WorldWideScience

Sample records for azorhizobium caulinodans ors571

  1. The genome of the versatile nitrogen fixer Azorhizobium caulinodans ORS571

    DEFF Research Database (Denmark)

    Lee, KB; De Backer, P; Aono, T; Liu, CT; Suzuki, S; Suzuki, T; Kaneko, T; Yamada, M; Tabata, S; Kupfer, DM; Najar, FZ; Wiley, GB; Roe, B; Binnewies, Tim Terence; Ussery, David; D'Haeze, WD; Herder, JD; Gevers, D; Vereecke, D; Holsters, M; Oyaizu, H

    2008-01-01

    -growing, submergence-tolerant tropical legume on which A. caulinodans can efficiently induce nodule formation on the root system and on adventitious rootlets located on the stem. RESULTS: The 5.37-Mb genome consists of a single circular chromosome with an overall average GC of 67% and numerous islands with varying GC...... contents. Most nodulation functions as well as a putative type-IV secretion system are found in a distinct symbiosis region. The genome contains a plethora of regulatory and transporter genes and many functions possibly involved in contacting a host. It potentially encodes 4717 proteins of which 96.3% have...

  2. Cyanuric acid hydrolase from Azorhizobium caulinodans ORS 571: crystal structure and insights into a new class of Ser-Lys dyad proteins.

    Directory of Open Access Journals (Sweden)

    Seunghee Cho

    Full Text Available Cyanuric acid hydrolase (CAH catalyzes the hydrolytic ring-opening of cyanuric acid (2,4,6-trihydroxy-1,3,5-triazine, an intermediate in s-triazine bacterial degradation and a by-product from disinfection with trichloroisocyanuric acid. In the present study, an X-ray crystal structure of the CAH-barbituric acid inhibitor complex from Azorhizobium caulinodans ORS 571 has been determined at 2.7 Å resolution. The CAH protein fold consists of three structurally homologous domains forming a β-barrel-like structure with external α-helices that result in a three-fold symmetry, a dominant feature of the structure and active site that mirrors the three-fold symmetrical shape of the substrate cyanuric acid. The active site structure of CAH is similar to that of the recently determined AtzD with three pairs of active site Ser-Lys dyads. In order to determine the role of each Ser-Lys dyad in catalysis, a mutational study using a highly sensitive, enzyme-coupled assay was conducted. The 10⁹-fold loss of activity by the S226A mutant was at least ten times lower than that of the S79A and S333A mutants. In addition, bioinformatics analysis revealed the Ser226/Lys156 dyad as the only absolutely conserved dyad in the CAH/barbiturase family. These data suggest that Lys156 activates the Ser226 nucleophile which can then attack the substrate carbonyl. Our combination of structural, mutational, and bioinformatics analyses differentiates this study and provides experimental data for mechanistic insights into this unique protein family.

  3. Nucleotide sequence of the fixABC region of Azorhizobium caulinodans ORS571: similarity of the fixB product with eukaryotic flavoproteins, characterization of fixX, and identification of nifW.

    Science.gov (United States)

    Arigoni, F; Kaminski, P A; Hennecke, H; Elmerich, C

    1991-03-01

    The nucleotide sequence of a 4.1 kb DNA fragment containing the fixABC region of Azorhizobium caulinodans was established. The three gene products were very similar to the corresponding polypeptides of Rhizobium meliloti. The C-terminal domains of both fixB products displayed a high degree of similarity with the alpha-subunits of rat and human electron transfer flavoproteins, suggesting a role for the FixB protein in a redox reaction. Two open reading frames (ORF) were found downstream of fixC. The first ORF was identified as fixX on the basis of sequence homology with fixX from several Rhizobium and Bradyrhizobium strains. The second ORF potentially encoded a 69 amino acid product and was found to be homologous to a DNA region in the Rhodobacter capsulatus nif cluster I. Insertion mutagenesis of the A. caulinodans fixX gene conferred a Nif- phenotype to bacteria growth in the free-living state and a Fix- phenotype in symbiotic association with the host plant Sesbania rostrata. A crude extract from the fixX mutant had no nitrogenase activity. Furthermore, data presented in this paper also indicate that the previously identified nifO gene located upstream of fixA was probably a homologue of the nifW gene of Klebsiella pneumoniae and Azotobacter vinelandii. PMID:1850088

  4. Regulation of Azorhizobium caulinodans ORS571 nitrogen fixation (nif/fix) genes.

    OpenAIRE

    Stigter, J.

    1994-01-01

    Biological nitrogen fixation is the microbial process by which atmospheric dinitrogen (N 2 ) is reduced to ammonia. In all microbes studied, dinitrogen reduction is catalyzed by a highly conserved enzyme complex, called nitrogenase. The nitrogenase subunits and functions required for nitrogenase assembly and activity are encoded by the nitrogen fixation (nif/fix) genes.Nitrogen-fixing organisms can be roughly divided into two major groups: the free-living nitrogen fixing (diazotrophic) specie...

  5. Sobrevivência de Bradyrhizobium e Azorhizobium em misturas de solo contaminadas com metais pesados

    Directory of Open Access Journals (Sweden)

    A. Matsuda

    2002-03-01

    Full Text Available Estudos foram realizados no Departamento de Ciência do Solo da Universidade Federal de Lavras (MG, no período de novembro/1999 a janeiro/2000, com o objetivo de avaliar a sobrevivência de estirpe e isolados de rizóbio em solo contaminado com metais pesados e verificar a relação entre tolerância do rizóbio a metais pesados em meio de cultura e sua sobrevivência em solo contaminado. Foram utilizados os dois microrganismos mais tolerantes [BR-4406 (estirpe recomendada para Enterolobium spp. e UFLA-01-457 (isolado de solo contaminado, ambos pertencentes ao gênero Bradyrhizobium ] e os dois mais sensíveis (UFLA-01-486 e UFLA-01-510, isolados de solo contaminado, pertencentes ao gênero Azorhizobium , todos selecionados de um grupo de 60estirpes/isolados em estudos prévios deste laboratório, em meio de cultura suplementado com metais pesados.Empregaram-se misturas de um Latossolo Vermelho-Escuro (LE que continham 0, 15 e 45% (v/v de um Latossolo Vermelho-Amarelo plíntico contaminado com Zn, Cd, Pb e Cu. As misturas de solo contaminado foram inoculadas com 20mL de cultura em YM na fase log das estirpes mencionadas, as quais foram testadas separadamente com três repetições. A avaliação do número de células viáveis no solo, realizada aos 0, 7, 14, 21 e 28dias de incubação, pelo método das diluições sucessivas e inoculação em placas com meio YMA, revelou comportamento diferenciado entre os organismos estudados. O número médio de células que sobreviveram ao final de 28 dias de incubação foi de (em UFCg-1de solo: 10(10,36, 10(10,29 e 10(9,70, para Bradyrhizobium, e 10(9,36, 10(7,54 e 0, para Azorhizobium em misturas de 0, 15 e 45% de solo contaminado, respectivamente. Portanto, houve maior sobrevivência de Bradyrhizobium do que de Azorhizobium , indicando maior tolerância a metais pesados do primeiro gênero.Como Bradyrhizobium foi também mais tolerante "in vitro", os resultados indicam haver relação entre o

  6. Tolerância de estirpes e isolados de Bradyrhizobium e de Azorhizobium a zinco, cádmio e cobre "in vitro"

    Directory of Open Access Journals (Sweden)

    I. C. B. Trannin

    2001-06-01

    Full Text Available Com o objetivo de avaliar a tolerância a metais pesados "in vitro" de estirpes inoculantes (I, isolados de solos contaminados com metais (ISC e de solos não contaminados (ISNC de Bradyrhizobium, simbiontes de Enterolobium contortisiliquum (tamboril e de Acacia mangium (acácia e de Azorhizobium, simbiontes de Sesbania virgata (sesbânia, foram realizados dois experimentos. No primeiro, dez estirpes e, ou, isolados para cada espécie vegetal foram testados em meio YMA modificado por adição de tampões biológicos (HEPES e MES, suplementado com diferentes concentrações de Cu, Cd e Zn. Cobre e Cd foram testados em concentrações de 0 a 40 mg L-1, para ambos os gêneros, enquanto Zn variou de 0 a 1.000 mg L-1, para Bradyrhizobium, e de 0 a 500 mg L-1, para Azorhizobium. O crescimento de rizóbio nas diferentes concentrações de metais foi avaliado com atribuição de valores para os padrões observados (0 a 5. Os ISC de ambos os gêneros foram mais tolerantes, mas Bradyrhizobium tolerou Zn (800 mg L-1 até duas vezes e Cu (40 mg L-1 até oito vezes mais que Azorhizobium. No segundo experimento, estirpes e isolados tolerantes (T, sensíveis (S e de tolerância média (TM a metais selecionados em meio YMA modificado foram estudados em soluções aquosas com diferentes concentrações de Cu (0 a 0,01 mg L-1, Cd e Zn (0 a 1,0 mg L-1. A avaliação do número de células viáveis em soluções de metais foi feita por contagem das unidades formadoras de colônia em 0, 24, 48, 72 e 96 h de incubação, pelo método das diluições sucessivas e inoculação em YMA. Embora as soluções de metais tenham sido mais discriminatórias quanto a tolerância a metais que o meio YMA, estes dois métodos mostraram que: (a Azorhizobium foi mais sensível que Bradyrhizobium, (b os ISC de ambos os gêneros foram mais tolerantes do que os ISNC e (c a ordem de toxidez dos metais foi Cu > Cd > Zn.

  7. Functional nodFE genes are present in Sinorhizobium sp. strain MUS10, a symbiont of tropical legume Sesbania rostrata

    Science.gov (United States)

    Sinorhizobium sp. strain MUS10, a rhizobium from the Indian subcontinent, forms nitrogen-fixing nodules on the stems and roots of tropical legume Sesbania rostrata. The structure of Nod factors (NFs) of MUS10 are similar to those of Azorhizobium caulinodans, S. saheli bv sesbaniae and S. terangae bv...

  8. A novel endo-hydrogenase activity recycles hydrogen produced by nitrogen fixation.

    Directory of Open Access Journals (Sweden)

    Gordon Ng

    Full Text Available BACKGROUND: Nitrogen (N(2 fixation also yields hydrogen (H(2 at 1:1 stoichiometric amounts. In aerobic diazotrophic (able to grow on N(2 as sole N-source bacteria, orthodox respiratory hupSL-encoded hydrogenase activity, associated with the cell membrane but facing the periplasm (exo-hydrogenase, has nevertheless been presumed responsible for recycling such endogenous hydrogen. METHODS AND FINDINGS: As shown here, for Azorhizobium caulinodans diazotrophic cultures open to the atmosphere, exo-hydrogenase activity is of no consequence to hydrogen recycling. In a bioinformatic analysis, a novel seven-gene A. caulinodans hyq cluster encoding an integral-membrane, group-4, Ni,Fe-hydrogenase with homology to respiratory complex I (NADH: quinone dehydrogenase was identified. By analogy, Hyq hydrogenase is also integral to the cell membrane, but its active site faces the cytoplasm (endo-hydrogenase. An A. caulinodans in-frame hyq operon deletion mutant, constructed by "crossover PCR", showed markedly decreased growth rates in diazotrophic cultures; normal growth was restored with added ammonium--as expected of an H(2-recycling mutant phenotype. Using A. caulinodans hyq merodiploid strains expressing beta-glucuronidase as promoter-reporter, the hyq operon proved strongly and specifically induced in diazotrophic culture; as well, hyq operon induction required the NIFA transcriptional activator. Therefore, the hyq operon is constituent of the nif regulon. CONCLUSIONS: Representative of aerobic N(2-fixing and H(2-recycling alpha-proteobacteria, A. caulinodans possesses two respiratory Ni,Fe-hydrogenases: HupSL exo-hydrogenase activity drives exogenous H(2 respiration, and Hyq endo-hydrogenase activity recycles endogenous H(2, specifically that produced by N(2 fixation. To benefit human civilization, H(2 has generated considerable interest as potential renewable energy source as its makings are ubiquitous and its combustion yields no greenhouse gases. As

  9. Dicty_cDB: Contig-U09825-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ne) Staphylothermus marinus F1, comp... 34 9.1 >AY421721_1( AY421721 |pid:none) Cryptococcus neoformans var. neofo...ne) Cryptococcus neoformans var. neofo... 162 2e-38 FM992691_439( FM992691 |pid:no...mosome 14 section 2... 38 0.20 12 ( DJ387414 ) Diagnosis of Diseases Associated with Apopto...37_4059( CP001037 |pid:none) Nostoc punctiforme PCC 73102, c... 61 7e-08 CP000301_762( CP000301 |pid:none) Rhodop...hizobium caulinodans ORS 571... 60 1e-07 CP000157_1522( CP000157 |pid:none) Erythrobacter litor

  10. Dicty_cDB: Contig-U00735-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available equence 11 from Patent WO03040681. 49 2e-04 CU207211_886( CU207211 |pid:none) Herminiimonas arsenicoxydans c..., clone: mib07054, 3' end, expre... 44 6.7 1 ( BG148484 ) uu79b10.y1 Soares_mouse_NMGB_bcell Mus musculus c....IK... 44 6.7 1 ( AA276535 ) vc44g11.r1 Soares mouse 3NbMS Mus musculus cDNA c... 44 6.7 1 ( AA184659 ) mt58d08.r1 Soares_thymus...ulfovibrio desulfuricans sub... 229 4e-59 AP010656_521( AP010656 |pid:none) Candidatus Azobacteroides pse..._1499( AP009384 |pid:none) Azorhizobium caulinodans ORS 57... 56 1e-06 BX640415_270( BX640415 |pid:none) Bordetella pertus

  11. Identification, sequencing and structural analysis of a nifA-like gene of Acetobacter diazotrophicus.

    Science.gov (United States)

    Teixeira, K R; Morgan, T; Meletzus, D; Galler, R; Baldani, J I; Kennedy, C

    1999-01-01

    A recombinant plasmid, pAD101, containing a DNA fragment of Acetobacter diazotrophicus strain PAL5 was isolated by its ability to restore Nif+ phenotype to a nifA- ntrC- double mutant of Azotobacter vinelandii. Hybridization with the nifA genes of Azospirillum brasilense located the nifA gene more precisely to specific fragments of pAD101. DNA sequencing of appropriate subclones of pAD101 revealed that the nifA gene was adjacent to the nifB gene in A. diazotrophicus, and the 5' end of the nifB gene was located downstream of the nitrogenase MoFe subunit gene, nifK. The deduced aminoacid sequence of A. diazotrophicus nifA and nifB gene were most similar to the NifA and NifB proteins of Azorhizobium caulinodans and Rhodobacter capsulatus, respectively. In addition, nucleotide sequences upstream of the A. diazotrophicus nifA-encoding region indicate features similar to those in the A. caulinodans nifA promoter region involved in O2 and fixed N regulation of nifA expression. PMID:10530336

  12. Sequence and structural organization of a nif A-like gene and part of a nifB-like gene of Herbaspirillum seropedicae strain Z78.

    Science.gov (United States)

    Souza, E M; Funayama, S; Rigo, L U; Yates, M G; Pedrosa, F O

    1991-07-01

    The deduced amino acid sequence derived from the sequence of a fragment of DNA from the free-living diazotroph Herbaspirillum seropedicae was aligned to the homologous protein sequences encoded by the nifA genes from Azorhizobium caulinodans, Rhizobium leguminosarum, Rhizobium meliloti and Klebsiella pneumoniae. High similarity was found in the central domain and in the C-terminal region. The H. seropedicae putative NifA sequence was also found to contain an interdomain linker similar to that conserved among rhizobial NifA proteins, but not K. pneumoniae or Azotobacter vinelandii. Analysis of the regulatory sequences found 5' from nifA indicated that the expression of this gene in H. seropedicae is likely to be controlled by NifA, NtrC and RpoN, as judged by the presence of specific NifA- and NtrC-binding sites and characteristic -24/-12 promoters. Possible additional regulatory features included an 'anaerobox' and a site for integration host factor. The N-terminus of another open reading frame was found 3' from nifA and tentatively identified as nifB by amino acid sequence comparison. The putative nifB promoter sequence suggests that expression of H. seropedicae nifB may be activated by NifA and dependent on RpoN. PMID:1840608

  13. Endophytic colonization of plant roots by nitrogen-fixing bacteria

    International Nuclear Information System (INIS)

    Nitrogen-fixing bacteria are able to enter into roots from the rhizosphere, particularly at the base of emerging lateral roots, between epidermal cells and through root hairs. In the rhizosphere growing root hairs play an important role in symbiotic recognition in legume crops. Nodulated legumes in endosymbiosis with rhizobia are amongst the most prominent nitrogen-fixing systems in agriculture. The inoculation of non-legumes, especially cereals, with various non-rhizobial diazotrophic bacteria has been undertaken with the expectation that they would establish themselves intercellularly within the root system, fixing nitrogen endophytic ally and providing combined nitrogen for enhanced crop production. However, in most instances bacteria colonize only the surface of the roots and remain vulnerable to competition from other rhizosphere micro-organisms, even when the nitrogen-fixing bacteria are endophytic, benefits to the plant may result from better uptake of soil nutrients rather than from endophytic nitrogen fixation. Azorhizobium caulinodans is known to enter the root system of cereals, other nonlegume crops and Arabidopsis, by intercellular invasion between epidermal cells and to internally colonize the plant intercellularly, including the xylem. This raises the possibility that xylem colonization might provide a nonnodular niche for endosymbiotic nitrogen fixation in rice, wheat, maize, sorghum and other non-legume crops. A particularly interesting, naturally occurring, non-qodular xylem colonising endophytic diazotrophic interaction with evidence for endophytic nitrogen fixation is that of Gluconacetobacter diazotrophicus in sugarcane. Could this beneficial endophytic colonization of sugarcane by G. diazotrophicus be extended to other members of the Gramineae, including the major cereals, and to other major non-legume crops of the World? (author)

  14. Bacterial dynamics during yearlong spontaneous fermentation for production of ngari, a dry fermented fish product of Northeast India.

    Science.gov (United States)

    Devi, Khunjamayum Romapati; Deka, Manab; Jeyaram, Kumaraswamy

    2015-04-16

    Azorhizobium caulinodans were detected throughout the fermentation. Principal component analysis showed a drastic bacterial community structural change at the sixth month of fermentation. These identified dominant bacterial cultures of T. halophilus, L. pobuzihii, S. carnosus and B. indicus could be effectively utilised for designing starter culture and optimizing fermentation technology for industrialisation of ngari production. PMID:25637876

  15. Sesbania virgata stimulates the occurrence of its microsymbiont in soils but does not inhibit microsymbionts of other species Sesbania virgata estimula a ocorrência de seu microssimbionte nos solos, mas não inibe os microssimbiontes de outras espécies

    OpenAIRE

    Ligiane Aparecida Florentino; Ana Paula Guimarães; Márcia Rufini; Krisle da Silva; Fátima Maria de Souza Moreira

    2009-01-01

    The legume species Sesbania virgata establishes a specific and efficient symbiosis with Azorhizobium doebereinerae. Previous studies have shown that A. doebereinerae occurrence correlates to the presence of S. virgata. This work aimed to evaluate the occurrence of A. doebereinerae and of other nitrogen-fixing Leguminosae-nodulating bacteria (NFLNB) in soil samples collected adjacent to and 10 m away from the stems of five S. virgata plants in pasture areas. Symbiotic characteristics of isolat...

  16. SITUACIÓN ACTUAL Y PERSPECTIVA DE LAS RELACIONES ENDÓFITAS PLANTA-BACTERIA. ESTUDIO DE CASO Gluconacetobacter diazotrophicus-CULTIVOS DE IMPORTANCIA ECONÓMICA

    OpenAIRE

    B. Dibut; R. Martínez-Viera; Marisel Ortega; Yoania Ríos; Grisel Tejeda; Liuba Planas; Janet Rodríguez

    2009-01-01

    En los últimos años, ha ganado especial interés el estudio de las asociaciones endofíticas planta-microoganismos, con énfasis en la introducción en la práctica agrícola de los buenos resultados que se han obtenido en la agrobiología. En este trabajo se ofrece una panorámica de la situación actual y perspectiva de estas asociaciones ilustradas en gran medida por las interacciones Rhizobium-cereales, Azorhizobium-arroz, Azospirillum y Herbaspirillum, al igual que cereales y Gluconacetobacter di...

  17. Dicty_cDB: Contig-U12134-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2e-54 CU207211_118( CU207211 |pid:none) Herminiimonas arsenicoxydans chr... 217 2e-54 ( P07991 ) RecName: Fu...ulfitobacterium hafniense DCB... 139 5e-31 AP009384_4028( AP009384 |pid:none) Azorhizobium cau...yyylfylclifhfyliflfhfylyl iflfhfcliflfhfylypiflfhfylyhlylfslslsplsesplddddelsflllslppp lplpllllllsssy*lvvlyv...4-1Q.Seq.d (2911 letters) Database: CSM 6905 sequences; 5,674,871 total letters Score E Sequences producing significa...7 bits (841), Expect = 0.0 Identities = 841/841 (100%) Strand = Plus / Plus Query: 939 taaattaccattggtaatatttggtttatcaccaatacca

  18. Dicty_cDB: Contig-U15650-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available i... 211 6e-53 CU207211_2645( CU207211 |pid:none) Herminiimonas arsenicoxydans ch... 211 6e-53 CP000926_4473... and uses. 56 0.005 1 ( AX641669 ) Sequence 2859 from Patent WO0101118. 56 0.005 1 ( EK...rantiacus J-10-f... 129 2e-43 AP009384_314( AP009384 |pid:none) Azorhizobium caulino...arch space: 297294773116 Effective search space used: 297294773116 Neighboring words thres...ntig-U15650-1Q.Seq.d (1858 letters) Database: CSM 8402 sequences; 8,075,542 total letters Score E Sequences producing significa

  19. Evaluation of nutrient limitation in aquatic ecosystems with nitrogen fixing bacteria

    Institute of Scientific and Technical Information of China (English)

    WU Gen-fu; WU Xue-chang; XUAN Xiao-dong; ZHOU Xue-ping

    2006-01-01

    There has always been a great need for simple and accurate bioassays for evaluating nutrient limitation in aquatic ecosystems. Whereas organic carbon is usually considered to be the limiting nutrient for microbial growth in many aquatic ecosystems,there are, however, many water sources that are limited by phosphorus or nitrogen. A method named "nitrogen fixing bacterial growth potential" (NFBGP) test, which is based on pre-culturing ofautochthonous (target) microorganisms was described. The method was applied to evaluate phosphorus or nitrogen nutrient limitation in lake and sewage water samples using an isolate of the nitrogen fixing bacterium, Azorhizobium sp. WS6. The results corresponded well to those from the traditional algal growth potential (AGP) test and the bacterial regrowth potential (BRP) test, suggesting that the NFBGP test is a useful supplementary method for evaluating the limiting nutrient, especially phosphorus, in an aquatic environment.

  20. Tolerância de rizóbios de diferentes procedências ao zinco, cobre e cádmio Tolerance of rhizobia genera from different origins to zinc, copper and cadmium

    Directory of Open Access Journals (Sweden)

    Alexandre Matsuda

    2002-03-01

    Full Text Available Sessenta estirpes/isolados dos gêneros Bradyrhizobium, Rhizobium, Sinorhizobium, Mesorhizobium e Azorhizobium, procedentes de diferentes locais (Mata Atlântica, Amazônia, culturas agrícolas e experimentos com metais pesados e de espécies hospedeiras pertencentes às subfamílias Papilionoideae, Mimosoideae e Caesalpinoideae, foram avaliadas quanto à tolerância a Zn, Cu e Cd em meio YMA modificado pela adição de tampões biológicos (HEPES e MES e suplementados com Cu (0 a 60 mg L-1, Cd (0 a 60 mg L-1 e Zn (0 a 1.000 mg L-1. Mediante padrões de crescimento atribuídos às culturas nas diferentes concentrações dos metais, avaliaram-se as concentrações máximas toleradas e as doses tóxicas destes metais para redução de crescimento em 25% (DT25 e 50% (DT50. Não houve influência da procedência na concentração máxima de metal tolerada. A ordem de sensibilidade aos metais, considerando-se as concentrações máximas toleradas, foi Azorhizobium > Rhizobium = Mesorhizobium = Sinorhizobium > Bradyrhizobium. A DT25 e a DT50 foram úteis para diferenciarem estirpes/isolados de um mesmo gênero, que atingiram a mesma concentração máxima tolerada a Zn, Cu e Cd. A ordem de toxicidade dos metais estudados foi Cu > Cd > Zn.Sixty strains/isolates of the genera Bradyrhizobium, Rhizobium, Sinorhizobium, Mesorhizobium and Azorhizobium, isolated from different hosts (legume subfamilies: Papilionoideae, Mimosoideae and Caesalpinoideae and location (Atlantic Forest, Amazon region, crop plantings and heavy metal experiments, were evaluated for Zn, Cu and Cd tolerance in YMA medium modified by the addition of biological buffers (HEPES and MES and supplemented with Cu (0 to 60 mg L-1, Cd (0 to 60 mg L-1, and Zn (0 to 1,000 mg L-1sulphates. Growth standards were applied to evaluate rhizobia cultures growth at different metal concentrations, allowing evaluation of highest tolerated concentrations of Zn, Cu, and Cd and the toxic doses

  1. Dicty_cDB: Contig-U14188-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 9 6e-16 CP000879_1539( CP000879 |pid:none) Petrotoga mobilis SJ95, complet... 89 6e-16 Z46959_1( Z46959 |pid...quefaciens FZB4... 87 2e-15 AE008692_1139( AE008692 |pid:none) Zymomonas mobilis subsp. mobili... 87 2e-...ivorans ... 96 1e-39 CP000088_551( CP000088 |pid:none) Thermobifida fusca YX, complete ... 166 4e-39 BC00010...CP000964 |pid:none) Klebsiella pneumoniae 342, comp... 99 8e-19 AP009384_2376( AP009384 |pid:none) Azorhizobium cauli...orme PCC 73102, c... 90 3e-16 AM942759_1047( AM942759 |pid:none) Proteus mirabilis strain HI4320... 90 3e-16

  2. Electrokinetic remediation and microbial community shift of β-cyclodextrin-dissolved petroleum hydrocarbon-contaminated soil.

    Science.gov (United States)

    Wan, Chunli; Du, Maoan; Lee, Duu-Jong; Yang, Xue; Ma, Wencheng; Zheng, Lina

    2011-03-01

    Electrokinetic (EK) migration of β-cyclodextrin (β-CD), which is inclusive of total petroleum hydrocarbon (TPH), is an economically beneficial and environmentally friendly remediation process for oil-contaminated soils. Remediation studies of oil-contaminated soils generally prepared samples using particular TPHs. This study investigates the removal of TPHs from, and electromigration of microbial cells in field samples via EK remediation. Both TPH content and soil respiration declined after the EK remediation process. The strains in the original soil sample included Bacillus sp., Sporosarcina sp., Beta proteobacterium, Streptomyces sp., Pontibacter sp., Azorhizobium sp., Taxeobacter sp., and Williamsia sp. Electromigration of microbial cells reduced the biodiversity of the microbial community in soil following EK remediation. At 200 V m(-1) for 10 days, 36% TPH was removed, with a small population of microbial cells flushed out, demonstrating that EK remediation is effective for the present oil-contaminated soils collected in field. PMID:21052991

  3. Electrokinetic remediation and microbial community shift of {beta}-cyclodextrin-dissolved petroleum hydrocarbon-contaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chunli; Du, Maoan; Yang, Xue; Ma, Wencheng [Harbin Institute of Technology (China). School of Municipal and Environmental Engineering; Lee, Duu-Jong [National Taiwan Univ., Taipei (China). Dept. of Chemical Engineering; Zheng, Lina [Dalian Ocean Univ. (China). College of Marine Environmental Engineering

    2011-03-15

    Electrokinetic (EK) migration of {beta}-cyclodextrin ({beta}-CD), which is inclusive of total petroleum hydrocarbon (TPH), is an economically beneficial and environmentally friendly remediation process for oil-contaminated soils. Remediation studies of oil-contaminated soils generally prepared samples using particular TPHs. This study investigates the removal of TPHs from, and electromigration of microbial cells in field samples via EK remediation. Both TPH content and soil respiration declined after the EK remediation process. The strains in the original soil sample included Bacillus sp., Sporosarcina sp., Beta proteobacterium, Streptomyces sp., Pontibacter sp., Azorhizobium sp., Taxeobacter sp., and Williamsia sp. Electromigration of microbial cells reduced the biodiversity of the microbial community in soil following EK remediation. At 200 V m{sup -1} for 10 days, 36% TPH was removed, with a small population of microbial cells flushed out, demonstrating that EK remediation is effective for the present oil-contaminated soils collected in field. (orig.)

  4. AcEST: DK946240 [AcEST

    Lifescience Database Archive (English)

    Full Text Available AQSQGPLGDVYTLERDRHGRHG 339 >tr|A8I028|A8I028_AZOC5 Conserved putative membrane protein OS=Azorhizobium cauli...ation of protein database search programs, Nucleic Acids Res. 25:3389-3402. Query= DK946240|Adiantum capillus-vener...86W6_RHILO Mlr7180 protein OS=Rhizobium loti GN=mlr7... 34 4.2 tr|A8I028|A8I028_AZOC5 Conserved putative...YMU02A01NGRL0011_P03 458 Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0011_P0...3. 5' end sequence. DK946240 - Show DK946240 Clone id YMU02A01NGRL0011_P03 Library YMU02 Length 458 Definition Adiantum capillus-ve

  5. Asymbiotic Acetylene Reduction by a Fast-Growing Cowpea Rhizobium Strain with Nitrogenase Structural Genes Located on a Symbiotic Plasmid

    OpenAIRE

    Bender, Gregory L.; Plazinski, Jacek; Rolfe, Barry G.

    1986-01-01

    A procedure was designed which enabled the detection of ex planta nitrogenase activity in the fast-growing cowpea Rhizobium strain IHP100. Nitrogenase activity in agar culture under air occurred at a rate similar to that found for Bradyrhizobium strain CB756 but lower than that for Rhizobium strain ORS571. Hybridization studies showed that both nod and nif genes were located on a 410-kilobase Sym plasmid in strain IHP100.

  6. Characterization and phylogenetic analysis of biosurfactant-producing bacteria isolated from palm oil contaminated soils

    Directory of Open Access Journals (Sweden)

    Kanokrat Saisa-ard

    2014-04-01

    Full Text Available Biosurfactant-producing bacteria were isolated from 89 different soil samples contaminated with palm oil in 35 palm oil industry sites in the south of Thailand. The phylogenetic diversity of the isolates was evaluated by 16S rRNA gene analysis. Among 1,324 colonies obtained, 134 isolates released extracellular biosurfactant when grown on low-cost substrates by a drop collapsing test. Among these, the 53 isolates that showed the highest biosurfactant production on different substrates were found to belong to 42 different bacterial genera. Among these sixteen (Caryophanon; Castellaniella; Filibacter; Geminicoccus; Georgenia; Luteimonas; Mesorhizobium; Mucilaginibacter; Nubsella; Paracoccus; Pedobacter; Psychrobacter; Rahnella; Sphingobium; Sphingopyxis and Sporosarcina were first reported as biosurfactant-producing strains. By using low-cost, agro-industrial by-products or wastes, Azorhizobium doebereinerae AS54 and Geminicoccus roseus AS73 produced extracellular biosurfactant, which exhibited the lowest surface tension reduction (25.5 mN/m and highest emulsification activity (69.0% when palm oil decanter cake and used palm oil was used as a carbon sources, respectively. Overall, this is the first study of a phylogenetic analysis of biosurfactant-producing bacteria from palm oil refinery industry site and their ability to produce biosurfactant on renewable substrates.

  7. Sesbania rostrata, légumineuse à nodules caulinaires : fixation symbiotique d'azote, et utilisation comme engrais vert

    OpenAIRE

    Moudiongui, A.

    1988-01-01

    Des souches de #Rhizobium$ isolées de #Sesbania rostrata$ provenant de différents lieux géographiques du Sénégal, ont été analysées. Leur comparaison avec la "souche de tige" de référence ORS571 a permis de mettre en évidence des différences au niveau des parentés immunologiques, du contenu plasmidique, de l'activité nitrogénase en condition de dérépression, et de l'efficience de la symbiose. L'azote combiné, ammoniacal ou nitrique affecte à la fois la nodulation et l'activité réductrice d'ac...

  8. SITUACIÓN ACTUAL Y PERSPECTIVA DE LAS RELACIONES ENDÓFITAS PLANTA-BACTERIA. ESTUDIO DE CASO Gluconacetobacter diazotrophicus-CULTIVOS DE IMPORTANCIA ECONÓMICA

    Directory of Open Access Journals (Sweden)

    B. Dibut

    2009-01-01

    Full Text Available En los últimos años, ha ganado especial interés el estudio de las asociaciones endofíticas planta-microoganismos, con énfasis en la introducción en la práctica agrícola de los buenos resultados que se han obtenido en la agrobiología. En este trabajo se ofrece una panorámica de la situación actual y perspectiva de estas asociaciones ilustradas en gran medida por las interacciones Rhizobium-cereales, Azorhizobium-arroz, Azospirillum y Herbaspirillum, al igual que cereales y Gluconacetobacter diazotrophicus con diferentes cultivos. Se plantea un proceso de rotación microbiana que manifiesta la bacteria Rhizobium en las diferentes fases de asociación cíclica en el agroecosistema (leguminosa, nódulo-suelo-gramínea-suelo-leguminosa en función de la fisiología de la productividad y el rendimiento. En el estudio con G. diazotrophicus, en las determinaciones realizadas en viandas tropicales y frutales en las condiciones de Cuba, se encontró una concentración de células de 4.2x105 por gramo de tejido fresco en las plantas bacterizadas y 2.7x102 células por gramo de tejido fresco para las hojas de plantas controles (sin bacterizar; por eso, es necesario aumentar la concentración bacteriana, tanto en las condiciones experimentales como de extensión, para obtener una respuesta favorable del efecto agrobiológico sobre las especies antes relacionadas. La respuesta a la inoculación encontrada para yuca, malanga y papaya constituyen un primer informe mundial. El impacto económico como consecuencia de la inoculación es elevado, con una relación beneficio/ costo superior a 40:1, por lo que resulta una biotecnología sumamente atractiva para ser introducida en el mercado actual de agrobiológicos. Igualmente, el resultado presenta impacto científico, tecnológico, ambiental y social.