade dos hospedeiros

  1. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  2. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  3. Elements of EAF automation processes

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Our article presents elements of Electric Arc Furnace (EAF) automation. So, we present and analyze detailed two automation schemes: the scheme of electrical EAF automation system; the scheme of thermic EAF automation system. The application results of these scheme of automation consists in: the sensitive reduction of specific consummation of electrical energy of Electric Arc Furnace, increasing the productivity of Electric Arc Furnace, increase the quality of the developed steel, increasing the durability of the building elements of Electric Arc Furnace.

  4. [Unusual elements in renal calculi].

    Science.gov (United States)

    Rodríguez-Miñón Cifuentes, J L; Salvador, E; Traba Villameytide, M L

    2006-01-01

    A group of 54 renal calculi were spontaneously passed renal stone after a nephritic colic. Two groups of calculi were found: papillary and non-papillary calculi. All calculi were analyzed by infrared spectroscopy and electronic microscopy scan (EMS) and EDAX. When the stones were analyzed with EDAX, elements such as C, N, O, Na, S, Mg, Al, Si, Cl, K, Ca, Mn, Fe, Ni, Zn were detected. The possible origin of these elements is discussed in this work.

  5. Nuclear chemistry of transactinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Nagame, Yuichiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-07-01

    The current status on the nuclear chemistry studies of transactinide elements is reviewed. The production of transactinides in heavy ion reactions is briefly discussed, and nuclear properties on the stability of transactinides are presented. Chemical properties of the trans-actinide elements 104, 105 and 106, and a typical experimental technique used to study these properties on an atom-at-a-time base are introduced. (author)

  6. Naturaleza, religión y cultura tradicional: Un ensayo sobre el pensamiento rústico

    Directory of Open Access Journals (Sweden)

    Calavia Sáez, Óscar

    1997-06-01

    Full Text Available This study focuses on the natural elements in the religious lore of La Rioja, in northern Spain: mainly trees, bulls and bees in myth and ritual. It stresses their sociological and cosmological meanings: patterns of kinship, marriage and group identity, ideas about gender, body and ultimately «nature». Furthermore, it this study proposes on implicit «rustic mind», contemporary wilt but apart from Christian taught (not a mere survival of the past and discusses the role of this «mind» in the history of Spanish Catholicism.Los elementos naturales presentes en el folklore religioso de La Rioja, en el norte de España, árboles, toros y abejas, en primer plano, son analizados en este estudio en sus componentes sociológicos (las ideas que reflejan sobre consanguinidad, alianza e identidad de grupo y organizados en una sucinta cosmología, que incluye nociones sobre el cuerpo, los géneros y la propia «naturaleza». Se explora la virtualidad de un «pensamiento rústico», diferente del cristianismo pero contemporáneo suyo (no una mera supervivencia del pasado y el lugar que ocupa en la historia del catolicismo español.

  7. El puente de Brotonne sobre el Sena - Francia

    Directory of Open Access Journals (Sweden)

    Campenon, -

    1978-12-01

    Full Text Available This bridge solves the connection problem between Rouen and Le Havre. The need to preserve the maritime tradition of Rouen and to permit the heavy shipping traffic through the estuary forced a structural design which main part, 696.5 m long, consists of a 5-span triss-braced bridge. The central span, 320 m long, is the longest pre-stressed concrete span in the world. The structure also includes two access ramps. This article analyses the features and construction procedures of each element in the structure, namely: — Foundations, consisting on cylindrical piers for the main spans and piers on piles for the access ramps and viaducts. — The curved octagonal piles, creating an interesting aesthetical effect. — The deck consisting on a single monocelular girder, formed by twincore wedged, pieces, prestressed in all directions. — The tower with a constant 2.60 dimension crosswise and tapered from 4.80 to 2.84 meters lengthwise. — Tensors, prestressing, etc.

    Este puente resuelve el problema de comunicación entre Rouen y Le Havre. La necesidad de respetar la tradición marítima de Rouen y la navegación de barcos de gran tonelaje obligó a realizar una estructura cuya obra principal, de una longitud de 696,5 m, es un puente atirantado que tiene cinco tramos, de los cuales el central, de 320 m, constituye el récord del mundo de luz en hormigón pretensado. La estructura comprende, además, dos viaductos de acceso. En este artículo se hace un análisis de las características y procedimientos de construcción de cada uno de los elementos que componen la obra: — Las cimentaciones, que son columnas cilíndricas para las pilas principales, y sobre pilotes en las pilas de los viaductos de acceso. — Las pilas, de forma octogonal curvilínea, que producen un gran efecto estético. — El tablero es una viga monocelular, formada por dovelas de dos almas pretensadas en todas direcciones. — Las torres, cuya sección es

  8. Marginalia: algumas notas adicionais sobre o dom

    Directory of Open Access Journals (Sweden)

    Pierre Bourdieu

    1996-10-01

    Full Text Available Prosseguindo a análise do dom, este artigo busca ultrapassar as visões fenomenológica, estruturalista e economicista do fenômeno. Para tanto, desloca o eixo de interrogação na direção do tempo e da incerteza ligados ao intervalo entre o dom e o contradom, do agente e da ação ligados às práticas, da economia de bens simbólicos e o habitus específico que a funda. Demonstrase assim, contra todo reducionismo (à consciência, ao cálculo inconsciente ou ao cálculo propriamente dito, que a razão do dom só pode repousar sobre sua dupla verdade, seu caráter generoso e obrigatório. Por outro lado, demonstrase também que foi somente através de uma revolução simbólica, e não o desenvolvimento de uma suposta natureza humana, que uma economia da troca pôde, historicamente, se destacar da economia do dom, cuja possibilidade continua aberta, dependendo apenas dos investimentos coletivos que sejam efetuados em sua direção.Resuming an analysis of the gift, this article seeks to go beyond the phenomenological, structuralist, and economicist view of this phenomenon. It thereby shifts the trust of questioning towards the time and uncertainty linked with the interval between the gift and the counter-gift, the agent and the action linked to such practices, the economy of symbolic goods, and the specific habitus underlying it. It thus demonstrates against any and all reductionism (to consciousness, to unconcious calculation, and to calculation per se that the gift's reason can only lie in its double truth, its generous and obligatory nature, both disinterested and interested. The author also demonstrates historically that it is only through a symbolic revolution, and not the development of a supposed human nature, that an economy of exchange can stand out from the economy of the gift, whose possibility remains open, requiring collective investments in its direction.

  9. As vicissitudes do "ensaio sobre o dom"

    Directory of Open Access Journals (Sweden)

    Lygia Sigaud

    1999-10-01

    Full Text Available A partir dos anos 60, antropólogos de diferentes tradições nacionais passaram a convergir no sentido de considerar que o texto de Marcel Mauss, "Ensaio sobre o Dom", contivesse uma teoria da troca, que atribui à identificação entre a coisa dada e o espírito do doador o princípio de explicação das transações. Esta interpretação contrasta com a que tiveram os contemporâneos de Mauss, os quais resgataram do trabalho suas dimensões relativas ao direito, às obrigações e às prestações totais. Partindo desta constatação, o artigo problematiza o destino do ensaio e busca torná-lo inteligível. Para tanto examina as condições sociointelectuais que contribuíram para que se produzisse a inflexão na leitura e a consolidação de uma espécie de crença coletiva em relação ao trabalho. Através deste estudo de caso, a autora identifica mecanismos que operam no processo de construção de teorias, na conformação de representações acerca de textos e na sua consagração no âmbito da antropologia.From the 1960s, anthropologists of different national traditions came to share the view that Marcel Mauss’s text, "Essay on the Gift," contained a theory of exchange which takes the identification between the thing given and the spirit of the donor as the explanatory principle of transactions. This interpretation contrasts with that held by Mauss’s contemporaries, who lifted from the work aspects relating to law, obligations and total prestations. Starting from this fact, the article problematizes the essay’s fate and seeks to make it intelligible. To this end, it examines the socio-intellectual conditions which contributed to producing this inflection in the readings of the work and the consolidation of a kind of collective belief concerning it. Through this case study, the author identifies mechanisms which operate in the process of constructing theories, in the conformity found in representations of certain texts, and in the

  10. Sobre la investigación en arquitectura y urbanismo. IV Jornadas Internacionales sobre Investigación en Arquitectura y Urbanismo.

    OpenAIRE

    Torres Cueco, Jorge

    2012-01-01

    Presentación inaugural de las IV Jornadas Internacionales sobre Investigación en Arquitectura y Urbanismo, a cargo del director de las jornadas, Sr. Jorge Torres Cueco. Torres Cueco, J. (2012). Sobre la investigación en arquitectura y urbanismo. IV Jornadas Internacionales sobre Investigación en Arquitectura y Urbanismo. 4IAU 4ª Jornadas Internacionales sobre Investigación en Arquitectura y Urbanismo. http://hdl.handle.net/10251/15033.

  11. Reflexiones sobre la anorexia Reflexões sobre a anorexia Reflections about anorexy

    Directory of Open Access Journals (Sweden)

    Andrea Ferrero

    2009-03-01

    Full Text Available El propósito de este artículo es presentar algunas reflexiones sobre el trastorno anoréxico, algunas posibles explicaciones sobre el mismo, y proponer una respuesta posible desde la perspectiva psicoanalítica. Este estudio plantea el sufrimiento del sujeto como la manifestación de una relación inconsciente entre las ecuaciones afectivas y el entramado social de la persona. Se discute la particular relación que se establece entre la necesidad, la demanda y el deseo en este tipo de trastornos, y cómo el síntoma anoréxico se plantea como estrategia enferma de defensa del deseo. Se puede considerar el impacto que la presión de la cultura tiene en la manutención del síntoma anoréxico, dada la importancia del ideal de delgadez y belleza, también asociados con la obtención de mayor éxito y felicidad. Finalmente, se plantea el valor del análisis de la personalidad en relación a aspectos sociales para la consideración del trastorno anoréxico, el cual debe ser comprendido singularmente, más allá de sus manifestaciones y de la posible limitación a la estructura de la histeria.O objetivo deste artigo é apresentar algumas reflexões sobre o processo de adoecimento da anorexia e algumas possíveis explicações sobre esse processo, bem como propor uma possível resposta a partir da perspectiva psicanalítica. Este estudo estabelece o sofrimento do sujeito como a manifestação da relação inconsciente entre as equações afetivas e a trama social da pessoa. Procura-se discutir a peculiar relação entre necessidade, demanda e desejo neste tipo de transtorno, e como a anorexia é uma estratégia patológica de defesa do desejo. Pôde-se observar a influência da pressão da cultura na manutenção da anorexia, justificada pelo ideal de magreza e de beleza, que também são associadas com a possibilidade de obter maior êxito e felicidade. Por último, considera-se o valor da análise da personalidade em relação aos aspectos sociais

  12. Nota sobre Marcel Mauss e o ensaio sobre a dádiva

    Directory of Open Access Journals (Sweden)

    Lanna Marcos

    2000-01-01

    Full Text Available Este artigo analisa a obra clássica de M. Mauss, Ensaio sobre a dádiva, à luz de desenvolvimentos recentes da Antropologia. Salienta como contribuição de Mauss o entendimento da dimensão política da troca de dádivas, assim como a sugestão de sua universalidade, posteriormente demonstrada por Lévi-Strauss, constituir-se em princípio formal-abstrato, e não num fato empírico-concreto. A partir desse princípio, avalia a tese segundo a qual a dádiva é fundamento de toda sociabilidade e comunicação humanas, assim como sua presença e sua diferente institucionalização em várias sociedades analisadas por Mauss, capitalistas e não-capitalistas.

  13. Uma Nota Sobre Efeitos de Gastos Públicos Federais Sobre o Crescimento da Economia Brasileira

    Directory of Open Access Journals (Sweden)

    Soraia Santos da Silva

    2014-12-01

    Full Text Available O artigo tem o objetivo de analisar os efeitos dos gastos governamentais sobre o produto da economia brasileira ao longo do período de 1980 a 2005, identificando a contribuição de algumas categorias de gastos públicos sobre o crescimento do produto no Brasil. Para isso, foram investigadas as séries dos componentes das despesas públicas federais, em particular, tanto por grupo como por função. Os procedimentos metodológicos usados basearam-se nos testes de Dickey-Fuller Aumentado (DFA e Phillips e Perron (PP, teste de Causalidade de Granger e o método de Cointegração de Engle e Granger e Johansen. Os resultados dos testes de raiz unitária mostraram que as séries estudadas de produto e despesas públicas são I(1. A maioria dos pares de variáveis mostrou causalidade no sentido de Granger fluindo dos componentes dos gastos públicos para o produto. As exceções ficaram por conta dos gastos com defesa e segurança nacional e educação. Da mesma forma, esses tipos de despesas não se mostraram estatisticamente significantes nas estimações. Entretanto, comunicação, saúde e saneamento, energia e recursos minerais e transporte foram as categorias de gastos públicos que mostraram relevância empírica na composição das despesas públicas. As evidências mostram que essas despesas podem ser consideradas como gastos produtivos. Para uma dada quantidade de fatores privados, melhores estradas, portos, ferrovias, comunicação, saúde e saneamento implicam uma maior produtividade desses fatores e, consequentemente, elevando o produto final.

  14. Physical model of Nernst element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Hiroaki [Venture Business Lab., Nagoya Univ., Nagoya (Japan); Ikeda, Kazuaki; Yamaguchi, Satarou

    1998-08-01

    Generation of electric power by the Nernst effect is a new application of a semiconductor. A key point of this proposal is to find materials with a high thermomagnetic figure-of-merit, which are called Nernst elements. In order to find candidates of the Nernst element, a physical model to describe its transport phenomena is needed. As the first model, we began with a parabolic two-band model in classical statistics. According to this model, we selected InSb as candidates of the Nernst element and measured their transport coefficients in magnetic fields up to 4 Tesla within a temperature region from 270 K to 330 K. In this region, we calculated transport coefficients numerically by our physical model. For InSb, experimental data are coincident with theoretical values in strong magnetic field. (author)

  15. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity...... vector in the transport equation, the system is coupled by the dependency of the fluid viscosity on the solute concentration and by a concentration-dependent boundary condition for the Navier-Stokes equations at the membrane surface. The spectral element discretization yields a nonlinear algebraic system....... The performance of the spectral element code when applied to several ultrafiltration problems is reported. (C) 1998 Elsevier Science Ltd. All rights reserved....

  16. Element-Based Computational Model

    Directory of Open Access Journals (Sweden)

    Conrad Mueller

    2012-02-01

    Full Text Available A variation on the data-flow model is proposed to use for developing parallel architectures. While the model is a data driven model it has significant differences to the data-flow model. The proposed model has an evaluation cycleof processing elements (encapsulated data that is similar to the instruction cycle of the von Neumann model. The elements contain the information required to process them. The model is inherently parallel. An emulation of the model has been implemented. The objective of this paper is to motivate support for taking the research further. Using matrix multiplication as a case study, the element/data-flow based model is compared with the instruction-based model. This is done using complexity analysis followed by empirical testing to verify this analysis. The positive results are given as motivation for the research to be taken to the next stage - that is, implementing the model using FPGAs.

  17. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  18. SUPERCONVERGENCE ANALYSIS FOR CUBIC TRIANGULAR ELEMENT OF THE FINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Qi-ding Zhu

    2000-01-01

    In this paper, we construct a projection interpolation for cubic triangular ele- ment by using othogonal expansion triangular method. We show two fundamental formulas of estimation on a special partion and obtain a superconvergence result of 1 -e order higher for the placement function and its tangential derivative on the third order Lobatto points and Gauss points on each edge of triangular element.

  19. Comentarios sobre la Ley de Ordenamiento Territorial Sostenible

    Directory of Open Access Journals (Sweden)

    Arturo J. Yglesias

    2014-04-01

    Full Text Available La denominada Ley de Ordenamiento Territorial Sostenible, no fue bien recibida en el medio jurídico. Tanto los profesores de las diferentes materias de Derecho de nuestra Facultad como las asociaciones profesionales y otros grupos e juristas de nuestro medio, formularon reservas de diverso calibre sobre el texto de la ley que van desde sus aspectos adjetivos como la terminología y redacción hasta cuestiones sustanciales como lo que ella dice sobre el régimen de la propiedad territorial y otras cuestiones vinculadas.Desde el discurso político vimos lanzar opiniones iracundas y alarmistas sobre las modificaciones que la ley estaría haciendo al régimen de la propiedad privada, sobre su supuesta inconstitucionalidad.Nosotros nos vamos a referir a la ley a sus antecedentes y de las críticas que se le hacían, en la parte que toca a nuestra materia, esto es en lo relativo al régimen de la propiedad y debemos decir, a vía de adelanto, que no vemos en ella nada que afecte el derecho de propiedad consagrado por la Constitución de la República, ni los principios generales que regulan la propiedad territorial conforme al Código Civil, conforme a la vieja ley de Centros Poblados, sus modificativas ni demás normas sobre la materia.

  20. Transposable elements and circular DNAs

    KAUST Repository

    Mourier, Tobias

    2016-09-26

    Circular DNAs are extra-chromosomal fragments that become circularized by genomic recombination events. We have recently shown that yeast LTR elements generate circular DNAs through recombination events between their flanking long terminal repeats (LTRs). Similarly, circular DNAs can be generated by recombination between LTRs residing at different genomic loci, in which case the circular DNA will contain the intervening sequence. In yeast, this can result in gene copy number variations when circles contain genes and origins of replication. Here, I speculate on the potential and implications of circular DNAs generated through recombination between human transposable elements.

  1. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  2. Organic chemistry of elemental phosphorus

    Energy Technology Data Exchange (ETDEWEB)

    Milyukov, V A; Budnikova, Yulia H; Sinyashin, Oleg G [A.E. Arbuzov Institute of Organic and Physical Chemistry, Kazan Scientific Centre of the Russian Academy of Sciences, Kazan (Russian Federation)

    2005-09-30

    The principal achievements and the modern trends in the development of the chemistry of elemental phosphorus are analysed, described systematically and generalised. The possibilities and advantages of the preparation of organophosphorus compounds directly from white phosphorus are demonstrated. Attention is focused on the activation and transformation of elemental phosphorus in the coordination sphere of transition metal complexes. The mechanisms of the reactions of white phosphorus with nucleophilic and electrophilic reagents are discussed. Electrochemical approaches to the synthesis of organic phosphorus derivatives based on white phosphorus are considered.

  3. FINITE ELEMENT ANALYSIS OF STRUCTURES

    Directory of Open Access Journals (Sweden)

    PECINGINA OLIMPIA-MIOARA

    2015-05-01

    Full Text Available The application of finite element method is analytical when solutions can not be applied for deeper study analyzes static, dynamic or other types of requirements in different points of the structures .In practice it is necessary to know the behavior of the structure or certain parts components of the machine under the influence of certain factors static and dynamic . The application of finite element in the optimization of components leads to economic growth , to increase reliability and durability organs studied, thus the machine itself.

  4. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  5. Fractal elements and their applications

    CERN Document Server

    Gil’mutdinov, Anis Kharisovich; El-Khazali, Reyad

    2017-01-01

    This book describes a new type of passive electronic components, called fractal elements, from a theoretical and practical point of view. The authors discuss in detail the physical implementation and design of fractal devices for application in fractional-order signal processing and systems. The concepts of fractals and fractal signals are explained, as well as the fundamentals of fractional calculus. Several implementations of fractional impedances are discussed, along with comparison of their performance characteristics. Details of design, schematics, fundamental techniques and implementation of RC-based fractal elements are provided. .

  6. A high temperature fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Sekido, A.; Nakai, M.; Ninomiya, Y.

    1982-12-21

    A solid electrolyte which conducts electricity with heating by oxygen ions and operates at a temperature of 1,000C is used in the element. The cathode, besides the ionic conductivity in oxygen, has an electron conductivity. The anode has electron conductivity. Substances such as Bi203, into which oxides of alkaline earth metals are added, are used for making the cathode. The electrolyte consists of ZrO2 and Y2O3, to which CaO is added. WC, to which an H2 type fuel is fed, serves as the anode. The element has a long service life.

  7. A 3D pyramid spline element

    Institute of Scientific and Technical Information of China (English)

    Juan Chen; Chong-Jun Li; Wan-Ji Chen

    2011-01-01

    In this paper,a 13-node pyramid spline element is derived by using the tetrahedron volume coordinates and the B-net method,which achieves the second order completeness in Cartesian coordinates.Some appropriate examples were employed to evaluate the performance of the proposed element.The numerical results show that the spline element has much better performance compared with the isoparametric serendipity element Q20 and its degenerate pyramid element P13 especially when mesh is distorted,and it is comparable to the Lagrange element Q27.It has been demonstrated that the spline finite element method is an efficient tool for developing high accuracy elements.

  8. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  9. Um ensaio etnofotográfico sobre o envelhecimento

    Directory of Open Access Journals (Sweden)

    Wilson José Alves Pedro

    2016-01-01

    Full Text Available O presente artigo propõe uma síntese reflexiva – imagética e textual sobre o tema processos de envelhecimento. Trata-se de um ensaio etnofográfico, a partir de registros do diário de campo, realizados em Portugal. A partir de um enquadre teórico sociológico propõe uma reflexão sobre a complexidade da apreensão dos processos de envelhecimento, enquanto fenômeno-objeto de estudo e seus determinantes. Aponta-se a necessidade de saberes interdisciplinares e procedimentos plurimetodológicos no âmbito dos estudos gerontológicos para compreender e agir sobre as multideterminações deste processo.

  10. Efeitos dos choques fiscais sobre o mercado de trabalho brasileiro

    Directory of Open Access Journals (Sweden)

    Diogo Baerlocher Carvalho

    2013-06-01

    Full Text Available Esse trabalho tem por objetivo entender quais os efeitos dos choques fiscais sobre o mercado de trabalho brasileiro. Em particular, utiliza se uma abordagem SVAR para avaliar esses efeitos sobre o emprego e o salário real. Os choques fiscais são identificados a partir da imposição de restrições de sinais puras sobre a relação dinâmica entre os gastos do governo, o produto real e a oferta de trabalho. As restrições são obtidas a partir de funções de resposta a impulso Bayesianas derivadas de um modelo DSGE na tradição da Nova Síntese Neoclássica. As funções de resposta a impulso obtidas a partir da abordagem SVAR mostram que choques fiscais aumentam o salário real e o emprego.

  11. Los imaginarios tradicionales sobre el oriente ecuatoriano

    Directory of Open Access Journals (Sweden)

    Esvertit Cobes, Natàlia

    2001-12-01

    Full Text Available This paper analizes several elements present in the traditionals imaginaries related to the Ecuadorian Oriente, according to the analysis of historygraphical, geographycal and advertising sources of the nineteenth century and early twenthy century. The result of this work is a contribution for the reinterpretation of the Ecuadorian Oriente history, which priorizes the point of view of the symbolic function played in the history of Ecuador by this region.

    En este trabajo se analizan algunos elementos presentes en los imaginarios tradicionales relativos al Oriente ecuatoriano, en base al análisis de fuentes historiográficas, geográficas y propagandísticas del siglo XIX y de la primera parte del XX. El resultado supone una aportación para la reinterpretación de la historia del Oriente ecuatoriano, en la que se prioriza la perspectiva de la función simbólica desempeñada por esta región en la historia del Ecuador.

  12. On Gothic Elements in Beloved

    Institute of Scientific and Technical Information of China (English)

    任欢

    2016-01-01

    Toni Morrison,a well-known female writer,won Nobel Prize for literature in 1993.Beloved,her fifth novel,wins great popu-larity among readers and it is famous for adopting gothic genre to represent black people’s trauma and deal with it.This paper aims at analy-zing the gothic elements demonstrated in this novel.

  13. Gothic Elements in Folding Beijing

    Institute of Scientific and Technical Information of China (English)

    Hua Yan

    2016-01-01

    The study claims that Folding Beijing can not only be read as science fiction but also as Gothic literature,in which perspective,Gothic Elements such as Gothic Setting, Gothic Wanderer and Transgressions,and Gothic Terror are discussed respectively.

  14. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  15. Trace elements: implications for nursing.

    Science.gov (United States)

    Hayter, J

    1980-01-01

    Although most were unknown a few years ago, present evidence indicates that at least 25 trace elements have some pertinence to health. Unlike vitamins, they cannot be synthesized. Some trace elements are now considered important only because of their harmful effects but traces of them may be essential. Zinc is especially important during puberty, pregnancy and menopause and is related to protein metabolism. Both fluoride and cadmium accumulate in the body year after year. Cadmium is positively correlated with several chronic diseases, especially hypertension. It is obtained from smoking and drinking soft water. Silicon, generally associated with silicosis, may be necessary for healthy bone and connective tissue. Chromium, believed to be the glucose tolerance factor, is obtained from brewer's yeast, spices, and whole wheat products. Copper deficiency may be implicated in a wide range of cardiovascular and blood related disorders. Either marginal deficiencies or slight excesses of most trace elements are harmful. Nurses should instruct patients to avoid highly refined foods, fad diets, or synthetic and fabricated foods. A well balanced and varied diet is the best safeguard against trace element excesses or deficiencies.

  16. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  17. Evidence for primordial superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Gentry, R.V.; Cahill, T.A.; Fletcher, N.R.; Kaufmann, H.C.; Medsker, L.R.; Nelson, J.W.; Flocchini, R.G.

    1976-07-05

    Microscopic crystalline monazite inclusions showing giant halo formation in biotite mica have been analyzed by the method of proton-induced x-ray emission. The observed x-ray energy spectra are best explained by the presence of a number of superheavy elements. (AIP)

  18. Presidential elements in government: introduction

    NARCIS (Netherlands)

    Reestman, J.H.

    2006-01-01

    The editorial board of the European Constitutional Law Review has solicited a number of contributions on presidential elements in government systems in Europe. At the origin of the project are some recent sweeping interventions of heads of state in the political arena. These are notably the (suspens

  19. Naturalistic Elements in Sister Carrie

    Institute of Scientific and Technical Information of China (English)

    刘艳晖

    2007-01-01

    @@ Theodore Dreiser is considered to be a controversial writer.His first novel.Sister Carrie makes a new way of presenting re-ality.This paper discusses the naturalistic elements from the de-tailed description of the environment in that society.

  20. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  1. Actinomycete integrative and conjugative elements

    NARCIS (Netherlands)

    Poele, Evelien M. te; Bolhuis, Henk; Dijkhuizen, Lubbert

    2008-01-01

    This paper reviews current knowledge on actinomycete integrative and conjugative elements (AICEs). The best characterised AICEs, pSAM2 of Streptomyces ambofaciens (10.9 kb), SLP1 (17.3 kb) of Streptomyces coelicolor and pMEA300 of Amycolatopsis methanolica (13.3 kb), are present as integrative eleme

  2. Sentidos y subjetividades detrás del discurso: reflexiones sobre las narrativas del exilio producidas en entrevistas orales

    Directory of Open Access Journals (Sweden)

    Franco, Marina

    2007-06-01

    Full Text Available This piece present some thoughts that have emerged from the work carried out with real testimonies from Argentine political emigrants. It is based on the analysis of some of the discursive variations used by the interviewees, their silences, that which they “forget”, their manner of structuring their memories and all those non-linguistic elements that characterised their communication with the interviewer. There is a special interest in reflecting on how these discursive elements are also a source that can generate meanings on the problem of exile. The analysis of these issues allows us to approach the complexity of the problems that have appeared in recent Argentinean history and the sense overload that encapsulates the concept and identity of the “exiled”.

    Este trabajo presenta algunas reflexiones surgidas del trabajo con testimonios orales de antiguos emigrados políticos argentinos. Se analizan algunas variantes discursivas utilizadas por ellos, sus silencios y “olvidos”, las formas de estructuración del relato y aquellos elementos no lingu..sticos que caracterizan el encuentro con el entrevistador. Nos interesa reflexionar sobre cómo esos elementos discursivos son una fuente productora de sentidos sobre el tema del exilio, cómo ciertos problemas de la historia reciente argentina atraviesan esa experiencia y observar la sobrecarga de sentidos que se tensan en el concepto e identidad de “exiliado”.

  3. SOBRE LA DEFINICIÓN DE LA LEY MORAL

    OpenAIRE

    2013-01-01

    Presentamos al lector de lengua castellana una traducción del texto "Sulla definizione della legge morale", del filósofo trentino Antonio Rosmini. Se trata de una respuesta elaborada por el autor para dar cuenta de las observaciones que vertiera sobre su teoría moral el jesuita Luigi Dmowski. Este último, en su libro Institutiones philosophiae arremete contra el filósofo de Trento y su tesis de que la ley moral es una noción de la mente, con cuyo uso se realiza un juicio sobre la moralidad de...

  4. Colonialismo e nacionalismo nos escritos de Marx sobre a Irlanda

    OpenAIRE

    Rafael Afonso da Silva

    2013-01-01

    Esta pesquisa tem como objeto a reflexão de Marx sobre o tema do colonialismo conduzido por países capitalistas ou, mais concretamente, pelo país capitalista que dominava o maior império colonial à época, a Inglaterra. De modo ainda mais específico, a pesquisa concentra-se nos escritos de Marx sobre a Irlanda. Esses escritos são examinados contra o pano de fundo de um conjunto mais amplo de escritos de Marx em torno do impacto do colonialismo britânico, expondo as contínuas reavaliações e rev...

  5. La socioepistemología. Un estudio sobre su racionalidad

    OpenAIRE

    Cantoral,Ricardo; López, José Iván

    2006-01-01

    Con esta investigación se pretende atender la siguiente cuestión: ¿cuál es la racionalidad que subyace a una explicación científica que se apoya en la idea de práctica?, se aborda esta pregunta haciendo una comparación con la estructura de otras teorías, que se considera tienen una cierta estabilidad. Esto nos permitió hacer inferencias sobre la racionalidad de la Socioepistemología y desde luego pretende ser también una reflexión de fondo sobre lo que significa hacer ciencia desde esta aprox...

  6. Monografía sobre los determinantes sociales de salud

    OpenAIRE

    Domínguez Santamaría, Mónica

    2012-01-01

    Las desigualdades en salud es uno de los problemas de salud que más preocupa a los responsables de Salud Pública. Las desigualdades sociales en salud han aumentado en los últimos años. Y es previsible que con la crisis económica actual el problema se agudice. El propósito de este trabajo es hacer una revisión bibliográfica sobre los documentos más importantes en los últimos cinco años sobre determinantes sociales de salud, que son las circunstancias en que las personas viven, condicionadas po...

  7. Pregnancias : sobre cuatro lavis de Colette Deblé

    OpenAIRE

    Derrida, Jacques

    2007-01-01

    ¿Cómo citar la representación del cuerpo femenino en la Historia del Arte occidental dejándose impregnar por los patrones y modelos pictóricos masculinos pero imprimiendo, a su vez, otras huellas, las de otro cuerpo? Esta pregunta atraviesa el texto del filósofo Jacques Derrida sobre las aguadas (lavis) de la pintora francesa Colette Deblé, dando lugar a una reflexión sobre el engendramiento, el parto y la cita pictórica. En el trabajo de Colette Deblé, el legado de la Historia del Arte y su ...

  8. Apuntes sobre la noción de afectividad colectiva

    OpenAIRE

    2010-01-01

    El presente texto, que se suscribe en el paradigma de la psicología social crítica, trata la temática de la afectividad colectiva, revisando en un primer momento las nociones clásicas en psicología sobre los afectos como proceso individual para, posteriormente, esbozar la premisa sobre la afectividad como una construcción social y colectiva, noción revisada desde los planteamientos de Pablo Fernández Christlieb, quien alude a la función cultural que cumplen los afectos en el plano de la vida ...

  9. Concepciones implícitas sobre el desarrollo infantil

    OpenAIRE

    Vilar Martínez, C.; Blasco Cubedo, María Jesús; Hernández Blasi, Carlos

    2001-01-01

    Setenes Jornades de Foment de la Investigació de la FCHS (Any 2001-2002) Partiendo del trabajo de Martí, E. et al. (1994) “ Ideas previas de una población universitaria sobre el desarrollo infantil” hemos realizado un estudio descriptivo para identificar las concepciones implícitas del conocimiento que tienen estudiantes universitarios sobre el desarrollo infantil. La muestra estaba constituida por 111 estudiantes de la Universitat Jaume I, con una media de edad de 19 años. Median...

  10. Santa sexualidad: concepciones de dos monjas sobre feminidad y sexualidad

    OpenAIRE

    Isabel Cristina Giraldo Quijano

    2009-01-01

    En el contexto de la religión católica, la feminidad y la sexualidad femenina se configuran según dogmas y representaciones sociales específicos, en los que la imagen de Cristo -y todo lo que ello implica- actúa como elemento fundamental en la construcción de las concepciones de las mujeres consagradas a la vida religiosa sobre sex ualidad, erotismo, cuerpo. amor. Este artículo pretende explorar desde un punto de vista sociológico las concepciones de dos monjas sobre los temas mencionados....

  11. Efectos del consumo moderado de cerveza sobre la salud cardiovascular

    OpenAIRE

    Sendino Sedano, Pablo José

    2015-01-01

    La cerveza es una bebida fermentada elaborada a partir de cebada malteada. Entre sus componentes se encuentran el etanol (excepto en la cerveza sin alcohol) y los polifenoles, ambos con numerosos efectos sobre la salud humana, y en especial sobre la salud cardiovascular. Así mismo la práctica de ejercicio de forma regular es un hábito saludable. El sistema cardiovascular tiene numerosas funciones muy importantes en el organismo, y también mucha patología relacionada. Uno de los cuadros clínic...

  12. A sangre y fuego: Nuevos datos sobre la metalurgia Aguada

    OpenAIRE

    2002-01-01

    Las placas de metal figuran entre los ítemes más característicos de la cultura material de Aguada. Se conocen poco más de 30 ejemplares, los cuales se encuentran dispersos en colecciones de América y Europa y muy pocos de ellos fueron sometidos a análisis técnicos. En esta oportunidad se dan a conocer los resultados de los estudios realizados sobre tres placas Aguada, orientados a obtener información sobre las cualidades tecnológicas de los materiales, aplicable al conocimiento de la dinámica...

  13. EL IMPUESTO SOBRE BEBIDAS AZUCARADAS EN ESPAÑA

    OpenAIRE

    Vicente Ortún; López-Valcárcel, Beatriz G; Jaime Pinilla

    2016-01-01

    Este artículo aporta una revisión crítica acerca de los retos a los que se enfrentan los impuestos sobre las bebidas azucaradas como instrumento de políticas de salud, para revertir la tendencia epidémica de la obesidad. Se valoran las experiencias de los países más significados, en particular México, y se reflexiona sobre el contrapeso que ejerce la industria a las políticas antiobesidad y el poder de los lobbies. Esas políticas impositivas en pro de la salud pública han de sobreponerse a la...

  14. Nuevos documentos sobre Rojas Zorrilla y su teatro

    Directory of Open Access Journals (Sweden)

    Madroñal, Abraham

    2007-06-01

    Full Text Available This article contains twelve unpublished documents on Rojas Zorrilla, related to his biography and literary works (comedias and autos sacramentales. The majority are handwritten by the poet himself, and they provide new information relevant to our knowledge of his life and to the understanding of his works.Se publican una docena de documentos inéditos sobre Rojas Zorrilla referidos a su biografía y a algunas comedias y autos. En buena parte dichos documentos son autógrafos del poeta y añaden o matizan informaciones concretas sobre él y sus obras.

  15. EL PENSAMIENTO SOCIAL SOBRE EL SUICIDIO EN ESTUDIANTES DE BACHILLERATO

    OpenAIRE

    Gabriel Montes Sosa; Francisco Montes Villegas

    2009-01-01

    En este estudio se analiza desde el marco de las representaciones sociales cómo los jóvenes preparatorianos manifiestan su pensamiento social sobre el suicidio. Se aplicaron cuestionarios abiertos a 169 jóvenes, mujeres y varones de bachillerato, para conocer la ocurrencia potencial de suicidio, las situaciones a las que se debe y su definición. Los resultados muestran que los jóvenes organizan su idea sobre el suicidio a partir de varios elementos en común: problemas diversos, depresión, baj...

  16. Santa sexualidad: concepciones de dos monjas sobre feminidad y sexualidad

    Directory of Open Access Journals (Sweden)

    Isabel Cristina Giraldo Quijano

    2009-12-01

    Full Text Available En el contexto de la religión católica, la feminidad y la sexualidad femenina se configuran según dogmas y representaciones sociales específicos, en los que la imagen de Cristo -y todo lo que ello implica- actúa como elemento fundamental en la construcción de las concepciones de las mujeres consagradas a la vida religiosa sobre sex ualidad, erotismo, cuerpo. amor. Este artículo pretende explorar desde un punto de vista sociológico las concepciones de dos monjas sobre los temas mencionados.

  17. Optimización sistólica sobre GPUs

    OpenAIRE

    Vidal, Pablo; Alba Torres, Enrique; Luna, Francisco

    2012-01-01

    En este trabajo se estudia una nueva aproximación algorítmica basada en un modelo de procesamiento paralelo conocido como computación sistólica. Este algoritmo se ejecuta sobre una Unidad de Procesamiento Gráfico empelando CUDA (Compute Unified Device Architecture). El algoritmo se compone de una matriz de celdas, donde cada una de ellas trabaja sobre una solución, realizando operaciones que la modifican para luego moverla a la celda contigua y repetir el proceso. Hemos evaluado el comportami...

  18. Concurrencia de titulares sobre la creación intelectual

    OpenAIRE

    Navarro Costa, Ruth

    1994-01-01

    El contenido de la tesis presentada bajo el titulo "Concurrencia de titulares sobre la creación intelectual" comprende un estudio pormenorizado de las obras debidas a un sujeto plurimo. Así, los capítulos i, ii y iii tratan respectivamente de las obras en colaboración, colectivas y derivadas como supuestos mas emblemáticos de cotitularidad sobre la obra del ingenio. Finalmente, en el capitulo iv se abordan algunos supuestos heterogéneos que pueden dar lugar a situaciones de concurrencia entre...

  19. Datos sobre la vida sexual en dos ciudades colombianas

    OpenAIRE

    2012-01-01

    Uno de los temas más difíciles de investigar científicamente es el referente a la vida sexual, principalmente por la dificultad de obtener datos precisos y verídicos sobre la conducta de los individuos. Este es un tema que se trata vagamente ó solo a través de la consulta médica ó el chiste. Resulta difícil preguntar a la gente sobre su conducta sexual y más difícil aun obtener una respuesta verdadera y clara. Este informe, aunque breve, ha logrado en parte eludir estos escollos. En primer lu...

  20. Superheavy-element spectroscopy: Correlations along element 115 decay chains

    Directory of Open Access Journals (Sweden)

    Rudolph D.

    2016-01-01

    Full Text Available Following a brief summary of the region of the heaviest atomic nuclei yet created in the laboratory, data on more than hundred α-decay chains associated with the production of element 115 are combined to investigate time and energy correlations along the observed decay chains. Several of these are analysed using a new method for statistical assessments of lifetimes in sets of decay chains.

  1. An improved optimal elemental method for updating finite element models

    Institute of Scientific and Technical Information of China (English)

    Duan Zhongdong(段忠东); Spencer B.F.; Yan Guirong(闫桂荣); Ou Jinping(欧进萍)

    2004-01-01

    The optimal matrix method and optimal elemental method used to update finite element models may not provide accurate results. This situation occurs when the test modal model is incomplete, as is often the case in practice. An improved optimal elemental method is presented that defines a new objective function, and as a byproduct, circumvents the need for mass normalized modal shapes, which are also not readily available in practice. To solve the group of nonlinear equations created by the improved optimal method, the Lagrange multiplier method and Matlab function fmincon are employed. To deal with actual complex structures,the float-encoding genetic algorithm (FGA) is introduced to enhance the capability of the improved method. Two examples, a 7-degree of freedom (DOF) mass-spring system and a 53-DOF planar frame, respectively, are updated using the improved method.Thc example results demonstrate the advantages of the improved method over existing optimal methods, and show that the genetic algorithm is an effective way to update the models used for actual complex structures.

  2. Low cost, lightweight fuel cell elements

    Science.gov (United States)

    Kindler, Andrew (Inventor)

    2001-01-01

    New fuel cell elements for use in liquid feed fuel cells are provided. The elements including biplates and endplates are low in cost, light in weight, and allow high efficiency operation. Electrically conductive elements are also a part of the fuel cell elements.

  3. The Transuranium Elements - Present Status: Nobel Lecture

    Science.gov (United States)

    Seaborg, G. T.

    1951-12-12

    The discovery of the transuranium elements and the work done on them up to the present time are reviewed. The properties of these elements, their relationship to other elements, their place in the periodic table, and the possibility of production and identification of other transuranium elements are discussed briefly.

  4. Controversia sobre el origen del anime. Una nueva perspectiva sobre el primer dibujo animado japonés

    OpenAIRE

    2012-01-01

    Recientes descubrimientos sobre los orígenes de la animación japonesa muestran indicios consistentes de que la primera animación nipona en formato cinematográfico data de la década de 1900, lo que puede llegar a cuestionar algunos aspectos fundamentales que sustentan la historia de la animación tradicional. En este artículo se realiza un análisis de la documentación existente sobre las primeras animaciones japonesas, demostrando que este peculiar estilo de animación tuvo en realidad un origen...

  5. Construcciones sociales sobre mujeres desde el discurso jurídico en sentencias penales sobre infanticidio

    Directory of Open Access Journals (Sweden)

    María Eugenia Gastiazoro

    2015-12-01

    Full Text Available El infanticidio como figura penal se suprime del Código Penal Argentino en 1994, para ser una figura de homicidio agravado por el vínculo con prisión o reclusión perpetua. Diez años después de su última derogación, el caso Romina Tejerina en Jujuy generó una serie de cuestionamientos respecto de su penalización. Otro caso, que tomó estado público fue el de Eli Díaz en la ciudad de Villa Dolores en Córdoba, juzgada en el 2006, siendo (en contraposición al caso Tejerina absuelta por una mayoría compuesta solo de ciudadanos comunes (jurados. En el presente trabajo se analiza la construcción y la producción que desde el discurso jurídico se hace de las diferentes mujeres en los casos de infanticidio. A su vez, estas imágenes se comparan con las representaciones que los legisladores tuvieron en el debate del Congreso del año 2010 cuando se intentó reponer la figura. La sujeción del género centrada en la buena o mala madre, mujer, esposa, en intersección con otras dimensiones de clase social, y edad, se categoriza en el discurso de los tribunales de acuerdo a imaginarios sociales que sostienen una identidad normativa sobre estas mujeres.

  6. SOBRE LA PAZ Y LOS DIÁLOGOS. CONSIDERACIONES SOBRE EL PAPEL DE LA SOCIEDAD CIVIL

    Directory of Open Access Journals (Sweden)

    William Ortiz Jiménez

    2014-10-01

    Full Text Available El ensayo hace una reflexión en torno al proceso de paz que se llevó a cabo en el gobierno del presidente Andrés Pastrana, y la participación que tuvo la sociedad civil en este asunto. Pero, trasciende, además, a la situación actual del conflicto en Colombia. A partir de las formulaciones de varios teóricos, entre los que se destacan Daniel Pécaut, Cohen, y Arato., Margarita Bonamusa, María Teresa Uribe, Daniel García-Peña, Habermas, Rawls, entre otros, se fortalece un marco teórico y de referencia bastante sólido para mostrar cómo lo público es indispensable en las acotaciones que lleven a la solución de los conflictos. Sin el concurso de lo público, tampoco sería viable la participación de la sociedad civil. Los espacios de solución de conflictos, el ágora, en palabras de Hanna Arendt, es el lugar esencial para la discusión, el consenso y los acuerdos. En política, la esfera de lo público prima sobre lo privado, porque el reconocimiento de las libertades, manifestaciones y la plenitud de los derechos sólo se logra en lugares comunes.

  7. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  8. Selective Smoothed Finite Element Method

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper examines three selective schemes for the smoothed finite element method (SFEM) which was formulated by incorporating a cell-wise strain smoothing operation into the standard compatible finite element method (FEM). These selective SFEM schemes were formulated based on three selective integration FEM schemes with similar properties found between the number of smoothing cells in the SFEM and the number of Gaussian integration points in the FEM. Both scheme 1 and scheme 2 are free of nearly incompressible locking, but scheme 2 is more general and gives better results than scheme 1. In addition, scheme 2 can be applied to anisotropic and nonlinear situations, while scheme 1 can only be applied to isotropic and linear situations. Scheme 3 is free of shear locking. This scheme can be applied to plate and shell problems. Results of the numerical study show that the selective SFEM schemes give more accurate results than the FEM schemes.

  9. Surface energies of elemental crystals

    Science.gov (United States)

    Tran, Richard; Xu, Zihan; Radhakrishnan, Balachandran; Winston, Donald; Sun, Wenhao; Persson, Kristin A.; Ong, Shyue Ping

    2016-09-01

    The surface energy is a fundamental property of the different facets of a crystal that is crucial to the understanding of various phenomena like surface segregation, roughening, catalytic activity, and the crystal’s equilibrium shape. Such surface phenomena are especially important at the nanoscale, where the large surface area to volume ratios lead to properties that are significantly different from the bulk. In this work, we present the largest database of calculated surface energies for elemental crystals to date. This database contains the surface energies of more than 100 polymorphs of about 70 elements, up to a maximum Miller index of two and three for non-cubic and cubic crystals, respectively. Well-known reconstruction schemes are also accounted for. The database is systematically improvable and has been rigorously validated against previous experimental and computational data where available. We will describe the methodology used in constructing the database, and how it can be accessed for further studies and design of materials.

  10. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  11. ADAPTIVE ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Yang Ruiliang; Wang Hongzhen

    2004-01-01

    It is shown that the basis of the ellipsoidal acoustic infinite element Burnett method,the multipole expansion,cannot represent real ellipsoidal acoustic field exactly.To solve the problem,a weight of angular direction is added to the multipole expansion.The comparison of the modified method and the prime method shows that the modified method can describe and solve the ellipsoidal acoustic field more accurately than ever.A dilating sphere is used to test the new method further.Unlike other infinite element methods,varied ratio of the ellipsoidal artificial boundary instead of sphere is used.The pressure value of the artificial boundary is utilized as the initial value of the new method.Then the radiating phenomena of the ellipsoidal acoustic field can be researched using the new method.These examples show the feasibility of the adaptive method.

  12. DOLFIN: Automated Finite Element Computing

    CERN Document Server

    Logg, Anders; 10.1145/1731022.1731030

    2011-01-01

    We describe here a library aimed at automating the solution of partial differential equations using the finite element method. By employing novel techniques for automated code generation, the library combines a high level of expressiveness with efficient computation. Finite element variational forms may be expressed in near mathematical notation, from which low-level code is automatically generated, compiled and seamlessly integrated with efficient implementations of computational meshes and high-performance linear algebra. Easy-to-use object-oriented interfaces to the library are provided in the form of a C++ library and a Python module. This paper discusses the mathematical abstractions and methods used in the design of the library and its implementation. A number of examples are presented to demonstrate the use of the library in application code.

  13. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  14. LOG PERIODIC DIPOLE ARRAY WITH PARASITIC ELEMENTS

    Science.gov (United States)

    The design and measured characteristics of dipole and monopole versions of a log periodic array with parasitic elements are discussed. In a dipole...array with parasitic elements, these elements are used in place of every alternate dipole, thereby eliminating the need of a twisted feed arrangement...for the elements to obtain log periodic performance of the anntenna. This design with parasitic elements lends itself to a monopole version of the

  15. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  16. Origin of the Chemical Elements

    CERN Document Server

    Rauscher, T

    2010-01-01

    This review provides the necessary background from astrophysics, nuclear, and particle physics to understand the cosmic origin of the chemical elements. It reflects the year 2009 state of the art in this extremely quickly developing interdisciplinary research direction. The discussion summarizes the nucleosynthetic processes in the course of the evolution of the Universe and the galaxies contained within, including primordial nucleosynthesis, stellar evolution, and explosive nucleosynthesis in single and binary systems.

  17. Conrad's Skeptical Elements in Nostromo

    Institute of Scientific and Technical Information of China (English)

    何旭

    2016-01-01

    The Paper analyze the skeptical elements in Nostromo through mostly the analysis of the values held by different char-acter and their respective destiny. Conrad expresses his skepticism towards material interest through the character of Charles Gould, who firmly believes that material interests alone can bring order and peace to the country. But his success is temporary. Eventually success of his silver mine not only intensifies political conflicts but also brings him disillusionment and loneliness.

  18. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  19. Pensamiento escolástico actual sobre el evolucionismo

    Directory of Open Access Journals (Sweden)

    Jorge Enrique Leal G.

    1962-07-01

    A este propósito nos ha parecido no solo conveniente, sino quizá útil, ensayar un recuento así sea somero y sintético, sobre las ideas que en la actualidad abriga la escuela escolástica en sus principales matices.

  20. Aspectos sobre el matrimonio en el Derecho Romano arcaico

    OpenAIRE

    Fern??ndez Baquero, Mar??a-Eva

    2004-01-01

    El libro "El Derecho de Familia: De Roma al Derecho actual" donde se encuentra recogido este cap??tulo "Aspectos sobre el matrimonio en el Derecho Romano arcaico" (p??gs. 193-207) tiene un total de 853 p??ginas.

  1. Sobre-educación en el mercado laboral colombiano

    Directory of Open Access Journals (Sweden)

    Jhon James Mora

    2008-12-01

    Full Text Available Este artículo analiza la sobre-educación en Colombia con datos de individuos y empresas compilados por el Servicio Nacional de Aprendizaje de Colombia en 2006, encuentra que la probabilidad de estar sobre-educado es del 14% y que depende de la movilidad entre áreas de desempeño, la experiencia, el género, el tamaño de la empresa y el nivel de educación. Los trabajadores sobre-educados ganan un 2% menos que los trabajadores correctamente educados, conforme al patrón internacional. Los resultados también muestran que la probabilidad de que los profesionales permanezcan en la misma área de desempeño aumenta con la experiencia, que cuanto mayor es la sobre-educación menor es la probabilidad de permanecer en dicha área y que los trabajadores con postgrado tienen menor probabilidad de permanecer en su área de desempeño.

  2. Sobre o estilo e o modo de falar e escrever

    Directory of Open Access Journals (Sweden)

    Pedro Caruso

    2001-02-01

    Full Text Available

    Este trabalho apresenta o texto crítico de uma Lei ou Provisão de Filipe I , rei de Portugal, sobre as diversas formas de tratamento no período arcaico da língua portuguesa.

  3. Indagación sobre la visión

    OpenAIRE

    Solbes Matarredona, Jordi

    2011-01-01

    Indagación sobre la luz y la visión usando objetos de la vida cotidiana: camara oscura y su fabricación con tubos de cartón, espejos planos, concavos y convexos (cucharas pulidas), lentes convergentes y divergentes, funcionamiento del ojo, etc.

  4. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  5. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  6. PubMed Medline 3: Elements de cerca i límits. Gener 2011

    OpenAIRE

    2011-01-01

    Tutorial sobre els elements de cerca i límits a la base de dades PubMed Medline,produïda per la National Library of Medicine. Conté articles de revistes relacionats amb la literatura biomèdica, la investigació i la pràctica clínica. La base de dades Medline conté les subbases: AIDS (abans Aidsline), Bioethics (abans Bioethicsline), Cancer (abans Cancerlit), Complementary Medicine, Core Clinical Journals, Dental Journals, History of Medicine, Nursing Journals, PubMed Central, OldMedline for Pr...

  7. The efficiency at industrial scale of a thermodynamic model for desulphurization of aluminium killed steels using slags in the system CaO-MgO-Al2O3-SiO2.

    Directory of Open Access Journals (Sweden)

    Butnariu, I.

    2010-02-01

    Full Text Available In this paper are presented the results of some desulphurization trials in the ladle carried out at industrial scale for steels with low carbon, low alloyed and aluminum killed, using basic slag and argon bubbling. The main variables of treatment have been established on the basis of a thermodynamic model that includes parameters as sulphur capacity of the slag, optical basicity of oxides and of the slags, the activities of oxides in the slags and activities of elements in the liquid steel. Sulphur contents at the end of treatment, are close to the values predicted by the model. Low sulfur levels achieved in the process, facilitate the subsequent treatment with calcium to modify the inclusions. Finally an evaluation is presented concerning the effects resulting from the reoxidation of the melt on the main indicators, showing the efficiency of the applied treatment for desulphurization.En este trabajo se presentan los resultados de algunos ensayos de desulfuración en cuchara, llevados a cabo a escala industrial, para aceros con bajo contenido en carbono, de baja aleación y calmados con aluminio, utilizando escorias basicás y corriente de argón. Las principales variables del tratamiento se han establecido sobre la base de un modelo termodinámico que incluye parámetros como la capacitad de captación de azufre por las escorias, la basicidad óptica de los óxidos y de las escorias , las actividades de los óxidos en las escorias y las actividades de los elementos en el acero liquido. Los contenidos de azufre al final de tratamiento están cerca de los valores predichos por el modelo. Los bajos niveles de azufre alcanzados en el proceso, facilitan el posterior tratamiento con calcio para modificar las inclusiones. Se presenta, finalmente, una evaluación de los efectos derivados de la reoxidación del fundido sobre los principales indicadores que muestran la eficiencia del tratamiento de desulfuración aplicado.

  8. Percepções sobre o Programa Bolsa Família na sociedade brasileira

    Directory of Open Access Journals (Sweden)

    Henrique Carlos de Oliveira de Castro

    2009-11-01

    Full Text Available O artigo trata de percepções da sociedade brasileira sobre o Programa Bolsa Família (PBF a partir de uma pesquisa realizada em amostra da população. A pesquisa indicou que a população reconhece o Programa e entende que ele está sendo utilizado de forma adequada, mesmo considerando problemas em sua execução. Houve uma importante diferença entre a opinião daqueles que conhecem beneficiários em relação àqueles que não conhecem, sendo que os primeiros se manifestaram de forma mais positiva em relação aos resultados e mais cautelosos em relação às críticas, conclui que o PBF adquiriu legitimidade junto à sociedade brasileira dado o nível de conhecimento da política e mesmo de apoio à sua existência e argumenta sobre a importância de buscar e considerar a opinião da sociedade como importante elemento de avaliação de políticas públicas.The paper is about perceptions of Brazilian society concerning the cash transfer program Bolsa Família of Brazilian government obtained in a national survey. It indicated that population recognizes the program and understands that it is being used in an appropriated way, even though considering problems in its execution. Important differences occurred in the opinion of those who knew beneficiaries comparing with those who didn't. The first group manifested positive opinion and criticized less then the second. The paper concludes that the program acquired legitimacy in the Brazilian society, considering the knowledge of this policy and supporting its existence. It argues for the importance of searching and considering the public opinion as a fundamental element of public policy assessing.

  9. Finite element analysis of elasto-plastic plate bending problems using transition rectangular plate elements

    Institute of Scientific and Technical Information of China (English)

    Bahattin Kanber; O.Yavuz Bozkurt

    2006-01-01

    In this work,the finite element analysis of the elasto-plastic plate bending problems is carried out using transition rectangular plate elements.The shape functions of the transition plate elements are derived based on a practical rule.The transition plate elements are all quadrilateral and can be used to obtain efficient finite element models using minimum number of elements.The mesh convergence rates of the models including the transition elements are compared with the regular element models.To verify the developed elements,simple tests are demonstrated and various elasto-plastic problems are solved.Their results are compared with ANSYS results.

  10. "Meu prazer agora é risco": sentidos sobre sexualidade entre jovens de um grupo sobre saúde

    Directory of Open Access Journals (Sweden)

    João Paulo Pereira Barros

    2013-04-01

    Full Text Available A sexualidade assumiu a condição de centralidade subjetiva pelo entrecruzamento de diversos demarcadores da Modernidade, como a legitimação do saber-verdade da ciência, a afirmação da individualidade e a institucionalização dos segmentos infanto-juvenis. Partindo dessa premissa, este artigo analisa sentidos produzidos por jovens sobre "sexualidade" em um grupo de discussão sobre saúde, com base em uma pesquisa-intervenção operacionalizada por observações-participantes e pela formação de oficinas sobre saúde, em uma escola pública de Fortaleza. Acerca dos sentidos sobre "sexualidade", as articulações entre "sexualidade" e "risco" se sobressaíram em relação às conexões entre "sexualidade" e "prazer". Isso sugere a força de um viés educativo baseado na scientia sexualis, aludido por Michael Foucault, operando com uma visão normativa-prescritiva da sexualidade, reiterando-a, mediante o signo da "prevenção", como tecnologia de governo. Usando como ferramenta o conceito de biopolítica, aponta-se que tais questões remetem à instalação de um paradigma de "gestão do risco" na contemporaneidade.

  11. Narrativas sobre síndrome de Down no Festival Internacional de Filmes sobre Deficiência Assim Vivemos

    Directory of Open Access Journals (Sweden)

    Ana Cristina Bohrer Gilbert

    Full Text Available O Festival Internacional de Filmes sobre Deficiência Assim Vivemos acontece bienalmente no Brasil desde 2003. Busca engajar a audiência em novas perspectivas sobre deficiência por meio de filmes, atividades interativas, imagens e discursos institucionais. Neste artigo, analisam-se os filmes cujo tema central é a síndrome de Down, exibidos entre 2003 e 2013, com o objetivo de examinar o tipo de construção narrativa e as imagens e os significados sobre pessoas com essa condição que são veiculados no festival. Foram utilizadas estratégias etnográficas no tratamento do material empírico e procedimentos semióticos de leitura isotópica na sua análise. Foram identificados três núcleos narrativos principais que acompanham o desenvolvimento teórico sobre deficiência, sendo que um deles apresenta-se alinhado com o que tem sido denominado de ‘estética da deficiência’.

  12. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    卢文科; 朱长纯; 刘君华; 刘清洪

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  13. Evaluación de acciones explosivas sobre estructuras de hormigón armado mediante elementos finitos

    Directory of Open Access Journals (Sweden)

    Bermejo, M.

    2015-09-01

    Full Text Available Explosive phenomena on concrete structures have catastrophic effects in many instances despite its reduced occurrence. The civil buildings are usually not designed to withstand this type of dynamic load, so a methodology to analyze the structural response on blast loads is recommended. This paper studies the behavior of reinforced concrete frame structures against these actions by lagrangian finite elements method with explicit time integration. Finite element models of segregated concrete and rebar are used to make possible the study of structure parts as columns and slabs, but is not possible to use these detailed models in complete structures because of excessive computational costs. Shell and beam elements models properly calibrated are needed to obtain a similar response. Conclusions and practical recommendations are provided for the use and calibration of models and realistic simulations.El fenómeno de explosión sobre estructuras de hormigón tiene efectos en muchos casos catastróficos a pesar de su reducida frecuencia. Las edificaciones civiles no suelen estar diseñadas para resistir este tipo de solicitación dinámica, por lo que conviene disponer de una metodología que permita analizar los efectos de las explosiones sobre las mismas. Este trabajo estudia el comportamiento de las estructuras reticuladas de hormigón armado frente a estas acciones, mediante métodos numéricos de elementos finitos lagrangianos con integración explícita en el tiempo. Se analizan de forma realista partes de la estructura como columnas y forjados usando modelos con hormigón y armaduras de forma segregada, pero las limitaciones computacionales los hacen inviables para estructuras completas. Se proponen modelos de elementos lámina y viga debidamente calibrados para obtener una respuesta similar. Se obtienen conclusiones para el uso y calibración de modelos y simulaciones realistas de edificios completos para estudios de seguridad.

  14. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    Inci eAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  15. Elemental composition of Malawian rice.

    Science.gov (United States)

    Joy, Edward J M; Louise Ander, E; Broadley, Martin R; Young, Scott D; Chilimba, Allan D C; Hamilton, Elliott M; Watts, Michael J

    2016-07-20

    Widespread potential dietary deficiencies of calcium (Ca), iron (Fe), iodine (I), selenium (Se) and zinc (Zn) have been identified in Malawi. Several deficiencies are likely to be compounded by high phytic acid (PA) consumption. Rice (Oryza sativa) is commonly consumed in some Malawian populations, and its mineral micronutrient content is important for food security. The considerable irrigation requirements and flooded conditions of paddy soils can also introduce or mobilise potentially toxic elements including arsenic (As), cadmium (Cd) and lead (Pb). The aim of this study was to determine the mineral composition of rice sampled from farmers' fields and markets in Malawi. Rice was sampled from 18 extension planning areas across Malawi with 21 white (i.e. polished) and 33 brown samples collected. Elemental composition was determined by inductively coupled plasma-mass spectrometry (ICP-MS). Arsenic speciation was performed using high-performance liquid chromatography (HPLC)-ICP-MS. Concentration of PA was determined using a PA-total phosphorus assay. Median total concentrations (mg kg(-1), dry weight) of elements important for human nutrition in brown and white rice, respectively, were: Ca = 66.5 and 37.8; Cu = 3.65 and 2.49; Fe = 22.1 and 7.2; I = 0.006 and Biofortification strategies could significantly increase Se and Zn concentrations and require further investigation. Concentrations of Fe in rice grain varied greatly, and this was likely due to contamination of rice samples with soil. Risk of As, Cd or Pb toxicity due to rice consumption in Malawi appears to be minimal.

  16. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  17. ACCURACY ANALYSIS FOR QUASI-CAREY ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Dongyang SHI; Xiaobin HAO

    2008-01-01

    In this paper, a new triangular element (Quasi-Carey element) is constructed by the idea of Specht element. It is shown that this Quasi-Carey element possesses a very special property, i.e.,the consistency error is of order O(h2), one order higher than its interpolation error when the exact solution belongs to Ha(Ω). However, the interpolation error and consistency error of Carey element are of order O(h). It seems that the above special property has never been seen for other triangular elements for the second order problems.

  18. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  19. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  20. Nuclear reactor fuel element. Kernreaktorbrennelement

    Energy Technology Data Exchange (ETDEWEB)

    Lippert, H.J.

    1985-03-28

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank.

  1. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  2. Elements of a Spatial Web

    DEFF Research Database (Denmark)

    Jensen, Christian S.

    2010-01-01

    community is hard at work inventing means of efficiently supporting new spatial query functionality. Points of interest with a web presence, called spatial web objects, have a location as well as a textual description. Spatio-textual queries return such objects that are near a location argument...... and are relevant to a text argument. An important element in enabling such queries is to be able to rank spatial web objects. Another is to be able to determine the relevance of an object to a query. Yet another is to enable the efficient processing of such queries. The talk covers recent results on spatial web...

  3. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-er/land use information), demographic information. The report is accom-pagnied with a spatial database for the regional case of forest recreation in Northern Zealand, Denmark. The spatial database contains forest polygons; forest attribute; estimation of total annual number of visits per site; and es...

  4. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  5. New alternating direction procedures in finite element analysis based upon EBE approximate factorizations. [element-by-element

    Science.gov (United States)

    Hughes, T. J. R.; Winget, J.; Levit, I.; Tezduyar, T. E.

    1983-01-01

    Element-by-element approximate factorization procedures are proposed for solving the large finite element equation systems which arise in computational mechanics. A variety of techniques are compared on problems of structural mechanics, heat conduction and fluid mechanics. The results obtained suggest considerable potential for the methods described.

  6. Analysis of composite structural elements

    Directory of Open Access Journals (Sweden)

    A. Baier

    2010-12-01

    Full Text Available Purpose: The themes of the study are composite structural components. For this purpose have been designed and built several research positions.Design/methodology/approach: Using different structural materials to build new device components requires multiple tests of the components. Research posts were designed in the advanced graphical program CAx Siemens NX 7.5. Analysed samples were made from the glass fibre, aramid and carbon of various weights. Due to the specific use of composite materials it focuses on the elements in the form of plates and flat bars. For the examination of experimental strain gauge technique was used bead, the force sensor and displacement sensor. The experimental methods were compared with computer simulation using the FEM.Findings: The aim of this study was to determine the basic material constants and a comparison of the experimental method and the method of computer simulation.Research limitations/implications: Change the number of layers and how to connect the laminate with the steel plate changes mechanical properties of the structural component.Practical implications: The ultimate result will be knowledge on the different forms of laminates, such as material properties, the stresses in all layers, strain and comparing the results obtained by two methods.Originality/value: The expected outcome of the study will be the composition and method of joining composite laminate with a steel plate to the possible application in the repair and construction of structural elements of freight wagons.

  7. Light element opacities from ATOMIC

    Science.gov (United States)

    Colgan, J.; Kilcrease, D. P.; Magee, N. H.; Armstrong, G. S. J.; Abdallah, J.; Sherrill, M. E.; Fontes, C. J.; Zhang, H. L.; Hakel, P.

    2013-06-01

    We present new calculations of local-thermodynamic-equilibrium (LTE) light element opacities from the Los Alamos ATOMIC code. ATOMIC is a multi-purpose code that can generate LTE or non-LTE quantities of interest at various levels of approximation. A program of work is currently underway to compute new LTE opacity data for all elements H through Zn. New opacity tables for H through Ne are complete, and a new Fe opacity table will be available soon. Our calculations, which include fine-structure detail, represent a systematic improvement over previous Los Alamos opacity calculations using the LEDCOP legacy code. Our opacity calculations incorporate atomic structure data computed from the CATS code, which is based on Cowan's atomic structure codes, and photoionization cross section data computed from the Los Alamos ionization code GIPPER. We make use of a new equation-of-state (EOS) model based on the chemical picture. ATOMIC incorporates some physics packages from LEDCOP and also includes additional physical processes, such as improved free-free cross sections and additional scattering mechanisms. In this report, we briefly discuss the physics improvements included in our new opacity calculations and present comparisons of our new opacities with other work for C, O, and Fe at selected conditions.

  8. METHODOLOGICAL ELEMENTS OF SITUATIONAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Tetyana KOVALCHUK

    2016-07-01

    Full Text Available The article deals with the investigation of theoretical and methodological principles of situational analysis. The necessity of situational analysis is proved in modern conditions. The notion “situational analysis” is determined. We have concluded that situational analysis is a continuous system study which purpose is to identify dangerous situation signs, to evaluate comprehensively such signs influenced by a system of objective and subjective factors, to search for motivated targeted actions used to eliminate adverse effects of the exposure of the system to the situation now and in the future and to develop the managerial actions needed to bring the system back to norm. It is developed a methodological approach to the situational analysis, its goal is substantiated, proved the expediency of diagnostic, evaluative and searching functions in the process of situational analysis. The basic methodological elements of the situational analysis are grounded. The substantiation of the principal methodological elements of system analysis will enable the analyst to develop adaptive methods able to take into account the peculiar features of a unique object which is a situation that has emerged in a complex system, to diagnose such situation and subject it to system and in-depth analysis, to identify risks opportunities, to make timely management decisions as required by a particular period.

  9. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  10. Centros de informação sobre medicamentos no Brasil : passado, presente e perspectivas do Sistema Brasileiro de Informação sobre Medicamentos

    OpenAIRE

    Carlos Cezar Flores Vidotti

    1999-01-01

    Resumo: Introdução. Após discussão dos diferentes fatores que justificam aexistência de Centros de Informação sobre Medicamentos (CIM), foram apresentadas as definições de informação sobre medicamentos (IM)e de centro de informação sobre medicamentos (CIM), e relacionadas às atividades usuais dos centros, tendo a informação passiva como atividade fundamental. O farmacêutico especialista em informação sobre medicamentos é o profissional com perfil mais adequado para atuar nos CIM, devendo ser ...

  11. Recovery of trans-plutonium elements; Recuperation des elements transplutoniens

    Energy Technology Data Exchange (ETDEWEB)

    Espie, J.Y.; Poncet, B.; Simon, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1970-07-01

    The object of this work is to study the recovery of americium and curium from the fission-product solution obtained from the processing of irradiated fuel elements made of natural metallic uranium alloyed with aluminium, iron and silicon; these elements have been subjected to an average irradiation of 4000 MW days/ton in a gas-graphite type reactor having a thermal power of 3.7 MW/ton of uranium. The process used consists of 3 extraction cycles and one americium-curium separation: - 1) extraction cycle in 40 per cent TBP: extraction of actinides and lanthanides; elimination of fission products; - 2) extraction cycle in 8 per cent D2EHPA: decontamination from the fission products, decontamination of actinides from lanthanides; - 3) extraction cycle in 40 per cent TBP: separation of the complexing agent and concentration of the actinides; - 4) americium-curium separation by precipitation. (authors) [French] Cette etude a pour objet, la recuperation de l'americium et du curium de la solution de produits de fission provenant du traitement de combustibles irradies a base d'uranium naturel metallique allie a l'aluminium, le fer, et le silicium, et ayant subi une irradiation moyenne de 4000 MWj/t dans une pile du type graphite-gaz, dont la puissance thermique est de 3.7 MW/t d'uranium. Le procede utilise comprend 3 cycles d'extraction et une separation americium-curium: - 1. cycle d'extraction dans le TBP a 40 pour cent: extraction des actinides et des lanthanides, elimination des produits de fission; - 2. cycle d'extraction dans le D2EHPA a 8 pour cent: decontamination en produits de fission, decontamination des actinides en lanthanides; - 3. cycle d'extraction dans le TBP a 40 pour cent: separation du complexant et concentration des actinides; - 4. separation americium-curium par precipitation. (auteurs)

  12. Infinite Possibilities for the Finite Element.

    Science.gov (United States)

    Finlayson, Bruce A.

    1981-01-01

    Describes the uses of finite element methods in solving problems of heat transfer, fluid flow, etc. Suggests that engineers should know the general concepts and be able to apply the principles of finite element methods. (Author/WB)

  13. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  14. Finite element differential forms on cubical meshes

    CERN Document Server

    Arnold, Douglas N

    2012-01-01

    We develop a family of finite element spaces of differential forms defined on cubical meshes in any number of dimensions. The family contains elements of all polynomial degrees and all form degrees. In two dimensions, these include the serendipity finite elements and the rectangular BDM elements. In three dimensions they include a recent generalization of the serendipity spaces, and new H(curl) and H(div) finite element spaces. Spaces in the family can be combined to give finite element subcomplexes of the de Rham complex which satisfy the basic hypotheses of the finite element exterior calculus, and hence can be used for stable discretization of a variety of problems. The construction and properties of the spaces are established in a uniform manner using finite element exterior calculus.

  15. Superconvergence for rectangular serendipity finite elements

    Institute of Scientific and Technical Information of China (English)

    CHEN; Chuanmiao(陈传淼)

    2003-01-01

    Based on an orthogonal expansion and orthogonality correction in an element, superconvergenceat symmetric points for any degree rectangular serendipity finite element approximation to second order ellipticproblem is proved, and its behaviour up to the boundary is also discussed.

  16. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per; Andresen, Inger; Perino, Marco;

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno...

  17. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  18. Superheavy Element Research at Tasca at GSI

    Science.gov (United States)

    Düllmann, Christoph E.

    2014-09-01

    Experiments on the synthesis of the heaviest elements are in the center of the current research program on superheavy elements at GSI Darmstadt. At the gas-filled recoil separator TASCA, search experiments for the new elements 119 and 120 have been performed in the reactions 50Ti + 249Bk and 50Ti + 249Cf, respectively, and the production of element 117 in the reaction 48Ca + 249Bk was studied. The experiments were performed successfully and the data are currently under analysis.

  19. Sobre a Pesquisa nas Artes: um discurso amoroso

    Directory of Open Access Journals (Sweden)

    Victoria Pérez Royo

    2015-09-01

    Full Text Available Este artigo resulta de um exercício de reescrita experimental e de um pensamento analógico cujo objetivo era abrir uma nova perspectiva sobre pesquisa nas artes. Metodologicamente, as diferentes figuras de amor no livro Fragmentos de um Discurso Amoroso, de Barthes, são levadas a conversar sobre a relação entre pesquisador e objeto de estudo. Essa analogia nos permite encontrar parâmetros de qualidade baseados em uma escala de valores diferentes dos hegemônicos na academia (produtividade, competitividade, inovação. Esses novos parâmetros podem constituir uma sólida base ontológica para a construção de uma nova política de pesquisa artística na academia que permita uma reconsideração radical dos processos de investigação em artes.

  20. ensayo crítico sobre Oliverio Girondo

    Directory of Open Access Journals (Sweden)

    Luis Felipe González G.

    2005-01-01

    Full Text Available A partir de la aparición, por cerca de diez años, del movimiento surrealista, se hará un esbozo de algunas las características de uno de los representantes de esta escuela literaria, Oliverio Girondo, partiendo de un poema del libro Veinte poemas para ser leídos en el tranvía, del cual se encontraron dos posiciones, en apariencia antagónicas, sobre la vanguardia, derivadas en un antiestilo o decadencia de los principios modernos (Calinescu, 1991 y una posibilidad de crítica a la institución arte (Bürger, 1987. Estas posiciones permitieron establecer algunas reflexiones acerca del concepto de saturación social que postula el construccionismo social y las características generales que propone Mukarovsky (1992 sobre la teoría crítica estructuralista.

  1. MEMORIA EMOCIONAL: EFECTOS DE LA CORTICOSTERONA SOBRE LOS RECUERDOS

    Directory of Open Access Journals (Sweden)

    ELIANA RUETTI

    2008-01-01

    Full Text Available Las hormonas adrenales, administradas inmediatamente antes o después de una tarea de aprendizaje, modulan la memoria. Este efecto varía de acuerdo al tiempo y a la intensidad con que se incrementan las hormonas. La liberación o administración de glucocorticoides inmediatamente antes o después de una tarea, facilitan la memoria. Por el contrario, la elevación o administración de glucocorticoides antes de una prueba de aprendizaje, deteriora la evocación de la información previamente adquirida. En este trabajo se revisan los principales estudios realizados con animales y humanos acerca del papel de los glucocorticoides sobre la memoria de eventos aversivos. A su vez se describe el efecto de la elevación aguda y crónica de las hormonas adrenales sobre la memoria.

  2. Instalación fotovoltaica sobre cubierta de nave industrial

    OpenAIRE

    Ramírez Basalo, Miguel Ángel

    2013-01-01

    El objetivo de este proyecto es el diseño y estudio de la instalación fotovoltaica con conexión a red sobre cubierta en una nave industrial, así como la iluminación interior y exterior de la misma nave. La instalación fotovoltaica sobre cubierta con conexión a red es una de las más demandadas hoy en día, y que puede reportar muchos beneficios y ventajas en el futuro. No es una necesidad real, pero se justificara su elección a través de un estudio técnico y económico, en el q...

  3. Bombeiros: um olhar sobre a qualidade de vida no trabalho

    Directory of Open Access Journals (Sweden)

    Janine Kieling Monteiro

    Full Text Available Este trabalho apresenta uma intervenção no corpo de bombeiros (São Leopoldo - RS realizada pelo NEPT (Núcleo de Excelência em Psicologia do Trabalho. Utilizamos um diagnóstico com sessenta e três entrevistas semi-estruturadas sobre o trabalho e funcionamento da corporação. Partindo da análise deste, propusemos palestras sobre estresse e qualidade de vida no trabalho (QVT. Foram levantados questionamentos acerca do mito do herói e do amor pela profissão bombeiro, que deixa em segundo plano seus problemas. Destacou-se o estresse no trabalho por situações traumáticas, como risco de vida eminente e mortes nos salvamentos. Entendemos que as intervenções contribuíram como espaço de escuta que propiciou reflexões a respeito da QVT.

  4. Planteamientos sobre la pobreza: una aproximación conceptual

    Directory of Open Access Journals (Sweden)

    Bertha Lucía Martínez Bernal

    2015-07-01

    Full Text Available En el presente artículo se presentan varias definiciones o conceptos para la comprensión, medición y el análisis de la pobreza. Para ello se retoma la producción escrita de diferentes estudiosos e investigadores que han hecho aportes valiosos sobre el tema. Al lado de estos conceptos se analizan los diferentes enfoques que se utilizan para aproximarse al estudio de la pobreza, aunque estas no son teorías ni explicaciones de sus causas, sino perspectivas sobre pobreza que denotan dichos enfoques. Así mismo se desarrolla una revisión de las metodologías más utilizadas en los procesos de identificación y agregación. Finalmente se interpretan las políticas públicas en los sectores sociales.

  5. EL PENSAMIENTO SOCIAL SOBRE EL SUICIDIO EN ESTUDIANTES DE BACHILLERATO

    Directory of Open Access Journals (Sweden)

    Gabriel Montes Sosa

    2009-01-01

    Full Text Available En este estudio se analiza desde el marco de las representaciones sociales cómo los jóvenes preparatorianos manifiestan su pensamiento social sobre el suicidio. Se aplicaron cuestionarios abiertos a 169 jóvenes, mujeres y varones de bachillerato, para conocer la ocurrencia potencial de suicidio, las situaciones a las que se debe y su definición. Los resultados muestran que los jóvenes organizan su idea sobre el suicidio a partir de varios elementos en común: problemas diversos, depresión, baja autoestima y comunicación deficiente. Así, el suicidio se objetiviza en estos esquemas y se ancla en sus relaciones existentes. Para contextualizar el estudio, en la primera parte del trabajo los autores incluyen una somera descripción de los datos estadísticos más importantes respecto del suicidio en el estado de Puebla.

  6. Pregnancias. Sobre cuatro lavis de Colette Deblé

    Directory of Open Access Journals (Sweden)

    Jacques Derrida

    2013-07-01

    Full Text Available ¿Cómo citar la representación del cuerpo femenino en la Historia del Arte occidental dejándose impregnar por los patrones y modelos pictóricos masculinos pero imprimiendo, a su vez, otras huellas, las de otro cuerpo? Esta pregunta atraviesa el texto del filósofo Jacques Derrida sobre las aguadas (lavis de la pintora francesa Colette Deblé, dando lugar a una reflexión sobre el engendramiento, el parto y la cita pictórica. En el trabajo de Colette Deblé, el legado de la Historia del Arte y su mitología engendrarán una serie infinita de aguadas donde el agua no pretende “lavar” la tradición (deshacerse de ella, acabar con ella sino inundarla, mojarla, empaparla con nuevas aguas para, escurriéndola, hacerla resonar nuevamente.

  7. Consenso Cultural sobre el Intento de Suicidio en Adolescentes

    Directory of Open Access Journals (Sweden)

    Javier Eduardo García de Alba García

    2011-01-01

    Full Text Available Este estudio buscó identificar la estructura semántica del dominio cultural, el promedio de conocimiento y el grado de consenso cultural manifestado por los adolescentes sobre el intento de suicidio. Fue un estudio cualitativo de listas libres, con un muestreo propositivo no aleatorizado de 27 adolescentes entre 13 y 18 años. Los resultados evidenciaron un solo modelo semántico. En lo estructural se identificó el problema familiar como una causa importante del intento suicida; las categorías depresión y tristeza se consideraron como signos y síntomas previos a esta tentativa y no como causas. Como estrategias de prevención, se consideró recibir información mediante pláticas o establecer conversaciones sobre los problemas. Este modelo permite proponer estrategias de prevención que privilegien el núcleo familiar.

  8. ANOTAÇÕES SOBRE A FOTOGRAFIA DE FUTEBOL

    Directory of Open Access Journals (Sweden)

    Rui Cezar dos Santos

    2004-12-01

    Full Text Available O autor apresenta de maneira sintética as principais evoluções na fotografia e sua apropriação pelo fotojornalismo esportivo. Discorre sobre a imaginária que a Indústria Cultural sabe explorar, produzindo rica iconografia do esporte, dentro da qual o atleta surge ao mesmo tempo como ídolo, de maneira idealizada, e como atleta, nos fragmentos que realçam o detalhe.

  9. Algunas consideraciones sobre la investigación de desarrollo

    Directory of Open Access Journals (Sweden)

    Nadal, J.

    1970-07-01

    Full Text Available Not availableAnte el auditorio más calificado de España, me invitan a desarrollar esta ponencia que trata de un tema al que habéis dedicado todos muchas horas de meditación. Un tema sobre el que cada uno de vosotros ha procurado acumular cuanta información le ha sido posible y, en definitiva, una materia de la que sois verdaderos maestros.

  10. Ensayo sobre el feminismo y el sujeto popular

    OpenAIRE

    León Nuñez, Carmen Violeta

    2012-01-01

    Se comenta acá el ensayo escrito por Ana Sojo, el cual se compone de tres partes principales  componen el texto: la primera versa  sobre  el  sujeto popular: la segunda se refiere al estudio de  la definición de la condición subalterna de la mujer y en la tercera analiza el feminismo y el ámbito de la política.

  11. Dialogos negativos anotaciones sobre el montaje de Medea Okupa

    Directory of Open Access Journals (Sweden)

    Marcelo José Islas

    2013-09-01

    Full Text Available En este texto hablamos de dos temas: la adaptación de una obra de Eurípides, ]Medea, y su montaje en el contexto de un espacio público a partir de un trabajo de investigación en actuación sobre la poética de la tragedia.Estos dos temas, que exponemos por separado una mejor comprensión.

  12. Documentos sobre la censura de libros en el siglo XVII

    Directory of Open Access Journals (Sweden)

    María Teresa Cobos

    1963-04-01

    Full Text Available Durante el siglo XVII, en materia de legislación sobre censura de impresión de libros , no se produjeron modificaciones substanciales en las directrices señaladas en la centuria precedente, especialmente en las contempladas en la Pragmática de Felipe II del 7 de septiembre de 1558 y en otros preceptos legales que la reiteraron y perfeccionaron.

  13. Una nota sobre "la transformación correcta"

    Directory of Open Access Journals (Sweden)

    Muñoz M. Alberto

    1986-12-01

    Full Text Available En la nota presente se intenta demostrar que hay algunos problemas conceptuales y lógicos en el artículo aludido, aunque presente aspectos incisivos y nuevos sobre la relación entre valores y precios, referidos al producto neto, a la composición orgánica del capital, a los salarios y a la relación plusvalía y ganancias

  14. Efectos del tipo funcional de entrenamiento sobre el ajuste lector

    OpenAIRE

    Rosalinda Arroyo Hernández; Guadalupe Mares Cárdenas

    2009-01-01

    El presente trabajo tuvo por objetivo evaluar los efectos de entrenar cinco tipos de contacto con las relaciones entre objetos y sus elaboraciones lingüísticas sobre el ajuste lector de estudiantes universitarios. Primeramente los participantes fueron expuestos a una evaluación de ajuste lector, consistente en preguntas de diferente complejidad funcional, para posteriormente ser asignados aleatoriamente a uno de cinco grupos experimentales diferenciados por el nivel de complejidad funcional d...

  15. Sobre inundaciones y anegamientos / Reflections on floods and flooding

    Directory of Open Access Journals (Sweden)

    Ferrando A., Francisco J.

    2006-11-01

    Full Text Available Respecto a anegamientos e inundaciones, el autor realiza algunas precisiones conceptuales que afectan la gestión de acciones preventivas, la planificación y el ordenamiento territorial; además se ofrece una sistematización del quehacer sobre las inundaciones./ The author punctualizes the concepts regarding preventive actions and territorial planning. Also the article includes a systematized list of actions related to flood management.

  16. Corpus de inscripciones sobre la esclavitud infantil en Hispania romana

    OpenAIRE

    Crespo Ortiz de Zárate, Santos

    2009-01-01

    Se presenta en este trabajo el corpus epigráfico relativo a la servidumbre infantil en Hispania romana, como base a una serie de estudios sobre la dependencia personal en este ámbito social. This work shows the epigraphic sources dealing with the children-slaves in Roman Spain and sets up a base for future studies about personal dependence in this social sphere.

  17. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  18. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  19. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  20. Data Element Dictionary: Facilities. Preliminary Draft.

    Science.gov (United States)

    Thomas, Charles R.

    The draft includes--(1) comments on file structure, (2) descriptions of dictionary organization and format, (3) alphabetical lists of elements, and (4) facilities related elements in dictionary form. The data element definitions in this draft are compatible with the Higher Education Facilities Classification and Inventory Procedures Manual, which…

  1. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068 Section... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section... elemental mercury (CAS. No. 7439-97-6) is subject to reporting under this section for the significant...

  2. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  3. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  4. Hegel sobre Tácito y la libertad teutona

    Directory of Open Access Journals (Sweden)

    Valerio Rocco Lozano

    2015-09-01

    Full Text Available Una investigación sobre la presencia (así como sobre la ausencia de Tácito en Hegel es crucial para entender la posición política y filosófica de este pensador, especialmente en la época de Jena. Tras algunas consideraciones sobre el conocimiento hegeliano de la historia y la cultura romanas, se abordará un análisis de su noción de "libertad teutona": Hegel se opone tanto a la neo-romanidad de los revolucionarios franceses como al esencialismo teutómano de los conservadores alemanes (derivado fundamentalmente de un uso fuertemente ideológico de la "Germania" de Tácito, así como a las caducas instituciones imperiales. Esta doble oposición sitúa a Hegel en medio de dos corrientes políticas (e incluso de dos ejércitos en guerra y se lleva a cabo desde una actitud que puede denominarse como “mediación sin nostalgia”

  5. O Impacto do Mobbing sobre o estresse no trabalho

    Directory of Open Access Journals (Sweden)

    Tássia Donadello Ferreira Lima

    2015-07-01

    Full Text Available Definido como um conjunto de ações hostis e antiéticas, desenvolvidas no ambiente de trabalho de forma sistemática e recorrente que deixa o trabalhador em uma posição indefesa, o mobbing tem sido investigado na sua relação com a saúde e qualidade de vida do trabalhador. Neste sentido, o objetivo no presente trabalho foi (1 o desenvolvimento de três instrumentos para mensuração do mobbing, considerando sua prática por chefes, colegas e subordinados e (2 investigar o impacto do mobbing sobre o estresse no trabalho. Participaram do estudo 300 servidores de uma universidade federal do estado do Rio de Janeiro, sendo 157 homens e 143 mulheres. Os participantes preencheram os três instrumentos para mensuração do mobbing e a EET (Escala de Estresse no Trabalho. A análise fatorial exploratória dos principais eixos com rotação promax revelou uma estrutura ideal de dois fatores em cada instrumento, sendo nomeados de (1 comportamento respeitoso e (2 mobbing praticado por chefes, colegas ou subordinados, conforme o caso. A Modelagem por Equações Estruturais revelou um impacto positivo significativo do mobbing sobre o estresse no trabalho. Da mesma maneira, o comportamento respeitoso por parte de chefes, colegas e subordinados teve influência negativa significativa sobre o estresse no trabalho.

  6. Sobre os conceitos de risco em Luhmann e Giddens

    Directory of Open Access Journals (Sweden)

    Marília Luz David

    2011-11-01

    Full Text Available http://dx.doi.org/10.5007/1806-5023.2011v8n1p30 O presente artigo discute as contribuições de Anthony Giddens e Niklas Luhmann para uma melhor definição do conceito de risco, tendo em vista o rigor teórico de ambos os autores. Inicialmente é feita uma breve exposição sobre como o conceito de risco passou a ser utilizado na Modernidade e recebeu a atenção de autores das Ciências Sociais, principalmente a partir da abordagem cultura proposta por Mary Douglas. Em seguida, as definições e correspondentes argumentos sobre o conceito de risco em Luhmann e Giddens são apresentados respectivamente. Finalmente, alguns pontos de distanciamento entre os autores são discutidos e de que maneira cada um contribuiu para o debate sobre os riscos na teoria social e para o diagnóstico da Modernidade.

  7. AUTOPERCEPCIÓN DE LOS ADULTOS MAYORES SOBRE SU VEJEZ*

    Directory of Open Access Journals (Sweden)

    Sagrario Garay Villegas

    2010-03-01

    Full Text Available El objetivo de este artículo es aproximarse a los significados y percepciones que tienen los adultos mayores sobre esta etapa de su vida. Para ello utilizaremos herramientas de carácter cualitativo y cuantitativo. Nuestra pretensión de usar ambos métodos es contar con la visión de la población con 60 años o más, sobre aspectos relacionados con su salud física y mental, pero también indagar el los factores que podrían estar influyendo en dicha percepción. Los resultados encontrados nos revelan que existe una asociación muy cercana entre la percepción sobre la salud física y el estado mental de las personas adultas mayores. Palabras clave: vejez; significados; salud mental; salud física y felicidad. * Agradecemos los valiosos comentarios a versiones preeliminares de este documento realizados por la Dra. Verónica Montes de Oca.

  8. Elements of algebraic coding systems

    CERN Document Server

    Cardoso da Rocha, Jr, Valdemar

    2014-01-01

    Elements of Algebraic Coding Systems is an introductory textto algebraic coding theory. In the first chapter, you'll gain insideknowledge of coding fundamentals, which is essential for a deeperunderstanding of state-of-the-art coding systems.This book is a quick reference for those who are unfamiliar withthis topic, as well as for use with specific applications such as cryptographyand communication. Linear error-correcting block codesthrough elementary principles span eleven chapters of the text.Cyclic codes, some finite field algebra, Goppa codes, algebraic decodingalgorithms, and applications in public-key cryptography andsecret-key cryptography are discussed, including problems and solutionsat the end of each chapter. Three appendices cover the Gilbertbound and some related derivations, a derivation of the Mac-Williams' identities based on the probability of undetected error,and two important tools for algebraic decoding-namely, the finitefield Fourier transform and the Euclidean algorithm for polynomials.

  9. Spectroscopy of the Heaviest Elements

    Science.gov (United States)

    Clark, Roderick

    2009-10-01

    The specific ``magic'' proton and neutron numbers, representing major spherical shell gaps, beyond 208Pb are a matter of considerable debate. It is well established that nuclei near Z=100, N=152 (252Fm) have well-deformed prolate shapes. By performing prompt and delayed gamma-ray spectroscopy on deformed transfermium nuclei we can learn about the single-particle structure, shell gaps, pairing correlations, and excitation modes in the heaviest nuclei. After a brief overview of state-of-the-art measurements, I will describe recent results from experiments at the 88-Inch Cyclotron of the Lawrence Berkeley National Laboratory which use the Berkeley Gas-filled Separator (BGS). I will then discuss the prospects of a new generation of spectroscopy measurements on the heaviest elements when the BGS is used in conjunction with the GRETINA gamma--ray tracking array.

  10. Thermionic fuel element technology status

    Science.gov (United States)

    Holland, J. W.; Horner, M. W.; Yang, L.

    1985-01-01

    The results of research, conducted between the mid-1960s and 1973, on the multiconverter thermionic fuel elements (TFEs) that comprise the reactor core of an SP-100 thermionic reactor system are presented. Fueled-emitter technology, insulator technology and cell and TFE assembly technology of the prototypical TFEs which were tested in-pile and out-of-pile during these years are described. The proto-TFEs have demonstrated reproducible performance within 5 percent and no premature failures within the 1.5 yr of operation (with projected 3-yr lifetimes). The two primary life-limiting factors had been identified as thermionic emitter dimensional increase due to interactions with the fuel and electrical insulator structural damage from fast neutrons. Multiple options for extending TFE lifetimes to 7 yr or longer are available and will be investigated in the 1984-1985 SP-100 program for resolution of critical technology issues. Design diagrams and test graphs are included.

  11. Sobre los Conceptos de Suelo de Habitación y Piso de Ocupación en Prehistoria

    Directory of Open Access Journals (Sweden)

    Alejandro GÓMEZ FUENTES

    2009-10-01

    Full Text Available RESUMEN: En el intento de establecer los conceptos de suelo de habitación y piso de ocupación se procede a la lectura de una serie de trabajos que hacen referencia a los siguientes problemas: Sobre el concepto de ciencia, Sobre el concepto de estructura: Etnografía, Etnología... y Sobre los conceptos de suelo de habitación y piso de ocupación. Se desmenuzan una serie de elementos que nos permiten definir lo que entendemos en sentido arqueológico por suelo de habitación distinto de piso de ocupación —histórico—. En el primer concepto «manejamos» aspectos geológico-humanos. En el segundo, atendemos muy especialmente al desarrollo histórico de los sucesivos suelos de habitación.ABSTRACT: In an attempt to establish the concepts of «soil of habitation» and «ground of occupation» we have read a series of works refering to the following problems: — About the concept of science. — About the concept of structure: etnography, etnology... — About the concepts of «soil of habitation» and «ground of occupation». A close took at a series of elements, allows no to define what we mean in an aroheological sense, by «soil of habitation» and «ground of occupation» historical. In the firest case we are talking about geological - human aspects. In the second expression we are talkin more specially about the historical development of the successive soils of habitation.

  12. Remediation using trace element humate surfactant

    Energy Technology Data Exchange (ETDEWEB)

    Riddle, Catherine Lynn; Taylor, Steven Cheney; Bruhn, Debra Fox

    2016-08-30

    A method of remediation at a remediation site having one or more undesirable conditions in which one or more soil characteristics, preferably soil pH and/or elemental concentrations, are measured at a remediation site. A trace element humate surfactant composition is prepared comprising a humate solution, element solution and at least one surfactant. The prepared trace element humate surfactant composition is then dispensed onto the remediation site whereby the trace element humate surfactant composition will reduce the amount of undesirable compounds by promoting growth of native species activity. By promoting native species activity, remediation occurs quickly and environmental impact is minimal.

  13. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  14. Efectos del D-003 sobre patrones conductuales de roedores

    Directory of Open Access Journals (Sweden)

    Lilia Fernández Dorta

    2005-01-01

    Full Text Available El D-003 es una mezcla de ácidos alifáticos de muy alto peso molecular purificada de la cera de la caña de azúcar con efectos hipocolesterolemizante y antiagregante plaquetario demostrados experimentalmente y en estudios clínicos Fase I y II. Los estudios experimentales y clínicos culminados han mostrado que el D-003 es seguro y bien tolerado. Sin embargo, la farmacología de la seguridad de nuevos medicamentos investiga sus efectos sobre diversos sistemas que pudieran ser blancos potenciales de toxicidad. Teniendo en cuenta que los efectos adversos relacionados con el Sistema Nervioso (SN están entre los más frecuentes para diversas áreas terapéuticas, estos estudios suelen investigar los efectos de las sustancias sobre la función y estructura del SN. La investigación de los efectos sobre patrones conductuales de roedores comúnmente representa la primera etapa de estos estudios. De acuerdo con ello, el presente estudio tuvo como objetivo investigar los efectos del tratamiento oral con D-003 (dosis únicas y repetidas sobre la actividad exploratoria, la respuesta al plato caliente, la sujeción y ejecución en varilla rotatoria y la evitación pasiva de una sola prueba de aprendizaje en ratones. Los animales se distribuyeron aleatoriamente en cinco grupos experimentales (10 animales/grupo: uno control que recibió el vehículo goma acacia-H20 y cuatro tratados con D-003 (5, 25, 100 y 400 mg/kg, respectivamente. El tratamiento oral con dosis únicas y repetidas de D-003 (400 mg/kg aumentó de forma modesta, pero significativa, la actividad exploratoria con respecto al grupo control. Sin embargo, el D-003 no modificó la respuesta en el ensayo de plato caliente, la capacidad de sujeción y ejecución motora en varilla rotatoria ni la retención del aprendizaje en el ensayo de evitación pasiva. Se necesitan estudios ulteriores que diluciden las causas por las cuales el D-003 aumenta la actividad exploratoria en ratones y que

  15. Efecto del D-004 sobre patrones conductuales en roedores

    Directory of Open Access Journals (Sweden)

    Daisy Carbajal Quintana

    2007-01-01

    Full Text Available El D-004 es un extracto lipídico de los frutos de la palma real cubana (Roystonea regia que ha mostrado efectos protectores sobre la hyperplasia prostática (HP inducida en roedores con testosterona, pero no con dihidrotestosterona y que además, antagoniza respuestas mediadas por los ¿1-adrenoreceptores prostáticos. El D-004 mostró una modesta acción antiinflamatoria en el modelo de granuloma por algodón, modelo que se acerca más a la condición de inflamación crónica aparejada a la hiperplasia prostatica benigna (HPB en el hombre, lo que podría contribuir, en alguna medida, a su efecto en los modelos de HP. Teniendo en cuenta que los efectos adversos relacionados con el sistema nervioso (SN están entre los más frecuentes para diversas áreas terapéuticas, es obligado investigar los efectos de las sustancias sobre la función y estructura del SN. La investigación de los efectos sobre patrones conductuales de roedores comúnmente representa la primera etapa de estos estudios. El presente estudio investigó los efectos del tratamiento oral con D-004 (dosis únicas y repetidas sobre la actividad exploratoria, la respuesta al plato caliente y a las contracciones inducidas con ácido acético (200, 400 y 800 mg/kg, así como sobre la sujeción en varilla rotatoria y la fuerza de agarre en ratones (250, 500 y 1 000 mg/kg. El tratamiento oral con D-004 no modificó la actividad exploratoria, la respuesta al plato caliente y a las contracciones inducidas con ácido acético, así como la sujeción en varilla y la fuerza de agarre . El tratamiento oral con D-004 en el intervalo de dosis indicado no indujo efectos neurotóxicos, ya que no modificó ninguna de las conductas estudiadas.

  16. Transition elements based on transfinite interpolation

    Science.gov (United States)

    Odabas, Onur R.; Sarigul-Klijn, Nesrin

    1993-01-01

    In this study the transfinite interpolation methodology, a 'blending-function' method in particular, is utilized for the formulation of transition elements. The method offers a formal way of meeting continuity requirements in a transition element. Element shape functions are derived by blending the continuity requirements of individual boundary segments. The blending directions are naturally orthogonal in rectangular domains therefore interpolation of the boundaries over rectangular 2D and 3D elements can be performed with minimal effort. In triangular domains, however, the choice of blending directions and interpolants is not straightforward. For that reason, two interpolation techniques are proposed for blending of the boundaries of triangular domains. A series of transition elements of various classes compatible with elements of different orders and dimensions is developed and the full potential of the transfinite interpolation, as it applies to element formulation, is explored.

  17. Rare earth elements: end use and recyclability

    Science.gov (United States)

    Goonan, Thomas G.

    2011-01-01

    Rare earth elements are used in mature markets (such as catalysts, glassmaking, lighting, and metallurgy), which account for 59 percent of the total worldwide consumption of rare earth elements, and in newer, high-growth markets (such as battery alloys, ceramics, and permanent magnets), which account for 41 percent of the total worldwide consumption of rare earth elements. In mature market segments, lanthanum and cerium constitute about 80 percent of rare earth elements used, and in new market segments, dysprosium, neodymium, and praseodymium account for about 85 percent of rare earth elements used. Regardless of the end use, rare earth elements are not recycled in large quantities, but could be if recycling became mandated or very high prices of rare earth elements made recycling feasible.

  18. Examen de las páginas Web sobre aprendizaje de idiomas. Discursos sobre lengua, aprendizaje y aprendices

    Directory of Open Access Journals (Sweden)

    José Aldemar Álvarez Valencia

    2016-12-01

    Full Text Available Las páginas web de aprendizaje de idiomas se han convertido en una fuente potencial de aprendizaje de idiomas desde la aparición de la World Wide Web. Al igual que cualquier material pedagógico, estas páginas web promulgan visiones sobre la lengua, el aprendizaje y los estudiantes a través de sus diseños semióticos (contenido y diseño estructural. Este estudio es un intento por explorar estas tres dimensiones mediante el examen de la estructura y los contenidos de Pumarosa, una página web de aprendizaje de inglés, y se centra en los usos de una estudiante-usuaria de este entorno virtual. Este estudio de caso se fundamenta en los elementos de la semiótica multimodal y otras estrategias cualitativas de recolección de datos, tales como entrevistas, grabación de la pantalla de acciones en el entorno virtual, y recuerdo estimulado. Los resultados indican que las visiones sobre la lengua, el aprendizaje y la forma en que los usuarios son posicionados en la página web ejercen una gran influencia sobre los significados que la estudiante-usuaria construye alrededor de esos conceptos

  19. Análisis de Fourier sobre ZN y conjuntos Bh

    Directory of Open Access Journals (Sweden)

    Jhon Jairo Bravo G.

    2010-06-01

    Full Text Available Un conjunto A de enteros positivos se llama un conjunto Bh, si todas las sumas de h elementos de A son diferentes. En este artículo usamos propiedades básicas del análisis de Fourier sobre ZN y seguimos el estilo de Ben Green [4] para deducir, con un método diferente, las cotas superiores obtenidas por Jia [6], Chen [2] y Graham [5] respecto al máximo cardinal que puede tener un conjunto Bh contenido en los primeros N enteros positivos. Abstract. A set A of positive integers is called a Bh set, if all sums of h elements of A are different. In this paper we use basic properties of Fourier analysis on ZN and follow the style of Ben Green [4] to conclude with a different method, the upper bounds obtained by Jia [6], Chen [2] and Graham [5] with respect to the maximum cardinal that can have a Bh set contained in the first N positive integers.

  20. A NOVEL ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    YANG Rui-liang; WANG Hong-zhen

    2005-01-01

    A novel ellipsoidal acoustic infinite element is proposed. It is based a new pressure representation, which can describe and solve the ellipsoidal acoustic field more exactly. The shape functions of this novel acoustic infinite element are similar .to the Burnett's method, while the weight functions are defined as the product of the complex conjugates of the shaped functions and an additional weighting factor. The code of this method is cheap to generate as for 1-D element because only 1-D integral needs to be numerical. Coupling with the standard finite element, this method provides a capability for very efficiently modeling acoustic fields surrounding structures of virtually any practical shape. This novel method was deduced in brief and the conclusion was kept in detail. To test the feasibility of this novel method efficiently, in the examples the infinite elements were considered, excluding the finite elements relative. This novel ellipsoidal acoustic infinite element can deduce the analytic solution of an oscillating sphere. The example of a prolate spheroid shows that the novel infinite element is superior to the boundary element and other acoustic infinite elements. Analytical and numerical results of these examples show that this novel method is feasible.