WorldWideScience

Sample records for axel patents technology

  1. Patent protection for microbial technologies.

    Science.gov (United States)

    Sherkow, Jacob S

    2017-11-01

    Microbial technologies often serve as the basis of fundamental research tools in molecular biology. These present a variety of ethical, legal and social issues concerning their patenting. This commentary presents several case studies of these issues across three major microbiological tools: CRISPR, viral vectors and antimicrobial resistance drugs. It concludes that the development of these technologies-both scientifically and commercially-depend, in part, on the patent regime available for each, and researchers' willingness to enforce those patents against others. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Technology Clusters Exploration for Patent Portfolio through Patent Abstract Analysis

    Directory of Open Access Journals (Sweden)

    Gabjo Kim

    2016-12-01

    Full Text Available This study explores technology clusters through patent analysis. The aim of exploring technology clusters is to grasp competitors’ levels of sustainable research and development (R&D and establish a sustainable strategy for entering an industry. To achieve this, we first grouped the patent documents with similar technologies by applying affinity propagation (AP clustering, which is effective while grouping large amounts of data. Next, in order to define the technology clusters, we adopted the term frequency-inverse document frequency (TF-IDF weight, which lists the terms in order of importance. We collected the patent data of Korean electric car companies from the United States Patent and Trademark Office (USPTO to verify our proposed methodology. As a result, our proposed methodology presents more detailed information on the Korean electric car industry than previous studies.

  3. Turning Technology into Business Using University Patents

    NARCIS (Netherlands)

    Hartmann, L.

    2014-01-01

    We present an education paradigm that stimulates innovation and entrepreneurship through a master's-level university course: "Turning Technology into Business". The course was specifically designed to connect technological research with education using patented technologies developed at the research

  4. Patent portfolio structure for single technology companies

    OpenAIRE

    Hartwell, Ian P.

    2004-01-01

    Single technology companies (STCs) are defined in this thesis as companies that (a) have the fundamental rights to a new technology, (b) have development of that technology as their core competence, (c) seek to exploit that technology primarily by licensing the patent rights, and (d) are driven primarily by 'technology push'. These factors often result in much of the value of the STC residing in its patent portfolio. This in turn may place significant - and often conflicting - ...

  5. Are Patents used to Suppress Useful Technology?

    DEFF Research Database (Denmark)

    Howells, John

    2006-01-01

    of innovation, other than in the trivial sense of excluding third parties from the right to develop the technology covered by the patent? There are many references to this possibility in the management, economic and legal literatures, but two highly-cited papers stand out for grounding their claims of corporate......This article examines the evidence behind claims that innovation is hindered or blocked (termed technology suppression) by corporations' use of patents. In other words, are there ways in which the exploitation of the exclusive development right of the patent can be shown to retard the process...... and the difference between economic monopoly and an exclusive right. It is argued here that what is at issue in this work is the proper function of the patent institution. It is shown early in this paper that the understanding of the patent institution as a system of development prospects makes better sense...

  6. Patent Keyword Extraction for Sustainable Technology Management

    Directory of Open Access Journals (Sweden)

    Jongchan Kim

    2018-04-01

    Full Text Available Recently, sustainable growth and development has become an important issue for governments and corporations. However, maintaining sustainable development is very difficult. These difficulties can be attributed to sociocultural and political backgrounds that change over time [1]. Because of these changes, the technologies for sustainability also change, so governments and companies attempt to predict and manage technology using patent analyses, but it is very difficult to predict the rapidly changing technology markets. The best way to achieve insight into technology management in this rapidly changing market is to build a technology management direction and strategy that is flexible and adaptable to the volatile market environment through continuous monitoring and analysis. Quantitative patent analysis using text mining is an effective method for sustainable technology management. There have been many studies that have used text mining and word-based patent analyses to extract keywords and remove noise words. Because the extracted keywords are considered to have a significant effect on the further analysis, researchers need to carefully check out whether they are valid or not. However, most prior studies assume that the extracted keywords are appropriate, without evaluating their validity. Therefore, the criteria used to extract keywords needs to change. Until now, these criteria have focused on how well a patent can be classified according to its technical characteristics in the collected patent data set, typically using term frequency–inverse document frequency weights that are calculated by comparing the words in patents. However, this is not suitable when analyzing a single patent. Therefore, we need keyword selection criteria and an extraction method capable of representing the technical characteristics of a single patent without comparing them with other patents. In this study, we proposed a methodology to extract valid keywords from

  7. Technology Trends Analysis Using Patent Landscaping

    Directory of Open Access Journals (Sweden)

    Sergey Vsevolodovich Kortov

    2017-09-01

    Full Text Available The article is devoted to the analysis and the choice of the priorities in technology development and, particularly, to the use of patent landscaping as a tool for the study of technology trends. Currently, patent activity indicators are often used for technology foresight and for competitive intelligence as well. Nevertheless, causal relationship between these indicators, on the one hand, and strategic and tactical decisions in the sphere of technological development on meso- and microeconomic level, on the other hand, are not adequately investigated to solve practical tasks. The goal of the work is to systemize the challenges of technology trends analysis, which could be effectively solved on the base of patent landscape analysis. The article analyses the patent landscaping methodology and tools, as well as their use for evaluating the current competitive environment and technology foresight. The authors formulated the generalized classification for the criteria of promising technologies for a selected region. To assess the compliance of a technology with these criteria, we propose a system of corresponding indicators of patenting activity. Using the proposed methodology, we have analysed the patent landscape to select promising technologies for the Sverdlovsk region. The research confirmed the hypothesis of the patent landscapes performance in evaluating such technology indicators as stages of the life cycle stage, universality (applicability in different industries, pace of worldwide development, innovations and science availability in the region and potential possibilities for scientific collaboration with international research institutions and universities. The results of the research may be useful to the wide audience, including representatives small and medium enterprises, large companies and regional authorities for the tasks concerned with the technology trends analysis and technology strategy design

  8. A Patent Analysis for Sustainable Technology Management

    Directory of Open Access Journals (Sweden)

    Junhyeog Choi

    2016-07-01

    Full Text Available Technology analysis (TA is an important issue in the management of technology. Most R&D (Research & Development policies have depended on diverse TA results. Traditional TA results have been obtained through qualitative approaches such as the Delphi expert survey, scenario analysis, or technology road mapping. Although they are representative methods for TA, they are not stable because their results are dependent on the experts’ knowledge and subjective experience. To solve this problem, recently many studies on TA have been focused on quantitative approaches, such as patent analysis. A patent document has diverse information of developed technologies, and thus, patent is one form of objective data for TA. In addition, sustainable technology has been a big issue in the TA fields, because most companies have their technological competitiveness through the sustainable technology. Sustainable technology is a technology keeping the technological superiority of a company. So a country as well as a company should consider sustainable technology for technological competition and continuous economic growth. Also it is important to manage sustainable technology in a given technology domain. In this paper, we propose a new patent analysis approach based on statistical analysis for the management of sustainable technology (MOST. Our proposed methodology for the MOST is to extract a technological structure and relationship for knowing the sustainable technology. To do this, we develop a hierarchical diagram of technology for finding the causal relationships among technological keywords of a given domain. The aim of the paper is to select the sustainable technology and to create the hierarchical technology paths to sustainable technology for the MOST. This contributes to planning R&D strategy for the sustainability of a company. To show how the methodology can be applied to real problem, we perform a case study using retrieved patent documents related to

  9. Savannah River Site Patented Technologies Summaries

    Energy Technology Data Exchange (ETDEWEB)

    Rabold, D.E.

    1995-07-18

    This information represents SRS`s contribution of the DOE technology information network, an internet service coordinated out of Los Alamos. The information provided is strictly DOE-SR-titled and-issued patented technologies including environmental remediation, robotics, sensors, materials science, biomedical applications, hydrogen, and consumer products.

  10. Patent Value: A Business Perspective for Technology Startups

    OpenAIRE

    Angela de Wilton

    2011-01-01

    In the last year, news headlines have highlighted record patent infringement settlements, multibillion dollar auctions of large corporate patent portfolios, and ongoing patent battles between key technology industry players. Despite this acknowledgment of the significant value of patents for large corporations, many small technology companies are understandably more focused on the near-term costs of obtaining a patent rather than future value. Costs may seem prohibitive to an early stage tech...

  11. Preliminary analysis of patent trends for magnetic fusion technology

    International Nuclear Information System (INIS)

    Levine, L.O.; Ashton, W.B.; Campbell, R.S.

    1984-02-01

    This study presents a preliminary analysis of development trends in magnetic fusion technology based on data from US patents. The research is limited to identification and description of general patent activity and ownership characteristics for 373 patents. The results suggest that more detailed studies of fusion patents could provide useful R and D planning information

  12. 48 CFR 27.204 - Patented technology under trade agreements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patented technology under trade agreements. 27.204 Section 27.204 Federal Acquisition Regulations System FEDERAL ACQUISITION... Patented technology under trade agreements. ...

  13. "Environmental Technology Strengths: International Rankings Based on US Patent Data"

    OpenAIRE

    Dora Marinova; Michael McAleer

    2003-01-01

    Patent information has been used by economists and researchers in the field of innovation to analyse current and forecast future technological directions. The recent surge in patenting activities in developed countries reaffirms the strong position of the patent system in a globalised world dominated by market mechanisms. This paper analyses the technological position of the top twelve foreign patenting countries in the USA, namely Australia, Canada, France, Germany, Italy, Japan, Korea, the ...

  14. Patent Value: A Business Perspective for Technology Startups

    Directory of Open Access Journals (Sweden)

    Angela de Wilton

    2011-12-01

    Full Text Available In the last year, news headlines have highlighted record patent infringement settlements, multibillion dollar auctions of large corporate patent portfolios, and ongoing patent battles between key technology industry players. Despite this acknowledgment of the significant value of patents for large corporations, many small technology companies are understandably more focused on the near-term costs of obtaining a patent rather than future value. Costs may seem prohibitive to an early stage technology startup. Some software startups question whether patents are relevant to their business. In practice, effective intellectual property (IP strategy and management is dependent on many factors, such as technology or industry sector, size and maturity of the business, technology lifecycle, and the business and market environment. IP strategy must be aligned to business strategy from the outset. By considering IP in the broader context of the overall business plan and the competitive environment, opportunities for generating increased return on R&D investment and added business value through patents or other forms of IP can be recognized early on. This approach ensures that a decision about whether or not to patent is driven by business reasons rather than budget constraints. This article examines the costs and benefits of patents from the perspective of early-stage technology startups and growing businesses, and it provides some general guidance on best practices for developing an IP and patent activity plan and for building a patent portfolio that appropriately supports business objectives.

  15. Advances in CO2 capture technology: A patent review

    International Nuclear Information System (INIS)

    Li, Bingyun; Duan, Yuhua; Luebke, David; Morreale, Bryan

    2013-01-01

    Highlights: ► Timely updates on carbon capture technologies: More than 1000 patents on solvent, sorbent, and membrane. ► More patents on solvent and sorbent compared to membrane. ► Environmental and health concerns exist regarding carbon capture technologies. -- Abstract: Carbon dioxide (CO 2 ) emissions are believed to be a major contributor to global warming. As a consequence, large anthropogenic CO 2 sources worldwide will eventually be required to implement CO 2 capture and storage technologies to control CO 2 emissions. In order to guide the establishment of policies for CO 2 removal, we reviewed the current status of CO 2 capture patents and technologies based on the Espacenet patent database and found that more than 1000 patents have been published on sorbent, solvent, and membrane. More than 60% of these patents were published since the year 2000, and a sharp increase in patent numbers was seen in the last several years; ∼25% patents were published in the last 2 years. Substantially more patents on CO 2 removal and separation technologies are expected in the coming years. Meanwhile, the top four major types of patents, which consist of more than 2/3 of these patents, were patents granted by Japan (JP), United States (US), World Intellectual Property Organization (WO), and China (CN), and approximately half of the patents were JP and US patents. Unfortunately, no current technologies for removing CO 2 from large sources like coal-based power plants exist which satisfy the needs of safety, efficiency, and economy; further enhancement and innovation are much needed.

  16. The diffusion of patented oil and gas technology with environmental uses: A forward patent citation analysis

    International Nuclear Information System (INIS)

    Duch-Brown, Néstor; Costa-Campi, María Teresa

    2015-01-01

    Relevant advances in the mitigation of environmental impact could be obtained by the appropriate diffusion of existing environmental technologies. In this paper, we look at the diffusion of knowledge related to environmental technologies developed within the oil and gas industry. To assess knowledge spillovers from oil and gas inventions as a measure of technology diffusion, we rely on forward patent citations methodology. Results show that there is a strong likelihood that the citing patent will be eventually linked to environmental technologies if the original oil and gas invention has already environmental uses. Moreover, both intra and intersectoral spillovers produce a “turnabout” effect, meaning that citing patents show the opposite quality level of the cited patent. Our results support the idea that more sector-specific environmental policies, with an emphasis on diffusion, would significantly improve the use of environmental technologies developed within the oil and gas industry. -- Highlights: •Knowledge spillovers from oil and gas inventions are of an intrasectoral nature. •Environmental uses in original patents diffuse to patents with environmental uses. •The “turnabout” effect converts low quality patents into high quality citing patents. •Diffusion of oil and gas inventions need more ad hoc instruments

  17. Managing the patent thicket and maximizing patent lifetime in vaccine technology.

    Science.gov (United States)

    Mertes, Maria M M; Stötter, Gerd

    2010-10-01

    Patents are exclusive rights for a limited period of time that are granted to provide an incentive for innovation and in exchange for the public disclosure of an invention. Patenting in the medical field, especially in the field of human vaccine technologies, is full of pitfalls, because the products that finally access the market are often covered by a multitude of exclusive IP rights. This commentary gives an overview on obstacles in vaccine patenting and how to overcome them, and intends to provide a patenting guideline for researchers.

  18. Applying patent information to tracking a specific technology

    Directory of Open Access Journals (Sweden)

    Chen-Yuan Liu

    2007-10-01

    Full Text Available Patents in general contain much novel technological information. This paper demonstrates that the usage of patent analysis can facilitate a unique scheme for tracking technology development. In this paper, the walking technique of the Japanese biped robot is tracked as an example. The searching method of the FI (file index and F-term classification system developed by JPO (Japan Patent Office was employed in this study, where all the related patent data were searched from the IPDL (Intellectual Property Digital Library. This study investigated an important technique applied to the humanoid biped robot that imitates the walking behavior of the human beings on two legs. By analyzing the patent information obtained, the relative research capabilities, technical strengths, and patent citation conditions among patent competitors were compared. Furthermore, a formulated technical matrix of patent map is established in this paper to indicate that the ZMP (Zero Moment Point control means is the main technology to achieve stabilized walking control of the humanoid biped robot. This study also incorporates relevant academic journal findings and industrial information. Results presented herein demonstrate that patents can function not only as a map for tracking a technology trajectory, but also as a guide to the main development of a new technology in years to come.

  19. EPA-developed, patented technologies available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  20. Identification and Analysis of Technology Emergence Using Patent Classification

    Science.gov (United States)

    2014-01-01

    and legal time and capital. The desired payoff for this investment is monopolistic control of a section of the technology space, allowed by present...the claims of their application based on either the prior art cited by the patent examiner or economic reali- ties surrounding the markets for...have been developed, the claims of the patents have been tuned and tested at the respective patent office, and market -driven commercial realities may

  1. Patent Strategy at the Age of High Technology

    Science.gov (United States)

    Aoyama, Hirokazu

    This paper is a summary of the lecture which the author presented at the 5th Hokuriku Workshop for Study of Scientific and Technological Information Activities on the 17th of January in 1986. The author analyzed the present situation and made some suggestions on them ; (1) the role of patent system has shifted from introduction of foreign technologies to independent technological development at the age of high technology, (2) circumstances of rapidly increasing international patent war, particularly patent conflict between U.S. and Japan concerning U.S. ITC, (3) as the service of soft aspects of economy has been closed up, the new business has come to the fore front, and the move to consider technology as a good has been activated, (4) how patent specification should be written, the way of obtaining and protecting patent successfully, (5) basic pattern of patent strategy and what the strategy should be to respond to the enterprises level, (6) present situation of patent information service, effective use of patent maps and information strategy.

  2. Technology Transfer Center to Assume Patenting and Licensing Responsibilities | Poster

    Science.gov (United States)

    The NCI Technology Transfer Center (TTC) is undergoing a reorganization that will bring patenting and licensing responsibilities to the Shady Grove and Frederick offices by October 2015. The reorganization is a result of an effort begun in 2014 by NIH to improve the organizational structure of technology transfer at NIH to meet the rapid rate of change within science, technology, and industry, and to better align the science and laboratory goals with the licensing and patenting process.

  3. The internationalisation of technology analysed with patent data

    OpenAIRE

    Bruno Van Pottelsberghe; Dominique Guellec

    2001-01-01

    This paper presents three new patent-based indicators of internationalisation of technology reflecting international co-operation in research and the location of research facilities of multinational firms. They witness both an increasing trend towards the globalisation of technology in the OECD area and large cross-country differences in the extent of internationalisation. An empirical analysis shows that the degree of technological internationalisation is higher for small countries and for c...

  4. Patent Donations: Making Use of the Gift of Technology

    Science.gov (United States)

    Talnack, G. Marie

    2010-01-01

    The lines between basic and applied research and the sectors of the U.S. economy responsible for each type have begun to blur. No better case for the blurring of these lines and the benefits of technology transfer among research institutions can be provided than the recent phenomenon of corporate patent donations to non-profit research…

  5. A new patented building technology based on ancient Roman knowledge

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl

    2010-01-01

    Super-light structures with pearl-chains is a new patented building technology by means of which you can build houses, bridges, tunnels, and even ships with longer spans, less material-, and energy consumption, without scaffolding, and making the use of arches, vaults, domes, ribbed shells, and new...

  6. Research Funding, Patent Search Training and Technology Transfer: a collaboration

    KAUST Repository

    Tyhurst, Janis

    2016-01-01

    This paper will focus on the collaboration efforts of three different university departments to create, teach and evaluate the benefits of a joint patent training series, as well as the future directions this collaboration will take. KAUST has as one of its goals the diversification of the Saudi economy. There is a strong focus at the university on developing entrepreneurial ideas and commercializing research done. The University Library supports this goal through the provision of electronic resources and introductory patent search training skills. However, the patent training class offered by the University Library is only one step in a process that faculty and students need when starting or taking their research to the next level. In the Fall of 2015, I met with representatives of the two major stakeholders in the patent arena, the office of Sponsored Research (OSR) and the Technology Transfer Office (TTO), to develop a patent training program to meet the needs of researchers. The OSR provides funding to researchers who have demonstrated that their ideas have merit with potential applications, the TTO works with researchers who are at the point of needing IP protection. The resulting discussion led us to collaborate on creating a workshop series that benefit the researcher’s information needs and each of our departments as well. In the first of the series of three 2 hour workshops, the Manager of TTO and the Lead Integrative Specialist from the OSR presented a workshop on an overview of Intellectual Property and the patenting process. These presentations focused on when and how to determine whether research is potentially patentable, why a researcher needs to protect his/her research and how to go about protecting it. The second workshop focused on introductory patent search skills and tools, how to expand a literature search to include the information found in patents, and how this kind of research will improve not only the literature search but the research

  7. Do Patents Shield Disclosure or Assure Exclusivity When Transacting Technology?

    OpenAIRE

    Gaétan de Rassenfosse; Alfons Palangkaraya; Elizabeth Webster

    2013-01-01

    Patents may assist trade in technology either by protecting buyers against the expropriation of the idea by third parties (the appropriation effect) or by enabling sellers to more frankly disclose the idea during the negotiation phase (the disclosure effect). We test for the presence of both these effects using quasi-experimental matching analysis on a novel dataset of 860 technology transaction negotiations. We identify the appropriation effect by comparing the probability of successful nego...

  8. Lessons from patents. Using patents to measure technological change in environmental models

    International Nuclear Information System (INIS)

    Popp, David

    2005-01-01

    When studying solutions to long-term environmental problems such as climate change, it is important to consider the role that technological change may play. Nonetheless, to date few economic models of environmental policy explicitly model the link between policy and technological change. There is a growing body of evidence that the incentives offered by prices and environmental regulations have a strong influence on both the creation and adoption of new technologies. In several recent papers, I have used patent data to examine the links between environmental policy and technological change. In addition, I have used the results of this research to calibrate the ENTICE model (for ENdogenous Technological change) of climate change, which links energy-related R and D to changes in the price of carbon. Drawing on my experiences from empirical studies on innovation and from modeling the climate change problem, in this paper I review some of the key lessons from recent empirical work using patents to study environmental innovation and diffusion, and discuss its implications for modeling climate change policy. I conclude by offering suggestions for future research

  9. Patent Information Use in Engineering Technology Design: An Analysis of Student Work

    Science.gov (United States)

    Phillips, Margaret; Zwicky, Dave

    2017-01-01

    How might engineering technology students make use of patent information in the engineering design process? Librarians analyzed team project reports and personal reflections created by students in an undergraduate mechanical engineering technology design course, revealing that the students used patents to consider the patentability of their ideas,…

  10. Analysis of the BEV Technology Progress of America, Europe, Japan and Korea Based on Patent Map

    Science.gov (United States)

    Yurong, Huang; Yuanyuan, Hou; Jingyan, Zhou; Ru, Liu

    2018-02-01

    The paper analyzed the Battery Electric Vehicle patent application trend, major country distribution, main technology layout and patentee of America, Europe, Japan and Korea based on patent information from 2006 to 2016 by using patent map method, and visualized the Battery Electric Vehicle technology progress conditions of the four countries and regions in the last decade.

  11. Technology and industrialization in Spanish economy from 1950 to 1960: the patents as technological activity indicators

    International Nuclear Information System (INIS)

    Hidalgo Nuchera, A.; Molero Zayas, J.; Granda Gayo, I.

    2007-01-01

    The goal of this research is to study the innovative activity developed in the fifties by the Spanish industry focussing on the foreign technology incorporated in the activity of several industrial sectors. The structure of innovation in each sector has been characterized by using patents as technological activity indicators. The data of patents registered in Spain belonging to the 1950-1960 period have been obtained taking into account the research developed by the Department of Business Administration of the Universidad Politecnica de Madrid through a subsidy granted by the Spanish Patent Office. (Author)

  12. Technological Monitoring Study Based on Invention Patents of Omeprazoleand Derivatives with Pharmaceutical Applications

    Directory of Open Access Journals (Sweden)

    Leandra Guimarães de Oliveira

    2010-11-01

    Full Text Available The current study intends to present the relevance of omeprazole, esomeprazole, rabeprazole, pantoprazole and lansoprazole by means of the technological foresight study, through invention patent documents from Brazilian applicants as indicators of innovation. The European database of patents (Espacenet, Word Patent Index (DERWENT and the Brazilian Patent Base of INPI were used, combining keywords and International Patent Classifications. The major applicants, countries of publication and claims categories were mapped. The 212 patent requests collected are mainly distributed in Chemistry, Pharmacy and Pharmacology areas. The results obtained revealed that the US was the main country with studies directed to this technological area (59 patent applications and the major applicant was the company Astrazeneca AB. Therefore, we can understand that this is a promising technology that may reflect in an increase of R&D activities and patent applications in this area.

  13. Research on Technology Innovation of China's NEV Industry Based on Patent Analysis

    DEFF Research Database (Denmark)

    Wang, Jingyu; Liu, Yingqi; Kokko, Ari

    2016-01-01

    Purpose/Significance: The development of Chinas new energy vehicle(NEV) industry is concerned by both the government and enterprises. Method/Process: Based on the patent data, this paper conducts a deep analysis on the technology innovation of Chinas NEV industry from three perspectives- the year...... distribution of the patent, the distribution of the patent applicants and the distribution of patent technology area. Then, the paper makes further correlation analysis on the NEV industry chain and the patent data. Result/Conclusion: In general,the paper comprehensively reflects the whole picture of Chinas...... NEV industry technology innovation and gives some ideas for its further development....

  14. Pre-empted Patents, Infringed Patents and Firms’ Participation in Markets for Technology

    DEFF Research Database (Denmark)

    Grimpe, Christoph; Hussinger, Katrin

    2014-01-01

    In recent years, firms have increasingly contributed to and been confronted with a patent landscape characterized by numerous but marginal inventions, overlapping claims and patent fences. As a result, firms risk their patent applications to be pre-empted or to be infringed upon by rivals. While...... patents on firms’ engagement in in- and cross-licensing. Based on a sample of more than 1100 German manufacturing firms our results show that firms engage in in-licensing as a reaction to pre-empted patents and in cross-licensing if their protected IP was infringed upon. However, these effects vary...

  15. Valuing patents on cost-reducing technology: A case study

    NARCIS (Netherlands)

    van Triest, S.P.; van de Vis, Wim

    2007-01-01

    We present an approach for valuing patents on production process improvements. Specifically, we focus on valuing a patent on cost-reducing process improvements from the viewpoint of the patent holding firm. We do this by considering the relevant cash flows that result from owning the patent. The

  16. The European Patent System: Dealing with emerging technologies.

    NARCIS (Netherlands)

    Kica, Evisa; Groenendijk, Nico

    2011-01-01

    In light of recent controversial patent decisions in biotechnology, this article argues that the current European patent examination and opposition procedures do not suffice to balance the patent system These procedures do not provide sufficient guidance for patent examiners to deal effectively with

  17. Measuring patent quality and national technological capacity in cross-country comparison

    OpenAIRE

    Boeing, Philipp; Müller, Elisabeth

    2016-01-01

    China recently surpassed the USA as the greatest global source of patent applications. However, without internationally comparable measures of patent quality it remains questionable whether China's patent expansion constitutes the rise of a new technological superpower. Our novel quality index is based on citations from international search reports and provides internationally comparable, quality-adjusted figures for applications made under the Patent Cooperation Treaty (PCT). We show that Ch...

  18. 14 CFR 1274.906 - Designation of New Technology Representative and Patent Representative.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Designation of New Technology... Conditions § 1274.906 Designation of New Technology Representative and Patent Representative. Designation of New Technology Representative and Patent Representative July 2002 (a) For purposes of administration...

  19. Firms’ Negative Perceptions on Patents, Technology Management Strategies, and Subsequent Performance

    Directory of Open Access Journals (Sweden)

    Eun Jin Han

    2017-03-01

    Full Text Available While patents do have many advantages, their disadvantages include requiring disclosure of technical information and imposing the burden of patenting and litigation costs. In this study, we investigate the relationship between a firm’s negative perception on patents, technology management strategies, and subsequent performance. For this purpose, we use a categorical canonical correlation analysis of the top 200, large, R&D-intensive firms in Korea. We find that negative perceptions such as burdensome transaction costs, non-patenting culture, and uncertainty of the outcome of patent litigation are associated with firms’ technology management strategies, such as purchase of licenses, and subsequent performance, such as an increase in the number of inventions from the cross-fertilization of different technologies. The results of this study are expected to contribute to a better understanding of firms’ negative attitudes toward the effects of patents, their subsequent technology management strategies, and resulting performance.

  20. Monitoring innovation in electrochemical energy storage technologies: A patent-based approach

    International Nuclear Information System (INIS)

    Mueller, Simon C.; Sandner, Philipp G.; Welpe, Isabell M.

    2015-01-01

    Highlights: • Grid effects of intermittent sources show increasing need for decentralized storage. • Novel patent classification is applied to monitor competing technologies. • Up-to-date geographical, organizational, and qualitative insight is given. • Redox flow patenting shows strong growth, lithium also strong absolute numbers. • Revealed patents allow the expectation of improved modules in the future. - Abstract: Due to the suitability to balance the intermittency in decentralized systems with renewable sources, electrochemical energy storage possibilities have been analyzed in several studies, all highlighting the need for improvements in relevant techno-economic parameters. Particularly a reduction in the costs per cycle is much needed, which could either come from innovation in more cost-efficient manufacturing methods, a higher endurance of charge/discharge sequences or higher capacities. Looking at patent applications as a metric allows us to determine whether the necessary technological progress is indeed occurring, as the mandatory publication of the underlying inventions provides access to otherwise hidden R and D activities. Our paper contributes to the literature with a compilation of technological classes related to important battery types in the novel Cooperative Patent Classification (CPC), which can be used to identify relevant patent applications of the competing technologies. Using the worldwide patent statistical database (PATSTAT), we find that promising technologies have been showing increasing patent counts in recent years. For example, the number of patent applications related to regenerative fuel cells (e.g. redox flow batteries) doubled from 2009 to 2011. Nevertheless, the volume of patent filings in technologies related to lithium remains unchallenged. Patent applications in this area are still growing, which indicates that the introduction of improved modules will continue. Using citation analysis, we have identified

  1. AXEL-2016: Introduction to Particle Accelerators

    CERN Multimedia

    2016-01-01

    AXEL-2016 is the latest in a yearly lecture series on particle accelerators given at CERN within the framework of the 2016 Technical Training Programme. As part of the BE department's Operation group’s shutdown lecture series, this general accelerator physics module has been offered since 2003 as a joint venture between the BE department and the Technical Training team and is open to the wider CERN community.    The lecturer is Rende Steerenberg, deputy leader of the Operation group and PS section leader. Programme: basic mathematics; transverse optics; lattice calculations; resonances; longitudinal motion; transfer lines, injection and ejection; longitudinal and transverse beam instabilities; colliders. A detailed programme is available on the AXEL-2016 webpage. Target audience: designed for technicians who are operating an accelerator or whose work is closely linked to accelerators, but also open to technicians, engineers and physicists interested i...

  2. A Survival Analysis on Fuel Cell Technology Patent Maintenance and Values Exploration between 1976 and 2001

    Directory of Open Access Journals (Sweden)

    Seng-Su Tsang

    2015-01-01

    Full Text Available Fuel cell R&D activities desirably arrive in patents; the costly maintenance fee challenges managers as well as researchers to whether or not renew existing patents. The key is, will the fuel cell patent’s value be worth renewing? Thus assessment of patent value is essential. Our study focus online searching was made available after 1976, as the initial year to conduct the patent search. Up to 2001, there are 2269 patents classified in the H01M 008/00~H01M 008/24 category, which is the category concerning fuel cell under the classification of the International Patent Classification. Effective exploitation of technology values is subject to the complementarities of organizational resources. The present study used the emerging technology of Fuel Cells as an example to show that firms may commercialize the values of technology according to their organizational resources. By aligning firms’ patenting strategies and the imparities between book values and market values this study concludes a technological ambidexterity with respect to firms’ technology development. The exploitative firms tend to file patents to defend their leadership in the product market as a result their technology is constrained within a firm’s boundaries. The results show that patent renewing decisions are consequence of firm’s constraints of complementary resources.

  3. An Interval Estimation Method of Patent Keyword Data for Sustainable Technology Forecasting

    Directory of Open Access Journals (Sweden)

    Daiho Uhm

    2017-11-01

    Full Text Available Technology forecasting (TF is forecasting the future state of a technology. It is exciting to know the future of technologies, because technology changes the way we live and enhances the quality of our lives. In particular, TF is an important area in the management of technology (MOT for R&D strategy and new product development. Consequently, there are many studies on TF. Patent analysis is one method of TF because patents contain substantial information regarding developed technology. The conventional methods of patent analysis are based on quantitative approaches such as statistics and machine learning. The most traditional TF methods based on patent analysis have a common problem. It is the sparsity of patent keyword data structured from collected patent documents. After preprocessing with text mining techniques, most frequencies of technological keywords in patent data have values of zero. This problem creates a disadvantage for the performance of TF, and we have trouble analyzing patent keyword data. To solve this problem, we propose an interval estimation method (IEM. Using an adjusted Wald confidence interval called the Agresti–Coull confidence interval, we construct our IEM for efficient TF. In addition, we apply the proposed method to forecast the technology of an innovative company. To show how our work can be applied in the real domain, we conduct a case study using Apple technology.

  4. 48 CFR 1852.227-72 - Designation of new technology representative and patent representative.

    Science.gov (United States)

    2010-10-01

    ... CONTRACT CLAUSES Texts of Provisions and Clauses 1852.227-72 Designation of new technology representative... of New Technology Representative and Patent Representative (JUL 1997) (a) For purposes of administration of the clause of this contract entitled “New Technology” or “Patent Rights—Retention by the...

  5. 77 FR 7095 - Transitional Program for Covered Business Method Patents-Definition of Technological Invention

    Science.gov (United States)

    2012-02-10

    ... 0651-AC75 Transitional Program for Covered Business Method Patents-- Definition of Technological... definition of technological invention that the Board will use in conducting transitional covered business... definition for covered business method patent in proposed Sec. 42.301(a). Additionally, the Office in a...

  6. 48 CFR 18.119 - Use of patented technology under the North American Free Trade Agreement.

    Science.gov (United States)

    2010-10-01

    ... under the North American Free Trade Agreement. 18.119 Section 18.119 Federal Acquisition Regulations... Available Acquisition Flexibilities 18.119 Use of patented technology under the North American Free Trade Agreement. Requirement to obtain authorization prior to use of patented technology may be waived in...

  7. Erving Goffman og Axel Honneth - Anerkendelse og krænkelse

    OpenAIRE

    Hansen, Annemette E

    2006-01-01

    En kombination af Erving Goffmans teorier om stigma og rollespil og Axel Honneths anerkendelsesteori En kombination af Erving Goffmans teorier om stigma og rollespil og Axel Honneths anerkendelsesteori

  8. EPA-developed, patented technologies related to water monitoring and remediation that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  9. EPA-developed, patented technologies related to vehicles and fuel emissions

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  10. EPA-developed, patented technologies related to pollution prevention that are available for licensing.

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  11. EPA-developed, patented technologies related to air quality that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  12. EPA-developed, patented technologies related to waste that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  13. A patent survey case: how could technological forecasting help cosmetic chemists with product innovation?

    Science.gov (United States)

    Domicio Da Silva Souza, Ivan; Juliana Pinheiro, Bárbara; Passarini Takahashi, Vania

    2012-01-01

    Patents represent a free and open source of data for studying innovation and forecasting technological trends. Thus, we suggest that new discussions about the role of patent information are needed. To illustrate the relevance of this issue, we performed a survey of patents involving skin care products, which were granted by the United States Patent and Trademark Office (USPTO) between 2006 and 2010, to identify opportunities for innovation and technological trends. We quantified the use of technologies in 333 patents. We plotted a life cycle of technologies related to natural ingredients. We also determined the cross impact of the technologies identified. We observed technologies related to processes applied to cosmetics (2.2%), functional packaging and applicators (2.9%), excipients and active compounds (21.5%), and cosmetic preparations (73.5%). Further, 21.6% of the patents were related to the use of natural ingredients. Several opportunities for innovation were discussed throughout this paper, for example, the use of peptides as active compounds or intracellular carriers (only 3.9% of the technologies in cosmetic preparations). We also observed technological cross impacts that suggested a trend toward multifunctional cosmetics, among others. Patent surveys may help researchers with product innovation because they allow us to identify available and unexplored technologies and turn them into whole new concepts.

  14. Technological Foresight Based on Citing and Cited Patents of Cellulose with Pharmaceutical Aplications.

    Directory of Open Access Journals (Sweden)

    Deysimar de Souza Carvalho

    2009-12-01

    Full Text Available The present study intends to present the relevance of cellulose by means of the technological foresight study through citing and cited documents from a patent application (WO 9745131 A1 as indicators of innovation. The European database of patents (espacenet was used, combining keywords and IPC. The major applicants, countries of publication and uses were mapped. The patent requests collected are mainly distributed in the area of polymers to medical devices and therapeutic methods that utilize cellulose. The results obtained revealed that the US were the main country with studies directed to this technological area (18 patent applications and the major applicant was the company Micro Therapeutics Inc. Therefore, we can understand that this is a promising technology that may reflect in an increase of R&D activities and in the patent deposits in this area.

  15. Making Patent Scopes Exceed the Technological Scopes of Scientific Inventions

    DEFF Research Database (Denmark)

    Beukel, Karin

    This paper presents the results of a grounded theory study of the transformation of scientific discoveries into patented inventions. Using an algebraic interpretive approach, the narratives collected during interviews are analyzed as Bayesian inferences and the developed theory is tested. The fin...... for searching in new directions for solutions if challenges of exploitation with regard to the scientific invention arise.......This paper presents the results of a grounded theory study of the transformation of scientific discoveries into patented inventions. Using an algebraic interpretive approach, the narratives collected during interviews are analyzed as Bayesian inferences and the developed theory is tested....... The findings recast the relationship between science and patents as a process in which the way the transformation of the scientific invention is handled has an effect on the breadth of the patent scope. Unleashing patent scope surplus is dependent on processes related to abstraction and cognitive variety...

  16. Delineating the scientific footprint in technology: Identifying scientific publications within non-patent references.

    NARCIS (Netherlands)

    Callaert, J.; Grouwels, J.; van Looy, Bart

    2012-01-01

    Indicators based on non-patent references (NPRs) are increasingly being used for measuring and assessing science–technology interactions. But NPRs in patent documents contain noise, as not all of them can be considered ‘scientific’. In this article, we introduce the results of a machine-learning

  17. A Short Course on Patent Reference for Science and Technology Librarians

    Science.gov (United States)

    Shackle, Linda

    2009-01-01

    Now that the full text of patents as well as patent searching tools are available for free on the Internet, every librarian who is responsible for assisting people with science and technology information should have a basic knowledge of this aspect of intellectual property. Whether a school librarian helping children discover the world of…

  18. Patterns of technological innovation and evolution in the energy sector: A patent-based approach

    International Nuclear Information System (INIS)

    Lee, Kyungpyo; Lee, Sungjoo

    2013-01-01

    Given the ever-increasing pace and complexity of technological innovation in the energy sector, monitoring technological changes has become of strategic importance. One of the most common techniques for technology monitoring is patent analysis, which enables the identification of technological trends over time. However, few previous studies have carried out patent analysis in the energy sector. This study aims to explore patterns of innovation and of evolution in energy technologies, particularly focusing on similarities and differences across technologies. For this purpose, we first defined the relevant energy technologies and extracted the associated patent data from the United States Patents and Trademark Office (USPTO) and then adopted six patent indices and developed six patent maps to analyze their innovation characteristics. We then clustered energy technologies with similar characteristics, so defining innovation categories, and analyzed the changes in these characteristics over time to define their evolution categories. As one of the few attempts to investigate the overall trends in the energy sector's innovation and evolution, this study is expected to help develop an in-depth understanding of the energy industry, which will be useful in establishing technology strategies and policy in this rapidly changing sector. - Highlights: • We examined the patterns of innovation and evolution of energy technologies. • Six types of innovation patterns such as “competitive” or “mature” were identified. • Six types of evolution patterns such as “towards closed innovation” were identified. • The patterns of evolution were related to the patterns of innovation

  19. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis

    OpenAIRE

    Chen, Ning; Liu, Yun; Cheng, Yijie; Liu, Long; Yan, Zhe; Tao, Lixin; Guo, Xiuhua; Luo, Yanxia; Yan, Aoshuang

    2015-01-01

    Influenza virus vaccine (IVV) is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this pa...

  20. 14 CFR 1260.58 - Designation of new technology representative and patent representative.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Designation of new technology... of new technology representative and patent representative. Designation of New Technology... of this grant entitled “New Technology,” the following named representatives are hereby designated by...

  1. Research and Development Strategy in Biological Technologies: A Patent Data Analysis of Japanese Manufacturing Firms

    Directory of Open Access Journals (Sweden)

    Hidemichi Fujii

    2016-04-01

    Full Text Available Biological technology allows us to invent new medical approaches, create effective food production methods and reserves and develop new materials for industrial production. There is a diversity of biological technology types, and different technologies have different priorities for invention. This study examines the factors that are important for the invention of biology-related technologies in Japan using patent application data and a decomposition analysis framework. As the results show, patent applications related to biochemistry and biotechnology increased until 1995 because of the expanded scale of R&D activities and the high priority assigned to biological technology. However, the number of patent applications stagnated after 1995, because the importance of biochemistry, especially waste-gas treatment technologies, decreased. Additionally, patent applications for medicines and disease-related technologies increased rapidly from 1971 to 1995. The primary determinant of rapid growth is an increase in research priority, especially among firms in the chemical industry whose technologies are related to supplemental foods and foods with health-promoting benefits. Finally, patent applications involving foodstuff- and agriculture-related technologies increased from 1971 to 1995 due to increased R&D and the increased priority of biological technology.

  2. Holding a candle to innovation in concentrating solar power technologies: A study drawing on patent data

    International Nuclear Information System (INIS)

    Braun, Frauke G.; Hooper, Elizabeth; Wand, Robert; Zloczysti, Petra

    2011-01-01

    Improved understanding of the innovative pathways of renewable energy technologies is vital if we are to make the transition to a low carbon economy. This study presents new evidence on innovation and industry dynamics in concentrating solar power (CSP) technologies. Though CSP is undergoing a renaissance, existing innovation studies have explored innovative activity in solar technologies in general, ignoring the major differences between solar photovoltaic and CSP technologies. This study, based on patent data, examines the level and dynamics of innovative activity in CSP between 1978 and 2004. Our unique contribution, based on engineering expertise and detailed datawork, is a classification system mapping CSP technologies to the International Patent Classification (IPC) system. The innovation performance of CSP is found to be surprisingly weak compared to the patent boom in other green technologies. Performance was strong around 1980 before falling dramatically, and has only recently begun to show signs of recovery. Innovation and R and D are concentrated in high-tech countries; the US, Germany and Japan, which do not necessarily have high domestic CSP potential. Large CSP potential is, therefore, not a sufficient condition for innovation. Innovators must possess economic and scientific capabilities. - Research highlights: → We develop a new classification system which allows us to map innovation in CSP technologies to the International Patent Classification System. → Evidence of innovation patterns in concentrating solar power technologies is presented. → Innovation performance in CSP is surprisingly weak compared to patenting in other green technologies, despite its strong potential as a low carbon power generation technology.

  3. DEVELOPING TECHNOLOGICAL INNOVATIONS ON THE BASES OF THE WORLD PATENT INFORMATION

    Directory of Open Access Journals (Sweden)

    N. A. KAMENEVA

    2015-04-01

    Full Text Available To ensure the innovative growth and progressive economic performance in high-technology industries, or at least to keep them at a fixed level it is necessary for the industrial enterprises to conduct scientific research and inventive activities through developing technological innovations and also through supporting, completing, replenishing, updating one of the most important intangible components of the business – patent resources: protective documents on inventions, industrial designs, utility models, trademarks etc. Scientific-and-engineering information, contained in international patent funds, allows determining the world state of the art, registering and securing the company’s exclusive patent rights to the innovations. This work presents the method of obtaining patent information in Russia by means of using various Russian and international databases and abstract journals that can help to investigate the world state of art in a given technological field.

  4. Optimal Selection Method of Process Patents for Technology Transfer Using Fuzzy Linguistic Computing

    Directory of Open Access Journals (Sweden)

    Gangfeng Wang

    2014-01-01

    Full Text Available Under the open innovation paradigm, technology transfer of process patents is one of the most important mechanisms for manufacturing companies to implement process innovation and enhance the competitive edge. To achieve promising technology transfers, we need to evaluate the feasibility of process patents and optimally select the most appropriate patent according to the actual manufacturing situation. Hence, this paper proposes an optimal selection method of process patents using multiple criteria decision-making and 2-tuple fuzzy linguistic computing to avoid information loss during the processes of evaluation integration. An evaluation index system for technology transfer feasibility of process patents is designed initially. Then, fuzzy linguistic computing approach is applied to aggregate the evaluations of criteria weights for each criterion and corresponding subcriteria. Furthermore, performance ratings for subcriteria and fuzzy aggregated ratings of criteria are calculated. Thus, we obtain the overall technology transfer feasibility of patent alternatives. Finally, a case study of aeroengine turbine manufacturing is presented to demonstrate the applicability of the proposed method.

  5. 48 CFR 27.204-1 - Use of patented technology under the North American Free Trade Agreement.

    Science.gov (United States)

    2010-10-01

    ... under the North American Free Trade Agreement. 27.204-1 Section 27.204-1 Federal Acquisition Regulations... Patents and Copyrights 27.204-1 Use of patented technology under the North American Free Trade Agreement... the patent holder is from a country that is a party to the North American Free Trade Agreement (NAFTA...

  6. 48 CFR 970.2770-3 - Technology transfer and patent rights.

    Science.gov (United States)

    2010-10-01

    ... cooperative research and development agreements with public and private entities for purposes of conducting research and development and transferring technology to the private sector. In implementing the NCTTA, DOE....2770-3 Technology transfer and patent rights. The National Competitiveness Technology Transfer Act of...

  7. 48 CFR 970.3102-05-30-70 - Patent costs and technology transfer costs.

    Science.gov (United States)

    2010-10-01

    ... technology transfer costs. 970.3102-05-30-70 Section 970.3102-05-30-70 Federal Acquisition Regulations System... Principles and Procedures 970.3102-05-30-70 Patent costs and technology transfer costs. (a) For management and operating contracts that do not include the clause at 970.5227-3, Technology Transfer Mission, the...

  8. Innovation in clean coal technologies. Empirical evidence from firm-level patent data

    Energy Technology Data Exchange (ETDEWEB)

    Kruse, Juergen [Koeln Univ. (Germany). Dept. of Economics; Koeln Univ. (Germany). Energiewirtschaftliches Inst.; Wetzel, Heike [Kassel Univ. (Germany). Inst. of Economics

    2016-02-15

    This article empirically analyzes supply-side and demand-side factors expected to a.ect innovation in clean coal technologies. Patent data from 93 national and international patent offices is used to construct new firm-level panel data on 3,648 clean coal innovators over the time period 1978 to 2009. The results indicate that on the supply-side a firm¡¯s history in clean coal patenting and overall propensity to patent positively a.ects clean coal innovation. On the demand-side we find strong evidence that environmental regulation of emissions, that is CO{sub 2}, NO{sub X} and SO{sub 2}, induces innovation in both efficiency improving combustion and after pollution control technologies.

  9. Patenting Bioprinting Technologies in the US and Europe– The 5th element in the 3rd dimension"

    DEFF Research Database (Denmark)

    Minssen, Timo; Mimler, Marc

    2017-01-01

    of bioprinting- inventions are being patented or would be- protectable under European and US patent laws. Rather than focusing on the highly relevant questions that 3D printing poses for patent infringement doctrines and research exemptions , this paper concentrates on the question of patentable subject matter......, “Patenting Bioprinting Technologies in the US and Europe– The 5th element in the 3rd dimension", Working Paper, forthcoming in: RM Ballardini, M Norrgård & J Partanen (red), 3D printing, Intellectual Property and Innovation – Insights from Law and Technology. Wolters Klu. Available at https...

  10. Research Funding, Patent Search Training and Technology Transfer: a collaboration

    KAUST Repository

    Tyhurst, Janis

    2016-01-01

    The third session builds on the first two by focusing in on how to evaluate a patent’s quality, how to read the patent to find the critical point(s) of the claim(s) being made, and free tools that will assist in evaluating the “intellectual space” around the claim(s) that will help focus and direct current and future research. This session is presented by another member of the TTO.

  11. Comparative analysis between academic and patent publications based on Fenton Technologies among China, Brazil, and the rest of the world.

    Science.gov (United States)

    de Luna, Airton José; Santos, Douglas Alves

    2017-03-01

    Worldwide, year by year, Fenton's Technologies have been highlighted in both academic and patent scopes, in part due to their proven efficiency as environment-friendly technologies destined to the abatement of organic pollutants, and also by their growing interest to produce industrial applications. Thus, aiming to understand the effective dynamic between two worlds, academy vs patents, the present study performs a comparative analysis about publications on Fenton-based Technologies (FbT). Therefore, in this work, technological foresight techniques were adopted focusing on patent and non-patent databases, employing for this, the Web of Science (WoS) database as a prospecting tool. The main results for the last decade point out to a strong increment of the Fenton's Technologies, as much in R&D as in patent applications in the world. Chinese Universities and firms command the scenario. There is an expressive gap between the academic and patent issues.

  12. A Study on Diffusion Pattern of Technology Convergence: Patent Analysis for Korea

    Directory of Open Access Journals (Sweden)

    Jae Young Choi

    2015-08-01

    Full Text Available Technology convergence indicates that technologies of different application areas are converted into a new and common unity of technology. Its range spans from inter-field, whereby technologies are converged between heterogeneous fields in homogeneous sector, to a wider inter-sector, whereby technologies belong to heterogeneous technology sector are converged. This paper determined the definition of technology convergence from previous literature and classified patents into technology category depending on patent information. Furthermore, we empirically measure technology convergence degree based on co-classification analysis and estimate its diffusion trend at the entire technology domain level by using overall 1,476,967 of patents filed to the KIPO (Korean Intellectual Property Office from 1998 to 2010. As a result, potential size and growth rate of technology convergence are varied by both technology and type of technology convergence, i.e., inter-field and inter-sector technology convergence. Diffusion pattern of inter-sector technology convergence appears as the more various form than that of inter-field technology convergence. In a relationship between potential size and growth rate of technology convergence, growth rate of technology convergence is in inverse proportion to potential size of technology convergence in general. That is, the faster the growth rate of technology convergence, the smaller the potential size of technology convergence. In addition, this paper found that technology convergence of the instrument and chemistry sector is actively progressing in both inter-field and inter-sector convergence, while the technologies related to Information and Communication Technology (ICT in electrical engineering sector have relatively mature progress of technology convergence, especially in inter-sector technology convergence.

  13. Knowledge flows, patent citations and the impact of science on technology

    NARCIS (Netherlands)

    Nomaler, Z.O.; Verspagen, B.

    2008-01-01

    Technological innovation depends on knowledge developed by scientific research. The number of citations made in patents to the scientific literature has been suggested as an indicator of this process of transfer of knowledge from science to technology. We provide an intersectoral insight into this

  14. Knowledge flows, patent citations and the impact of science on technology

    NARCIS (Netherlands)

    Nomaler, Z.O.; Verspagen, B.

    2007-01-01

    Technological innovation depends on knowledge developed by scientific research. The num-ber of citations made in patents to the scientific literature has been suggested as an indicator of this process of transfer of knowledge from science to technology. We provide an intersec-toral insight into this

  15. Energy prices, technological knowledge and green energy innovation. A dynamic panel analysis of patent counts

    International Nuclear Information System (INIS)

    Kruse, Juergen; Wetzel, Heike; Koeln Univ.

    2014-01-01

    We examine the effect of energy prices and technological knowledge on innovation in green energy technologies. In doing so, we consider both demand-pull effects, which induce innovative activity by increasing the expected value of innovations, and technology-push effects, which drive innovative activity by extending the technological capability of an economy. Our analysis is conducted using patent data from the European Patent Office on a panel of 26 OECD countries over the period 1978-2009. Utilizing a dynamic count data model for panel data, we analyze 11 distinct green energy technologies. Our results indicate that the existing knowledge stock is a significant driver of green energy innovation for all technologies. Furthermore, the results suggest that energy prices have a positive impact on innovation for some but not all technologies and that the e.ect of energy prices and technological knowledge on green energy innovation becomes more pronounced after the Kyoto protocol agreement in 1997.

  16. Innovation in concentrating solar power technologies: A study drawing on patent data

    OpenAIRE

    Braun, Frauke G.; Hooper, Elizabeth; Wand, Robert; Zloczysti, Petra

    2010-01-01

    Better understanding the innovative process of renewable energy technologies is important for tackling climate change. Though concentrating solar power is receiving growing interest, innovation studies so far have explored innovative activity in solar technologies in general, ignoring the major differences between solar photovoltaic and solar thermal technologies. This study relies on patent data to examine international innovative activity in concentrating solar power technologies. Our uniqu...

  17. Impact of energy technology patents in China: Evidence from a panel cointegration and error correction model

    International Nuclear Information System (INIS)

    Li, Ke; Lin, Boqiang

    2016-01-01

    Enhancing energy technology innovation performance, which is widely measured by energy technology patents through energy technology research and development (R&D) activities, is a fundamental way to implement energy conservation and emission abatement. This study analyzes the effects of R&D investment activities, economic growth, and energy price on energy technology patents in 30 provinces of China over the period 1999–2013. Several unit root tests indicate that all the above variables are generated by panel unit root processes, and a panel cointegration model is confirmed among the variables. In order to ensure the consistency of the estimators, the Fully-Modified OLS (FMOLS) method is adopted, and the results indicate that R&D investment activities and economic growth have positive effects on energy technology patents while energy price has a negative effect. However, the panel error correction models indicate that the cointegration relationship helps to promote economic growth, but it reduces R&D investment and energy price in the short term. Therefore, market-oriented measures including financial support and technical transformation policies for the development of low-carbon energy technologies, an effective energy price mechanism, especially the targeted fossil-fuel subsidies and their die away mode are vital in promoting China's energy technology innovation. - Highlights: • Energy technology patents in China are analyzed. • Relationship between energy patents and funds for R&D activities are analyzed. • China's energy price system hinders energy technology innovation. • Some important implications for China's energy technology policy are discussed. • A panel cointegration model with FMOLS estimator is used.

  18. Spreadsheet Patents

    DEFF Research Database (Denmark)

    Borum, Holger Stadel; Kirkbro, Malthe Ettrup; Sestoft, Peter

    2018-01-01

    This technical report gives a list of US patents and patent applications related to spreadsheet implementation technology. It is intended as a companion to the monograph Spreadsheet Implementation Technology (Peter Sestoft, MIT Press 2014), and substantially extends and updates an appendix from...

  19. TECHNOLOGICAL INFORMATION REGARDING PREBIOTICS AND PROBIOTICS NUTRITION VERSUS THE PATENT REGISTERS: WHAT IS NEW?

    Science.gov (United States)

    Reis, José Maciel Caldas Dos; Pinheiro, Maurício Fortuna; Oti, André Takashi; Feitosa-Junior, Denilson José Silva; Pantoja, Mauro de Souza; Barros, Rui Sérgio Monteiro

    2016-01-01

    Food is a key factor both in prevention and in promoting human health. Among the functional food are highlighted probiotics and prebiotics. Patent databases are the main source of technological information about innovation worldwide, providing extensive library for research sector. Perform mapping in the main patent databases about pre and probiotics, seeking relevant information regarding the use of biotechnology, nanotechnology and genetic engineering in the production of these foods. Electronic consultation was conducted (online) in the main public databases of patents in Brazil (INPI), United States (USPTO) and the European Patent Bank (EPO). The research involved the period from January 2014 to July 2015, being used in the title fields and summary of patents, the following descriptors in INPI "prebiotic", "prebiotic" "probiotics", "probiotic" and the USPTO and EPO: "prebiotic", "prebiotics", "probiotic", "probiotics". This search haven't found any deposit at the brazilian patents website (INPI) in this period; US Patent &Trademark Office had registered 60 titles in patents and the European Patent Office (EPO) showed 10 documents on the issue. Information technology offered by genetic engineering, biotechnology and nanotechnology deposited in the form of titles and abstracts of patents in relation to early nutritional intervention as functional foods, has increasingly required to decrease the risks and control the progression of health problems. But, the existing summaries, although attractive and promising in this sense, are still incipient to recommend them safely as a therapeutic tool. Therefore, they should be seen more as diet elements and healthy lifestyles. A alimentação é fator primordial tanto na prevenção quanto na promoção para a saúde humana. Dentre os alimentos funcionais destacam-se os probióticos e prebióticos. Os bancos de dados de patentes representam a maior fonte de informação tecnológica acerca de inovação em nível mundial

  20. What Drives the International Transfer of Climate Change Mitigation Technologies? Empirical Evidence from Patent Data

    International Nuclear Information System (INIS)

    Dechezleprete, A.; Glachant, M.; Meniere, Y.

    2010-01-01

    Using patent data from 66 countries for the period 1990-2003, we characterize the factors which promote or hinder the international diffusion of climate-friendly technologies on a global scale. Regression results show that technology-specific capabilities of the recipient countries are determinant factors. In contrast, the general level of education is less important. We also show that restrictions to international trade - e.g., high tariff rates - and to a lesser extent lax intellectual property regimes negatively influence the international diffusion of patented knowledge. A counter-intuitive result is that barriers to foreign direct investments can promote transfers. We discuss different possible interpretations. (authors)

  1. Prospects and trends in the development of terahertz technologies: patent landscape

    Directory of Open Access Journals (Sweden)

    D. А. Usanov

    2017-01-01

    Full Text Available The article is dedicated to the analysis of areas where terahertz radiation is applicable with the hwlp of a patent papers review, as well as to obtaining knowledge about the invention activity changes in this area over the past 35 years.Orbit patent databases’ capabilities were used to complete this analysis. Data search was conducted by keywords “terahertz” or “THz.” The searches were neither limited by submission dates, by priorities, nor by the country. A comprehensive analysis will allow to determine a more than 7389 patent-analog families’ aplications submitted in the period between 1980 and 2017 years. Statistical processing of obtained documents has been completed with the assistance of program software, indicated in the database. It was revealed that terahertz technologies have significant prospects to be applied in various areas; a fact, that is confirmed by an identified range of fields, where electromagnetic radiation of terahertz spectrum is applicable and is constantly growing. The dynamics of patenting is characterized by annual stable positive growth in the number of applications for inventions in the researched area. The highest number of inventions was identified in the field of instrumentation technologies, optics, telecommunications, semiconductor technologies, and medicine. Additionally, there was analyzed the state of patenting over the course of last five years. Examples of inventions were given. There were identified leading countries and companies in the researched area.

  2. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis

    Science.gov (United States)

    Liu, Long; Yan, Zhe; Tao, Lixin; Guo, Xiuhua; Luo, Yanxia; Yan, Aoshuang

    2015-01-01

    Influenza virus vaccine (IVV) is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this paper (a) designs the technology classification system and search strategy for the identification of IVV; and (b) presents a longitudinal analysis of the global IVV development based on the European Patent Office (EPO) patents. Bibliometric analysis is used to rank countries, institutions, inventors and technology subfields contributing to IVV technical progress. The results show that the global trends of IVV are a multi-developing feature of variety but an uneven technical resource distribution. Although the synthetic peptide vaccine is a comparatively young field, it already demonstrates the powerful vitality and the enormous development space. With the worldwide competition increasing, all nations especially China should be looking to increase devotion, enhance capability and regard effectiveness of technological innovation. PMID:26372160

  3. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis.

    Science.gov (United States)

    Chen, Ning; Liu, Yun; Cheng, Yijie; Liu, Long; Yan, Zhe; Tao, Lixin; Guo, Xiuhua; Luo, Yanxia; Yan, Aoshuang

    2015-01-01

    Influenza virus vaccine (IVV) is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this paper (a) designs the technology classification system and search strategy for the identification of IVV; and (b) presents a longitudinal analysis of the global IVV development based on the European Patent Office (EPO) patents. Bibliometric analysis is used to rank countries, institutions, inventors and technology subfields contributing to IVV technical progress. The results show that the global trends of IVV are a multi-developing feature of variety but an uneven technical resource distribution. Although the synthetic peptide vaccine is a comparatively young field, it already demonstrates the powerful vitality and the enormous development space. With the worldwide competition increasing, all nations especially China should be looking to increase devotion, enhance capability and regard effectiveness of technological innovation.

  4. Technology Resource, Distribution, and Development Characteristics of Global Influenza Virus Vaccine: A Patent Bibliometric Analysis.

    Directory of Open Access Journals (Sweden)

    Ning Chen

    Full Text Available Influenza virus vaccine (IVV is a promising research domain that is closely related to global health matters, which has been acknowledged not only by scientists and technology developers, but also by policy-makers. Meanwhile, patents encompass valuable technological information and reflect the latest technological inventions as well as the innovative capability of a nation. However, little research has examined this up-and-coming research field using patent bibliometric method. Thus, this paper (a designs the technology classification system and search strategy for the identification of IVV; and (b presents a longitudinal analysis of the global IVV development based on the European Patent Office (EPO patents. Bibliometric analysis is used to rank countries, institutions, inventors and technology subfields contributing to IVV technical progress. The results show that the global trends of IVV are a multi-developing feature of variety but an uneven technical resource distribution. Although the synthetic peptide vaccine is a comparatively young field, it already demonstrates the powerful vitality and the enormous development space. With the worldwide competition increasing, all nations especially China should be looking to increase devotion, enhance capability and regard effectiveness of technological innovation.

  5. Conditions of the potential for commercialization of the patent: the implementation of a technology public offering system technology at CNEN

    International Nuclear Information System (INIS)

    Archila, Daniela Lima Cerqueira

    2015-01-01

    This dissertation identifies the main factors which represent the conditions for the potential commercialization of patents aiming at the implementation of a system for technology public offering at CNEN as a strategy for creating licensing opportunities to the industrial sector. The method applied refers to an exploratory case study of a patented technology selected from a sample of CNEN's patent portfolio in the biopharmaceutical sector. The case study comprehends a field research of interviews conducted with two specialists in technology and innovation management, one researcher from CNEN and a biopharmaceutical company. The results show that among the nineteen main factors - related to technology, market, business and Science and Technology Organization (STO) - the market dynamics, the potential applications of the technology and an abstract of its main benefits compared to existing technologies are the major relevant information for each technology to be included in the public offering system. Other results indicate that the evaluation of such factors may be conducted by competent professionals to bring less uncertainty and risk to the early-stage of the innovation process, as well as enhance the potential interest of a company in the technology. On the other hand, the latter requires innovation capabilities to move the technology forward – additional R&D, scale-up, manufacturing and marketing - whilst the STO needs a entrepreneurial culture that mitigates its obstacles, creates more positive solutions for its routines and processes and gives sustainability to its Technology Transfer Office (TTO) through valuing its personnel in the long term. Finally, emphasis on technological partnerships with companies can be a motivating feature for directing the STO's patent strategy to the creation of proprietary technological platforms that reflect problems experienced by the commercial environment, as well as the development of this strategic patent

  6. The Investigation of the European and Eurasian Markets for Technologies: Ukraine in Regional Patent Spaces

    Directory of Open Access Journals (Sweden)

    Grytsulenko Svitlana I.

    2017-05-01

    Full Text Available The exclusive right to intellectual property acts as a universally recognized tool of the modern competitive struggle for the markets for goods and technologies, which actualizes the issue of Ukraine’s participation in this process. For this purpose, based on the data from the European, Eurasian and world patent statistics, the article measures the level of inventive activity of Ukraine in the nearest regional markets for technologies. Among the relevant quantitative and qualitative indicators for the evaluation of the patenting in Ukraine and leading countries of Europe and Eurasia there analyzed: the total volume and dynamics of filing patent applications; the total volume and specific weight of patent portfolios; the high-tech patenting. Based on the results of the study, the corresponding conclusions are drawn. In particular, the huge gap between Ukraine and leaders of inventive activity predetermined the absence of any significant influence of the country on the development of innovative markets in Europe and Eurasia. The decrease in Ukraine’s striving to succeed in the above mentioned ones leads to the loss of both promising markets and entire sectors of the national economy.

  7. 75 FR 34988 - Notice of Intent To Grant Exclusive Patent License; Fiber Optic Sensor Systems Technology...

    Science.gov (United States)

    2010-06-21

    ...; Fiber Optic Sensor Systems Technology Corporation AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant to Fiber Optic Sensor... inventions described in U.S. Patent No. 7,149,374: Fiber Optic Pressure Sensor, Navy Case No. 84,557.//U.S...

  8. 77 FR 73456 - Notice of Intent To Grant Exclusive Patent License; Fiber Optic Sensor Systems Technology...

    Science.gov (United States)

    2012-12-10

    ...; Fiber Optic Sensor Systems Technology Corporation AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant to Fiber Optic Sensor... Modulated Fiber Optic Pressure Sensor, Navy Case No. 83,816.//U.S. Patent No. 7,149,374: Fiber Optic...

  9. 48 CFR 3027.208 - Use of patented technology under the North American Free Trade Agreements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Use of patented technology under the North American Free Trade Agreements. 3027.208 Section 3027.208 Federal Acquisition... American Free Trade Agreements. (f) Contracting officers shall ensure compliance. ...

  10. EPA-developed, patented technologies related to miscellaneous areas of environmental experties and invention that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  11. EPA-developed, patented technologies related to contaminated sites and hazardous substances that are available for licensing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Under the Federal Technology Transfer Act (FTTA), Federal Agencies can patent inventions developed during the course of research. These technologies can then be...

  12. New patent in sight for CERN-made technology

    CERN Multimedia

    Antonella Del Rosso

    2014-01-01

    A portable gamma and beta radiation survey meter capable of operating in a strong magnetic field is the most recent subject of a CERN patent application. Developed by members of the HSE Unit, the new instrument may find applications not only in research laboratories but also in hospitals where radioactivity is managed in the presence of magnetic fields.   The new instrument consists of two parts: an active probe and a counting unit. Inside the probe, a scintillating crystal sends its signal to a photo detection module, which in turn is connected to the electronics. The counting unit is a portable box to be fixed on the operator’s waist. Tested in a magnetic field up to 1 Tesla, this innovative radiation survey meter has an operating range of a fraction of µSv/h to 1 mSv/h for the ambient dose equivalent rate, and 45 keV – 1.3 MeV for photon energy, with a fast response. “The instrument is the result of a collaboration between CERN and the Milan Politecnico ...

  13. Understanding the development trends of low-carbon energy technologies: A patent analysis

    International Nuclear Information System (INIS)

    Albino, Vito; Ardito, Lorenzo; Dangelico, Rosa Maria; Messeni Petruzzelli, Antonio

    2014-01-01

    Highlights: • Governments’ strategies set important frameworks to develop and sustain low-carbon energy technologies. • Commercial activities play a key role in the low-carbon energy technologies’ development. • The number of patents that are based upon basic research is growing. - Abstract: Eco-innovations are being recognized as fundamental means to foster sustainable development, as well as to create new business opportunities. Nowadays, the eco-innovation concept is gaining ground within both academic and practitioner studies with the attempt to better understand the main dynamics underlying its nature and guide policymakers and companies in supporting its development. This paper contributes to the extant literature on eco-innovation by providing a comprehensive overview of the evolution of a specific type of eco-innovations that are playing a crucial role in the current socio-economic agenda, namely low-carbon energy technologies. Accordingly, we focus our attention on the related patenting activity of different countries and organizations over time, as well as on influencing policy initiatives and events. Hence, we collected 131,661 patents granted at the United States Patent and Trademark Office (U.S.PTO.) between 1971 and 2010, and belonging to the “Nuclear power generation”, “Alternative energy production”, and “Energy conservation” technological classes, as indicated by the International Patent Classification (IPC) Green Inventory. Our findings report the development trends of low-carbon energy technologies, as well as identify major related environmental programs, historical events, and private sector initiatives explaining those trends, hence revealing how these different circumstances have significantly influenced their development over time

  14. Longitudinal Patent Analysis for Nanoscale Science and Engineering: Country, Institution and Technology Field

    International Nuclear Information System (INIS)

    Huang Zan; Chen Hsinchun; Yip, Alan; Ng, Gavin; Guo Fei; Chen Zhikai; Roco, Mihail C.

    2003-01-01

    Nanoscale science and engineering (NSE) and related areas have seen rapid growth in recent years. The speed and scope of development in the field have made it essential for researchers to be informed on the progress across different laboratories, companies, industries and countries. In this project, we experimented with several analysis and visualization techniques on NSE-related United States patent documents to support various knowledge tasks. This paper presents results on the basic analysis of nanotechnology patents between 1976 and 2002, content map analysis and citation network analysis. The data have been obtained on individual countries, institutions and technology fields. The top 10 countries with the largest number of nanotechnology patents are the United States, Japan, France, the United Kingdom, Taiwan, Korea, the Netherlands, Switzerland, Italy and Australia. The fastest growth in the last 5 years has been in chemical and pharmaceutical fields, followed by semiconductor devices. The results demonstrate potential of information-based discovery and visualization technologies to capture knowledge regarding nanotechnology performance, transfer of knowledge and trends of development through analyzing the patent documents

  15. Longitudinal Patent Analysis for Nanoscale Science and Engineering: Country, Institution and Technology Field

    Science.gov (United States)

    Huang, Zan; Chen, Hsinchun; Yip, Alan; Ng, Gavin; Guo, Fei; Chen, Zhi-Kai; Roco, Mihail C.

    2003-08-01

    Nanoscale science and engineering (NSE) and related areas have seen rapid growth in recent years. The speed and scope of development in the field have made it essential for researchers to be informed on the progress across different laboratories, companies, industries and countries. In this project, we experimented with several analysis and visualization techniques on NSE-related United States patent documents to support various knowledge tasks. This paper presents results on the basic analysis of nanotechnology patents between 1976 and 2002, content map analysis and citation network analysis. The data have been obtained on individual countries, institutions and technology fields. The top 10 countries with the largest number of nanotechnology patents are the United States, Japan, France, the United Kingdom, Taiwan, Korea, the Netherlands, Switzerland, Italy and Australia. The fastest growth in the last 5 years has been in chemical and pharmaceutical fields, followed by semiconductor devices. The results demonstrate potential of information-based discovery and visualization technologies to capture knowledge regarding nanotechnology performance, transfer of knowledge and trends of development through analyzing the patent documents.

  16. 48 CFR 27.204-2 - Use of patented technology under the General Agreement on Tariffs and Trade (GATT).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Use of patented technology... Regulations System FEDERAL ACQUISITION REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND... and Trade (GATT). Article 31 of Annex 1C, Agreement on Trade-Related Aspects of Intellectual Property...

  17. The Role of Mobile Technology in Tourism: Patents, Articles, News, and Mobile Tour App Reviews

    Directory of Open Access Journals (Sweden)

    Dongwook Kim

    2017-11-01

    Full Text Available The purpose of this research is to identify the status and role of mobile technology in achieving sustainable and smart tourism, and to suggest future research and strategy directions for academia and managers in practice. This research utilized multiple sources, such as patents, academic articles, and news, and selected methodologies optimized for the purpose of each study. Study 1 used Netminer, a social network analysis program, to analyze the relationships between patent’s International Patent Classification (IPC codes. Study 2 used the T-LAB program for content analysis to analyze the texts of patents, journal articles, and news. Study 3 used the Leximancer program, which utilizes relative frequency to analyze mobile app consumer reviews. In study 1, we identified various forms of data related technologies and mobile technologies for smart city systems and maps. In study 2, we found the environment, sustainability, business, and market themes to be related to mobile technology. In study 3, we explored consumers’ attitudes and preferences for mobile travel app using their reviews. Advances in mobile technology are expected to create innovative experiences for consumers, foster a sustainable competitive advantage for tourism destinations and tourism-related suppliers, and create sustainable competencies for smart tourism.

  18. Technological Change in a Small European Country: A Patent- Based Analysis for Greece

    OpenAIRE

    Maria Markatou

    2012-01-01

    The description of the development of the Greek technological change is the main aim of this paper. The analysis is based on the examination and elaboration of patent records and relies on the study of their technological content and their economic direction. Results show that technological change focuses on producing new technologies for the ‘agricultural sector’, ‘food’, ‘pharmaceuticals’, ‘metal shaping-separation’, ‘rubber-plastic products’, ‘building-housing’, ‘instruments’ and ‘electric...

  19. Technology Analysis of Global Smart Light Emitting Diode (LED Development Using Patent Data

    Directory of Open Access Journals (Sweden)

    Sangsung Park

    2017-08-01

    Full Text Available Technological developments related to smart light emitting diode (LED systems have progressed rapidly in recent years. In this paper, patent documents related to smart LED technology are collected and analyzed to understand the technology development of smart LED systems. Most previous studies of the technology were dependent on the knowledge and experience of domain experts, using techniques such as Delphi surveys or technology road-mapping. These approaches may be subjective and lack robustness, because the results can vary according to the selected expert groups. We therefore propose a new technology analysis methodology based on statistical modeling to obtain objective and relatively stable results. The proposed method consists of visualization based on Bayesian networks and a linear count model to analyze patent documents related to smart LED technology. Combining these results, a global hierarchical technology structure is created that can enhance the sustainability in smart LED system technology. In order to show how this methodology could be applied to real-world problems, we carry out a case study on the technology analysis of smart LED systems.

  20. Nanotechnology and patents in agriculture, food technology, nutrition and medicine - advantages and risks: worldwide patented nano- and absorber particles in food nutrition and agriculture.

    Science.gov (United States)

    Benckiser, Gero

    2012-12-01

    The keywords nanotechnology, super absorber, agriculture, nutrition, and food technology exhibited 28,149 positive matches under more than 68 million patents worldwide. A closer look at the first 500 nanotechnology, agriculture, nutrition and biotechnology related patents, published during 2011-2012, unveiled that 64% are parts of machines and control devices while about 36% comprise metal oxides, fertilizers, pesticides and drugs, which are compounds and often applied in combination with inorganic or organic super absorbing polymeric structures. The latter compounds are in the focus of this special issue.

  1. International Technology Diffusion of Joint and Cross-border Patents

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2013-01-01

    textabstractWith the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth, every country has

  2. International Technology Diffusion of Joint and Cross-border Patents

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2015-01-01

    markdownabstract__Abstract__ With the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth, every

  3. International Technology Diffusion of Joint and Cross-border Patents

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2015-01-01

    markdownabstract__Abstract__ With the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth,

  4. Are Lipases Still Important Biocatalysts? A Study of Scientific Publications and Patents for Technological Forecasting.

    Science.gov (United States)

    Daiha, Karina de Godoy; Angeli, Renata; de Oliveira, Sabrina Dias; Almeida, Rodrigo Volcan

    2015-01-01

    The great potential of lipases is known since 1930 when the work of J. B. S. Haldane was published. After eighty-five years of studies and developments, are lipases still important biocatalysts? For answering this question the present work investigated the technological development of four important industrial sectors where lipases are applied: production of detergent formulations; organic synthesis, focusing on kinetic resolution, production of biodiesel, and production of food and feed products. The analysis was made based on research publications and patent applications, working as scientific and technological indicators, respectively. Their evolution, interaction, the major players of each sector and the main subject matters disclosed in patent documents were discussed. Applying the concept of technology life cycle, S-curves were built by plotting cumulative patent data over time to monitor the attractiveness of each technology for investment. The results lead to a conclusion that the use of lipases as biocatalysts is still a relevant topic for the industrial sector, but developments are still needed for lipase biocatalysis to reach its full potential, which are expected to be achieved within the third, and present, wave of biocatalysis.

  5. Technological Monitoring Applied to Survey-Based on Brazilian Patent Applications about PEMFC

    Directory of Open Access Journals (Sweden)

    Deysimar de Souza Carvalho

    2011-06-01

    Full Text Available The present study aims to show the importance of patents as an instrument of technological innovation and to assess the relevance of technology of PEMFC in Brazil by means of the technological monitoring methodology from 1996 to 2005. This study used different Industrial Property Databases (INPI-BR, ESPACENET and DWPI, in order to retrieve the BR applications in each database. Relevant keywords as “fuel cell” were used in combination with specific IPC (H01M8 in order to assess the main applicants, countries, IPCs and technological innovation over time. In Brazil, the country holding more requests in this area is the United States (US with 53,7% of the patent applications, while Brazil (BR accounts for 4,4% of the total requests. It was also observed that the North-American company, UTC Fuel Cells comes on top of the list and that there were no patent applications of Brazilian origin (BR in other countries.

  6. The Technology Trend of Japanese Patent for the Nuclear Fuel Assembly Inspection

    International Nuclear Information System (INIS)

    Cho, Jai Wan; Choi, Young Soo; Lee, Nam Ho; Jeong, Kyung Min; Suh, Yong Chil; Kim, Chang Hoi; Shin, Jung Cheol

    2008-06-01

    Japanese technology patents for the nuclear fuel assembly inspection unit, from the year 1993 to the year 2006, were investigated. The fuel rods which contain fissile material are grouped together in a closely-spaced array within the fuel assembly. Various kinds of reactor including the PWR reactor are being operated in Japan. There are many kinds of nuclear fuel assemblies in Japan, and the shape and the size of these nuclear fuel assemblies are various also. As the structure of these various fuel assemblies is a regular square as the same as the Korean one, the inspection method described in Japanese technology patent can be applied to the inspection of the nuclear fuel assembly of the Korea. This report focuses on advances in VIT(visual inspection test) of nuclear fuel assembly using the state-of-the-art CCD camera system

  7. The Technology Trend of Japanese Patent for the Nuclear Fuel Assembly Inspection

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jai Wan; Choi, Young Soo; Lee, Nam Ho; Jeong, Kyung Min; Suh, Yong Chil; Kim, Chang Hoi; Shin, Jung Cheol

    2008-06-15

    Japanese technology patents for the nuclear fuel assembly inspection unit, from the year 1993 to the year 2006, were investigated. The fuel rods which contain fissile material are grouped together in a closely-spaced array within the fuel assembly. Various kinds of reactor including the PWR reactor are being operated in Japan. There are many kinds of nuclear fuel assemblies in Japan, and the shape and the size of these nuclear fuel assemblies are various also. As the structure of these various fuel assemblies is a regular square as the same as the Korean one, the inspection method described in Japanese technology patent can be applied to the inspection of the nuclear fuel assembly of the Korea. This report focuses on advances in VIT(visual inspection test) of nuclear fuel assembly using the state-of-the-art CCD camera system.

  8. Technology and industrialization in Spanish economy from 1950 to 1960: the patents as technological activity indicators; Tecnologia e industrializacion en la economia espanola de 1950 a 1960: Nueva evidencia a partir de datos de patentes

    Energy Technology Data Exchange (ETDEWEB)

    Hidalgo Nuchera, A.; Molero Zayas, J.; Granda Gayo, I.

    2007-07-01

    The goal of this research is to study the innovative activity developed in the fifties by the Spanish industry focussing on the foreign technology incorporated in the activity of several industrial sectors. The structure of innovation in each sector has been characterized by using patents as technological activity indicators. The data of patents registered in Spain belonging to the 1950-1960 period have been obtained taking into account the research developed by the Department of Business Administration of the Universidad Politecnica de Madrid through a subsidy granted by the Spanish Patent Office. (Author)

  9. Patent Assessment Quality

    DEFF Research Database (Denmark)

    Burke, Paul F.; Reitzig, Markus

    2006-01-01

    The increasing number of patent applications worldwide and the extension of patenting to the areas of software and business methods have triggered a debate on "patent quality". While patent quality may have various dimensions, this paper argues that consistency in the decision making on the side...... of the patent office is one important dimension, particularly in new patenting areas (emerging technologies). In order to understand whether patent offices appear capable of providing consistent assessments of a patent's technological quality in such novel industries from the beginning, we study the concordance...... of the European Patent Office's (EPO's) granting and opoposition decisions for individual patents. We use the historical example of biotech patens filed between 1978 until 1986, the early stage of the industry. Our results indicate that the EPO shows systematically different assessments of technological quality...

  10. The Population Ecology of Technology: An Empirical Study of US Biotechnology Patents from 1976 to 2003

    Science.gov (United States)

    van den Oord, Ad; van Witteloostuijn, Arjen

    2017-01-01

    A detailed understanding of technological change as an evolutionary process is currently not well understood. To increase our understanding, we build upon theory from organizational ecology to develop a model of endogenous technological growth and determine to what extent the pattern of technological growth can be attributed to the structural or systemic characteristics of the technology itself. Through an empirical investigation of patent data in the biotechnology industry from 1976 to 2003, we find that a technology’s internal (i.e., density and diversity) ecological characteristics have a positive effect on its growth rate. The niche’s external characteristics of crowding and status have a negative effect on its growth rate. Hence, applying theory from organizational ecology increases our understanding of technological change as an evolutionary process. We discuss the implications of our findings for the study of technological growth and evolution, and suggest avenues for further research. PMID:28081570

  11. Patent applications for using DNA technologies to authenticate medicinal herbal material

    Directory of Open Access Journals (Sweden)

    Chan Albert

    2009-11-01

    Full Text Available Abstract Herbal medicines are used in many countries for maintaining health and treating diseases. Their efficacy depends on the use of the correct materials, and life-threatening poisoning may occur if toxic adulterants or substitutes are administered instead. Identification of a medicinal material at the DNA level provides an objective and powerful tool for quality control. Extraction of high-quality DNA is the first crucial step in DNA authentication, followed by a battery of DNA techniques including whole genome fingerprinting, DNA sequencing and DNA microarray to establish the identity of the material. New or improved technologies have been developed and valuable data have been collected and compiled for DNA authentication. Some of these technologies and data are patentable. This article provides an overview of some recent patents that cover the extraction of DNA from medicinal materials, the amplification of DNA using improved reaction conditions, the generation of DNA sequences and fingerprints, and the development of high-throughput authentication methods. It also briefly explains why these patents have been granted.

  12. Measuring science–technology interactions using patent citations and author-inventor links: an exploration analysis from Chinese nanotechnology

    International Nuclear Information System (INIS)

    Wang Gangbo; Guan Jiancheng

    2011-01-01

    This article contributes to the growing study on the interactions between science and technology with China’s evidence in the field of nanotechnology, based on the database of United States Patent and Trademark Office. The analysis is focused during the period of 1991–2008, a rapid increasing period for the development of nanotechnology. Using the non-patent references cited by patents, we first investigate the science–technology connections in the context of Chinese nanotechnology, especially in institutional sectors and its application fields. Those patents, produced by academic researchers and directed towards basic scientific knowledge, generally cite more scientific references with a higher proportion of self-citations. It is interesting to find that patents contributed by collaborations between public organizations and corporations seldom contain scientific references. Following an interesting path on matching the data of publications and patents, we establish the author-inventor links in this emerging field. Author-inventors, who are co-active in publishing and patenting, are at the very top of the most prolific and highly cited researchers. Finally, we employ social network analysis to explore the characteristics of scientific and technological networks generated by co-authorship and co-invention data, to investigate the position and the role of patenting–publishing scientists in these research networks.

  13. Technical training: AXEL-2008 - Introduction to Particle Accelerators

    CERN Multimedia

    2008-01-01

    CERN Technical Training 2008: Learning for the LHC! AXEL-2008 is a course series on particle accelerators, given at CERN within the framework of the AB Operation Group Shut-down Lectures. Since 2003, this course has been organized as a joint venture between the AB Department and Technical Training and is open to a wider CERN community. The AXEL-2008 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is also open to technicians, engineers and physicists interested in this field. The course does not require any prior knowledge of accelerators. However, some basic knowledge of trigonometry, matrices and differential equations and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) from 29th January to 1st February 2008, and given in English with questions and answers als...

  14. Technical training: AXEL-2012 - Introduction to Particle Accelerators

    CERN Multimedia

    HR Department

    2011-01-01

    CERN Technical Training 2012: Learning for the LHC! AXEL-2012 is a course series on particle accelerators, given at CERN within the framework of the Technical Training Program. Being part of BE Department’s Operation Group Shutdown Lecture series, the general accelerator physics module is organized since 2003 as a joint venture between the BE Department and Technical Training, and is open to a wider CERN community. The AXEL-2012 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) from the 16th – 20th of January 2012, and given in English with ...

  15. Technical Training: AXEL-2005 - Introduction to Particle Accelerators

    CERN Multimedia

    Monique Duval

    2005-01-01

    CERN Technical Training 2005: Learning for the LHC! AXEL-2005 is a course series on particle accelerators, given at CERN within the framework of the 2005 Technical Training Programme. Known in the past as the PS Complex Operation Course (or the 'PS Shutdown Course', now AB/OP), the general accelerator physics section is organised since 2003 as a joint venture between the AB department and Technical Training, and is open to a wider CERN community. The AXEL-2005 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to all people (technicians, engineers, physicists) interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course will be given in French on course supports in English; questions and answers possible in both languages. AXEL-2005 - I...

  16. Patents as instruments for exploring innovation dynamics: geographic and technological perspectives on “photovoltaic cells”

    NARCIS (Netherlands)

    Leydesdorff, L.; Alkemade, F.; Heimeriks, G.; Hoekstra, R.J.

    2015-01-01

    The recently developed Cooperative Patent Classifications of the U.S. Patent and Trade Office (USPTO) and the European Patent Office (EPO) provide new options for an informed delineation of samples in both USPTO data and the Worldwide Patent Statistical Database (PatStat) of EPO. Among the

  17. Conditions of the potential for commercialization of the patent: the implementation of a technology public offering system technology at CNEN; Condicionantes do potencial de exploracao comercial da patente: a implantacao de um sistema de oferta publica de tecnologia na CNEN

    Energy Technology Data Exchange (ETDEWEB)

    Archila, Daniela Lima Cerqueira

    2015-07-01

    This dissertation identifies the main factors which represent the conditions for the potential commercialization of patents aiming at the implementation of a system for technology public offering at CNEN as a strategy for creating licensing opportunities to the industrial sector. The method applied refers to an exploratory case study of a patented technology selected from a sample of CNEN's patent portfolio in the biopharmaceutical sector. The case study comprehends a field research of interviews conducted with two specialists in technology and innovation management, one researcher from CNEN and a biopharmaceutical company. The results show that among the nineteen main factors - related to technology, market, business and Science and Technology Organization (STO) - the market dynamics, the potential applications of the technology and an abstract of its main benefits compared to existing technologies are the major relevant information for each technology to be included in the public offering system. Other results indicate that the evaluation of such factors may be conducted by competent professionals to bring less uncertainty and risk to the early-stage of the innovation process, as well as enhance the potential interest of a company in the technology. On the other hand, the latter requires innovation capabilities to move the technology forward – additional R&D, scale-up, manufacturing and marketing - whilst the STO needs a entrepreneurial culture that mitigates its obstacles, creates more positive solutions for its routines and processes and gives sustainability to its Technology Transfer Office (TTO) through valuing its personnel in the long term. Finally, emphasis on technological partnerships with companies can be a motivating feature for directing the STO's patent strategy to the creation of proprietary technological platforms that reflect problems experienced by the commercial environment, as well as the development of this strategic patent

  18. Scientific production and technological production: transforming a scientific paper into patent applications.

    Science.gov (United States)

    Dias, Cleber Gustavo; Almeida, Roberto Barbosa de

    2013-01-01

    Brazil has been presenting in the last years a scientific production well-recognized in the international scenario, in several areas of knowledge, according to the impact of their publications in important events and especially in indexed journals of wide circulation. On the other hand, the country does not seem to be in the same direction regarding to the technological production and wealth creation from the established scientific development, and particularly from the applied research. The present paper covers such issue and discloses the main similarities and differences between a scientific paper and a patent application, in order to contribute to a better understanding of both types of documents and help the researchers to chose and select the results with technological potential, decide what is appropriated for industrial protection, as well as foster new business opportunities for each technology which has been created.

  19. Innovation in the U.S. building sector: An assessment of patent citations in building energy control technology

    International Nuclear Information System (INIS)

    Altwies, Joy E.; Nemet, Gregory F.

    2013-01-01

    Buildings are crucial to addressing energy problems because they are large consumers of end-use energy, and potential exists to dramatically improve their efficiencies. However, the pace of innovation in buildings is generally characterized as inadequate, despite the implementation of an array of policy instruments aimed at promoting efficiency. The literature on innovation in the building industry provides several explanations including: fragmented decision-making, principal agent problems, inadequate information, and limited learning across heterogeneous projects. We investigate the innovation process for buildings in the U.S. with a case study of patenting in energy management control systems (EMCS) for commercial buildings and programmable thermostats (PT) for residential buildings. Using U.S. patent data, we find that: (1) patenting activity peaked around 1980, subsequently declined, and then increased considerably in the past decade; (2) commercial, rather than residential, buildings account for the recent increase; and (3) building control technologies have benefitted from inventions originating outside the industry, notably from electronics and computers, with a shift toward the latter in recent years. - Highlights: ► We investigate the innovation process for buildings in the U.S. using patents. ► We use commercial and residential building controls technology as a case study. ► Patenting peaked around 1980, declined, and then increased in the past decade. ► Commercial building control patents account for most of the recent increase. ► Inventions in electronics and computers have led to innovation in building controls.

  20. Study the content relationship between science and technology documents: A compression of papers and patent in Autonomous Underwater Vehicle Dominos

    Directory of Open Access Journals (Sweden)

    Soraia Zolfaghari

    2016-08-01

    Full Text Available The current research aims at studying the conceptual relationship between the science and technology documents through the comparison of vocabularies that are used within the patents and the papers in the field of Autonomous Underwater Vehicles (AUV.  The research method is descriptive. To perform the research, the patents were retrieved from Google Patents and Lens websites, and the papers from IEEE Explore database. A hybrid keyword-class method was used to conduct the search. It means that the search query was consisted of "Autonomous Underwater Vehicle" keyword and “H” class. The titles and the abstracts of the patents and the papers were automatically indexed through a semi-automatic method. This resulted in 195 keywords for patents and 114 ones for papers. Co-occurrence matrices of these two sets of keywords were created through RavarMatrix software. The hierarchical maps of keywords were drawn by SPSS. Findings show that 65 percent of papers’ keywords are those that occurred within the patents but 23 percent of patents’ keywords are similar to the papers’.  The structural comparison of patents and papers clustering’s also revealed that the structural proximity between patents and papers vocabularies is equal to zero. The other finding showed that the similarity between the members of ego networks of prominent keywords is for two cases zero and for others fewer than 15 percent except for the keyword “data”. It may be concluded that the science is affected by technology in the field of AUV.

  1. Lovely but dangerous: The impact of patent citations on patent duration

    OpenAIRE

    Maurseth, Per Botolf

    2001-01-01

    - What is the impact of patent citations on patent renewal behaviour? Patent citations are commonly used as an indicator of technology spillovers. For cited patents therefore, patent citations have a potentially ambiguous impact. On the one hand, patent citations may indicate a scientific breakthrough, a high value of the cited patent and therefore a long survival period. On the other hand, patent citations may indicate competing innovations that render the cited patent obsolete. By discri...

  2. What drives innovation in nuclear reactors technologies? An empirical study based on patent counts

    International Nuclear Information System (INIS)

    Berthelemy, Michel

    2012-01-01

    This paper examines the evolution of innovation in nuclear power reactors between 1974 and 2008 in twelve OECD countries and assesses to what extent nuclear innovation has been driven by economic incentives, political decisions and safety regulation considerations. We use priority patent applications related to Nuclear Power Plants (NPPs) as a proxy for innovating activity. Our results highlight that nuclear innovation is partly driven by the conventional paradigm where both demand-pull, measured by NPPs constructions in the innovating country and in the rest of the world, and technology-push, measured by Research and Development (R and D) expenditures specific to NPPs, have a positive and significant impact on innovation. Our results also evidence that the impact of public R and D expenditures and national NPPs construction on innovation is stronger when the quality of innovation, measured by forward patent citations, is taken into account, and have a long run positive impact on innovation through the stock of knowledge available to innovators. In contrast, we show that political decisions following the Three Miles Island and Chernobyl nuclear accidents, measured by NPPs cancellations, have a negative impact on nuclear innovation. Finally, we find that the nuclear safety authority has an ambivalent effect on innovation. On one hand, regulatory inspections have a positive impact on innovation, one the other hand, regulatory decisions to temporarily close a NPP have an adverse impact on innovation. (author)

  3. AXEL-2015 - Introduction To Particle Accelerators | starting 19 January

    CERN Multimedia

    2014-01-01

    CERN Technical Training 2015: Learning for the LHC AXEL-2015 is a lecture series on particle accelerators, given at CERN within the framework of the 2014 Technical Training Programme. As part of the BE Department’s Operations Group Shutdown Lecture series, the general accelerator physics module has been organised since 2003 as a joint venture between the BE Department and Technical Training, and is open to the general CERN community. The AXEL-2015 course is designed for technicians who are operating an accelerator or whose work is closely linked to accelerators, but it is also open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge of accelerators. However, some basic knowledge of trigonometry, matrices and differential equations and some basic knowledge of magnetism would be an advantage. The series will consists of 10 one-hour sessions (Monday 19 January 2015 – Friday 23 January 2015, from 9 a.m. to 10.15 a.m. and ...

  4. Technical training: AXEL-2009 - Introduction to Particle Accelerators

    CERN Multimedia

    HR Department

    2009-01-01

    CERN Technical Training 2009: Learning for the LHC! AXEL-2009 is a course series on particle accelerators, given at CERN within the framework of the 2009 Technical Training Program. Known in the past as the PS Complex Operation Course (or the ‘PS Shutdown Course’), the general accelerator physics module as been organized since 2003 as a joint venture between the AB Department and Technical Training Service, and is open to a wider CERN community. The AXEL-2009 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is also open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge of accelerators. However, some basic knowledge of trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) from 19 to 23 January 2009, and will be given i...

  5. Technical training: AXEL-2008 - Introduction to Particle Accelerators

    CERN Multimedia

    2008-01-01

    CERN Technical Training 2008: Learning for the LHC! AXEL-2008 is a course series on particle accelerators, given at CERN within the framework of the AB Operation Group Shut-down Lectures. Since 2003, this course is organized as a joint venture between the AB department and Technical Training, and is open to a wider CERN community. The AXEL-2008 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) from the 29th of January to the 1st February 2008, and given in English with questions and answers also possible in French. The lecturer is Rende Steerenberg, engineer and sup...

  6. Beaufort Formation, eastern Axel Heiberg Island, Canadian Arctic Archipelago

    Energy Technology Data Exchange (ETDEWEB)

    Bustin, R.M.

    1982-07-01

    On eastern Axel Heiberg Island erosional outliers of the Miocene-early Pliocene Beaufort Formation overlie with angular unconformity, or are faulted against, Mesozoic and early Tertiary strata East of Princess Margaret Arch the Beaufort Formation is divisible into three lithofacies: a conglomerate lithofacies interpreted as alluvial-plain deposits, a sandstone conglomerate lithofacies interpreted as distal alluvial-fan deposits and a sandstone-mudstone-siltstone lithofacies interpreted as alluvial-plain deposits. The floodplain was vegetated by a coniferous forest which was characterized by Picea banksii, Larix, Metasequoia and Alnus. Paleocurrent analysis, facies relationships and petrology of the conglomerates and sandstones indicate the provenance of the Beaufort Formation wa Mesozoic strata to the west. Deposition of the Beaufort Formation on eastern Axel Heiberg Island clearly postdates folding of mid-Eocene and older strata and thus provides a minimum age for orogenesis in this part of the Arctic. The occurrence of faulted massiv conglomerates of the Beaufort Formation provides evidence for Miocene-early Pliocene or earlier uplift of ancestral Princess Margaret Arch and a still-later phase of extension.

  7. Technical training: AXEL-2006 - Introduction to Particle Accelerators

    CERN Multimedia

    Davide Vitè

    2006-01-01

    CERN Technical Training 2006: Learning for the LHC! AXEL-2006 is a course series on particle accelerators, given at CERN within the framework of the 2006 Technical Training Programme. Known in the past as the PS Complex Operation Course (or the 'PS Shutdown Course'), the general accelerator physics module is organised since 2003 as a joint venture between the AB department and Technical Training, and is open to a wider CERN community. The AXEL-2006 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) during the week 6-10 February March 2006, and given in English...

  8. Technical Training: AXEL-2005: Introduction to Particle Accelerators

    CERN Multimedia

    Monique Duval

    2005-01-01

    CERN Technical Training 2005: Learning for the LHC! AXEL-2005 is a course series on particle accelerators, given at CERN within the framework of the 2005 Technical Training Programme. Known in the past as the PS Complex Operation Course (or the 'PS Shutdown Course', now AB/OP), the general accelerator physics section is organised since 2003 as a joint venture between the AB department and Technical Training, and is open to a wider CERN community. The AXEL-2005 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to all people (technicians, engineers, physicists) interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) during the week 14-18 March 2005, given in Fr...

  9. Technical training: AXEL-2011 - Introduction to Particle Accelerators

    CERN Multimedia

    HR Department

    2010-01-01

    CERN Technical Training 2011: Learning for the LHC! AXEL-2011 is a course series on particle accelerators, given at CERN within the framework of the 2011 Technical Training Program. As part of the BE Department’s Operation Group Shutdown Lecture series, the general accelerator physics module has been organized since 2003 as a joint venture between the BE Department and Technical Training, and is open to a wider CERN community. The AXEL-2011 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is also open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge of accelerators. However, some basic knowledge of trigonometry, matrices and differential equations, and some basic knowledge of magnetism would be an advantage. The series will be composed of 10 one-hour courses (Monday 10.01.2011 – Fri 14.01.2011, from 09:00 to 10:30 and from 14:00 to 15:...

  10. Technical training: AXEL-2009 - Introduction to Particle Accelerators

    CERN Multimedia

    HR Department

    2008-01-01

    CERN Technical Training 2009: Learning for the LHC! AXEL-2009 is a course series on particle accelerators, given at CERN within the framework of the 2009 Technical Training Program. Known in the past as the PS Complex Operation Course (or the ‘PS Shutdown Course’), the general accelerator physics module is organized since 2003 as a joint venture between the AB department and Technical Training, and is open to a wider CERN community. The AXEL-2009 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) from the 19th – 23rd of January 2009, and given in English with...

  11. Technical training: AXEL-2010 - Introduction to particle accelerators

    CERN Multimedia

    HR Department

    2010-01-01

    CERN Technical Training 2010: Learning for the LHC! AXEL-2010 is a course series on particle accelerators, given at CERN within the framework of the 2010 Technical Training Program. Known in the past as the PS Complex Operation Course (or the ‘PS Shutdown Course’), the general accelerator physics module is organized since 2003 as a joint venture between the BE department and Technical Training, and is open to a wider CERN community. The AXEL-2010 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to technicians, engineers, and physicists interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course series will be composed of 10 one-hour lectures (mornings and afternoons) from the 1st – 5th of February 201...

  12. What drives innovation in renewable energy technology? Evidence based on patent counts

    Science.gov (United States)

    McCormick, Jesse

    America's future economic growth and international competitiveness depend on our capacity to innovate, particularly in emerging global markets. This paper analyzes the forces that drive innovation in one such market, renewable energy technologies, utilizing the theory of induced technological innovation. Specifically, this paper operationalizes the determinants of innovation to consist of: 1) private market forces, 2) public policy that influences price and market size, and 3) public policy that catalyzes R&D investment. Analysis is conducted using a negative binomial regression to determine which of the three foundational determinants has the greatest impact on renewable energy innovation. In so doing this paper builds off of work conducted by Johnstone et al. (2010). Innovation is measured using European Patent Office data on a panel of 24 countries spanning the period from 1978-2005. The implications of this study are straightforward; policies, not market forces, are responsible for driving innovation in renewable energy technologies. Market-oriented policies are effective for mature technologies, particularly hydro, and to a lesser extent wind and solar power. R&D-oriented policy is effective for a broader technology set. In short, the United States needs a comprehensive policy environment to support renewable energy innovation; market forces alone will not provide the pace and breadth of innovations needed. That environment can and should be strategically targeted, however, to effectively allocate scare resources.

  13. Modern evaluation of patents

    Science.gov (United States)

    Ignat, V.

    2016-08-01

    The number of patents is not so important as the market value. The market value is especially important for licensing of patents, make-or-buy decisions for technology procurement, corporate finance. Patents can be used as collateral for financing. Patents and credit approvals: without patents only 46% and with patents 54%. The value share of knowledge-based components to industrial products already reached 50% and it is still rising. OECD called these developments under the slogan "knowledge economy”. German Norm-DIN 77100 provides a working method for monetary evaluation of a patent. The value of a patent arises from its use. A patent can be used to protect or to earn licensing revenues. An evaluation expertise is required in areas, such as marketing, finance, R & D and strategic planning. As an indicator of the value of a patent is often used the number of citations. The number of a patent citation refers to its meaning and value. Other indicators would be: size of the patent family, validity of the patent, result of objections against patent application, number and quality of claims. The analysis of 9.000 patents resulted that only 7.2% worth over 10 million euro and 68% below 1 million euro. The cost method: it is considered the cost that would be incurred for the development and patenting of a similar invention. The market method: are used the prices that have been achieved in comparable with recently transactions. The Income method: the potential reward is measured, which can arise from a patent. The evaluation will be in the following areas: legal status, technology, market conditions, finance and strategy. Each question relates to a different parameter of a value.

  14. ChemicalVia: a CERN-patented technology for use in high-density circuits

    CERN Multimedia

    Patrice Loïez

    2003-01-01

    High-density multilayer printed circuits such as those pictured here are found in miniaturized modern equipment from video cameras to mobile phones. Adjacent layers in these circuits are electrically connected by microvias, consisting of a small-diameter hole (usually 50 µm) with a thin metal-deposited surface covering their cylindrical walls to ensure local conductivity between the two layers. ChemicalVia is a new method, patented by CERN, to make microvias on high-density multilayer printed circuits using chemicals rather than complex laser, plasma or photoimaging technology. The process is compatible with all standard printed-circuit assembly lines, and has the advantages of low initial investment and reduced manufacturing costs. http://www.cern.ch/ttdatabase

  15. Patenting Nanomedicine in Europe:

    DEFF Research Database (Denmark)

    Nordberg, Ana

    Patenting Nanomedicine in Europe: Applying the ‘medical methods exception’ to emerging technologies is based on the authors PhD dissertation, defended in March 2014, at the University of Copenhagen. The book debates restrictions on the patentability of medical methods in European Patent Law....... The main question addressed is whether it is viable and advisable the reinterpretation, reformulation or replacement of Article 53 (c) EPC – a provision restricting the patenting of medical methods. The subject is approached by reference to emerging technologies, and using nanomedicine innovation...... as example and point of departure. Nanotechnology inventions blur the lines between patentable subject matter and what may fall under the exception from patentability. It is a good example of how in recent years, emerging technologies have been challenging the patent system and exposing the need for re...

  16. Strategies on Technology Transfer and Patents Commercialization for Nanotechnology at the Spanish National Research Council.

    Science.gov (United States)

    Maira, Javier; Etxabe, Javier; Serena, Pedro A

    2018-02-14

    Nanoscience and nanotechnology made their appearance in the scientific scene at a time when both the economy of Spain and the Spanish Research and Innovation System were experiencing strong growth. This circumstance resulted in a remarkable development of nanoscience and nanotechnology especially in universities and public research institutions such as the Spanish National Research Council (Consejo Superior de Investigaciones Científicas-CSIC). However, this development in academia has not been reflected in a similar increment in the transfer of knowledge to the productive sector despite several efforts and initiatives were launched. The CSIC, the main generator of scientific knowledge in Spain, has designed and implemented a series of actions in order to take advantage of the knowledge generated in nanotechnology by its research groups by mean of an appropriate transfer to both the Spanish and the international industry. Internal methodologies used in CSIC in order to protect and commercialize nanotechnology based intellectual property as well as their effects are reviewed. The evolution of CSIC nanotechnology patents portfolio is also analyzed. There has been a clear increase in the patent license agreements of CSIC in the period 2002- 2015 in the field of nanotechnology. This increase is correlated to these facts: (i) Highly qualified team managing Intellectual Property issues, (ii) The presence of CSIC in international fairs, and (iii) Proactive search of companies and investors. Successful results can be achieved in technology transfer when the appropriate resources are available and properly organized with an adequate combination of efforts in knowledge protection, promotion and commercialization of technologies and support to the scientific entrepreneurs of the institution. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. How Important are Noncorporate Patents?

    DEFF Research Database (Denmark)

    Schneider, Cédric

    2011-01-01

    This article analyses the innovative performances of noncorporate inventors using patent citations data from the European Patent Office. The results show that inventions patented outside an established corporate framework are on average less ‘important’ than corporate patents, but with large...... variations across technology classes. Patents applied for by independent inventors, start-ups and corporate firms are of comparable ‘quality’ in emerging technologies. The results also highlight that in these fields noncorporate patents are more ‘radical’ than corporate patents....

  18. A Hybrid Method of Analyzing Patents for Sustainable Technology Management in Humanoid Robot Industry

    Directory of Open Access Journals (Sweden)

    Jongchan Kim

    2016-05-01

    Full Text Available A humanoid, which refers to a robot that resembles a human body, imitates a human’s intelligence, behavior, sense, and interaction in order to provide various types of services to human beings. Humanoids have been studied and developed constantly in order to improve their performance. Humanoids were previously developed for simple repetitive or hard work that required significant human power. However, intelligent service robots have been developed actively these days to provide necessary information and enjoyment; these include robots manufactured for home, entertainment, and personal use. It has become generally known that artificial intelligence humanoid technology will significantly benefit civilization. On the other hand, Successful Research and Development (R & D on humanoids is possible only if they are developed in a proper direction in accordance with changes in markets and society. Therefore, it is necessary to analyze changes in technology markets and society for developing sustainable Management of Technology (MOT strategies. In this study, patent data related to humanoids are analyzed by various data mining techniques, including topic modeling, cross-impact analysis, association rule mining, and social network analysis, to suggest sustainable strategies and methodologies for MOT.

  19. A study on technology development strategy and collaborative relationships using patent information

    Science.gov (United States)

    Nakaoka, Iori; Fujino, Hayato; Chen, Yunju; Park, Yousin; Matsuno, Seigo

    2017-10-01

    Japanese economy has fallen into a long downturn called "The Lost Two Decades" after the collapse of bubble economy in early 1990s. Many companies could not gain competitive advantages although they conducted various management reforms to restore their competitiveness. The companies that have played the main role of the Japanese economy growth until then have lost the sustained competitive advantage. Moreover, they have struggled in the global market even now. On the other hand, Japanese automobile companies have high competitiveness and market share due to their advanced technology development. It is considered that personnel groups engaged in research and development of their companies cannot turn into core rigidity and the structure also hinders new core capabilities. In addition, there is a hypothesis that the close relationships with many suppliers contribute to acquisition of competitive advantage. Therefore, this paper focuses on the collaboration relationships with suppliers and core rigidity of human resources related to research and development as the analysis factors. First, we analyze the composition and core rigidity degree of human resources involved in technology development by social network analysis using patent information, which represents the research and development capability. Second, we analyze the degree of collaboration among companies based on the hypothesis that advanced technology development can be executed by joint research and developments with many kinds of suppliers. As a result, features of close collaboration with suppliers and high core rigidity rate in the Japanese automobile industry are clarified.

  20. Examining the patterns of innovation in low carbon energy science and technology: Publications and patents of Asian emerging economies

    International Nuclear Information System (INIS)

    Wong, Chan-Yuan; Fatimah Mohamad, Zeeda; Keng, Zi-Xiang; Ariff Azizan, Suzana

    2014-01-01

    This paper focuses on selected Asian emerging economies. The study employs publications and patents as proxies for science and technology, and its analysis is divided into three main parts: production trends, catching-up trends and patterns of convergence. The findings resulted in four salient points to be considered by policy makers: (1) ASEAN-4 lagged significantly behind the more advanced economies (Korea, Taiwan and China) even though their performance was identical in the early 1990s. China has forged ahead in terms of scientific publications and patents production, but lags behind in patents quality; (2) compared to the world average, the region as a whole has high potential to forge ahead in low carbon energy scientific production. (3) Advanced economies in Asia kicked off their low carbon energy science and technology development more from technological rather than scientific production, with no straightforward co-evolution between the two competencies. This demonstrates the need for a strong science-based technological foundation and a high level of dynamism for low carbon energy technology development; and (4) the economies demonstrated contrasting development trends in their focus between the supply and demand sides of energy technology development. The performance of the advanced economies is higher in ‘demand-side’ low carbon energy innovations

  1. International nanotechnology development in 2003: Country, institution, and technology field analysis based on USPTO patent database

    International Nuclear Information System (INIS)

    Huang Zan; Chen Hsinchun; Chen Zhikai; Roco, Mihail C.

    2004-01-01

    Nanoscale science and engineering (NSE) have seen rapid growth and expansion in new areas in recent years. This paper provides an international patent analysis using the U.S. Patent and Trademark Office (USPTO) data searched by keywords of the entire text: title, abstract, claims, and specifications. A fraction of these patents fully satisfy the National Nanotechnology Initiative definition of nanotechnology (which requires exploiting specific phenomena and direct manipulation at the nanoscale), while others only make use of NSE tools and methods of investigation. In previous work we proposed an integrated patent analysis and visualization framework of patent content mapping for the NSE field and of knowledge flow pattern identification until 2002. In this paper, the results are updated for 2003, and the new trends are presented

  2. International nanotechnology development in 2003: Country, institution, and technology field analysis based on USPTO patent database

    Science.gov (United States)

    Huang, Zan; Chen, Hsinchun; Chen, Zhi-kai; Roco, Mihail C.

    2004-08-01

    Nanoscale science and engineering (NSE) have seen rapid growth and expansion in new areas in recent years. This paper provides an international patent analysis using the U.S. Patent and Trademark Office (USPTO) data searched by keywords of the entire text: title, abstract, claims, and specifications. A fraction of these patents fully satisfy the National Nanotechnology Initiative definition of nanotechnology (which requires exploiting specific phenomena and direct manipulation at the nanoscale), while others only make use of NSE tools and methods of investigation. In previous work we proposed an integrated patent analysis and visualization framework of patent content mapping for the NSE field and of knowledge flow pattern identification until 2002. In this paper, the results are updated for 2003, and the new trends are presented.

  3. [Overview of patents on targeted genome editing technologies and their implications for innovation and entrepreneurship education in universities].

    Science.gov (United States)

    Fan, Xiang-yu; Lin, Yan-ping; Liao, Guo-jian; Xie, Jian-ping

    2015-12-01

    Zinc finger nuclease, transcription activator-like effector nuclease, and clustered regularly interspaced short palindromic repeats/Cas9 nuclease are important targeted genome editing technologies. They have great significance in scientific research and applications on aspects of functional genomics research, species improvement, disease prevention and gene therapy. There are past or ongoing disputes over ownership of the intellectual property behind every technology. In this review, we summarize the patents on these three targeted genome editing technologies in order to provide some reference for developing genome editing technologies with self-owned intellectual property rights and some implications for current innovation and entrepreneurship education in universities.

  4. How ordinary judges and juries decide the seemingly complex technological questions of patentability over the prior art.

    Science.gov (United States)

    Kieff, F Scott

    2003-01-01

    Determinations of patentability over the prior art are often thought to raise questions that are so technologically complex that they require special training and judgment to answer, especially in fast-moving fields like modern biotechnology. This essay explores the somewhat counterintuitive argument that under the U.S. system they do not and should not. According to this view, determinations of patentability over the prior art are based entirely on factual inquiries that are best made by lay judges and juries, just like the factual determinations these people regularly make in any ordinary nonpatent trial. This is good because judges and juries are adept at these determinations, and because appellate courts are adept at reviewing them. It leads to a system that is cheaper overall in allowing private litigants to better predict outcomes that also better approximate the correct answer than would be possible under other regimes premised upon the expert technological knowledge and judgment of a decisionmaker.

  5. Revisited Inventory of Glaciers on Axel Heiberg Island, Nunavut

    Science.gov (United States)

    Thomson, L.; Osinski, G.

    2009-05-01

    As documented in the IPCC's Climate Change 2007 report, the high latitude regions of the Northern Hemisphere are experiencing the highest rates of warming. Given that 35% of the global glacial ice exists within the Arctic Archipelago, this region provides an excellent laboratory for monitoring the anticipated degree of glacial recession [1]. Evidence of arctic warming through negative mass balance trends has been detected in several studies already [e.g., 2]. Here, we show the importance and value of historical records in the task of monitoring glacial retreat. A highly detailed inventory developed by S. Ommanney in 1969 [3], has been revisited and transformed into digital format for the purposes of integration with modern inventories. The Ommanney inventory covers the entirety of Axel Heiberg Island , NU, and includes details often lacking in present day inventories, including orientations (accumulation and ablation zones), elevations (highest, lowest, elevation of the snowline, and the mean elevations of both the accumulation and ablation areas), length (of the ablation area, exposed ice, and of the total glacier including debris cover), area (of the ablation area, exposed ice, and of the total glacier), accumulation area ratio (AAR), depth, volume, and a six digit code which gives qualitative details on glacier attributes. This report is one of the most thorough and comprehensive glacier inventory report ever published in Canada. More recent inventories used for comparison include the glacier extents created by the National Topographic System based on photography from 1980-1987, as well as extents developed by Dr. Luke Copland for the Global Land Ice Measurements from Space (GLIMS) database using 1999-2000 satellite imagery. Our preliminary results show that approximately 90% of ice bodies under 0.2km on Axel Heiberg Island have disappeared entirely in the 40 year period of interest. The issue of glacier definition will be discussed as a possible cause of these

  6. Used, Blocking and Sleeping Patents

    DEFF Research Database (Denmark)

    Torrisi, Salvatore; Gambardella, Alfonso; Giuri, Paola

    2016-01-01

    This paper employs data from a large-scale survey (InnoS&T) of inventors in Europe, the USA, and Japan who were listed in patent applications filed at the European Patent Office with priority years between 2003 and 2005. We provide evidence regarding the reasons for patenting and the ways in which...... patents are being utilized. A substantial share of patents is neither used internally nor for market transactions, which confirms the importance of strategic patenting and inefficiency in the management of intellectual property. We investigate different types of unused patents—unused blocking patents...... and sleeping patents. We also examine the association between used and unused patents and their characteristics such as family size, scope, generality and overlapping claims, technology area, type of applicant, and the competitive environment from where these patents originate. We discuss our results...

  7. The Academic Advantage: Gender Disparities in Patenting

    OpenAIRE

    Sugimoto, Cassidy R.; Ni, Chaoqun; West, Jevin D.; Larivi?re, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely...

  8. Clearing the fog of anticancer patents from 1993-2013: through an in-depth technology landscape & target analysis from pioneer research institutes and universities worldwide.

    Directory of Open Access Journals (Sweden)

    Ajay Dara

    Full Text Available BACKGROUND: In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR: India's largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. METHODOLOGY/PRINCIPAL FINDINGS: The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. CONCLUSIONS/SIGNIFICANCE: The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade

  9. Clearing the fog of anticancer patents from 1993-2013: through an in-depth technology landscape & target analysis from pioneer research institutes and universities worldwide.

    Science.gov (United States)

    Dara, Ajay; Sangamwar, Abhay T

    2014-01-01

    In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR): India's largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade anticancer scenario with respect to top public funded universities worldwide.

  10. Clearing the Fog of Anticancer Patents from 1993–2013: Through an In-Depth Technology Landscape & Target Analysis from Pioneer Research Institutes and Universities Worldwide

    Science.gov (United States)

    Dara, Ajay; Sangamwar, Abhay T.

    2014-01-01

    Background In a search for an effective anticancer therapy the R&D units from leading universities and institutes reveal numerous technologies in the form of patent documents. The article addressed comparative anticancer patent landscape and technology assessment of Council of Scientific and Industrial Research (CSIR): India’s largest R&D organisation with top twenty international public funded universities and institutes from eight different countries. Methodology/Principal Findings The methodology include quantitative and qualitative assessment based on the bibliometric parameters and manual technology categorisation to understand the changing patent trends and recent novel technologies. The research finding analysed 25,254 patent documents from the year 1993 to 2013 and reported the insights of latest anticancer technologies and targets through categorisation studies at the level of drug discovery, development and treatment & diagnosis. The article has reported the technology correlation matrix of twelve secondary class technologies with 34 tertiary sub-class research area to identify the leading technologies and scope of future research through whitespaces analysis. In addition, the results have also addressed the target analysis, leading inventor, assignee, collaboration network, geographical distribution, patent trend analysis, citation maps and technology assessment with respect to international patent classification systems such as CPC, IPC and CPI codes. Conclusions/Significance The result suggested peptide technology as the dominating research area next to gene therapy, vaccine and medical preparation containing organic compounds. The Indian CSIR has ranked itself at seventh position among the top 20 universities. Globally, the anticancer research was focused in the area of genetics and immunology, whereas Indian CSIR reported more patents related to plant extract and organic preparation. The article provided a glimpse of two decade anticancer scenario

  11. Performance of Patenting Firms

    DEFF Research Database (Denmark)

    Madsen, Erik Strøjer; Smith, Valdemar; Nielsen, Anders Østergaard

    2000-01-01

    Most countries focus on industries with high technology and the governments grant subsidies to innovating firms. However, there has been remarkable few studies of the performance of innovative firms or industries. This study examines the performance of patent active firms compared to the non-patenting...... firms within the manufacturing sector in Denmark. Performance is measured both by growth in employment as well as in the return on equity and profit share in turnover. The results suggest that differences in performance of patenting and non-patenting firms are very small, which questions the political...

  12. 37 CFR 1.710 - Patents subject to extension of the patent term.

    Science.gov (United States)

    2010-07-01

    ... of Patent Term Extension of Patent Term Due to Regulatory Review § 1.710 Patents subject to extension... primarily manufactured using recombinant DNA, recombinant RNA, hybridoma technology, or other processes...

  13. Test of the Brink-Axel Hypothesis for the Pygmy Dipole Resonance

    Science.gov (United States)

    Martin, D.; von Neumann-Cosel, P.; Tamii, A.; Aoi, N.; Bassauer, S.; Bertulani, C. A.; Carter, J.; Donaldson, L.; Fujita, H.; Fujita, Y.; Hashimoto, T.; Hatanaka, K.; Ito, T.; Krugmann, A.; Liu, B.; Maeda, Y.; Miki, K.; Neveling, R.; Pietralla, N.; Poltoratska, I.; Ponomarev, V. Yu.; Richter, A.; Shima, T.; Yamamoto, T.; Zweidinger, M.

    2017-11-01

    The gamma strength function and level density of 1- states in 96Mo have been extracted from a high-resolution study of the (p → , p→ ' ) reaction at 295 MeV and extreme forward angles. By comparison with compound nucleus γ decay experiments, this allows a test of the generalized Brink-Axel hypothesis in the energy region of the pygmy dipole resonance. The Brink-Axel hypothesis is commonly assumed in astrophysical reaction network calculations and states that the gamma strength function in nuclei is independent of the structure of the initial and final state. The present results validate the Brink-Axel hypothesis for 96Mo and provide independent confirmation of the methods used to separate gamma strength function and level density in γ decay experiments.

  14. Essentials of the successful drafting of invention applications on nuclear technology in the view of patent examination

    International Nuclear Information System (INIS)

    Zhai Chenyang

    2010-01-01

    Up to now, there has been a comparatively low ratio of domestic authorization in terms of invention applications in the field of nuclear technology. In this paper, the main reasons according to my experience in the patent examination are revealed in the following three aspects: (1) there is a lack of novelty or inventive step; (2) the scope of some claims is not clearly defined; (3) the description is improperly drafting. Common problems are shown and analyzed. Suggestion for avoiding the problems and corresponding solutions are given. (author)

  15. Google Patents: The global patent search engine

    OpenAIRE

    Noruzi, Alireza; Abdekhoda, Mohammadhiwa

    2014-01-01

    Google Patents (www.google.com/patents) includes over 8 million full-text patents. Google Patents works in the same way as the Google search engine. Google Patents is the global patent search engine that lets users search through patents from the USPTO (United States Patent and Trademark Office), EPO (European Patent Office), etc. This study begins with an overview of how to use Google Patent and identifies advanced search techniques not well-documented by Google Patent. It makes several sug...

  16. Environmentally conscious patent histories

    Science.gov (United States)

    Crouch, Dennis D.; Crouch, Henry L.

    2004-02-01

    There is a need for investigators, legislators, and business leaders to understand the magnitude of innovation and discovery in the field of environmentally conscious technologies (ECTs). Knowledge of the "big picture" is important to providing a national and global account of actual environmental stewardship over the last twenty-five years. A recitation of the Environmental Protection Agency (EPA) supported Acts which have been enacted into law reveals one facet of the multifaceted dynamic of environmental consciousness. The popular discussion and debate, as well as partisan lobbying, which created the political forces leading to environmentally conscious legislation is another facet. A third facet is the corporate response to the threats and opportunities predicted by CEO"s and others through environmental scanning. This paper examines changes in environmentally conscious inventive effort by comparing data from United States Patents issued from 1976 through 2003. Patents are useful tool for measuring technological innovation because they are publicly available records of innovative activity. Although not all inventions result in patent applications, the monopoly rights granted on the invention give the inventor a strong incentive to obtain patents on any viable product or process. Among the results, we found a significant increase in patents relating to environmentally conscious products and processes during the period in question. Specifically, a dramatic increase in patent activity was seen for the decade of the 1990"s. Surprisingly, the patenting rate from 2000 to 2003 seems to have stabilized. Additionally public discussion of ECTs appears to have a positive impact on patent filings.

  17. Research method of nuclear patent information

    International Nuclear Information System (INIS)

    Mo Dan; Gao An'na; Sun Chenglin; Wang Lei; You Xinfeng

    2010-01-01

    When faced with a huge amount of nuclear patent information, the key to effective research include: (1) Choose convenient way to search, quick access to nuclear technology related patents; (2) To overcome the language barrier, analysis the technical content of patent information; (3) Organize the publication date of retrieved patent documents, analysis the status and trends of nuclear technology development; (4) Research the patented technology of main applicants; (5) Always pay attention to the legal status of patent information, free use the invalid patents, at the same time avoid the patent infringement. Summary, patent information is important to obtain the latest technical information source, and the research work of patent information is a comprehensive understanding and mastery way for advanced nuclear technology. (authors)

  18. Using Patent Development, Education Policy and Research and Development Expenditure Policy to Increase Technological Competitiveness of Small European Union Member States

    Directory of Open Access Journals (Sweden)

    Ferraro Simona

    2017-08-01

    Full Text Available The Chinese Belt and Road Initiative will open new trade routes between China and the European Union (EU and increase competition pressures on smaller EU member states. This article ranks where states like Estonia stand internationally in terms of innovativeness (and consequent competitiveness by conducting an econometric study of patent development, education policy and research and development (R&D expenditure policy. The authors claim that small member states such as Estonia should follow the example of countries such as Germany and adopt policies which focus more on increased public spending on R&D and innovation in public universities of science and technology, and raise support for high tech startups with a strong focus on international patenting. Member States must go further and subsidise R&D activities by focusing, inter alia, on filing of foreign patents such as triadic patents.

  19. The academic advantage: gender disparities in patenting.

    Science.gov (United States)

    Sugimoto, Cassidy R; Ni, Chaoqun; West, Jevin D; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  20. Recognition of Prior Learning, Self-Realisation and Identity within Axel Honneth's Theory of Recognition

    Science.gov (United States)

    Sandberg, Fredrik; Kubiak, Chris

    2013-01-01

    This paper argues for the significance of Axel Honneth's theory of recognition for understanding recognition of prior learning (RPL). Case studies of the experiences of RPL by paraprofessional workers in health and social care in the UK and Sweden are used to explicate this significance. The results maintain that there are varying conditions of…

  1. Social Freedom and the Demands of Justice. A Study of Axel Honneth's Recht der Freiheit

    NARCIS (Netherlands)

    Claassen, R.J.G.

    2014-01-01

    In his most recent voluminous work Das Recht der Freiheit (2011) Axel Honneth brings his version of the recognition paradigm to full fruition. Criticizing Kantian theories of justice, he develops a Hegelian alternative which has at its core a different conception of freedom. In this paper, I will

  2. The interplay between standardization and technological change : a study on wireless technologies, technological trajectories, and essential patent claims

    NARCIS (Netherlands)

    Bekkers, R.N.A.; Martinelli, A.

    2010-01-01

    In many technology fields, standardization is the primary method of achieving alignment between actors. Especially if strong network effects and increasing returns are present, the market often ends up with a single standard that dominates the technical direction, activities and search heuristics,

  3. Decoding Patent Information Using Patent Maps

    OpenAIRE

    Liu, Chen-Yuan; Yang, James Chingyu

    2008-01-01

    Patent information is a derivative product from the legal patent system. This information, which includes patent applications, patent descriptions, patent gazettes, patent abstracts, and patent data, is prepared in exact compliance with the regulations and specifications of the patent acts. Patent information, different from other published circulating information, is legally well protected. For convenience, this study classifies patent information into bibliographic and numeric data to creat...

  4. Contact lens technology to 2020 and beyond: a review of recent patent literature.

    Science.gov (United States)

    Papas, Eric B

    2017-09-01

    Contact lenses have been a common means of vision correction for more than half a century. Recent developments raise the possibility that the next several years will see the range of applications in which they are used broaden considerably, with an associated expansion in both the number and type of individuals who consider them to be a valuable option. To describe this new landscape, a review of recent patent submissions covering the period 1 January 2014 to 1 February 2017 was undertaken. The results show that in the main, areas where contact lenses will be applied include drug delivery, visual augmentation and biosensing. © 2017 Optometry Australia.

  5. Use of Patent Applications as a Tool for Technology Development Prospection on the Ethanol Production Chain from Lignocellulosic Biomasses in Brazil

    Directory of Open Access Journals (Sweden)

    Luiz André Felizardo Silva Schlittler

    2012-09-01

    Full Text Available The growing concerns regarding the future of global energy supplies have encouraged R&D in alternative sources to complement the global energy matrix. Brazil has earned notoriety as one of the largest producers of ethanol and biomass. This has aroused other countries’ interest in Brazil’s capabilities. However, the technologies for converting biomass into ethanol are not sufficiently mature, and have been developed in a decentralized manner. The lignocellulosic ethanol technologies can be divided into the following three groups: pretreatment, enzymes and ethanol production. One of the most efficient methods for mapping such technologies is through patent applications because the applications provide important information on trends in long-term technological development. Among all the patent applications deposited in the Brazilian database, pretreatment technologies were the most exploited followed by enzymes and ethanol production. The large number of documents from USA and European countries efforts the importance of Brazil in this technological scenario.

  6. Patenting Nanomedicine in Europe

    DEFF Research Database (Denmark)

    Nordberg, Ana

    This work addresses the question of determining whether reinterpretation, reformulation or replacement of article 53 (c) of the European Patent Convention is viable and advisable. It does so by reference to novel or resurfacing interpretative concerns connected with emerging technologies exemplif......This work addresses the question of determining whether reinterpretation, reformulation or replacement of article 53 (c) of the European Patent Convention is viable and advisable. It does so by reference to novel or resurfacing interpretative concerns connected with emerging technologies...... exemplified by nanomedicine, while considering known interpretative issues and traditional objections to this provision. The debate concerning the patentability of ‘medical methods’ is multi-layered and complex. The ‘medical methods exception’ is a public policy mechanism, intended to introduce flexibility...... in the patent system in order to allow for the protection of core ethical values of society. Nanotechnology inventions blur the lines between patentable subject matter and what may fall under the exception from patentability. It is a good example of how in recent years, emerging technologies have been...

  7. Invention and Transfer of Climate Change Mitigation Technologies on a Global Scale: A Study Drawing on Patent Data

    International Nuclear Information System (INIS)

    Dechezlepretre, A.; Glachant, M.; Hascic, I.; Johnstone, N.; Meniere, Y.

    2010-01-01

    This paper uses the EPO/OECD World Patent Statistical Database (PATSTAT) to provide a quantitative description of the geographic distribution of inventions in thirteen climate mitigation technologies since 1978 and their international diffusion on a global scale. Statistics suggest that innovation has mostly been driven by energy prices until 1990. Since then, environmental policies, and climate policies more recently, have accelerated the pace of innovation. Innovation is highly concentrated in three countries - Japan, Germany and the USA - which account for 60% of total innovations. Surprisingly, the innovation performance of emerging economies is far from being negligible as China and South Korea together represent about 15% of total inventions. However, they export much less inventions than industrialized countries, suggesting their inventions have less value. More generally, international transfers mostly occur between developed countries (73% of exported inventions). Exports from developed countries to emerging economies are still limited (22%) but are growing rapidly, especially to China. (authors)

  8. Mapping technological trajectories as patent citation networks : a study on the history of fuel cell research

    NARCIS (Netherlands)

    Verspagen, B.

    2005-01-01

    Technological change is argued to be taking place along ordered and selective patterns, shaped jointly by technological and scientific principles, and economic and other societal factors. Historical, descriptive analysis is often used to analyze these "trajectories". Recently, quantitative methods

  9. Mapping technological trajectories as patent citation networks : a study on the history of fuel cell research

    NARCIS (Netherlands)

    Verspagen, B.

    2007-01-01

    Technological change is argued to be taking place along ordered and selective patterns, shaped jointly by technological and scientific principles, and economic and other societal factors. Historical, descriptive analysis is often used to analyze these "trajectories". Recently, quantitative methods

  10. When patents matter: The impact of competition and patent age on the performance contribution of intellectual property rights protection

    NARCIS (Netherlands)

    Maresch, Daniela; Fink, Matthias; Harms, Rainer

    2016-01-01

    The question whether patenting impacts patenting firms' subsequent financial performance is important for technology-oriented companies. However, relevant research has led to contradictory results. We strive to overcome this impasse by introducing innovation competition and patent age as moderators

  11. 78 FR 17187 - Notice of Intent To Grant Exclusive Patent License; Fiber Optic Sensor Systems Technology...

    Science.gov (United States)

    2013-03-20

    ...; Fiber Optic Sensor Systems Technology Corporation AGENCY: Department of the Navy, DoD. ACTION: Notice..., 2012, announcing an intent to grant to Fiber Optic Sensor Systems Technology Corporation, a revocable... the Navy hereby gives notice of its intent to grant to Fiber Optic Sensor Systems Technology...

  12. Constructing an Intelligent Patent Network Analysis Method

    Directory of Open Access Journals (Sweden)

    Chao-Chan Wu

    2012-11-01

    Full Text Available Patent network analysis, an advanced method of patent analysis, is a useful tool for technology management. This method visually displays all the relationships among the patents and enables the analysts to intuitively comprehend the overview of a set of patents in the field of the technology being studied. Although patent network analysis possesses relative advantages different from traditional methods of patent analysis, it is subject to several crucial limitations. To overcome the drawbacks of the current method, this study proposes a novel patent analysis method, called the intelligent patent network analysis method, to make a visual network with great precision. Based on artificial intelligence techniques, the proposed method provides an automated procedure for searching patent documents, extracting patent keywords, and determining the weight of each patent keyword in order to generate a sophisticated visualization of the patent network. This study proposes a detailed procedure for generating an intelligent patent network that is helpful for improving the efficiency and quality of patent analysis. Furthermore, patents in the field of Carbon Nanotube Backlight Unit (CNT-BLU were analyzed to verify the utility of the proposed method.

  13. An Evidence Framework for Off-Patent Pharmaceutical Review (EFOR) for Health Technology Assessment in Emerging Markets.

    Science.gov (United States)

    Brixner, Diana; Kaló, Zoltán; Maniadakis, Nikos; Kim, Kyoo; Wijaya, Kalman

    2018-03-29

    This article introduces an Evidence Framework for Off-Patent Pharmaceutical Review (EFOR), which establishes value-based criteria in a template that manufacturers use to provide evidence showing how their products meet those criteria. Health authorities in emerging markets can then use the evidence presented in the EFOR to evaluate off-patent pharmaceuticals (OPPs) in a consistent, transparent, and evidence-based manner to support policy decisions, including pricing, reimbursement, formulary listing, and drug procurement. A literature search found no multi-criteria evidence framework for evaluating OPPs in emerging markets. An International Outcomes Research Board (IORB) of academia and industry experts conducted extensive research, meetings, and workshops to define high-priority criteria to incorporate into an evidence-based health technology assessment (HTA) tool using the multi-criteria decision analysis (MCDA) technique. The resulting framework was further tailored for country-specific needs in workshops in three emerging countries (Kazakhstan, Vietnam, and Indonesia). The IORB defined nine criteria four categories (Product, Manufacturing, Service, and Value Assessment), which OPP manufacturers can use to provide evidence for reimbursement and health policy decision making. Then the IORB developed the EFOR as a base case document, which can be adapted and used as a template by health authorities in emerging countries. Emerging countries have a significant need for an HTA tool that balances affordability with accurate evidence showing the value differentiation of OPPs. The value attributes in this setting often are different from those in developed markets, which emphasize new products and have high regulation and manufacturing standards. The EFOR is an easy-to-use, adaptable framework that emerging countries can use to increase the consistency, transparency, and effectiveness of drug decision making. The open source EFOR is available as Supplemental Materials

  14. Interactions between science and technology: analysis of the intellectual production of the researchers-inventors of the first letter- patent of the UFRGS

    Directory of Open Access Journals (Sweden)

    Ana Maria Mielniczuk de Moura

    2006-12-01

    Full Text Available The paper discusses intellectual and industrial property and existing differences between scientific and technological knowledge. It aims at incorporating the patent in the context of the scientific and technological communication. It presents preliminary data of a study that aims at analyzing the relationship between scientific and technological information in the intellectual production of the researchers-inventors of the first patent from the Federal University of Rio Grande do Sul (UFRGS. It concludes that, in the case studied, a flow between scientific and technological information occurs, in which the former, after its diffusion and approval in the peer review process, subsidizes the latter. It suggests that other studies should be carried out.

  15. Validity of the Generalized Brink-Axel Hypothesis in (238)Np.

    Science.gov (United States)

    Guttormsen, M; Larsen, A C; Görgen, A; Renstrøm, T; Siem, S; Tornyi, T G; Tveten, G M

    2016-01-08

    We analyze primary γ-ray spectra of the odd-odd (238)Np nucleus extracted from (237)Np(d,pγ)(238)Np coincidence data measured at the Oslo Cyclotron Laboratory. The primary γ spectra cover an excitation-energy region of 0≤E(I)≤5.4  MeV, and allow us to perform a detailed study of the γ-ray strength as a function of excitation energy. Hence, we can test the validity of the generalized Brink-Axel hypothesis, which, in its strictest form, claims no excitation-energy dependence on the γ strength. In this work, using the available high-quality (238)Np data, we show that the γ-ray strength function is to a very large extent independent of the initial and final states. Thus, for the first time, the generalized Brink-Axel hypothesis is experimentally verified for γ transitions between states in the quasicontinuum region, not only for specific collective resonances, but also for the full strength below the neutron separation energy. Based on our findings, the necessary criteria for the generalized Brink-Axel hypothesis to be fulfilled are outlined.

  16. System failure, innovation policy and patents: Fuel cells and related hydrogen technology in Norway 1990-2002

    International Nuclear Information System (INIS)

    Godoe, Helge; Nygaard, Stian

    2006-01-01

    The empirical focus of this article is technological innovation activities in the emerging field of fuel cells and related hydrogen technology in Norway from 1990 to 2002. In this period, four comparatively large-scale research and development projects and a number of smaller projects aimed at development of fuel cells technology were undertaken, resulting in many inventions that were subsequently patented. Although this creativity may be considered an indication of success, only one of the projects became successful in an innovation perspective. All the large projects were initiated and funded for divergent political and economic reasons. An important reason in the late 1980s was the prospect of using Norway's abundant supply of natural gas in fuel cells for electric power generation. The large R and D projects that attempted to develop fuel cells based on natural gas as energy source failed. In contrast, the successful project was undertaken by military R and D, i.e. in a different system of innovation than the projects that failed. Analysis of these cases points to the importance of a systemic approach to innovations-and to policy making. One challenge for policy makers is to decide how they should promote this development which is crucial for the vision of a future 'Hydrogen Economy', i.e. what kind of policy incentives should be introduced to spur efficiency in technological development and diffusion. Theoretically, many options are available; however, understanding the innovation dynamics in this sector is fundamental for making choices. In this article, focus will be set on policy aspects using an innovation systemic approach to analyze development of fuel cells and related hydrogen technology in Norway

  17. The "Food Polymer Science" approach to the practice of industrial R&D, leading to patent estates based on fundamental starch science and technology.

    Science.gov (United States)

    Slade, Louise; Levine, Harry

    2018-04-13

    This article reviews the application of the "Food Polymer Science" approach to the practice of industrial R&D, leading to patent estates based on fundamental starch science and technology. The areas of patents and patented technologies reviewed here include: (a) soft-from-the-freezer ice creams and freezer-storage-stable frozen bread dough products, based on "cryostabilization technology" of frozen foods, utilizing commercial starch hydrolysis products (SHPs); (b) glassy-matrix encapsulation technology for flavors and other volatiles, based on structure-function relationships for commercial SHPs; (c) production of stabilized whole-grain wheat flours for biscuit products, based on the application of "solvent retention capacity" technology to develop flours with reduced damaged starch; (d) production of improved-quality, low-moisture cookies and crackers, based on pentosanase enzyme technology; (e) production of "baked-not-fried," chip-like, starch-based snack products, based on the use of commercial modified-starch ingredients with selected functionality; (f) accelerated staling of a starch-based food product from baked bread crumb, based on the kinetics of starch retrogradation, treated as a crystallization process for a partially crystalline glassy polymer system; and (g) a process for producing an enzyme-resistant starch, for use as a reduced-calorie flour replacer in a wide range of grain-based food products, including cookies, extruded expanded snacks, and breakfast cereals.

  18. Patenting Biotechnological Inventions in Europe

    Directory of Open Access Journals (Sweden)

    Peter Raspor

    2002-01-01

    Full Text Available The patent system has been able to provide the protection for the achievements of different technologies and in that way it has supported further development and growth of the industry where those achievements were implemented. Modern technologies like information technology and biotechnology with genetic engineering that appeared in the 70s have overgrown the frames of the existing patent system because of their exponential development during the last thirty years. Industry that invests a huge amount of money in these technologies, especially in the field of biotechnology, where the results are very uncertain, has started to claim changes in the patent system.

  19. The dynamics of technological discontinuities : a patent citation network analysis of telecommunication switches

    NARCIS (Netherlands)

    Martinelli, A.

    2010-01-01

    This work focuses on the long-term structural evolution of the telecommunication switching industry, analyzing both the technology and the firm level. The first contribution of this work is in the empirical representation of technological change. Following the growing field of research about the use

  20. The population ecology of technology : An empirical study of US biotechnology patents from 1976 to 2003

    NARCIS (Netherlands)

    Van Oord, Ad Den; Van Witteloostuijn, Arjen

    2017-01-01

    A detailed understanding of technological change as an evolutionary process is currently not well understood. To increase our understanding, we build upon theory from organizational ecology to develop a model of endogenous technological growth and determine to what extent the pattern of

  1. High-quality patents for emerging science and technology through external actors: Community scientific experts and knowledge societies

    NARCIS (Netherlands)

    Kica, Evisa; Groenendijk, Nico; Rodriguez, V.F.; Bonaccorsi, A.; Borras, S.

    2010-01-01

    This article explores one type of administrative mechanism to achieve high-quality patents: Article 115 of the European Patent Convention, which permits the inclusion of third parties to provide input to the prior art search and to communicate relevant information to the examiner in charge. Our

  2. Foreign patent documentation and information research

    International Nuclear Information System (INIS)

    Wang Tongsheng; Wu Xianfeng; Liu Jia; Cao Jifen; Song Tianbao; Feng Beiyuan; Zhang Baozhu

    2014-01-01

    Patent documentations are important scientific and technical documentations, which gather legal information, technical information and economic information together. According to WIPO forecasts, making full use of patent documentation can save 40% of research funding and 60% of the study period. Foreign patent documentations are the world's most valuable patent documentations, and many original technologies that have significant influence are first disclosed in foreign patent documentation. Studying and making use of foreign patent documentations can improve our starting point of scientific and technological innovation, and reduce the research investment. This paper analyzes foreign patent documentation and, combining with the actual development of nuclear technology in our country, makes specific recommendations for patent documentation research. (authors)

  3. The Bayh-Dole Act: Selected Issues in Patent Policy and the Commercialization of Technology

    National Research Council Canada - National Science Library

    Schacht, Wendy H

    2009-01-01

    ...) to certain types of entities with the expressed purpose of encouraging the commercialization of new technologies through cooperative ventures between and among the research community, small business, and industry...

  4. Patent office governance and patent system quality

    OpenAIRE

    PICARD, Pierre M.; VAN POTTELSBERGHE DE LA POTTERIE, Bruno

    2011-01-01

    The present paper discusses the role of quality in patent systems from the perspective of patent offices' behavior and organization. After documenting original stylized facts, the paper presents a model in which patent offices set patent fees and the quality level of their examination processes. Various objectives of patent offices' governors are considered. We show that the quality of the patent system is maximal for the patent offices that maximises either the social welfare or its own prof...

  5. Joint and Cross-border Patents as Proxies for International Technology Diffusion

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); M.J. McAleer (Michael); J-T. Tang (Ju-Ting)

    2016-01-01

    markdownabstractWith the advent of globalization, economic and financial interactions among countries have become widespread. Given technological advancements, the factors of production can no longer be considered to be just labor and capital. In the pursuit of economic growth, every country has

  6. Patents and Technological Progress in a Globalized World-Liber Amicorum Joseph Straus

    DEFF Research Database (Denmark)

    Minssen, Timo

    2012-01-01

    and Technological Progress in a Globalized Economy". Starting with Rainer Moufang's portrayal of the fascinating life and career of Professor Straus and the leitmotivs of his work (pp.VII–XVII), which is followed by the table of contents and a brief description of the contributors (pp.XIX–XXX), the book sets out...

  7. Inventions shaping technological trajectories: do existing patent indicators provide a comprehensive picture?

    NARCIS (Netherlands)

    Arts, Sam; Appio, Francesco Paolo; van Looy, Bart

    2013-01-01

    Since Schumpeter’s (The theory of economic development, 1934) seminal work on economic development, innovation is considered as one of the main drivers of firm performance and economic growth. At the same time, technological innovations vary considerably in terms of impact with only a minority of

  8. Tendências tecnológicas de polietilenos e polipropileno através da prospecção em documentos de patente nos Estados Unidos e Europa - 1990/1997 Technological trends for polyethylene and polypropylene through the study of patent documents in the United States and Europe - 1990/1997

    Directory of Open Access Journals (Sweden)

    Adelaide M. S. Antunes

    2000-03-01

    Full Text Available O presente artigo fornece uma avaliação estratégica da tecnologia de produção de polímeros à base de etileno, principalmente o polietileno, bem como dos polímeros a base de propileno, principalmente o polipropileno, mostrando a tendência em relação a novos produtos, mercados e de concorrentes, com base em informações extraídas de documentos de patentes publicados a partir de 1990. O termo documento de patente abrange pedidos de patente publicados ou patentes concedidas. Da análise dos documentos de patente recuperados nesta pesquisa resultou uma visualização das tendência tecnológicas na indústria de poliolefinas nos mercados europeu e norte-americano, identificando e quantificando quatro indicadores tecnológicos: catalisadores, características da molécula, tipo de produto e campo de aplicação. Uma conclusão importante diz respeito à concentração de tecnologia, onde se observa que 6% das empresas com atividade em patenteamento detêm cerca de 40% do total de documentos, sendo que somente as quatro maiores depositárias dominam mais de 20% do total. Nota-se uma tendência de as empresas em buscar a inovação nas etapas finais da cadeia produtiva, com uma grande concentração de patentes em produtos e melhoria de aplicação.This article offers a strategic assessment of the technology for the production of polymers based on ethylene and propylene (mainly polyethylene and polypropylene, demonstrating the trends related to new products, markets and competitors, based on information extracted from patent documents published since 1990. The term "patent document" covers published patent applications or granted patents. A vision of the technological trends in the polyolefin industry in Europe and North America has been elucidated based upon the analysis of the patent documents studied during this research, and four technological indicators were identified and quantified: catalysts, molecular attributes, product type and

  9. Current Energy Patents

    International Nuclear Information System (INIS)

    Kelly, R.C.

    1982-01-01

    Current Energy Patents (CEP) provides abstracting and indexing coverage of the international patent literature, including patent applications, that concerns any aspect of energy production, conservation, and utilization

  10. Patent licensing and selling to China as a strategy of technology transfer in a New Era: A perspective of European firms

    DEFF Research Database (Denmark)

    Li, Ying; Meijer, Elise; Duysters, Geert

    2010-01-01

    International technology transfer enables firms in developed countries to exploit the value of their technological innovations, and provides firms in developing countries with access to technological and organizational knowledge. This study aims to present a timely description of the experience...... and intentions of EU firms with regard to patent licensing and/or selling to China in this new era. Firms from 12 European countries in various industries were surveyed by an online questionnaire. We found that (1) large and small EU firms are very different with regard to the number of non...

  11. Exploring gender differences in patenting in Spain

    OpenAIRE

    Elba Mauleón; Cinzia Daraio; Maria Bordons

    2013-01-01

    The under-representation of women in science and technology is a matter of current great concern. Obtaining patent-based indicators by gender is crucial to analyse the situation of women in innovation, identify potential cases of gender inequalities, and support policy measures to promote gender balance. In this article we analyse men and women involvement in Spanish patents applied to the European Patent Office during 1990--2004. At least one female inventor is present in 18% of the patents;...

  12. Normative reconstruction in Axel Honneth and the multiple fair and just of the labor market

    OpenAIRE

    Rosenfield, Cinara L.; Mello, Luciana Garcia de; Corrêa, Andressa S.

    2016-01-01

    Esse artigo tem por objetivo analisar as contribuições de Axel Honneth para o atual debate das teorias da justiça, entre as quais a principal é a busca de princípios normativos encrustados na realidade social. Em sua obra O direito da liberdade, o autor indica a liberdade como o grande valor moderno. O medium da justiça seria uma liberdade de tipo social a qual estaria expressa nas instituições vinculadas às relações pessoais, ao mercado e ao universo político. Considerando a lacuna entre os ...

  13. Do Military Personnel Patent

    Science.gov (United States)

    2016-12-01

    following questions: In what fields are military personnel most likely to patent, and how do demographics, such as age, race, and gender , along with...technologies, which have transformed how the United States wages war. DARPA continues to develop new technologies and capabilities for the U.S. military today...build the European navies so it instead decided to utilize an innovative ship design to exploit a gap specific to the British Royal Navy. The six

  14. The Coordination of Independently-Owned Vacuum Tube Patents in the Alleged Early Radio Patent Thicket

    DEFF Research Database (Denmark)

    Howells, John; Ron D, Katznelson

    -examines the legal trajectories and entrepreneurial exploitation of these patents with a focus on vacuum tube technology where Fleming’s diode patent ‘overlapped’ with earlier prior art and, dependent on court decisions, with later commercial implementations of De Forest’s triode patents. We show, by means...... of the relevant historical record, patent claims, litigation records and other relevant law, how the ‘overlapping’ patent rights were resolved by the courts and by the immunity of suppliers to the Government from patent infringement liability. We trace the cross-licensing agreements between the different radio...

  15. CERN Technical Training 2003: Learning for the LHC! : AXEL-2003  -  Introduction to Particle Accelerators

    CERN Multimedia

    2003-01-01

    AXEL-2003 is a course given at CERN within the framework of the Technical Training Programme. The course will present an introduction to particle accelerators. Known in the past as the PS Complex Operation Course (or the "PS Shutdown Course"), and organised by the ex-PS division until last year, it is now organised as a joint venture between the AB division and Technical Training, and open to a wider CERN community. The AXEL-2003 course series is designed for technicians who are operating an accelerator, or whose work is closely linked to accelerators, but it is open to all people (technicians, engineers, physicists) interested in this field. The course does not require any prior knowledge on accelerators. However, some basic knowledge on trigonometry, matrices and differential equations, and some basic notions of magnetism would be an advantage. The course and the course supports will be in English, with questions and answers also in French. Lectures will be recorded and available online via the Web Lectu...

  16. Panorama dos pedidos de patente de tecnologias relativas ao setor têxtil brasileiro | A panorama of patent requests for Brazilian textile sector technologies

    Directory of Open Access Journals (Sweden)

    Ricardo C. Rodrigues

    2015-10-01

    sector, deposited and published in Brazil between 1999 and 2009. On this database we analysed results showing countries and firms interested in the Brazilian market; the products, processes and or equipment which may constitute innovations; as well as the present status of the textile sector in terms of reseach and development. Keywords: Industrial Property; Textile Industry; Management; Technology.

  17. Immersive Technology for Human-Centric Cyberphysical Systems in Complex Manufacturing Processes: A Comprehensive Overview of the Global Patent Profile Using Collective Intelligence

    Directory of Open Access Journals (Sweden)

    Usharani Hareesh Govindarajan

    2018-01-01

    Full Text Available Immersive technology for human-centric cyberphysical systems includes broad concepts that enable users in the physical world to connect with the cyberworld with a sense of immersion. Complex systems such as virtual reality, augmented reality, brain-computer interfaces, and brain-machine interfaces are emerging as immersive technologies that have the potential for improving manufacturing systems. Industry 4.0 includes all technologies, standards, and frameworks for the fourth industrial revolution to facilitate intelligent manufacturing. Industrial immersive technologies will be used for smart manufacturing innovation in the context of Industry 4.0’s human machine interfaces. This research provides a thorough review of the literature, construction of a domain ontology, presentation of patent metatrend statistical analysis, and data mining analysis using a technology function matrix and highlights technical and functional development trends using latent Dirichlet allocation (LDA models. A total of 179 references from the IEEE and IET databases and 2,672 patents are systematically analyzed to identify current trends. The paper establishes an essential foundation for the development of advanced human-centric cyberphysical systems in complex manufacturing processes.

  18. US photovoltaic patents: 1991--1993

    Energy Technology Data Exchange (ETDEWEB)

    Pohle, L

    1995-03-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials as well as manufacturing and support functions. The patent entries in this document were issued from 1991 to 1993. The entries were located by searching USPA, the database of the US Patent Office. The final search retrieved all patents under the class ``Batteries, Thermoelectric and Photoelectric`` and the subclasses ``Photoelectric,`` ``Testing,`` and ``Applications.`` The search also located patents that contained the words ``photovoltaic(s)`` or ``solar cell(s)`` and their derivatives. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors, and subjects only peripherally concerned with photovoltaic. Some patents on these three subjects were included when ft appeared that those inventions might be of use in terrestrial PV power technologies.

  19. Discrimination against foreigners in the patent system : evidence from standard-essential patents

    NARCIS (Netherlands)

    de Rassenfosse, G.; Raiteri, E.; Bekkers, R.N.A.

    This paper tests for traces of discrimination against foreign firms in the patent prosecution process. It focuses on the case of China and looks specifically at patent applications declared as essential to a technological standard. The choice of standard-essential patents (SEPs) is particularly

  20. Discrimination in the patent system: evidence from standard-essential patents

    NARCIS (Netherlands)

    de Rassenfosse, G.; Raiteri, E.; Bekkers, R.N.A.

    2017-01-01

    This paper tests for traces of discrimination against foreigners in the patent prosecution process. It focuses on the case of China and looks specifically at patent applications declared as essential to a technological standard, so called standard-essential patents. The identification strategy

  1. Overcoming Social Pathologies in Education: On the Concept of Respect in R. S. Peters and Axel Honneth

    Science.gov (United States)

    Stojanov, Krassimir

    2009-01-01

    The concept of respect plays a central role in several recent attempts to re-actualise the programme of a critical social theory. In Axel Honneth's most prominent version of that concept, respect is closely tied to the sphere of law, and it is limited to the recognition of a Kantian-type moral autonomy of the individual. So interpreted, the…

  2. Imitation, patent protection and welfare

    NARCIS (Netherlands)

    Mukherjee, A.; Pennings, H.P.G.

    2000-01-01

    Once a new technology has been invented it is shown that the innovator has an incentive to postpone technology adoption when the cost of imitation is high and patent protection is strong. With the possibility of licensing it is shown that licensing oftechnology instead of delaying technology

  3. Contribuições de Axel Honneth aos debates da teoria crítica

    Directory of Open Access Journals (Sweden)

    Brena Costa Lerbach

    2014-07-01

    Full Text Available Este artigo pretende apresentar alguns dos debates e propostas teóricas que caracterizam a tradição sociológica conhecida como Teoria Crítica. Para tanto, aborda o pensamento de Max Horkheimer e de Theodor Adorno, ambos ligados à sua origem; as críticas e proposições realizadas por Jürgen Habermas; e, em seguida, as elaboradas por seu sucessor, Axel Honneth. Por fim, traremos as formulações deste último autor no livro “Luta por reconhecimento: a gramática moral dos conflitos sociais”, o qual aborda elementos importantes para a compreensão dos movimentos sociais no século XXI. E, como buscaremos argumentar, mantém vivos, de maneira atualizada, os propósitos presentes na origem da Teoria Crítica.   Abstract: This article aims to present some of the debates and theoretical proposals that characterize the sociological tradition known as Critical Theory. Therefore, it approaches Max Horkheimer and Theodor Adorno’s thought, both related to its origin; the critics and propositions made by Jürgen Habermas; and, subsequently, those elaborated by his successor, Axel Honneth. Finally, we are going to handle on this last author’s formulations in the book “The struggle for recognition: the moral grammar of social conflicts”, which approaches important elements for social movements’ comprehension in the XXI century. And, as we’ll try to argue, they keep alive, in an upgraded way, the purposes from Critical Theory’s origin. Resumen: Este artículo presenta algunos de los debates y posiciones teóricas que caracterizan la tradición sociológica conocida como Teoría Crítica. Por lo tanto, explora el pensamiento de Max Horkheimer y Theodor Adorno, ambos vinculados a su origen; las críticas y las propuestas realizadas por Jürgen Habermas; y, después,  las elaboradas por su sucesor, Axel Honneth. Por último, traeremos las formulaciones de este último autor en el libro “La lucha por el reconocimiento: la gram

  4. The Academic Advantage: Gender Disparities in Patenting

    Science.gov (United States)

    Sugimoto, Cassidy R.; Ni, Chaoqun; West, Jevin D.; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women’s rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women’s patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women—and in particular academic women—contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed. PMID:26017626

  5. The academic advantage: gender disparities in patenting.

    Directory of Open Access Journals (Sweden)

    Cassidy R Sugimoto

    Full Text Available We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO. Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  6. Experiences of nonrecognition among offshore workers in the Campos basin: an approach based on Axel Honneth

    Directory of Open Access Journals (Sweden)

    Adelia Maria Miglievich Ribeiro

    2011-11-01

    Full Text Available Our research focused on a specific group of workers – those employed in the petroleum industry in the Campos Basin (RJ by Petrobrás – and service providers. Their interviews provide empirical material for a possible new approach to the offshore workers’ environment based on some issues raised by Axel Honneth, current Critical Theory’s exponent, such as the experience of disrespect, moral feelings of indignation, and his articulation in search for solutions to configure or not a struggle for recognition. We attest the analytical potential of the Honnethian premises in guiding empirical investigations which may lead to the review of the production relationship as a space to experience the claim for its humanization within advanced capitalism, in which the tendency to individualistic and conformist solutions prevail as they are triggered by the concurrent work precariousness.

  7. AXEL HONNETH AND THE RECONSTRUCTION OF JUSTICE: AN ATTEMPT TO OVERCOME THE "DISTRIBUTION PARADIGM"

    Directory of Open Access Journals (Sweden)

    Stanley Souza Marques

    2015-12-01

    Full Text Available The article takes up the criticisms directed by Axel Honneth to the basic structure of the dominant conceptions of justice, but merely to point out the general outlines of his alternative project of justice normative reconstruction. If John Rawls and Michael Walzer structure theories of distributive justice very consistently and in order to get to the autonomy protection (already taken so in a more sophisticated way, that to be satisfied it transcends the (mere obligation of not interfering in the realization of individual life projects, Honneth proposes the radicalization of justice's demands. It is because he pays his attention to the mutual expectation of consideration. This point would be the new texture of the social justice. In this sense, the principles of fair distribution leave the scene to make way for principles which guidelines are directed towards the society basic institutions involved in a new goal: to set up favourable contexts for the success of plural reciprocal relationships.

  8. Alienation from the Objectives of the Patent System: How to Remedy the Situation of Biotechnology Patent.

    Science.gov (United States)

    Jiang, Li

    2018-03-12

    Some fundamental biotechnologies hold unprecedented potential to eradicate many incurable diseases. However, in absence of regulations, the power of patent makes the future use of some important biotechnology in few institution's hands. The excessive patents restrict researcher access to the fundamental technologies. It generates concerns and complaints of deteriorating the public health and social welfare. Furthermore, intellectual curiosities, funding, respect among colleagues etc., rather than patents, are the real motivations driving a major ground-breaking discoveries in biotechnology. These phenomena reveal that some biotechnology patents are alienated from the purpose of patent system. Therefore, it is necessary to take some approaches to stop over-patenting these fundamental biotechnology inventions. This article proposes a model regulatory framework for controlling biotechnology patent alienating from the purpose of patent system.

  9. Patent challenges for standard-setting in the global economy : lessons from information and communication industry

    NARCIS (Netherlands)

    Maskus, K.; Merrill, S.A.; Bekkers, R.N.A.; Sandy Block, Marc; Contreras, Jorge; Gilbert, Richard; Goodman, David; Marasco, Amy; Simcoe, Tim; Smoot, Oliver; Suttmeier, Richard; Updegrove, Andrew

    2014-01-01

    Patent Challenges for Standard-Setting in the Global Economy: Lessons from Information and Communication Technology examines how leading national and multinational standard-setting organizations (SSOs) address patent disclosures, licensing terms, transfers of patent ownership, and other issues that

  10. How patent experts create patent breadth

    DEFF Research Database (Denmark)

    Beukel, Karin

    2014-01-01

    Science as an input to patented inventions is a fundamental of economic growth. However, our understanding of how science is transformed into patents is limited. In the present paper I seek to fill this gap by examining the micro-foundations of science-patent transformations. Using an inductive......, grounded theory approach to study the transformation of 12 scientific discoveries into patents I recast the relationship between science and patents: I show it as a particular process that affects patent breadth. Exploiting surplus patent breadth depends on the processes of abstraction and cognitive...... variety, which can be mobilized by patenting experts. The theory is tested using a recently published algebraic interpretive method for examining causal relationships in small-N studies....

  11. How patent experts create patent breadth

    DEFF Research Database (Denmark)

    Beukel, Karin

    2018-01-01

    Science as an input to patented inventions is a fundamental of economic growth. However, our understanding of how science is transformed into patents is limited. In the present paper I seek to fill this gap by examining the micro-foundations of science-patent transformations. Using an inductive......, grounded theory approach to study the transformation of 12 scientific discoveries into patents I recast the relationship between science and patents: I show it as a particular process that affects patent breadth. Exploiting surplus patent breadth depends on the processes of abstraction and cognitive...... variety, which can be mobilized by patenting experts. The theory is tested using a recently published algebraic interpretive method for examining causal relationships in small-N studies....

  12. A study of fuel cell patenting activity in Canada

    International Nuclear Information System (INIS)

    Lee, B.Y.; Sajewycz, M.

    2004-01-01

    'Full text:' A patent application is generally filed shortly after completion of research and development; therefore, patent filing statistics provide insight into the state of innovation of a technology. A study has been conducted on fuel cell patenting activity in Canada. This study examines fuel cell patenting trends between 1989-2003 and specific activity in 2001, identifies the major players in the Canadian fuel cell industry, and examines the patent landscape by fuel cell technology. Our results show that historically, Canadians have been leaders at home and abroad in fuel cell innovation. However, Canadians have recently fallen behind in protecting their patent rights at home, and now rank fourth behind German, American and Japanese fuel cell patent filers in the Canadian patent office. However, our data also shows that a significant number of new Canadian entities have emerged and have been very active filing new patent applications. These new entities as well as established Canadian companies are examined in detail. (author)

  13. Argonne National Laboratory patent portfolio

    International Nuclear Information System (INIS)

    Huguelet, B.C.

    1976-01-01

    This booklet contains the abstracts of all active U. S. patents on technology items that originated at ANL, the applicability of which is not limited to nuclear reactors. Also listed are the titles of all ANL-originated nuclear-related U. S. patents that are still in force. Selected technology items for which patent applications have been filed and are available for licensing are included in several categories. Categories included in this booklet are as follows: atmospheric and earth sciences; biological and medical sciences; chemistry and chemical engineering; cryogenics and superconductivity; electronics and electrical engineering; energy conversion; measurements and controls; methods and devices; materials and fabrication; physics, accelerators and fusion; and selected nuclear-related technology

  14. Test of Axel-Brink predictions by a discrete approach to resonance-averaged (n,γ) spectroscopy

    International Nuclear Information System (INIS)

    Raman, S.; Shahal, O.; Slaughter, G.G.

    1981-01-01

    The limitations imposed by Porter-Thomas fluctuations in the study of primary γ rays following neutron capture have been partly overcome by obtaining individual γ-ray spectra from 48 resonances in the 173 Yb(n,γ) reaction and summing them after appropriate normalizations. The resulting average radiation widths (and hence the γ-ray strength function) are in good agreement with the Axel-Brink predictions based on a giant dipole resonance model

  15. Performance of Patenting Firms in Danish Manufacturing

    DEFF Research Database (Denmark)

    Madsen, Erik Strøjer; Smith, Valdemar; Nielsen, Anders Østergaard

    2000-01-01

    Most countries focus on industries with high technology and the governments grant subsidies to innovating firms. However, there has been remarkable few studies of the performance of innovative firms or industries. This study examines the performance of patent active firms compared to the non-patenting...... firms within the manufacturing sector in Denmark. Performance is measured both by growth in employment as well as in the return on equity and profit share in turnover. The results suggest that differences in performance of patenting and non-patenting firms are very small, which questions the political...

  16. Entrevista com Axel Honneth - "As relações de trabalho no mundo atual"

    Directory of Open Access Journals (Sweden)

    Elsa Cristine Bevian

    2016-06-01

    Full Text Available http://dx.doi.org/10.5007/1807-1384.2016v13n2p165 O Instituto de Pesquisas Sociais (Institut für Sozialforschung foi fundado em 1923, como um anexo da Universidade de Frankfurt, hoje intitulada Johann Wolfgang Goethe-Universität Frankfurt am Main. A Escola de Frankfurt, desde 1930, foi dirigida por Max Horkheimer, e reunia pensadores como Theodor W. Adorno, Erich Fromm, Herbert Marcuse, e, contou também como membro do "círculo de fora" do Instituto, Walter Benjamin. Estes intelectuais formularam, como sabemos, o que conhecemos como "Teoria Crítica". Nos anos sessenta, temos a "segunda geração", marcado pela obra de Jürgen Habermas. Aquele que foi seu assistente entre 1984 e 1990, Axel Honneth, veio a ser o Diretor do Instituto frankfurtiano desde 2001. Com ele inaugura-se a "terceira geração" da Escola, cuja proposta consiste em relançar a "Teoria Crítica", sobretudo a partir do livro Kampf um Anerkennung. Zur moralischen Grammatik sozialer Konflikte, de 1992 (publicado no Brasil como Luta por reconhecimento - A Gramática Moral dos Conflitos Sociais. Trad. Luiz Repa. São Paulo: Ed. 34, 2003, tendo como ponto de partida a Fenomenologia do Espírito de Hegel. Honneth centra sua reflexão na "teoria do reconhecimento" e, através dela, são apresentados os limites da obra das gerações de frankfurtianos anteriores.  A falta de reconhecimento passa a ser vista como base dos conflitos interpessoais, sociais e políticos na atualidade. Mais recentemente, Honneth publicou Das Recht der Freiheit (Berlin, Suhrkamp, 2011 - O direito à liberdade e Die Idee des Sozialismus (Berlin, Suhrkamp, 2015 - A ideia do socialismo, sustentando que o socialismo está vivo como ideia, e tem como cerne a liberdade social. Foi em 2014, no Instituto de Pesquisas Sociais de Frankfurt, que aconteceu o encontro e a entrevista com o Diretor do Instituto, Axel Honneth. O foco da breve entrevista, aqui apresentada no original alemão e em tradução portuguesa.

  17. Published patent applications and patents from the promoted R + D area

    International Nuclear Information System (INIS)

    Jaeckel, G.; Zierl, I.

    1977-09-01

    The Ministry for Research and Technology of the Federal Republic of Germany has sponsored technological R + D for industrial innovations since 1969. The following compilation includes the published patent applications and patents from all projects which were sponsored up to and including 1973. (orig.) [de

  18. US Photovoltaic Patents, 1988--1990

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials, as well as manufacturing and support functions. The patent entries in this document were issued from 1988 through 1990. The entries were located by searching USPA, the data base of the US Patent Office. The final search retrieved all patents under the class ``Batteries, Thermoelectric and Photoelectric`` and the subclasses ``Photoelectric,`` ``Testing,`` and ``Applications.`` The search also located patents that contained the words ``photovoltaic(s)`` or ``solar cell(s)`` and their derivatives. A manual search of the patents in the Solar Energy Research Institute (SERI) patent file augmented the data base search. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors and subjects only peripherally concerned with photovoltaics. Some patents on these three subjects were included when it appeared that those inventions might be of use in terrestrial PV power technologies.

  19. US Photovoltaic Patents, 1988--1990

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-01

    This document contains US patents on terrestrial photovoltaic (PV) power applications, including systems, components, and materials, as well as manufacturing and support functions. The patent entries in this document were issued from 1988 through 1990. The entries were located by searching USPA, the data base of the US Patent Office. The final search retrieved all patents under the class Batteries, Thermoelectric and Photoelectric'' and the subclasses Photoelectric,'' Testing,'' and Applications.'' The search also located patents that contained the words photovoltaic(s)'' or solar cell(s)'' and their derivatives. A manual search of the patents in the Solar Energy Research Institute (SERI) patent file augmented the data base search. After the initial list was compiled, most of the patents on the following subjects were excluded: space photovoltaic technology, use of the photovoltaic effect for detectors and subjects only peripherally concerned with photovoltaics. Some patents on these three subjects were included when it appeared that those inventions might be of use in terrestrial PV power technologies.

  20. Patents in INIS

    International Nuclear Information System (INIS)

    Scheel, H.; Breitfeld, B.

    1983-01-01

    Proceeding from the INIS rules for collecting, characterizing, and making available patent documents, results of an analysis are presented, which concern timeliness, origin, and classification of patents according to the INIS subject categories and the International Patent Classification. GDR's capabilities for SDI services and retrospective searches are outlined taking into account patents. For a selected subject area (IPC G21) the coverage of patents announced by INIS was found to be about 30%

  1. 77 FR 48733 - Transitional Program for Covered Business Method Patents-Definitions of Covered Business Method...

    Science.gov (United States)

    2012-08-14

    ... Office 37 CFR Part 42 Transitional Program for Covered Business Method Patents--Definitions of Covered... Business Method Patents-- Definitions of Covered Business Method Patent and Technological Invention AGENCY... forth in detail the definitions of the terms ``covered business method patent'' and ``technological...

  2. Bibliography of US patents on augmentation of convective heat and mass transfer

    International Nuclear Information System (INIS)

    Webb, R.L.; Junkhan, G.H.; Bergles, A.E.

    1980-09-01

    Granted patents are an important source of information on the potential commercialization of augmented heat transfer technology. This report presents a bibliography of US patents pertinent to that technology. The total number of patents cited is 321. They are presented in three separate lists: by patent number, alphabetically by first inventor, and by augmentation techniques

  3. SUBJECTION AND RECOGNIZABILITY: AGAINST RECOGNITION’S INNOCENCE IN AXEL HONNETH

    Directory of Open Access Journals (Sweden)

    Jacinta Gorriti

    2015-06-01

    Full Text Available This article presents a critical reading of Axel Honneth’s work “Recognition as ideology” (2006, built upon Judith Butler’s theory of subjection. It attempts to show that because of not considering here enough the dimension of power, the German thinker does not confront successfully the stances that question recognition’s critical potential. This work suggests that such an absence is linked to Honneth’s definition of recognition as being the opposite of practices of domination or subordination. However, Honneth affirms that these skeptical stances are based on the idea that every recognitional praxis reproduces in some way the dominating social order. This article offers then, a critical look upon this idea, warning that an analysis about the way power works on daily recognition practices does not necessarily entail a resignation of the critical function of recognition. More likely, as the Butlerian (and Foucauldian notion of critique suggests, only by framing recognition in the normative horizon that defines it, it can become the basis of social inquiry.

  4. Freedom and friendship in Axel Honneth’s freedom’s right

    Directory of Open Access Journals (Sweden)

    Muders Sebastian

    2017-01-01

    Full Text Available In Axel Honneth’s Freedom’s Right (FR personal relations, among which Honneth includes not only family and partner relationships but friendship as well, enable the realization of one ‘specific form of freedom, which is difficult to specify’ (FR 233. This assertion constitutes one of the main thesis of Freedom’s Right. Accordingly, ‘freedom in the sense of individual autonomy’ should, among countless different ‘conceptions of freedom’ be understood as the only one that has the power to shape modern society, while all other values effective within modernity should be understood as ‘aspects of the constitutive idea of individual autonomy’ (FR 35. In this paper we argue that Honneth’s discussion of the value of friendship does not accomplish its aim for three reasons: first, Honneth is compelled by his argument to postulate one radical cleavage internal to the concept of friendship, by way of an exaggerated contrast between ancient and modern forms of friendship. Second, in his discussion Honneth marginalizes other existing axiologies of friendship, which attribute some other important instrumental, constitutive and final values to this term. Third, even a weaker thesis, one that treats the value of friendship as the precondition of individual freedom as a primus inter pares, seems to lose sight of the central importance that friendship has for us.” Honneth’s key thesis about the unique value of friendship in our society is thereby challenged.

  5. Essential patents in industry standards : the case of UMTS

    NARCIS (Netherlands)

    Bekkers, R.N.A.; Bongard, R.; Nuvolari, A.

    2009-01-01

    We study the determinants of essential patents in industry standards. In particular, we assess the role of two main factors: the significance of the technological solution contained in the patent and the involvement of the applicant of the patent in the standardization process. To this end, we

  6. 77 FR 38771 - Prospective Grant of Exclusive Patent License

    Science.gov (United States)

    2012-06-29

    ... Exclusive Patent License AGENCY: National Institute of Standards and Technology, Department of Commerce. ACTION: Notice of prospective grant of exclusive patent license. SUMMARY: This is a notice in accordance... embodied in U.S. Patent Application No. 13/346,999 titled ``Chirped-Pulse Terahertz Spectroscopy for...

  7. 77 FR 65673 - Prospective Grant of Exclusive Patent License

    Science.gov (United States)

    2012-10-30

    ... Exclusive Patent License AGENCY: National Institute of Standards and Technology, Commerce. ACTION: Notice of prospective grant of exclusive patent license. SUMMARY: This is a notice in accordance with 35 U.S.C. 209(e.... Patent Application No. 61/625,511 titled ``UV-Assisted Alcohol Sensing with Zinc Oxide Functionalized...

  8. 77 FR 48130 - Prospective Grant of Exclusive Patent License

    Science.gov (United States)

    2012-08-13

    ... Exclusive Patent License AGENCY: National Institute of Standards and Technology, Commerce. ACTION: Notice of prospective grant of exclusive patent license. SUMMARY: This is a notice in accordance with 35 U.S.C. 209(e... Provisional Application for Patent Application No. 61,638,362 titled ``Flow Cytometer Systems and Associated...

  9. Teaching Chemistry Students How To Use Patent Databases and Glean Patent Information

    Science.gov (United States)

    MacMillan, Margy; Shaw, Lawton

    2008-07-01

    Patent literature is an important source of chemical information that is often neglected by chemical educators. This paper describes an effort to teach chemistry students how to use patent databases to search for information on applied chemical technology related to the manufacture of industrial and specialty chemicals. Students in a second-year-level organic chemistry class were shown how to search patent literature as part of a group research paper assignment that involved determining the feasibility of starting an industrial chemical operation to manufacture a given industrial chemical. Students who were assigned high value or specialty chemicals were most likely to cite patent literature in their final papers. Students who were assigned plastics or bulk commodity chemicals were less likely to cite patents. It is suggested that students made choices about the usefulness of patent literature and that patents were most useful when current patents existed and provided the patent owner a competitive advantage. For plastics or commodity chemicals, manufacturing technologies tend to be mature and are well described by more accessible information sources. Suggestions are made for effective introduction of patent literature instruction into upper-level chemistry courses.

  10. Nanotechnology patents in the automotive industry (a quantitative & qualitative analysis).

    Science.gov (United States)

    Prasad, Raghavendra; Bandyopadhyay, Tapas K

    2014-01-01

    The aim of the article is to present a trend in patent filings for application of nanotechnology to the automobile sector across the world, using the keyword-based patent search. Overviews of the patents related to nano technology in the automobile industry have been provided. The current work has started from the worldwide patent search to find the patents on nanotechnology in the automobile industry and classify the patents according to the various parts of an automobile to which they are related and the solutions which they are providing. In the next step various graphs have been produced to get an insight into various trends. In next step, analysis of patents in various classifications, have been performed. The trends shown in graphs provide the quantitative analysis whereas; the qualitative analysis has been done in another section. The classifications of patents based on the solution they provide have been performed by reading the claims, titles, abstract and full texts separately. Patentability of nano technology inventions have been discussed in a view to give an idea of requirements and statutory bars to the patentability of nanotechnology inventions. Another objective of the current work is to suggest appropriate framework for the companies regarding use of nano technology in the automobile industry and a suggestive strategy for patenting of the inventions related to the same. For example, US Patent, with patent number US2008-019426A1 discusses the invention related to Lubricant composition. This patent has been studied and classified to fall under classification of automobile parts. After studying this patent, it is deduced that, the problem of friction in engine is being solved by this patent. One classification is the "automobile part" based while other is the basis of "problem being solved". Hence, two classifications, namely reduction in friction and engine were created. Similarly, after studying all the patents, a similar matrix has been created.

  11. Patentability of inventions under the Nigeria's patents and designs act

    African Journals Online (AJOL)

    Patentability of inventions under the Nigeria's patents and designs act: an examination. ... AFRICAN JOURNALS ONLINE (AJOL) · Journals · Advanced Search · USING ... The Nigerian Patent Registry refuses patent applications for Software or ...

  12. Litigation-proof patents: avoiding the most common patent mistakes

    National Research Council Canada - National Science Library

    Goldstein, Larry M

    2014-01-01

    "Litigation-Proof Patents: Avoiding the Most Common Patent Mistakes explains the principles of excellent patents, presents the ten most common errors in patents, and details a step-by-step method for avoiding these common errors...

  13. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  14. A guide of patent map

    International Nuclear Information System (INIS)

    1999-12-01

    This book introduces application and characteristic of patent information, types of patent information data and research of patent information, arrangement of patent information and patent map, analysis of patent information, necessity, writing period arrangement way of patent map, cases of patent map on selection of task of research and development, system of research and development and application, examples of PM such as MAP by year, application, technique, Inventor, and claim point map and computerization like data arrangement of PM patent, collection of analysis range and item analysis of patent, cases and written reports on patent analysis.

  15. Interações entre ciência e tecnologia: análise da produção intelectual dos pesquisadores-inventores da primeira carta-patente da UFRGS Interactions between science and technology: analysis of the intellectual production of the researchers-inventors of the first letter- patent of the UFRGS

    Directory of Open Access Journals (Sweden)

    Helen Beatriz Frota Rozados

    2006-01-01

    Full Text Available Discute questões como propriedade intelectual e industrial e diferenças existentes entre conhecimento científico e tecnológico. Busca inserir a patente no contexto da comunicação científica e tecnológica. Apresenta dados de um estudo que objetiva analisar a relação entre a informação científica e a tecnológica na produção intelectual dos pesquisadores-inventores da primeira carta-patente da Universidade Federal do Rio Grande do Sul (UFRGS. O período analisado compreende os anos anteriores à publicação do pedido da patente (1996-2000 e posteriores (2001-2005. Conclui que, no caso analisado, ocorre um fluxo entre a informação científica e tecnológica, na qual a primeira, após sua divulgação e aprovação pelos pares, subsidia a segunda. Da mesma forma, a patente gera um impacto na produção científica dos pesquisadores, ocorrendo uma retroalimentação entre ciência e tecnologia. Sugere que novos estudos sejam realizados.The paper discusses intellectual and industrial property and existing differences between scientific and technological knowledge. It aims at incorporating the patent in the context of the scientific and technological communication. It presents preliminary data of a study that aims at analyzing the relationship between scientific and technological information in the intellectual production of the researchers-inventors of the first patent from the Federal University of Rio Grande do Sul (UFRGS. It concludes that, in the case studied, a flow between scientific and technological information occurs, in which the former, after its diffusion and approval in the peer review process, subsidizes the latter. It suggests that other studies should be carried out.

  16. Patents for Soldiers

    Science.gov (United States)

    2016-06-10

    PATENTS FOR SOLDIERS A thesis presented to the Faculty of the U.S. Army Command and General Staff College in partial fulfillment...COVERED (From - To) AUG 2015 – JUNE 2016 4. TITLE AND SUBTITLE Patents for Soldiers 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM...protection of an innovative idea; that is, a patent . A Soldier’s pursuit of patents provides the Army with tangible and intangible benefits. There are on

  17. Have Chinese firms learned from their prior technology in-licensing? An analysis based on patent citations

    DEFF Research Database (Denmark)

    Li-Ying, Jason; Wang, Yuandi; Salomo, Søren

    2013-01-01

    With the rapid rise of Chinese economy, now ranking as the second largest economy in the world in 2010, many Chinese firms have started taking technological lead in the global market. Nevertheless, whether Chinese firms have learned from their prior inlicensing technologies and accumulated...

  18. Transferability and Commercialization of Patent Rights: Economic and Practical Perspectives

    Directory of Open Access Journals (Sweden)

    Haim V. Levy

    2012-01-01

    Full Text Available The transformation of innovation into commercial value depends primarily on appropriate protection of the intellectual property, usually by patents, and efficient pathway(s of its transferability as well as the transfer of the protected knowledge. The key features of patents, from an economic perspective, are that they encompass new knowledge and confer monopoly rights to the owner. The exclusiveness of patent rights is generally conceived as a necessary mechanism to ensure further innovation, stimulate advanced research and facilitate efficient market transactions with patent rights. The patent holder can transfer the technology embodied by way of granting to others a license to use the patented invention in return for a share of the revenues, usually royalties. Patent rights transferability has been proven to be efficient and profitable to the industry as well as beneficial to the welfare of society. The economic and practical perspectives of the transferability and commercialization of patent rights are discussed.

  19. Digital pathology: A systematic evaluation of the patent landscape

    Directory of Open Access Journals (Sweden)

    Ioan C. Cucoranu

    2014-01-01

    Full Text Available Introduction: Digital pathology is a relatively new field. Inventors of technology in this field typically file for patents to protect their intellectual property. An understanding of the patent landscape is crucial for companies wishing to secure patent protection and market dominance for their products. To our knowledge, there has been no prior systematic review of patents related to digital pathology. Therefore, the aim of this study was to systematically identify and evaluate United States patents and patent applications related to digital pathology. Materials and Methods: Issued patents and patent applications related to digital pathology published in the United States Patent and Trademark Office (USPTO database (www.uspto.gov (through January 2014 were searched using the Google Patents search engine (Google Inc., Mountain View, California, USA. Keywords and phrases related to digital pathology, whole-slide imaging (WSI, image analysis, and telepathology were used to query the USPTO database. Data were downloaded and analyzed using the Papers application (Mekentosj BV, Aalsmeer, Netherlands. Results: A total of 588 United States patents that pertain to digital pathology were identified. In addition, 228 patent applications were identified, including 155 that were pending, 65 abandoned, and eight rejected. Of the 588 patents granted, 348 (59.18% were specific to pathology, while 240 (40.82% included more general patents also usable outside of pathology. There were 70 (21.12% patents specific to pathology and 57 (23.75% more general patents that had expired. Over 120 unique entities (individual inventors, academic institutions, and private companies applied for pathology specific patents. Patents dealt largely with telepathology and image analysis. WSI related patents addressed image acquisition (scanning and focus, quality (z-stacks, management (storage, retrieval, and transmission of WSI files, and viewing (graphical user interface (GUI

  20. Digital pathology: A systematic evaluation of the patent landscape.

    Science.gov (United States)

    Cucoranu, Ioan C; Parwani, Anil V; Vepa, Suryanarayana; Weinstein, Ronald S; Pantanowitz, Liron

    2014-01-01

    Digital pathology is a relatively new field. Inventors of technology in this field typically file for patents to protect their intellectual property. An understanding of the patent landscape is crucial for companies wishing to secure patent protection and market dominance for their products. To our knowledge, there has been no prior systematic review of patents related to digital pathology. Therefore, the aim of this study was to systematically identify and evaluate United States patents and patent applications related to digital pathology. Issued patents and patent applications related to digital pathology published in the United States Patent and Trademark Office (USPTO) database (www.uspto.gov) (through January 2014) were searched using the Google Patents search engine (Google Inc., Mountain View, California, USA). Keywords and phrases related to digital pathology, whole-slide imaging (WSI), image analysis, and telepathology were used to query the USPTO database. Data were downloaded and analyzed using the Papers application (Mekentosj BV, Aalsmeer, Netherlands). A total of 588 United States patents that pertain to digital pathology were identified. In addition, 228 patent applications were identified, including 155 that were pending, 65 abandoned, and eight rejected. Of the 588 patents granted, 348 (59.18%) were specific to pathology, while 240 (40.82%) included more general patents also usable outside of pathology. There were 70 (21.12%) patents specific to pathology and 57 (23.75%) more general patents that had expired. Over 120 unique entities (individual inventors, academic institutions, and private companies) applied for pathology specific patents. Patents dealt largely with telepathology and image analysis. WSI related patents addressed image acquisition (scanning and focus), quality (z-stacks), management (storage, retrieval, and transmission of WSI files), and viewing (graphical user interface (GUI), workflow, slide navigation and remote control). An

  1. Science and Technology Output Indicators in the Islamic Republic of Iran: A Case Study on the Relevance between Patents and Scientific Products of Iranian Inventors

    Directory of Open Access Journals (Sweden)

    Mohamad Alaee Arani

    2012-10-01

    Full Text Available The output of scientific products represents the efforts of scientific and industrial communities. The study on this output shows scientific attitudes and approaches of a community towards world of science. Quantitative studies can give a representation of the size and extent of the scientific efforts of researchers in special occasions, or a particular society. Patents are one of these important outputs. In this study, the names of Iranian inventors were extracted by carrying a combined search and the analysis of patent data available through Europe Patent Office (EPO, the United States Patent and Trademark Office (USPTO, Japan Patent Office (JPO, and the World Intellectual Property Organization (WIPO databases. Inventors amount of scientific products were also evaluated by using citation indexes in Thompson Reuters (formerly ISI Web of Science. Content analysis research method was adopted. Results of this study reported no significant correlation was found between scientific output and patent application. Findings also indicated a 6.5 percent contribution of patent researcher in comparison with non-patent researchers of Iranian indexed articles by Web of Science.

  2. On Sharks, Trolls, and Other Patent Animals

    DEFF Research Database (Denmark)

    Reitzig, Markus; Henkel, Joachim; Heath, Christopher

    2007-01-01

    Patent trolls (or sharks) are small patent holding individuals or firms who trap R&D intense manufacturers in patent infringement situations in order to receive damage awards for the illegitimate use of their technology. While of great concern to management, their existence and impact for both...... corporate decision makers and policy makers remains to be fully analyzed from an academic standpoint. In this paper we show why patent sharks can operate profitably, why they are of growing concern, how manufacturers can forearm themselves against them, and which issues policy makers need to address. To do...... so, we map international indemnification rules with strategic rationales of small patent-holding firms within a game-theoretical model. Our central finding is that the courts’ unrealistic consideration of the trade-offs faced by inadvertent infringers is a central condition for sharks to operate...

  3. Axel Honneth: The law of freedom – Institutionalization of freedom in modern societies - A reconstruction and some remarks

    Directory of Open Access Journals (Sweden)

    Jacob Dahl Rendtorff

    2012-03-01

    Full Text Available This paper reconstructs the argument of Axel Honneth's recent book Das Recht der Freiheit as a theory of the institutionalization of freedom in modern society. In particular, it looks at Honneth's argument for the realization of freedom in law and morality that is proposed as a contemporary re-interpretation of Hegel's Philosophy of Right. Then I discuss Honneth's argument for the reality of freedom in the ethical spheres of civil society, in particular in the family, the market and in democracy. Finally, the paper proposes some critical remarks to Honneth's theory.

  4. Axel Honneth: The law of freedom – Institutionalization of freedom in modern societies - A reconstruction and some remarks

    DEFF Research Database (Denmark)

    Rendtorff, Jacob Dahl

    2012-01-01

    This paper reconstructs the argument of Axel Honneth's recent book Das Recht der Freiheit as a theory of the institutionalization of freedom in modern society. In particular, it looks at Honneth's argument for the realization of freedom in law and morality that is proposed as a contemporary re......-interpretation of Hegel's Philosophy of Right. Then I discuss Honneth's argument for the reality of freedom in the ethical spheres of civil society, in particular in the family, the market and in democracy. Finally, the paper proposes some critical remarks to Honneth's theory....

  5. Concerns and evidence for ex-post hold-up with essential patents

    NARCIS (Netherlands)

    Bekkers, R.N.A.

    2015-01-01

    Patented technologies may add significant value to technical standards. But the owners of patents that are necessary required in order to implement a standard (“essential patents”) obtain a particularly powerful position. One of the widely recognized risks here is patent holdup, where the patent

  6. Inventing around Edison’s Incandescent Lamp Patent

    DEFF Research Database (Denmark)

    Howells, John; Katznelson, Ron D.

    ’s ‘898 patent. Third, by analysis of forward citation to these patents we show that regardless of these inventions’ commercial viability in the incandescent lamp market, some became important prior art for new technological fields and some laid the groundwork for the later successful substitute...... for Edison’s carbon filament. Fourthly, we show that the recent view that Edison’s patent gave the patent holder General Electric (GE) a dominant position in the incandescent lamp market is incorrect: we show that besides commercially-successful invention around the claims of this patent, data for GE...

  7. Inventing around Edison’s incandescent lamp patent

    DEFF Research Database (Denmark)

    Howells, John; Ron D, Katznelson

    ’s ‘898 patent. Third, by analysis of forward citation to these patents we show that regardless of these inventions’ commercial viability in the incandescent lamp market, some became important prior art for new technological fields and some laid the groundwork for the later successful substitute...... for Edison’s carbon filament. Fourthly, we show that the recent view that Edison’s patent gave the patent holder General Electric (GE) a dominant position in the incandescent lamp market is incorrect: we show that besides commercially-successful invention around the claims of this patent, data for GE...

  8. Patent analysis for competitive technical intelligence and innovative thinking

    Directory of Open Access Journals (Sweden)

    H Dou

    2006-01-01

    Full Text Available Patents are a very useful source of technical information. The public availability of patents over the Internet, with for some databases (eg. Espacenet the assurance of a constant format, allows the development of high value added products using this information source and provides an easy way to analyze patent information. This simple and powerful tool facilitates the use of patents in academic research, in SMEs and in developing countries providing a way to use patents as a ideas resource thus improving technological innovation.

  9. Monitoring nanotechnology using patent classifications: an overview and comparison of nanotechnology classification schemes

    Energy Technology Data Exchange (ETDEWEB)

    Jürgens, Björn, E-mail: bjurgens@agenciaidea.es [Agency of Innovation and Development of Andalusia, CITPIA PATLIB Centre (Spain); Herrero-Solana, Victor, E-mail: victorhs@ugr.es [University of Granada, SCImago-UGR (SEJ036) (Spain)

    2017-04-15

    Patents are an essential information source used to monitor, track, and analyze nanotechnology. When it comes to search nanotechnology-related patents, a keyword search is often incomplete and struggles to cover such an interdisciplinary discipline. Patent classification schemes can reveal far better results since they are assigned by experts who classify the patent documents according to their technology. In this paper, we present the most important classifications to search nanotechnology patents and analyze how nanotechnology is covered in the main patent classification systems used in search systems nowadays: the International Patent Classification (IPC), the United States Patent Classification (USPC), and the Cooperative Patent Classification (CPC). We conclude that nanotechnology has a significantly better patent coverage in the CPC since considerable more nanotechnology documents were retrieved than by using other classifications, and thus, recommend its use for all professionals involved in nanotechnology patent searches.

  10. Monitoring nanotechnology using patent classifications: an overview and comparison of nanotechnology classification schemes

    International Nuclear Information System (INIS)

    Jürgens, Björn; Herrero-Solana, Victor

    2017-01-01

    Patents are an essential information source used to monitor, track, and analyze nanotechnology. When it comes to search nanotechnology-related patents, a keyword search is often incomplete and struggles to cover such an interdisciplinary discipline. Patent classification schemes can reveal far better results since they are assigned by experts who classify the patent documents according to their technology. In this paper, we present the most important classifications to search nanotechnology patents and analyze how nanotechnology is covered in the main patent classification systems used in search systems nowadays: the International Patent Classification (IPC), the United States Patent Classification (USPC), and the Cooperative Patent Classification (CPC). We conclude that nanotechnology has a significantly better patent coverage in the CPC since considerable more nanotechnology documents were retrieved than by using other classifications, and thus, recommend its use for all professionals involved in nanotechnology patent searches.

  11. [Axel Ström--pioneer of social medicine and administrator].

    Science.gov (United States)

    Sundby, Per

    2002-01-10

    Dr Axel Strøm (1901-85), professor in the University of Oslo from 1940 to 1970, was a leader in Norwegian medicine in the latter half of the 20th century. He qualified in 1926 and in 1936 gained a doctorate with a dissertation on the toxin production of the Corynebacterium diphtheriae. His first appointment as a professor was in hygiene. In 1951 he moved on to public health, a field that he pioneered in Norway and the other Scandinavian countries. As a professor during the German occupation of Norway in the Second World War, he joined the university's resistance against the Nazi authorities' attempts at taking control. When the war was over he became deeply involved in research on the impact of war on health. At a time when the study of the impact of lifestyle factors was still in its infancy, he suggested that the war-induced reduction in dietary fat consumption might be the cause of observed lower cardiovascular mortality. Of more practical importance were the studies he initiated of the mainly psychological late-onset effects of traumas suffered by prisoners in German camps, seamen, soldiers and other exposed groups. In this area, too, he was an early explorer, of what has come to be known as post-traumatic stress disorder. His efforts led to improved war pension entitlements for the victims. Over the years, exposed groups became his major professional interest as a public health specialist. In his academic work, dr Strøm also pioneered medical ethics, care for the elderly, legislation on abortion, and the rapidly expanding field of the medical basis for social security benefits. As a practising physician he was in the vanguard of occupational medicine and other kinds of preventive medicine. What brought him most recognition was, however, his leading role over many years in the Norwegian Medical Association and in the University of Oslo. He served as chairman of the Junior Hospital Doctors Association, president of the Norwegian Medical Association and

  12. Invention note and patent note

    International Nuclear Information System (INIS)

    Chang, Sung Su

    1997-09-01

    This book deals with origin of invention and term related patent and invention, making idea, brain storming, 10 laws of invention skill, attitude of inventors, invention order, making good inventions, patent system, preparation of application, procedure and method of patent, management of patent, patent and trademark office, patent lawyer, copyright, new intellectual property right, industrial property right, trademark, invasion of industrial property right, patent, Judgment, preparation of items, application of industrial property right and effect of inventor and related people.

  13. Biotechnological Patents Applications of the Deuterium Oxide in Human Health.

    Science.gov (United States)

    da S Mariano, Reysla M; Bila, Wendell C; Trindade, Maria Jaciara F; Lamounier, Joel A; Galdino, Alexsandro S

    2017-01-01

    Deuterium oxide is a molecule that has been used for decades in several studies related to human health. Currently, studies on D2O have mobilized a "Race for Patenting" worldwide. Several patents have been registered from biomedical and technological studies of D2O showing the potential of this stable isotope in industry and health care ecosystems. Most of the patents related to the applications of the deuterium oxide in human health have been summarized in this review. The following patents databases were consulted: European Patent Office (Espacenet), the United States Patent and Trademark Office (USPTO), the United States Latin America Patents (LATIPAT), Patent scope -Search International and National Patent Collections (WIPO), Google Patents and Free Patents Online. With this review, the information was collected on recent publications including 22 patents related to deuterium oxide and its applications in different areas. This review showed that deuterium oxide is a promising component in different areas, including biotechnology, chemistry and medicine. In addition, the knowledge of this compound was covered, reinforcing its importance in the field of biotechnology and human health. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Revising the Complex Economics of Patent Scope

    DEFF Research Database (Denmark)

    Howells, John

    Merges and Nelson claim to have provided an empirically grounded argument that pioneer patents of 'broad' scope are used to block technological development. It is widely understood in both law and economics that they have, as they claim, faulted Kitch's 'prospect theory' of patents, a theory...... that a function of patents is to enable the coordinated development of novel technical ideas. This article is a critical review of Merges and Nelson's historical empirical evidence. I find that, first, 'broad' scope is only implicated in one of the examples cited by Merges and Nelson as supportive evidence...... - the Wright brothers' warped-wing patent; second, that strict development block, defined as the prevention, or retardation of the development of technology understood to be capable of useful development, was not illustrated by any of their examples. Therefore I conclude that their general thesis...

  15. Worldwide nanotechnology development: a comparative study of USPTO, EPO, and JPO patents (1976-2004)

    International Nuclear Information System (INIS)

    Li Xin; Lin Yiling; Chen Hsinchun; Roco, Mihail C.

    2007-01-01

    To assess worldwide development of nanotechnology, this paper compares the numbers and contents of nanotechnology patents in the United States Patent and Trademark Office (USPTO), European Patent Office (EPO), and Japan Patent Office (JPO). It uses the patent databases as indicators of nanotechnology trends via bibliographic analysis, content map analysis, and citation network analysis on nanotechnology patents per country, institution, and technology field. The numbers of nanotechnology patents published in USPTO and EPO have continued to increase quasi-exponentially since 1980, while those published in JPO stabilized after 1993. Institutions and individuals located in the same region as a repository's patent office have a higher contribution to the nanotechnology patent publication in that repository ('home advantage' effect). The USPTO and EPO databases had similar high-productivity contributing countries and technology fields with large number of patents, but quite different high-impact countries and technology fields after the average number of received cites. Bibliographic analysis on USPTO and EPO patents shows that researchers in the United States and Japan published larger numbers of patents than other countries, and that their patents were more frequently cited by other patents. Nanotechnology patents covered physics research topics in all three repositories. In addition, USPTO showed the broadest representation in coverage in biomedical and electronics areas. The analysis of citations by technology field indicates that USPTO had a clear pattern of knowledge diffusion from highly cited fields to less cited fields, while EPO showed knowledge exchange mainly occurred among highly cited fields

  16. What is the Destiny of Patents of Brazilian Universities?

    Directory of Open Access Journals (Sweden)

    André Luiz de Souza Querido

    2011-03-01

    Full Text Available The power of patent is expressed when the innovative product or process goes to market, and the exclusive right that patent ensures generates the market power, and the holder possibility to obtain competitive advantage over competitors. Thus, it becomes compelling the discussions on the universities need for transformation of patent applications efforts into granted patents, which could be negotiated with a higher degree of juridical certainty and, consequently, higher value added. To establish an Index of Patents Granting, and understand the importance of Technological Innovation Nuclei for the increase of this index, it was developed a survey on the number of patents granted to Brazilian universities and evaluated the structure of Technological Innovation Nuclei of these universities. From the survey on the granting cases, it was verified that the universities presenting, among other characteristics, better structured Technological Innovation Nuclei stood out.

  17. Nanotechnology strength indicators: international rankings based on US patents

    Science.gov (United States)

    Marinova, Dora; McAleer, Michael

    2003-01-01

    Technological strength indicators (TSIs) based on patent statistics for 1975-2000 are used to analyse patenting of nanotechnology in the USA, and to compile international rankings for the top 12 foreign patenting countries (namely Australia, Canada, France, Germany, Great Britain, Italy, Japan, Korea, the Netherlands, Sweden, Switzerland and Taiwan). As the indicators are not directly observable, various proxy variables are used, namely the technological specialization index for national priorities, patent shares for international presence, citation rate for the contribution of patents to knowledge development and rate of assigned patents for potential commercial benefits. The best performing country is France, followed by Japan and Canada. It is shown that expertise and strength in nanotechnology are not evenly distributed among the technologically advanced countries, with the TSIs revealing different emphases in the development of nanotechnology.

  18. Patents and nanomedicine.

    Science.gov (United States)

    Bawa, Raj

    2007-06-01

    Big pharma's business model, which relies on a few blockbusters to generate profits, is clearly broken. Patent expiration on numerous blockbusters in recent years is already altering the drug landscape. Drug companies are also facing other challenges that necessitate development and implementation of novel R&D strategies, including those that focus on nanotechnology and miniaturization. Clearly, there is enormous excitement and expectation regarding nanomedicine's potential impact. However, securing valid and defensible patent protection will be critical. Although early forecasts for nanomedicine commercialization are encouraging, there are numerous bottlenecks as well. One of the major hurdles is an emerging thicket of patent claims, resulting primarily from patent proliferation as well as continued issuance of surprisingly broad patents by the US Patent and Trademark Office (PTO). Adding to this confusion is the fact that the US National Nanotechnology Initiative's widely cited definition of nanotechnology is inaccurate and irrelevant from a nanomedicine perspective. It is also the cause of the inadequate patent classification system that was recently unveiled by the PTO. All of this is creating a chaotic, tangled patent landscape in various sectors of nanomedicine where the competing players are unsure of the validity and enforceability of numerous issued patents. If this trend continues, it could stifle competition and limit access to some inventions. Therefore, reforms are urgently needed at the PTO to address problems ranging from poor patent quality and questionable examination practices to inadequate search capabilities, rising attrition, poor employee morale and a skyrocketing patent application backlog. Only a robust patent system will stimulate the development of commercially viable nanomedicine products that can drastically improve a patient's quality of life and reduce healthcare costs.

  19. The impact of effective patents on future innovations in nanomedicine.

    Science.gov (United States)

    Bosetti, Rita; Vereeck, Lode

    2012-03-01

    The success of nanomedicine is dependent upon an effective protection of IP rights. Unfortunately, the US nanomedicine patent system is dysfunctional because long R&D procedures as well as the patent pendency are insufficiently taken into account. This could be solved by changing the patent-protection starting point and increasing the capacity of the US PTO. The nanotechnology industry also suffers from overlapping patents. This could be avoided by improving the expertise of the PTO, using a more accurate definition of nanotechnology and devising a generally accepted nomenclature that enhances prior-art searches. To avoid disputes, inference practices and strategic patenting can be used. In the case of a dispute, parties can fall back on re-examination, cross-licensing and patent litigation. Cross-licensing agreements are recommended since they allows parties to access technology, create synergies and exclude third-party competitors. Solving the patent problems in the nanotechnology industry is a necessary step for future success.

  20. Expedited patent examination for green inventions: Developing countries' policy choices

    International Nuclear Information System (INIS)

    Lu, Bingbin

    2013-01-01

    Innovation in green technology is important. Patent rights can provide incentives for green technology research and development. Expedited patent examination for green inventions has emerged as a policy instrument to provide such incentives. Developing countries were never opposed to patents for green technologies. China and Brazil have led the way by offering expedited examinations for green patent applications. More developing countries are expected to follow. Expedited examination for green technologies is consistent with the intellectual property system objectives and is justified by the clear social benefit from green technologies. Introducing such expedited programs in developing countries has sufficient advantages. Existing models of expedited programs for green technologies are analyzed to generalize key issues and to discern suitable policy choices for developing countries. When introducing such programs, a balanced definition for green technology is preferred; a special classification requirement is premature and is not recommended; a pre-examination search requirement is generally recommended to balance patent office workloads, and a green patent database is recommended. - Highlights: • There is no north–south divide in promoting green technologies. • Earlier issuance of green patents has its great social benefit. • Green patent application should receive expedited examination. • Developing countries should introduce such expedited programs. • A suitable approach for developing countries is searched and recommended

  1. Patent landscape of neglected tropical diseases: an analysis of worldwide patent families.

    Science.gov (United States)

    Akinsolu, Folahanmi Tomiwa; de Paiva, Vitor Nobre; Souza, Samuel Santos; Varga, Orsolya

    2017-11-14

    "Neglected Tropical Diseases" (NTDs) affect millions of people in Africa, Asia and South America. The two primary ways of strategic interventions are "preventive chemotherapy and transmission control" (PCT), and "innovative and intensified disease management" (IDM). In the last 5 years, phenomenal progress has been achieved. However, it is crucial to intensify research effort into NTDs, because of the emerging drug resistance. According to the World Health Organization (WHO), the term NTDs covers 17 diseases, namely buruli ulcer, Chagas disease, dengue, dracunculiasis, echinococcosis, trematodiasis, human African trypanosomiasis, leishmaniasis, leprosy, lymphatic filariasis, onchocerciasis, rabies, schistosomiasis, soil-transmitted helminthes, taeniasis, trachoma, and yaws. The aim of this study is to map out research and development (R&D) landscape through patent analysis of these identified NTDs. To achieve this, analysis and evaluation have been conducted on patenting trends, current legal status of patent families, priority countries by earliest priority years and their assignee types, technological fields of patent families over time, and original and current patent assignees. Patent families were extracted from Patseer, an international database of patents from over 100 patent issuing authorities worldwide. Evaluation of the patents was carried out using the combination of different search terms related to each identified NTD. In this paper, a total number of 12,350 patent families were analyzed. The main countries with sources of inventions were identified to be the United States (US) and China. The main technological fields covered by NTDs patent landscape are pharmaceuticals, biotechnology, organic fine chemistry, analysis of biological materials, basic materials chemistry, and medical technology. Governmental institutions and universities are the primary original assignees. Among the NTDs, leishmaniasis, dengue, and rabies received the highest number of

  2. The Seductive-Plausibility of Patent Hold-Up Myths — A Flawed Historiography of Patents

    DEFF Research Database (Denmark)

    Howells, John; Katznelson, Ron D

    In previous work we have shown that a flawed historiography of patents continues to be the basis for patent policy advocacy. We set out objective standards of evidence that allegations of development block due to assertion of patents must meet. We show the extent of the errors in the historical...... record in the aircraft, automobile, radio and incandescent lamp technologies. We then evaluate how they measure against the objective standards. We find many simple errors and that an absence of indicia of development block characterise scholarship alleging that assertion of patents blocked development...... of multiple case studies subjected to such standards justifies the rebuttable presumption that “pioneer patents have never blocked development”....

  3. Data anonymization patent landscape

    Directory of Open Access Journals (Sweden)

    Mirjana Pejić Bach

    2017-01-01

    Full Text Available The omnipresent, unstoppable increase in digital data has led to a greater understanding of the importance of data privacy. Different approaches are used to implement data privacy. The goal of this paper is to develop a data anonymization patent landscape, by determining the following: (i the trend in data anonymization patenting, (ii the type of technical content protected in data anonymization, (iii the organizations and countries most active in patenting data anonymization know-how; and (iv the topics emerging most often in patent titles. Patents from the PatSeer database relating to data anonymization from 2001 to 2015 were analyzed. We used the longitudinal approach in combination with text mining techniques to develop a data anonymization patent landscape. The results indicated the following. The number of single patent families is growing with a high increase after 2010, thus indicating a positive trend in the area of patenting data anonymization solutions. The majority of patenting activities relate to the G Physics section. Organizations from the USA and Japan assigned the majority of patents related to data anonymization. The results of text mining indicate that the most often used word in titles of data anonymization patents are “anonym*, “method”, “data” and “system”. Several additional words that indicated the most frequent topics related to data anonymization were: “equipment”, “software”, “protection”, “identification”, or “encryption”, and specific topics such as “community”, “medical”, or “service”.

  4. A patent landscape on application of microorganisms in construction industry.

    Science.gov (United States)

    Dapurkar, Dipti; Telang, Manasi

    2017-07-01

    Construction biotechnology includes research and development of construction materials and processes that make use of various microbes. The present technology landscape gives a perspective on how microbes have been used in construction industry as cement and concrete additives by analyzing patents filed in this technology arena. All patents related to the technology of interest published globally to date have been reviewed. The earliest patent filing in this technology domain was recorded in the year 1958 and the patenting activity reached its peak around mid to late 1990s. The early technology was mainly focused on microbial polysaccharides and other metabolic products as additives. Year 2002 onwards, biomineralization has taken precedence over the other technologies with consistent patent filings indicating a shift in innovation focus. Japan has been the global leader with highest number of patents filed on application of microbes in construction industry. Southeast University, China has topped the patent assignee list with maximum number of filings followed by Kajima Corp. and Shin-Etsu Chemical Co., Ltd. Most patent applications have claimed microbe based bio-products. Construction-related microbial technologies are mainly based on activity of different microorganisms such as urease-producing, acidogenic, halophilic, alkaliphilic, nitrate and iron-reducing bacteria. Sporosarcina pasteurii has been the most widely used microbe for biomineralization.

  5. Can patents prohibit research? On the social epistemology of patenting and licensing in science.

    Science.gov (United States)

    Biddle, Justin B

    2014-03-01

    A topic of growing importance within philosophy of science is the epistemic implications of the organization of research. This paper identifies a promising approach to social epistemology--nonideal systems design--and uses it to examine one important aspect of the organization of research, namely the system of patenting and licensing and its role in structuring the production and dissemination of knowledge. The primary justification of patenting in science and technology is consequentialist in nature. Patenting should incentivize research and thereby promote the development of knowledge, which in turn facilitates social progress. Some have disputed this argument, maintaining that patenting actually inhibits knowledge production. In this paper, I make a stronger argument; in some areas of research in the US--in particular, research on GM seeds--patents and patent licenses can be, and are in fact being, used to prohibit some research. I discuss three potential solutions to this problem: voluntary agreements, eliminating patents, and a research exemption. I argue against eliminating patents, and I show that while voluntary agreements and a research exemption could be helpful, they do not sufficiently address the problems of access that are discussed here. More extensive changes in the organization of research are necessary.

  6. Truth and falsity of patent

    International Nuclear Information System (INIS)

    Park, Gum Jin

    2006-10-01

    This book describes the process of the effect to build the business of patent strongly in difficult situation. The titles of this contents are finally, lawsuit if formed, the task of patent application introduction of tasks of patent negotiation, negotiation with Fujitsu, Mitsubishi, Oki and NEC, amalgamation between LG semiconductor and Hyundai Electronic Industry, life in incorporated company, current condition of application for a patent, the method to process strategy patent, how to make strong patent and effective negotiation strategy for a patent and strategy of patent application.

  7. Evaluation of Brazilian biotechnology patent activity from 1975 to 2010.

    Science.gov (United States)

    Dias, F; Delfim, F; Drummond, I; Carmo, A O; Barroca, T M; Horta, C C; Kalapothakis, E

    2012-08-01

    The analysis of patent activity is one methodology used for technological monitoring. In this paper, the activity of biotechnology-related patents in Brazil were analyzed through 30 International Patent Classification (IPC) codes published by the Organization for Economic Cooperation and Development (OECD). We developed a program to analyse the dynamics of the major patent applicants, countries and IPC codes extracted from the Brazilian Patent Office (INPI) database. We also identified Brazilian patent applicants who tried to expand protection abroad via the Patent Cooperation Treaty (PCT). We had access to all patents published online at the INPI from 1975 to July 2010, including 9,791 biotechnology patent applications in Brazil, and 163 PCTs published online at World Intellectual Property Organization (WIPO) from 1997 to December 2010. To our knowledge, there are no other online reports of biotechnology patents previous to the years analyzed here. Most of the biotechnology patents filed in the INPI (10.9%) concerned measuring or testing processes involving nucleic acids. The second and third places belonged to patents involving agro-technologies (recombinant DNA technology for plant cells and new flowering plants, i.e. angiosperms, or processes for obtaining them, and reproduction of flowering plants by tissue culture techniques). The majority of patents (87.2%) were filed by nonresidents, with USA being responsible for 51.7% of all biotechnology patents deposited in Brazil. Analyzing the resident applicants per region, we found a hub in the southeast region of Brazil. Among the resident applicants for biotechnology patents filed in the INPI, 43.5% were from São Paulo, 18.3% were from Rio de Janeiro, and 9.7% were from Minas Gerais. Pfizer, Novartis, and Sanofi were the largest applicants in Brazil, with 339, 288, and 245 biotechnology patents filed, respectively. For residents, the largest applicant was the governmental institution FIOCRUZ (Oswaldo Cruz

  8. Searching bioremediation patents through Cooperative Patent Classification (CPC).

    Science.gov (United States)

    Prasad, Rajendra

    2016-03-01

    Patent classification systems have traditionally evolved independently at each patent jurisdiction to classify patents handled by their examiners to be able to search previous patents while dealing with new patent applications. As patent databases maintained by them went online for free access to public as also for global search of prior art by examiners, the need arose for a common platform and uniform structure of patent databases. The diversity of different classification, however, posed problems of integrating and searching relevant patents across patent jurisdictions. To address this problem of comparability of data from different sources and searching patents, WIPO in the recent past developed what is known as International Patent Classification (IPC) system which most countries readily adopted to code their patents with IPC codes along with their own codes. The Cooperative Patent Classification (CPC) is the latest patent classification system based on IPC/European Classification (ECLA) system, developed by the European Patent Office (EPO) and the United States Patent and Trademark Office (USPTO) which is likely to become a global standard. This paper discusses this new classification system with reference to patents on bioremediation.

  9. BioChroma - A New and Patented Technology for Processing Radioactive Wastewater from Nuclear Medicine Therapy Facilities in Hospitals and Clinics.

    Science.gov (United States)

    Rodríguez, José Canga

    2012-01-01

    After undergoing radionuclide therapy, patients generate wastewater with a considerable amount of radioactivity, which can reach levels of as much as 90% of the administered dose. Due to the risk of accumulation after discharge into the sewer, it is advisable to collect this effluent for its treatment prior to final discharge. Delay and decay (natural decomposition of the isotope) is the most commonly used technical method of abating radioactive iodine, but it is frequently criticized as being complex and very expensive. BioChroma is a technology that has been developed as an alternative to these complicated and expensive systems. This paper describes this new technology and presents, as an example, a system that was installed and successfully commissioned in the middle of 2008 in a nuclear medicine ward with 12 beds in Stuttgart (Germany). Based on existing legislation, the responsible authorities and the company that operated the hospital agreed on a maximum activity level of 5 Bq/l. If a typical delay and decay system would have been installed, the 180 m(3) treatment plant that was already available in the hospital cellar would have to be extended by additional 150 m(3). By implementing the patented BioChroma process, the space requirements were reduced by 75%. For instance, since the new system was integrated into the existing installation, tanks accounting for 120 m³ could be used as buffering volume in the new wastewater treatment plant. The operation of the referred plant is currently producing very good results with values below the specified limit of 5 Bq/l for the isotope (131)I. In addition, (90)Y has been reported to be eliminated at the same time. Over the past 2 years of operation, the wastewater treatment plant has been able to achieve a maximum processing capacity of more than 2,000 l/day, which equates to a nuclear medicine ward with approx. 20 beds. The highest level recorded during the test period (of 180 days after start-up) was a peak of

  10. BioChroma – A New and Patented Technology for Processing Radioactive Wastewater from Nuclear Medicine Therapy Facilities in Hospitals and Clinics

    International Nuclear Information System (INIS)

    Rodríguez, José Canga

    2012-01-01

    After undergoing radionuclide therapy, patients generate wastewater with a considerable amount of radioactivity, which can reach levels of as much as 90% of the administered dose. Due to the risk of accumulation after discharge into the sewer, it is advisable to collect this effluent for its treatment prior to final discharge. Delay and decay (natural decomposition of the isotope) is the most commonly used technical method of abating radioactive iodine, but it is frequently criticized as being complex and very expensive. BioChroma is a technology that has been developed as an alternative to these complicated and expensive systems. This paper describes this new technology and presents, as an example, a system that was installed and successfully commissioned in the middle of 2008 in a nuclear medicine ward with 12 beds in Stuttgart (Germany). Based on existing legislation, the responsible authorities and the company that operated the hospital agreed on a maximum activity level of 5 Bq/l. If a typical delay and decay system would have been installed, the 180 m 3 treatment plant that was already available in the hospital cellar would have to be extended by additional 150 m 3 . By implementing the patented BioChroma process, the space requirements were reduced by 75%. For instance, since the new system was integrated into the existing installation, tanks accounting for 120 m³ could be used as buffering volume in the new wastewater treatment plant. The operation of the referred plant is currently producing very good results with values below the specified limit of 5 Bq/l for the isotope 131 I. In addition, 90 Y has been reported to be eliminated at the same time. Over the past 2 years of operation, the wastewater treatment plant has been able to achieve a maximum processing capacity of more than 2,000 l/day, which equates to a nuclear medicine ward with approx. 20 beds. The highest level recorded during the test period (of 180 days after start-up) was a peak of nearly 2

  11. The patent activity of the Czech R

    Directory of Open Access Journals (Sweden)

    Kučera Zdeněk

    2016-12-01

    Full Text Available An effective knowledge transfer between research institutions and industry is a significant bottleneck in the national innovation system. CR adopted in recent years a series of systemic measures aimed to stimulate the orientation of the R&D organizations towards the generation of knowledge directly applicable in the innovation process and more generally to improve the collaboration of the R&D establishment with the industry. In the majority of programs supporting the applied research patents and industrial designs and utility models are among the anticipated results. The Methodology of the evaluation of R&D organizations implemented in the second half of the last decade brought financial bonuses for the creation of the results in the category of industrial property. Despite of this stimulus CR lags behind the technologically advanced EU countries in the patent activities. The topic of this article is a comparison of the protection of the industrial property rights in the Czech higher education institutions and governmental R&D institutions with selected EU countries. We make use of a couple of quantitative indicators to assess the quality and the technological and the commercial potential of the produced industrial property. Despite a dynamic growth of the patent applications in the CR the number of patent applications relative to the country size is far below the EU-15 average. The Czech research organizations contribute to a higher extent to the number of patent applications then do the analogous institutions in EU-15 countries where the majority of patent applications come from the industrial sphere. The Czech research organizations mainly limit the patent rights to the Czech Republic whereas in the EU-15 countries the opposite is preponderant and only a small fraction of patent applications remains limited to the national environment. Thus the majority of the Czech patents created by research organizations cannot be commercialized on the

  12. Scientific Prediction and Prophetic Patenting in Drug Discovery.

    Science.gov (United States)

    Curry, Stephen H; Schneiderman, Anne M

    2015-01-01

    Pharmaceutical patenting involves writing claims based on both discoveries already made, and on prophesy of future developments in an ongoing project. This is necessitated by the very different timelines involved in the drug discovery and product development process on the one hand, and successful patenting on the other. If patents are sought too early there is a risk that patent examiners will disallow claims because of lack of enablement. If patenting is delayed, claims are at risk of being denied on the basis of existence of prior art, because the body of relevant known science will have developed significantly while the project was being pursued. This review examines the role of prophetic patenting in relation to the essential predictability of many aspects of drug discovery science, promoting the concepts of discipline-related and project-related prediction. This is especially directed towards patenting activities supporting commercialization of academia-based discoveries, where long project timelines occur, and where experience, and resources to pay for patenting, are limited. The need for improved collaborative understanding among project scientists, technology transfer professionals in, for example, universities, patent attorneys, and patent examiners is emphasized.

  13. Nano/micro-electro mechanical systems: a patent view

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Guangyuan, E-mail: hu.guangyuan@mail.shufe.edu.cn, E-mail: hu.guangyuan@shufe.edu.cn [Shanghai University of Finance and Economics, School of Public Economics and Administration (China); Liu, Weishu [Shanghai Jiao Tong University, Antai College of Economics and Management (China)

    2015-12-15

    Combining both bibliometrics and citation network analysis, this research evaluates the global development of micro-electro mechanical systems (MEMS) research based on the Derwent Innovations Index database. We found that worldwide, the growth trajectory of MEMS patents demonstrates an approximate S shape, with United States, Japan, China, and Korea leading the global MEMS race. Evidenced by Derwent class codes, the technology structure of global MEMS patents remains steady over time. Yet there does exist a national competitiveness component among the top country players. The latecomer China has become the second most prolific country filing MEMS patents, but its patent quality still lags behind the global average.

  14. R&D, patents and innovation: a differential game approach

    OpenAIRE

    Wang, H.-M.

    2016-01-01

    A patent race is a technological competition among firms and the firm making a first-hand innovation takes advantages of patenting. Firms strategically invest in R&D and produce knowledge in order to innovate. Instead of growing model of R&D, I use a differential game approach to investigate firms interaction of R&D behavior in a patent race. In general, knowledge is an intangible good that gives a special feature of a patent race. Whether knowledge is substitutable to the existing knowledge ...

  15. Patents and Downstream Innovation Suppresion - Facts or Fiction?

    DEFF Research Database (Denmark)

    Howells, John

    of development as aircraft, the car, radio and electric lighting. Merges and Nelson quite logically use their work to question the value of Kitch's prospect theory of patents,[2] a theory that emphasises that the social value of patents is that they enable the coordination of technological development...... and R. Nelson, "On the Complex Economics of Patent Scope," Columbia Law Review 90, no. 4 (1990), R. Merges and R. Nelson, "On Limiting or Encouraging Rivalry in Technical Progress: The Effect of Patent Scope Decisions," Journal of Economic Behavior and Organisation 25 (1994). [2] Merges and Nelson, "On...

  16. Nano/micro-electro mechanical systems: a patent view

    International Nuclear Information System (INIS)

    Hu, Guangyuan; Liu, Weishu

    2015-01-01

    Combining both bibliometrics and citation network analysis, this research evaluates the global development of micro-electro mechanical systems (MEMS) research based on the Derwent Innovations Index database. We found that worldwide, the growth trajectory of MEMS patents demonstrates an approximate S shape, with United States, Japan, China, and Korea leading the global MEMS race. Evidenced by Derwent class codes, the technology structure of global MEMS patents remains steady over time. Yet there does exist a national competitiveness component among the top country players. The latecomer China has become the second most prolific country filing MEMS patents, but its patent quality still lags behind the global average

  17. Exploiting abstract possibilities: a critique of the concept and practice of product patenting.

    Science.gov (United States)

    Radder, Hans

    2004-01-01

    Developments in biotechnology and genomics have moved the issue of patenting scientific and technological inventions toward the center of interest. In particular, the patentability of genes of plants, animals, or humans and of genetically modified (parts of) living organisms has been discussed, and questioned, from various normative perspectives. This paper aims to contribute to this debate. For this purpose, it first explains a number of relevant aspects of the theory and practice of patenting. The focus is on a special and increasingly significant type of patents, namely product patents. The paper provides three general arguments against the concept and practice of product patenting. The first argument briefly considers the claim that patents are legitimate because they promote socially useful innovation. Against this claim, it is argued that product patents may hamper rather than promote such innovation. The second and main argument concludes that product patents are not adequately based on actual technological inventions, as they should be according to the usual criteria of patentability. The principal moral issue is that product patents tend to reward patentees for inventions they have not really made available. The final argument proposes a method for patenting the heat of the sun. Assuming that granting this patent will be generally considered absurd, the argument exposes a further, fundamental problem of the concept and practice of product patenting.

  18. Japan's patent issues relating to life science therapeutic inventions.

    Science.gov (United States)

    Tessensohn, John A

    2014-09-01

    Japan has made 'innovation in science and technology' as one of its central pillars to ensure high growth in its next stage of economic development and its life sciences market which hosts regenerative medicine was proclaimed to be 'the best market in the world right now.' Although life science therapeutic inventions are patentable subject matter under Japanese patent law, there are nuanced obviousness and enablement challenges under Japanese patent law that can be surmounted in view of some encouraging Japanese court developments in fostering a pro-patent applicant environment in the life sciences therapeutic patent field. Nevertheless, great care must be taken when drafting and prosecuting such patent applications in the world's second most important life sciences therapeutic market.

  19. 77 FR 32642 - Patents and Inventions; Delegation of Authority

    Science.gov (United States)

    2012-06-01

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Disease Control and Prevention Patents and... Prevention (CDC), the Deputy Director, DLPP, LSPPPO, OSELS, CDC, and the Chief, Technology Management Branch... regarding the invention and patent program of CDC and the authority to make determinations of rights in...

  20. Globalization and Growth of US University Patenting (2009-2014)

    Science.gov (United States)

    Leydesdorff, Loet; Etzkowitz, Henry; Kushnir, Duncan

    2016-01-01

    Following a pause, with a relatively flat rate, from 1998 to 2008, the long-term trend of university patenting rising as a share of all patenting has resumed, driven by the internationalization of academic entrepreneurship and the persistence of US university technology transfer. The authors disaggregate this recent growth in university patenting…

  1. Survey of the patents intensity in advanced ceramics

    International Nuclear Information System (INIS)

    Rodrigues, C.S.; Oliveira, E.C. de; Pencinato, M.V.; Bandeira, R.J.; Ribeiro, E.

    1989-01-01

    A survey about a sectorial diagnostic of advanced ceramics, using patents of the Industrial Properties National Institute, as a reference documentation is presented. The mains points for generating technology in 80 decade are identified, by the institutions/company titularies of patents. (C.G.C.) [pt

  2. R&D, patents and innovation: a differential game approach

    NARCIS (Netherlands)

    Wang, H.-M.

    2016-01-01

    A patent race is a technological competition among firms and the firm making a first-hand innovation takes advantages of patenting. Firms strategically invest in R&D and produce knowledge in order to innovate. Instead of growing model of R&D, I use a differential game approach to investigate firms

  3. Just-in-time patents and the development of standards

    NARCIS (Netherlands)

    Kang, B.; Bekkers, R.

    2015-01-01

    Modern technical standards often include large numbers of patented technologies that are required to implement those standards. These “standard-essential patents” are very valuable assets, and firms that do not own such patents are prepared to spend billions of dollars purchasing them. Whereas large

  4. 75 FR 38543 - Patent, Trademark and Copyright Acts

    Science.gov (United States)

    2010-07-02

    ... DEPARTMENT OF THE INTERIOR Geological Survey Patent, Trademark and Copyright Acts AGENCY: Geological Survey, Interior. ACTION: Notice of prospective intent to award exclusive license. SUMMARY: The... Technologies Group, Inc., 253 Portman Lane, Suite 107, Bridgeville, PA 15017 on U.S. Patent No. 6,485,696 B1...

  5. Patents and Downstream Innovation Suppression - Facts or Fiction?

    DEFF Research Database (Denmark)

    Howells, John

    the value of Kitch's prospect theory of patents, a theory that the social value of patents is that they enable the efficient coordination of technological development.    I re-examine history and legal sources bearing on Merges and Nelson's illustrative cases and find no case to illustrate downstream...

  6. Patent Ductus Arteriosus

    Science.gov (United States)

    ... With Patent Ductus Arteriosus Figure A shows the interior of a normal heart and normal blood flow. ... PDA may shrink and go away. However, some children need treatment to close their PDAs. Some children ...

  7. Patent Keyword Extraction Algorithm Based on Distributed Representation for Patent Classification

    Directory of Open Access Journals (Sweden)

    Jie Hu

    2018-02-01

    Full Text Available Many text mining tasks such as text retrieval, text summarization, and text comparisons depend on the extraction of representative keywords from the main text. Most existing keyword extraction algorithms are based on discrete bag-of-words type of word representation of the text. In this paper, we propose a patent keyword extraction algorithm (PKEA based on the distributed Skip-gram model for patent classification. We also develop a set of quantitative performance measures for keyword extraction evaluation based on information gain and cross-validation, based on Support Vector Machine (SVM classification, which are valuable when human-annotated keywords are not available. We used a standard benchmark dataset and a homemade patent dataset to evaluate the performance of PKEA. Our patent dataset includes 2500 patents from five distinct technological fields related to autonomous cars (GPS systems, lidar systems, object recognition systems, radar systems, and vehicle control systems. We compared our method with Frequency, Term Frequency-Inverse Document Frequency (TF-IDF, TextRank and Rapid Automatic Keyword Extraction (RAKE. The experimental results show that our proposed algorithm provides a promising way to extract keywords from patent texts for patent classification.

  8. DOE Patents Available for Licensing

    International Nuclear Information System (INIS)

    Stuber, C.

    1981-01-01

    DOE Patents Available for Licensing (DOE PAL) provides abstracting and indexing coverage of the DOE patent literature, including patent applications, that concerns any apsect of energy production, conservation, and utilization. The citations are arranged by subject category. DOE is prepared to grant exclusive or nonexclusive, revocable licenses under DOE-owned US patents and patent applications in accordance with the provisions of 10CFR781

  9. Patent protection strategies

    Directory of Open Access Journals (Sweden)

    Himanshu Gupta

    2010-01-01

    Full Text Available It is widely recognized that the pharmaceutical industry faces serious financial challenges. Large numbers of blockbuster drugs are losing patent protection and going generic. The pipeline of new drugs is too sparse to fill the gap and generate a platform for future growth. Moreover, many of the new products are biologics with much narrower target patient populations and comparatively higher prices relative to traditional pharmaceuticals. So now the time has come for pharmaceutical scientists to have a better understanding of patent fundamentals. This need is illustrated by analyses of key scientific and legal issues that arose during recent patent infringement cases involving Prozac, Prilosec, and Buspar. Facing this scenario, the pharmaceutical industry has moved to accelerate drug development process and to adopt at the same time different strategies to extend the life time of the patent monopoly to provide the economic incentives and utilizing it for drug discovery and development. This review covers the need of patent protection and various strategies to extend the patent.

  10. 37 CFR 1.5 - Identification of patent, patent application, or patent-related proceeding.

    Science.gov (United States)

    2010-07-01

    ... UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES General Provisions General Information and Correspondence § 1.5 Identification of patent, patent... benefit of the date of deposit with the United States Postal Service. If the returned correspondence is...

  11. Prostitution in Deutschland zwischen Missachtung und Anerkennung: Eine normative Betrachtung der Sexarbeit im Kontext der anerkennungstheoretischen Aspekte aus der kritischen Theorie Axel Honneths.

    OpenAIRE

    Jensen, Signe Marie; Janella, Renik

    2014-01-01

    This project report is investigating the societal consequences of prostitution in Germany. In this, we focus on the most recent developments since its’ legalization in 2002. We are investigating who is benefitting the most from this business and furthermore in which ways the involved women are being marginalised and violated. The social consequences of these phenomena are being critically analyzed through the theory of recognition as articulated by Axel Honneth. The main issue are psychologic...

  12. Confidential patent application with an example of preparation

    Directory of Open Access Journals (Sweden)

    Obrad T. Čabarkapa

    2013-12-01

    ; the rest of the patent application, etc.. Description of the invention The description of the invention aims to provide sufficient technical data and to further clarify and describe all the details of the invention for which protection is sought in the claims. The description should enable the average expert in the specific field of technology to perform  or to conduct a  procedure on the application and determine whether it meets the requirements for patentability. The description contains the following units: title of the invention; technology field; technical problem; state of technology; brief summary of the invention; a brief description of the figures of the draft; detailed invention description and the methods of industrial and other applications of the invention. The claims The claims are the most important part of the patent application and all other elements of the patent application are in a function of patent claims. The claims must define the invention solely by its technical characteristics. They are submitted on a separate sheet after the description of the invention under the title "The claims". Depending  on the protection sought, one or more claims can be placed. Abstract The abstract contains the title of the invention and a brief summary of the invention as shown in the description, the requirements and the draft. A brief review must indicate the technical field to which the invention relates and must allow a clear understanding of the technical problem, the essence of the problem and the basic way (ways of using the invention. The abstract contains a maximum of 150 words. Draft of the invention A draft of the invention is submitted on separate sheets, along with the title of the invention on each side. The reference signs given in the description, requirements and the draft must be the same throughout the application. Other documents with the patent application In addition to the above mentioned sections of the patent application, the following

  13. The lifespan of semiconductor patents by assignee and patent characteristics

    Directory of Open Access Journals (Sweden)

    Chang Shu-Hao

    2017-01-01

    Full Text Available Evaluating the values of patents is critical for both managers and investors. Patent maintenance time is an ideal proxy indicator for evaluating commercial patent value. This study investigated the survival rates of patents in the semiconductor industry by using a survival analysis and incorporated a predictive model for patent maintenance times. The technical characteristics of the patents, the assignee factors, and the statuses of the patents were used as the predictive factors for patent maintenance time. The results revealed a small entity size and the number of assignees are the risk factors that increase the likelihood of the maintenance time of a patent decreasing. The litigation status of a patent and the number of its international patent classifications, claims, forward citations, and assignments were determined to be the protection factors that raise the likelihood of its maintenance time extending. Additionally, substantial differences were noted between small entities and nonsmall entities and between being litigated and not in their effects on the survival rates of patents. This study examined the factors that affect the survival rates of patents and provides a reference for the managers and investors of intellectual property rights to use when assessing technical and commercial patent values.

  14. Test Collections for Patent-to-Patent Retrieval and Patent Map Generation in NTCIR-4 Workshop

    OpenAIRE

    Fujii, Atsushi; Iwayama, Makoto; Kando, Noriko

    2004-01-01

    This paper describes the Patent Retrieval Task in the Fourth NTCIR Workshop, and the test collections produced in this task. We perform the invalidity search task, in which each participant group searches a patent collection for the patents that can invalidate the demand in an existing claim. We also perform the automatic patent map generation task, in which the patents associated with a specific topic are organized in a multi-dimensional matrix.

  15. Strategic management and utilization of patents

    International Nuclear Information System (INIS)

    Kim, Gyeong Go; Yun, Gwon Jun

    1993-11-01

    This book deals with why does management of patents need?, system of management of patents with function and site of management of patents and system and composition, what does management of patents department do?, task like technical development, management regulation, patent information, management of patents in small business with technical development of small business, how does business manage the patents in real, introduction of management of patents in the U.S, Europe, Japan, and Korea, and management of patents as strategic management.

  16. Comprehension and application of patent information

    International Nuclear Information System (INIS)

    Lee, Sang Nam

    2004-05-01

    This book gives descriptions of conception of patent information such as the meaning, characteristic, function, investigation and map of patent information, pro-patent period and patent strategy of the business. It also deals with comprehension of patent information like publication of nations, patent document, patent procedure in Korea, patent procedure in Japan, the U.S, and Europe, article and function of patent document, patent information survey such as writing of search keyword, procedure of the survey and search site of other countries, patent analysis and patent map.

  17. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  18. 從專利與論文產量之觀點探討科學與技術之關係 Relation between Technology and Science: A Perspective of Patent and Paper Production

    Directory of Open Access Journals (Sweden)

    Wen-Yau Cathy Lin

    2011-03-01

    Full Text Available 本研究以電子與電機產業為例,從其發明專利產量與科學論文產量的觀點探討科學與技術之關係。先前的研究多數透過對技術專利與科學文獻之間的引用來探討關於科學與技術的連結,但這樣的角度僅能呈現其相互影響的部分面向。因此本研究選擇以電子與電機產業專利表現極佳的20家世界知名公司為例,從同一個公司之專利產量與科學文獻產量的角度切入,探討科學與技術兩者之間的關連,並分別從其被引用狀況,分析企業產出專利與發表科學論文後所造成的影響程度。此外本研究也分析各公司的技術週期時間(TechnologyCycleTime,TCT,探討TCT與Patent-PaperRatio之間的關連,並改良即時影響指數(ModifiedCurrentImpactIndex,ModifiedCII的計算方法使其同時適用於專利與論文,進而比較各公司的專利與論文之即時影響指數。其中發明專利與科學論文分別檢索自USPTO與WoS資料庫,於1989年至2008年間之資料。研究結果顯示,雖然近20年來電子與電機領域的科學論文成長幅度比技術專利大,但該領域中技術專利表現最優秀的20個公司的科學論文發表狀況與產生的影響力卻與其專利數量與影響力之間關連不顯著。本結果對於電子與電機領域之公司在技術與科學之間的連結關係提供一項新的實務證據。This study investigates the relation between production of utility patents and scientific papers in the electrical and electronic (E&E industry. Unlike most prior researches delving into the link between science and technology through patent citations and paper citations, this article takes top 20 companies in the E&E industry as an example to examine the link between science and technology in terms of the productivity of patents and papers in one company. It also probes into patent citations and paper citations respectively and its consequences. Furthermore, this

  19. Are biosimilars patentable?

    Science.gov (United States)

    Rolfe, Damian; Parker, Jayson; Morgan, Max

    2016-08-01

    This paper explores whether, and under what circumstances, a biosimilar approved in the United States under the Biologics Price Competition and Innovation Act (hereafter 'BPCIA') can be patented. The possibility that a biosimilar product could have meaningful patent protection arises from specific requirements for biosimilarity under the BPCIA, which account for the fact that manufacturing processes of biologics are inherently imprecise. The requirements for biosimilar approval may provide sufficient leeway to a biosimilar applicant to patent structural or formulation differences that provide non-clinical but business-relevant advantages over the reference molecule, such as improved shelf-life or ease of manufacture, without compromising clinical biosimilarity. Examination of the BPCIA and related Acts, Food and Drug Administration (FDA) guidance papers, case law, patent database searching, and relevant scholarly articles. Legislative and regulatory requirements for the approval of a biosimilar under the BPCIA are focused on clinical results and allow a degree of leeway for differences to exist between a biosimilar's structure and non-clinical components and those of the biosimilar's reference molecule. This leeway can be exploited to provide the biosimilar with potentially patentable business-relevant advantages over its reference product while maintaining clinical biosimilarity to the reference product.

  20. Identity, recognition and redistribution: a critical analysis of Charles Taylor, Axel Honneth and Nancy Fraser’s theories

    Directory of Open Access Journals (Sweden)

    Javier Amadeo

    2017-06-01

    Full Text Available http://dx.doi.org/10.5007/2175-7984.2017v16n35p242 The politics of identity and the idea of recognition have become dominant issues in contemporary political theory. Recognition, as a concept, means that an individual or a social group claims the right to have their identity recognized, directly or throw the mediation of set of institutions. The theories that have evaluated these questions address both important theoretical issues and central political subjects, as the definition of minority rights, national self-determination claims or the challenges posed of our increasingly multicultural societies. The main objective of this paper is to discuss the central arguments presents by Charles Taylor, Axel Honneth and Nancy Fraser emphasizing the discussion around the relationship between recognition and redistribution. A more specific purpose is to analyze the relation between the question of injustice based on the demand of identity and the problem of economic inequality. Finally, we try to understand some of the theoretical and political implications of the idea of difference and the recognition theory in a broader conceptual perspective.

  1. the possible overlap between plant variety protection and patent

    African Journals Online (AJOL)

    the patentability of inventions in all fields of technology, and specifically .... of different plants; the traits or characteristics associated with the genes will be expressed ... David Kaplan, Intellectual Property Rights and Innovation in South Africa: A.

  2. The clinical impact of vehicle technology using a patented formulation of benzoyl peroxide 5%/clindamycin 1% gel: comparative assessments of skin tolerability and evaluation of combination use with a topical retinoid.

    Science.gov (United States)

    Del Rosso, James Q; Tanghetti, Emil

    2006-02-01

    A major challenge encountered in clinical practice in patients with acne vulgaris is irritation related to topical medications used for treatment. Advances in vehicle technology have improved formulations containing active ingredients known to produce irritation in some patients, such as benzoyl peroxide (BP) and topical retinoids. Clinical studies, including combination therapy studies have demonstrated that certain additives, such as silicates and specific humectants, reduce irritation by maintaining barrier integrity. A patented gel formulation of BP 5%/clindamycin phosphate 1% (clindamycin) containing dimethicone and glycerin has been studied both as a monotherapy and in combination with topical retinoid use. This article evaluates specific vehicle additives included in this gel formulation and explains their role in reducing irritation. Data from clinical trials utilizing this technology in acne management are also reviewed.

  3. Patent Races and Market Value

    DEFF Research Database (Denmark)

    Czarnitzki, Dirk; Hussinger, Katrin; Leten, Bart

    Patent races are models of strategic interactions between firms competing to develop an invention. The winning firm secures a patent, protecting the invention from imitation. This paper tests the assumption made about the reward structure in patent races, both in discrete and complex industries. We...... identify patent race winners using detailed information from the patent examination reports at the European Patent Office (EPO). Estimates of a market value equation featuring large, R&D-intensive U.S., European and Japanese firms, show that if firms win patent races, their market value increases...... significantly. We further show that the gain in market value is significantly larger for patent race winners in discrete industries than for firms in complex industries....

  4. El Sistema de patentes en Colombia

    Directory of Open Access Journals (Sweden)

    Rafael Viana Barceló

    2014-01-01

    Full Text Available En este documento se realiza un análisis económico del Sistema de Patentes de Colombia. Para ello, se establece el efecto que tienen las patentes concedidas a los inventores foráneos sobre la Inversión Extranjera Directa y el Producto Interno Bruto Nacional, a través de la técnica de regresión de data panel. De igual manera, se identifican los sectores económicos que registran mayores tasas de innovación por parte de los inventores nacionales y extranjeros. Se muestra que el sistema nacional de propiedad intelectual tiene un grado de fortaleza acorde con el resto de países latinoamericanos; para ello, se construye un índice de grado de fortalecimiento de sistema de patente nacional que luego será comparado con el de otros países latinos.Palabras Clave: Sistema de Patentes; Derechos de Propiedad Intelectual; Inversión Directa extranjera; Producto Interno Bruto e innovación tecnológica. The system of patents in ColombiaAbstractIn this document an economic analysis of the System of Patents of Colombia is made. For it, the effect that has the patents granted to the foreign inventors on the Direct Foreign Investment and the Internal Product Gross National, through the technique of regression of data settles down panel. Of equal way, the economic sectors are identified that register greater rates of innovation on the part of the national and foreign inventors.Sample that the national system of intellectual property has a degree of agreed strength with the rest of Latin American countries; for it, an index of degree of fortification of system of national patent is constructed that soon will be compared with the one of other Latin countries.Keywords: System Patent; Rights of Intellectual Property; Foreign Direct Investment; Gross Domestic Product and Technology Innovation.

  5. The fallacy of Software Patents

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Software patents are usually used as argument for innovation but do they really promote innovation? Who really benefits from software patents? This talk attempts to show the problems with software patents and how they can actually harm innovation having little value for software users and our society in general.

  6. Analysing patent landscapes in plant biotechnology and new plant breeding techniques.

    Science.gov (United States)

    Parisi, Claudia; Rodríguez-Cerezo, Emilio; Thangaraj, Harry

    2013-02-01

    This article aims to inform the reader of the importance of searching patent landscapes in plant biotechnology and the use of basic tools to perform a patent search. The recommendations for a patent search strategy are illustrated with the specific example of zinc finger nuclease technology for genetic engineering in plants. Within this scope, we provide a general introduction to searching using two online and free-access patent databases esp@cenet and PatentScope. The essential features of the two databases, and their functionality is described, together with short descriptions to enable the reader to understand patents, searching, their content, patent families, and their territorial scope. We mostly stress the value of patent searching for mining scientific, rather than legal information. Search methods through the use of keywords and patent codes are elucidated together with suggestions about how to search with or combine codes with keywords and we also comment on limitations of each method. We stress the importance of patent literature to complement more mainstream scientific literature, and the relative complexities and difficulties in searching patents compared to the latter. A parallel online resource where we describe detailed search exercises is available through reference for those intending further exploration. In essence this is aimed at a novice patent searcher who may want to examine accessory patent literature to complement knowledge gained from mainstream journal resources.

  7. Obstacles to prior art searching by the trilateral patent offices: empirical evidence from International Search Reports.

    Science.gov (United States)

    Wada, Tetsuo

    Despite many empirical studies having been carried out on examiner patent citations, few have scrutinized the obstacles to prior art searching when adding patent citations during patent prosecution at patent offices. This analysis takes advantage of the longitudinal gap between an International Search Report (ISR) as required by the Patent Cooperation Treaty (PCT) and subsequent national examination procedures. We investigate whether several kinds of distance actually affect the probability that prior art is detected at the time of an ISR; this occurs much earlier than in national phase examinations. Based on triadic PCT applications between 2002 and 2005 for the trilateral patent offices (the European Patent Office, the US Patent and Trademark Office, and the Japan Patent Office) and their family-level citations made by the trilateral offices, we find evidence that geographical distance negatively affects the probability of capture of prior patents in an ISR. In addition, the technological complexity of an application negatively affects the probability of capture, whereas the volume of forward citations of prior art affects it positively. These results demonstrate the presence of obstacles to searching at patent offices, and suggest ways to design work sharing by patent offices, such that the duplication of search costs arises only when patent office search horizons overlap.

  8. Patent Searching for Librarians and Inventors.

    Science.gov (United States)

    Wherry, Timothy Lee

    Information on patents is provided for librarians and laypersons requiring an understanding of the system and the processes involved. Chapter 1 discusses successful patents; terms and concepts; patent types; copyright; trademark; requirements; patent examiners; patent pending; expiration; patentee and assignee; and reissued patents. Chapter 2…

  9. Patent pools: Intellectual property rights and competition.

    NARCIS (Netherlands)

    Rodriguez, V.F.

    2010-01-01

    Patent pools do not correct all problems associated with patent thickets. In this respect, patent pools might not stop the outsider problem from striking pools. Moreover, patent pools can be expensive to negotiate, can exclude patent holders with smaller numbers of patents or enable a group of major

  10. Patent urachus repair - slideshow

    Science.gov (United States)

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent urachus repair - series—Normal anatomy URL of this ...

  11. Patent ductus arteriosus

    Science.gov (United States)

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent ductus arteriosus URL of this page: //medlineplus.gov/ ...

  12. Patent urachus repair

    Science.gov (United States)

    ... Drugs & Supplements Videos & Tools About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Patent urachus repair URL of this page: //medlineplus.gov/ ...

  13. Patent Blocking and Infringement and their Effects on Firms?

    DEFF Research Database (Denmark)

    Grimpe, Christoph; Hussinger, Katrin

    In recent years, firms have increasingly contributed to and been confronted with a patent landscape characterized by numerous but marginal inventions, overlapping claims and patent fences. As a result, firms risk to be blocked in their patent applications or to be infringed upon by rivals. While...... both aspects constitute major challenges for the appropriation of returns to inventive activity, extant literature suggests that participation in the market for technology might actually resolve or at least alleviate these problems. In this paper, we investigate the effect of patent blocking...... and infringement on firms’ engagement in in- and cross-licensing. Based on a sample of more than 1000 German manufacturing firms our results show that firms engage in in-licensing as a reaction to patent blocking and in both in- and cross-licensing if their protected IP was infringed upon. However, these effects...

  14. Patenting and Innovation in China: Incentives, Policy, and Outcomes

    Science.gov (United States)

    2015-01-01

    limited at 30,000 yuan. See: Kriegel,  J. (2012). Strategies to leverage Chinese patent subsidies Intellectual Property  Magazine .   26 A patent claim...2012). Strategies to leverage Chinese patent subsidies Intellectual Property  Magazine .  Kumar, N. (2003). "Intellectual property rights, technology and...innovation in China: the role of patents in  biotechnology  and  pharmaceutical industries, Edward Elgar.  Liang, M. (2011). "Chinese Patent Quality: Running

  15. Patent prosecution strategies for stem cell related applications.

    Science.gov (United States)

    Kumar, Rajeev; Yeh, Jenny J; Fernandez, Dennis; Hansen, Nels

    2007-09-01

    Stem cell research and the intellectual property derived from it, because of its potential to completely transform health care, demand an especially high level of consideration from business and patent prosecution perspectives. As with other revolutionary technologies, ordinary risks are amplified (e.g., litigation), and ordinarily irrelevant considerations may become important (e.g., heightened level of both domestic and foreign legislative risk). In the first part of this article, general strategies for patent prosecutors such as several prosecution considerations and methods for accelerating patent prosecution process are presented. In the second part, patent prosecution challenges of stem cell-related patents and possible solutions are discussed. In the final part, ethical and public policy issues particular to stem cell-related and other biotechnological inventions are summarized.

  16. METRICS DEVELOPMENT FOR PATENTS.

    Science.gov (United States)

    Veiga, Daniela Francescato; Ferreira, Lydia Masako

    2015-01-01

    To develop a proposal for metrics for patents to be applied in assessing the postgraduate programs of Medicine III - Capes. From the reading and analysis of the 2013 area documents of all the 48 areas of Capes, a proposal for metrics for patents was developed to be applied in Medicine III programs. Except for the areas Biotechnology, Food Science, Biological Sciences III, Physical Education, Engineering I, III and IV and Interdisciplinary, most areas do not adopt a scoring system for patents. The proposal developed was based on the criteria of Biotechnology, with adaptations. In general, it will be valued, in ascending order, the deposit, the granting and licensing/production. It will also be assigned higher scores to patents registered abroad and whenever there is a participation of students. This proposal can be applied to the item Intellectual Production of the evaluation form, in subsection Technical Production/Patents. The percentage of 10% for academic programs and 40% for Masters Professionals should be maintained. The program will be scored as Very Good when it reaches 400 points or over; Good, between 200 and 399 points; Regular, between 71 and 199 points; Weak up to 70 points; Insufficient, no punctuation. Desenvolver uma proposta de métricas para patentes a serem aplicadas na avaliação dos Programas de Pós-Graduação da Área Medicina III - Capes. A partir da leitura e análise dos documentos de área de 2013 de todas as 48 Áreas da Capes, desenvolveu-se uma proposta de métricas para patentes, a ser aplicada na avaliação dos programas da área. Constatou-se que, com exceção das áreas Biotecnologia, Ciência de Alimentos, Ciências Biológicas III, Educação Física, Engenharias I, III e IV e Interdisciplinar, a maioria não adota sistema de pontuação para patentes. A proposta desenvolvida baseou-se nos critérios da Biotecnologia, com adaptações. De uma forma geral, foi valorizado, em ordem crescente, o depósito, a concessão e o

  17. Patenting and the gender gap: should women be encouraged to patent more?

    Science.gov (United States)

    de Melo-Martín, Inmaculada

    2013-06-01

    The commercialization of academic science has come to be understood as economically desirable for institutions, individual researchers, and the public. Not surprisingly, commercial activity, particularly that which results from patenting, appears to be producing changes in the standards used to evaluate scientists' performance and contributions. In this context, concerns about a gender gap in patenting activity have arisen and some have argued for the need to encourage women to seek more patents. They believe that because academic advancement is mainly dependent on productivity (Stuart and Ding in American Journal of Sociology 112:97-144, 2006; Azoulay et al. in Journal of Economic Behavior & Organization 63:599-623, 2007), differences in research output have the power to negatively impact women's careers. Moreover, in the case of patenting activity, they claim that the gender gap also has the potential to negatively affect society. This is so because scientific and technological advancement and innovation play a crucial role in contemporary societies. Thus, women's more limited involvement in the commercialization of science and technology can also be detrimental to innovation itself. Nevertheless, calls to encourage women to patent on grounds that such activity is likely to play a significant role in the betterment of both women's careers and society seem to be based on two problematic assumptions: (1) that the methods to determine women's productivity in patenting activities are an appropriate way to measure their research efforts and the impact of their work, and (2) that patenting, particularly in academia, benefits society. The purpose of this paper is to call into question these two assumptions.

  18. Handbook of technology law. General funamentals, environment law, genetic engineering act, energy act, telecommunication act and media act, patent act, computer act. 2. ed.; Handbuch des Technikrechts. Allgemeine Grundlagen Umweltrecht, Gentechnikrecht, Energierecht, Telekommunikations- und Medienrecht, Patentrecht, Computerrecht

    Energy Technology Data Exchange (ETDEWEB)

    Schulte, Martin; Schroeder, Rainer (eds.) [Technische Univ. Dresden (Germany). Juristische Fakultaet

    2011-07-01

    On the boundaries between technology sciences, jurisprudence, social sciences and economic science the technology law proves as a cross-sectional area par excellence. The bases of the technology law are presented: individual, particularly important scopes of the technology law (appliance safety regulations, technology law and environment law, genetic engineering act, energy right, telecommunications law and media law, patent law, computer law, data security, legally binding telecooperation) are analyzed in detail. The manual contacts all lawyers who want to provide a first in-depth insight of this new field of law. [German] Im Grenzbereich von Technik-, Rechts-, Sozial- und Wirtschaftswissenschaften erweist sich das Technikrecht als Querschnittsmaterie par excellence. Die Grundlagen des Technikrechts werden dargestellt; einzelne, besonders wichtige Bereiche des Technikrechts (Geraetesicherheitsrecht, Technik und Umweltrecht, Gentechnikrecht, Energierecht, Telekommunikations- und Medienrecht, Patentrecht, Computerrecht, Datensicherheit, Rechtsverbindliche Telekooperation) werden eingehend analysiert. Das Handbuch wendet sich an alle in Wissenschaft und Praxis mit dem Technikrecht befassten Juristen, die sich einen ersten vertieften Einblick in dieses neue Rechtsgebiet verschaffen wollen. (orig.)

  19. Decoding gene patents in Australia.

    Science.gov (United States)

    Denley, Adam; Cherry, James

    2014-10-03

    Patents directed to naturally occurring genetic material, such as DNA, RNA, chromosomes, and genes, in an isolated or purified form have been granted in Australia for many years. This review provides scientists with a summary of the gene patent debate from an Australian perspective and specifically reviews how the various levels of the legal system as they apply to patents-the Australian Patent Office, Australian courts, and Australian government-have dealt with the issue of whether genetic material is proper subject matter for a patent. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  20. Electric current activated/assisted sintering (ECAS): a review of patents 1906-2008

    International Nuclear Information System (INIS)

    Grasso, Salvatore; Sakka, Yoshio; Maizza, Giovanni

    2009-01-01

    The electric current activated/assisted sintering (ECAS) is an ever growing class of versatile techniques for sintering particulate materials. Despite the tremendous advances over the last two decades in ECASed materials and products there is a lack of comprehensive reviews on ECAS apparatuses and methods. This paper fills the gap by tracing the progress of ECAS technology from 1906 to 2008 and surveys 642 ECAS patents published over more than a century. It is found that the ECAS technology was pioneered by Bloxam (1906 GB Patent No. 9020) who developed the first resistive sintering apparatus. The patents were searched by keywords or by cross-links and were withdrawn from the Japanese Patent Office (342 patents), the United States Patent and Trademark Office (175 patents), the Chinese State Intellectual Property Office of P.R.C. (69 patents) and the World Intellectual Property Organization (12 patents). A subset of 119 (out of 642) ECAS patents on methods and apparatuses was selected and described in detail with respect to their fundamental concepts, physical principles and importance in either present ECAS apparatuses or future ECAS technologies for enhancing efficiency, reliability, repeatability, controllability and productivity. The paper is divided into two parts, the first deals with the basic concepts, features and definitions of basic ECAS and the second analyzes the auxiliary devices/peripherals. The basic ECAS is classified with reference to discharge time (fast and ultrafast ECAS). The fundamental principles and definitions of ECAS are outlined in accordance with the scientific and patent literature. (topical review)

  1. Survey and research for the enhancement of large-scale technology development 3. Patent researches on new tasks for development under large-scale project; Ogata gijutsu kaihatsu suishin no tame no chosa kenkyu. 3. Ogata project shinki kaihatsu tema ni kansuru tokkyo chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1981-03-01

    Regarding 'high-speed computation systems for technological use' and 'manganese nodule mining systems,' researches are conducted into technological trends from the viewpoint of patent. As for applications for patents involving the Josephson effect device, there are 79 patents disclosed in Japan, with applications from Japan recording a peak in 1977-1978 and those from overseas in 1974-1975. As for important applicants, IBM distinguishes itself among those overseas while, in Japan, the Nippon Telegraph and Telephone Public Corporation occupies 47%, and Fujitsu, Ltd., 34%. In the case of GaAs-based transistors, businesses in Japan occupies as much as 90% of the applications overwhelming overseas businesses occupying less than 10%. As for the patents on manganese nodule mining systems, 183 Japanese patents are pending, with 88 already granted in America. While the main concern in Japan has transferred from the continuous elevator bucket system of 1971-1974 to the fluid dredge system, the fluid dredge system has consistently been occupying the overpowering majority in America. (NEDO)

  2. Optimal patent policies: A survey

    DEFF Research Database (Denmark)

    Poulsen, Odile

    2002-01-01

    This paper surveys some of the patent literature, in particular, it focuses on optimal patent policies. We compare two situations. The first where the government only has a single policy tool to design the optimal patent policy, namely the optimal patent length. In the second situation......, the government uses two policy tools, the optimal breadth and length. We show that theoretical models give very different answers to what is the optimal patent policy. In particular, we show that the optimal patent policy depends among othet things on the price elasticity of demand, the intersectoral elasticity...... of research outputs as well as the degree of compettition in the R&D sector. The actual law on intellectual property, which advocates a unique patent length of 20 years is in general not supported by theoretical models....

  3. Patenting Human Genes in Europe

    DEFF Research Database (Denmark)

    Minssen, Timo

    2017-01-01

    In accordance with the concept of the book and the assigned scope of the contribution, this chapter describes the European law with respect to the patent-eligibility of isolated DNA sequences. This chapter will further include a brief comparison with recent developments from the US and Australia....... It will, however, not focus on the important debates regarding the patent-eligibility of other biological material, diagnostic methods patents (as data aggregators) or abstract ideas which will be addressed by other contributions. Moreover, the analysis will merely concentrate on patent-eligibility. Other...... patentability requirement will only be briefly touched upon in the discussion part. The paper starts out in section 1.5.2 by discussing the patent-eligibility of isolated human DNA sequences on the European national level and under the Biotechnology Directive. Then the patent-eligibility of isolated human DNA...

  4. Labor Mobility and Patenting Activity

    DEFF Research Database (Denmark)

    Kaiser, Ulrich; Kongsted, Hans Christian; Rønde, Thomas

    We measure the quantitative importance of labor mobility as a vehicle for the transmission of knowledge and skills across firms. For this purpose we create a unique data set that matches all applications of Danish firms at the European Patent Office to linked employer-employee register data...... for the years 1999-2002. The Danish workforce is split into "R&D workers", who hold a bachelor's or a master's degree in a technical field, and "non{R&D workers". We find that mobile R&D workers ("R&D joiners"') contribute more to patenting activity than immobile R&D workers. Furthermore, R&D workers who have...... previously been employed by a patenting firm ("patent exposed workers") have a larger effect on patenting activity than R&D workers without this experience. Patent exposed R&D joiners constitute the most productive group of workers: for firms that patented prior to 1999, one additional worker of this type...

  5. Quantification of pneumothorax volume on chest radiographs: comparison between the collins' and the axel's methods with three-dimensional CT as the standard of reference

    International Nuclear Information System (INIS)

    Lee, Chang Keun; Kim, Hyung Jin; Lee, Kyung Hee; Kim, Joung Taek; Kim, Kwang Ho; Suh, Chang Hae; Han, Heon

    1999-01-01

    The purpose of this study was twofold. In a preliminary study, we evaluated the accuracy of 3-D (three-dimensional) CT for the estimation of pneumothorax volume and for providing the optimal postprocessing method for clinical study. In the clinical study, we determined which of the two methods, Collins' and Axel's, was more accurate for the estimation of pneumothorax volume, as seen on chest radiographs, using 3-D CT as the standard of reference. In the preliminary study, 3-D CT was applied to phantoms and to four patients with pneumothorax using two different postprocessing methods, manual contour delineation and thresholding. In the clinical study, 3-D CT was performed in 13 patients with pneumothorax. For the purpose of evaluating conventional radiographs, a localizer scan was used for comparing the accuracy of Collins' method with that of Axel's method, with 3-D CT as the standard of reference. The preliminary study revealed that 3-D CT estimated pneumothorax volume with great accuracy and that manual contour delineation and thresholding measured volume equally well. Because of the shorter postprocessing time required with thresholding than with manual contour delineation (5 min versus 30 min), the former was used during clinical study. The results of this indicated close correlation between the measurements obtained using Collins' method on chest radiographs and those obtained by 3-D CT(r=0.95, p 0.05). 3-D CT can estimate pneumothorax volume with great accuracy. Collins' method is superior to Axel's method for the quantification of pneumothorax volume as seen on chest radiographs

  6. Question of Drug Workers under the Prism Theory of Axel Honneth recognition . Human Right to Work and his pretension of Universal Validity

    OpenAIRE

    Maria Cecília Máximo Teodoro; Sabrina Colares Nogueira

    2016-01-01

    Relate the theme regarding the Theory of Recognition Axel Honnet, the human right to work as a human right to claim to universal validity, from the perspective of the Declaration of Fundamental Principles and Rights at Work ILO, for purposes of setting parameters and recognition of social (re) integration of chemical class dependent workers is the main goal of this article. We will analyze the theoretical framework in which the pursuit of human dignity at work is the goal of the state to whic...

  7. Patent Analysis for Pyroprocessing of Spent Nuclear Fuels

    International Nuclear Information System (INIS)

    Yoo, Jae Hyung; Kim, Jung Kuk; Lee, Han Soo; Seo, In Seok; Kim, Eun Ka

    2011-01-01

    Analysis of foreign and domestic patents for pyroprocessing technology of spent nuclear fuels was carried out in this study. The current status of pyroprocessing technology development in such countries as Korea, USA, Japan and EU was analyzed by classifying the patents for 1975 through 2009 according to registration country, assignee, calendar year and technology area. The major assignees' activity indices were compared in order to find out whether there is any concentrated area of technical details. Technology competitiveness of the countries was also investigated from the information of patent citation number and family size. Furthermore, some essential unit technologies required for the commercialization of pyroprocessing were derived and examined in the aspect of the state of art as well as the trend of technology development.

  8. Quality and quantity: Can we have both within the European patent system?

    DEFF Research Database (Denmark)

    Elsmore, Matthew J.

    2009-01-01

    Scrutiny of patent systems is never far away. The European Patent Office has long faced rising levels of 'inventive activity'. Fast, fluid technologies and strategic firm behavior add to the difficulties faced in trying to reward inventions with commensurate rights. Analysis suggests stronger...... patent protection does not necessarily equate with more innovation and greater diffusion of knowledge; nor do more patents lead to or reflect more innovation. This article focuses on improving the fundamental workings of the European system as is stands, and proposes a focus on quality and patent...

  9. Recent patents on flavonoids.

    Science.gov (United States)

    Mamta, Gokhale; Bansal, Y K; Sandhu, S S

    2013-12-01

    Flavonoids are substances which are widely distributed in the plant kingdom. They occur in considerable quantities in common food products, spices and beverages. Interest of researchers has been greatly enhanced towards therapeutic potential of flavonoids in last some years. This review summarizes important patents pertaining to recent biotechnological techniques applied for the production, analysis of biosynthetic pathways, effects and applications of different flavonoids. For systematic studies investigations which have been published in the form of patents, are classified in different sectors like biosynthesis, medical application, antimicrobial activity, alteration of flower color, industrial application, cosmetics, food and plant tissue culture. A number of activities have been observed in each sector with vast area of research on flavonoids.

  10. How Patent Function Integration with R&D Influence the Value of Patents

    DEFF Research Database (Denmark)

    Beukel, Karin; Valentin, Finn

    Patent strategies are endogenous to firm appropriability. However, to what extent does firm’s R&D teams’ engagement with patent experts influence the value of patents? We estimate the relationship between firm’s R&D use of patent functions on patent value in Biotech firms. Controlling...... for characteristics of scientific team, firm effects, and other patent value indicators, we find that having a firm specific (in-house) internal patent function is a driver of patent value. In addition, we find that the way in which patent functions create patent value differs dependent on whether the firm has...... internal patent function or not. In-house patent functions create value through narrow patents, whereas, firms with no in-house patent function create valuable patents by the use of broader scoped patents. Our results point to a strong effect of firm specific patent functions, but also explain how firms...

  11. Science of invention patent

    International Nuclear Information System (INIS)

    Park, Yeong Taek; Park, Su Dong

    1999-02-01

    This book tells science of invention patent about new way of invention and creative solution for problems, basic conception of TRIZ, resolution of physical contradictory and technical contradictory, development of system and types of evolution, change of thinking for solving the problems, analysis of structure for problem solution, problem solution using scientific phenomenon and effect, use of standard solution and algorithm of creative problem solution.

  12. A Research on Enterprise Patent Protection and Innovation Strategy

    Institute of Scientific and Technical Information of China (English)

    Zeng Sumei

    2017-01-01

    In the 21st century, high-tech serves as the foundation of competitiveness for the whole world, at the same time, intellectual property, especially the patent has become an effective means for an enterprise to participate in the international competition, and intellectual property is also the key strategic resource to gain competitive advantage. In effect, the competition amongst enterprises is mainly concerning the competition of patent technology. Those enterprises with a large number of high level professional powers gain the initiative edge of survival. Therefore, it is vital for the enterprise to adopt the patent protection and innovation strategy, so as to elevate the survival ability and competitiveness of an enterprise.

  13. Enforcing patents in the era of 3D printing

    DEFF Research Database (Denmark)

    Ballardini, Rosa Maria; Norrgård, Marcus; Minssen, Timo

    2015-01-01

    This article explores relevant laws and doctrines of patent infringement in Europe with a special emphasis on 3D printing (3DP) technologies. Considering the difficulties that patent owners might face in pursuing direct patent infringement actions in the rapidly evolving era of 3DP, we suggest...... of IP law. Enforcing patents in the era of 3D printing Rosa Maria Ballardini, Marcus Norrgård, and Timo Minssen Journal of Intellectual Property Law & Practice 2015 10: 850-866......, although the internet platforms and CAD files repositories will play a major role in the development and spreading of the 3DP technology, they will likely to be at the center of major law disputes unless they carefully consider the scope of their activities (host and/or customize and/or print) in light...

  14. Eastern European patenting activities in the USA

    Energy Technology Data Exchange (ETDEWEB)

    Marinova, D. [Murdoch University, Perth, WA (Australia). Inst. of Sustainability & Technological Policy

    2001-09-01

    The patenting activities of the former centrally planned economies in the US between 1976 and 1999 are examined. The technological performance of Eastern Europe is assessed and compared with that of the OECD countries. A sharp decline is observed as a consequence of the economic changes undergone by these countries in recent years. The study reveals some common technological strengths, such as in the areas of petroleum, coal, chemicals and other related products, and country-specific advantages, such as in mining in the former USSR, Poland and Bulgaria, textiles, clothing, footwear and leather in the former Czechoslovakia, printing, publishing and recorded media in the former East Germany, health in the former Yugoslavia, energy in Romania and design in Slovenia. Recommendations are made for the future use of foreign patents.

  15. PATENT ANALYSIS: A LOOK AT THE INNOVATIVE NATURE OF PLANT-BASED COSMETICS

    Directory of Open Access Journals (Sweden)

    Francine C. S. César

    Full Text Available The use of plants have become a important trend in cosmetic market, with a crescent number of patent applications. Despite various herbal-based ingredients have been described in scientific literature, most of them are restricted to patent databases. In this work we analyze the innovative use of plants and its derivatives in cosmetic technologies, based on patent analysis. The investigation was conducted using Derwent World Patents Index (Thomson Reuters Scientific, USA from 1995 to 2015. The search was carried out to evaluate the number of patent deposits, the patent depositors profiles, the countries with most patent applications, the International Patent Classification (IPC and the main plant families using in cosmetics. Patent analysis revealed an increase number of applications involving cosmetic containing plants components, with a higher number of deposits related to anti-ageing and whitening skin treatment. Fabaceae, Asteraceae, Rosaceae, Lamiaceae, Poaceae, Rutaceae, Lilliacae and Apiaceae were the key plant families used in cosmetic formulations for skin care treatment. Comparison between scientific and technological data pointed out divergences between patents deposits and aid-based scientific reports. The use of patent analysis in combination with scientific data opens up wider aspects of knowledge and enables a better rationalization of innovative works.

  16. Section for Standard and Patents - Standardization and Patents

    International Nuclear Information System (INIS)

    Wojtowicz, S.; Trechcinski, R.; Rybka, M.; Ryszkowska, A.; Wardaszko, J.

    1997-01-01

    Full text: The most important tasks of the Section in 1996 were: preparation of national standards and program of future work on standards for nuclear instrumentation and electronic equipment in nuclear engineering; organization of activities and participation in the meetings of the Commissions for Standardization No 173 Microprocessor Systems, No 266 Nuclear Instrumentation; giving opinions and expertises on national and international standards for equipment in nuclear engineering; cooperation with the Commission for Standardization No 246 Radiological Protection; control of inventiveness activity; The quality of the technical products is being improved by: a) selection of the proper types of interface systems, technical coordination and quality control; b) creation of standards at a high technical level; The Section works mainly for the Polish Committee for Standardization, the National Atomic Energy Agency, Association of Polish Electrical Engineers and Research Institutes in Poland. The activity of the Section is useful for all national institutions where backplane busses and nuclear electronic equipment is produced or used. The Section participates in the following international organizations: IEC (International Electrotechnical Commission) TC 45 (Nuclear Instrumentation); ISO/IEC Joint Technical Committee ISO/IEC JTCl SC26 (Microprocessor systems); ESONE (European Studies on Norms for Electronics); The section takes part in popularization of nuclear technology and instrumentation in the following ways: distribution of standards and technical documentation to national institutions dealing with nuclear apparatus; collecting and distributing technical information from international organizations (e.g. ESONE); organization of technical and scientific, national and international conferences (New Generation Nuclear Power Plants - September 96, QNX in Real World - January 96); participation in the technical conference organized by the Polish Committee for

  17. Strategies for stem cell patent applications in the light of recent court cases.

    Science.gov (United States)

    Eyre, David E; Schlich, George W

    2015-01-01

    Stem cells offer the prospect of treatments for diseases and injuries that are currently beyond medical science. Although development of these potential medical marvels has been dogged by their controversial origin, technological developments and guidance from recent judicial decisions have answered and overcome many of these difficulties. In particular, the European Patent Office, United States Patent and Trademark Office, Japan Patent Office and State Intellectual Property Office of China have published guidelines covering patenting of stem cell technologies in the light of recent decisions. We now see a patent landscape where stem cell technologies and related therapies can, with very few exceptions, be protected via patents, provided the appropriate form of claim wording is used.

  18. Question of Drug Workers under the Prism Theory of Axel Honneth recognition . Human Right to Work and his pretension of Universal Validity

    Directory of Open Access Journals (Sweden)

    Maria Cecília Máximo Teodoro

    2016-06-01

    Full Text Available Relate the theme regarding the Theory of Recognition Axel Honnet, the human right to work as a human right to claim to universal validity, from the perspective of the Declaration of Fundamental Principles and Rights at Work ILO, for purposes of setting parameters and recognition of social (re integration of chemical class dependent workers is the main goal of this article. We will analyze the theoretical framework in which the pursuit of human dignity at work is the goal of the state to which we treat below the dignity of man as a right whose claim to universal validity is based on the recognition of the theory of Axel Honneth . That said, we analyze the possible dignity of man at work in a global context from the recognition of new rights, especially with regard to the category of workers who occupy the social portion of chemical-dependent, whose participation in the social process is prevented, creating a category of workers socially excluded, which is intended to overcome.

  19. Tracking U.S. biofuel innovation through patents

    International Nuclear Information System (INIS)

    Kessler, Jeff; Sperling, Daniel

    2016-01-01

    We use biofuel patents as a proxy for biofuel innovation. Through use of natural language processing and machine-learning algorithms, we expand patent classification capabilities to better explain the history of biofuels innovation. Results indicate that after the initial establishment of the U.S. biofuel industry, there were two surges in biofuel innovation: 1995–2000, characterized by heavy patenting by 1st generation (food-based) biofuel firms; and 2005–2010, characterized by a second surge of innovation by those same large firms, complemented by a large number of biotechnology firms producing a relatively small number of 2nd generation biofuel patents. Our analysis corroborates the widespread understanding that the first surge in biofuel innovation was linked to innovations in agriculture, and that the second surge of biofuel innovation was driven by demand-pull policies mandating and incentivizing biofuels. But the slow emergence of a 2nd generation cellulose-based biofuels industry, far slower than called for by policy, suggests that technology-push policies more focused on R&D and investment may be needed to accelerate the commercialization of 2nd generation biofuels. - Highlights: • Patenting activity closely corresponds to sociotechnical shifts in biofuel innovation. • The Renewable Fuel Standard likely contributed to the rise in biofuel patenting activity after 2005. • 2nd generation biofuel technology innovation appears lacking compared to 1st generation technologies.

  20. Decoding Gene Patents in Australia

    OpenAIRE

    Denley, Adam; Cherry, James

    2015-01-01

    Patents directed to naturally occurring genetic material, such as DNA, RNA, chromosomes, and genes, in an isolated or purified form have been granted in Australia for many years. This review provides scientists with a summary of the gene patent debate from an Australian perspective and specifically reviews how the various levels of the legal system as they apply to patents—the Australian Patent Office, Australian courts, and Australian government—have dealt with the issue of whether genetic m...

  1. Patents: Recent Trends and Puzzles

    OpenAIRE

    Zvi Griliches

    1989-01-01

    This paper reviews the historical data on patenting in the United States with special reference to the last 20 years and their potential relation, if any, to the recent productivity slowdown. Two Points are made: Patents are not a "constant-yardstick" indicator of either inventive input or output. Moreover, they are "produced" by a governmental agency which goes through its own budgetary and inefficiency cycles. The paper shows that the appearance of an absolute decline in patenting in the 19...

  2. The role of patent and non-patent databases in patent research in universities

    Science.gov (United States)

    Tolstaya, A. M.; Suslina, I. V.; Tolstaya, P. M.

    2017-01-01

    This studies deal with the description and systematization of the popular patent retrieval resources. The importance of the non-patent information when conducting patent research for the intellectual property created in educational and scientific activity of the university is highlighted. The differences in the patent and non-patent information are found out. Based on the databases` analysis the authors conducted the patent research on "Wireless endoscopic capsules" (development of the NRNU MEPhI). This study can be used to facilitate the university work on the new product development in order to improve the efficiency of the process of the commercialization of the intellectual activity results, including the entering the international market.

  3. Clearing a path through the CRISPR patent jungle - Part I: User generated licensing models

    DEFF Research Database (Denmark)

    Minssen, Timo; Van Zimmeren, Esther; Wested, Jakob

    2018-01-01

    The revocation of Broad Institute’s patent EP2771468, marks the latest major development in a series of patent battles over the revolutionary and highly lucrative CRISPR- Cas 9 technology (and other gene editing technologies) in the US and Europe. While this is the first EPO decision......, researchers and companies looking to commercialize CRISPR–Cas9 gene editing and comparable techniques will probably continue to face a very complex, highly fragmented patent landscape for the next decades. Typically, patent claims will become narrower and may be harder to enforce. This may trigger some...

  4. Biocompatible Synthetic and Semi-synthetic Polymers - A Patent Analysis.

    Science.gov (United States)

    Ranganathan, Balu; Miller, Charles; Sinskey, Anthony

    2018-01-01

    Bioengineering has come of ages by setting up spare parts manufacturing units to be used in human body such as invasive implants and interventional controlled drug delivery in vivo systems. As a matter of fact patients on basis of their fiscal strength have the option to undergo prophylactic tactical manoeuvre for longer life spans. In this sphere of invasive implants, biocompatible polymer implants are a state of the art cutting edge technology with outstanding innovations leading to number of very successful start-up companies with a plethora of patent portfolios. From 2000 onwards, patent filings and grants for biocompatible polymers are expanding. Currently definition of biocompatibility is quite ambiguous with respect to the use of FDA approved polymeric materials. This article analysed patent portfolios for the trend patterns of prolific biocompatible polymers for capitalization and commercialization in the forthcoming years. Pair Bulk Data (PBD) portal was used to mine patent portfolios. In this patent preliminary analysis report, patents from 2000 to 2015 were evaluated using 317(c) filings, grants and classifications data for poly(vinyl alcohol) (PVA), poly(glycolic acid) (PGA), poly(hydroxyalkanoates) (PHAs) and poly(lactic acid) (PLA). This patent portfolio preliminary analysis embarks into patent analysis for New Product Development (NPD) for corporate R&D investment managerial decisions and on government advocacy for federal funding which is decisive for developmental advances. An in-depth patent portfolio investigation with return of investment (RoI) is in the pipeline. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  5. Patent citation network in nanotechnology (1976-2004)

    International Nuclear Information System (INIS)

    Li Xin; Chen Hsinchun; Huang Zan; Roco, Mihail C.

    2007-01-01

    The patent citation networks are described using critical node, core network, and network topological analysis. The main objective is understanding of the knowledge transfer processes between technical fields, institutions and countries. This includes identifying key influential players and subfields, the knowledge transfer patterns among them, and the overall knowledge transfer efficiency. The proposed framework is applied to the field of nanoscale science and engineering (NSE), including the citation networks of patent documents, submitting institutions, technology fields, and countries. The NSE patents were identified by keywords 'full-text' searching of patents at the United States Patent and Trademark Office (USPTO). The analysis shows that the United States is the most important citation center in NSE research. The institution citation network illustrates a more efficient knowledge transfer between institutions than a random network. The country citation network displays a knowledge transfer capability as efficient as a random network. The technology field citation network and the patent document citation network exhibit a less efficient knowledge diffusion capability than a random network. All four citation networks show a tendency to form local citation clusters

  6. Collaborative networks and patent production in Andean Community of Nations universities (UCANS, 2005-2015

    Directory of Open Access Journals (Sweden)

    Carlos Enrique Agüero Aguilar

    2017-06-01

    Full Text Available The competitiveness and technological development of a region are measured by the degree of innovation supporting them. The quantity and quality of patents generated and applied in production dynamics serve as an element for evaluation. In this sense, universities play a role as generators and transmitters of knowledge. So it is important to identify the level of their collaboration and the trends in terms of technology application in order to establish future policies for development in this sector. This article identifies the degree of collaboration, types of patents, actors (primary and secondary and dynamics of patents produced at the Andean Community of Nations universities during the period 2005-2015 and present in the European Patent Office database. In conclusion, there is a great disparity between CAN universities regarding patent production, so it is necessary to strengthen the collaborative level among universities in this community. Nevertheless, an increase is seen in the production of patents.

  7. Wacky Patents Meet Economic Indicators

    DEFF Research Database (Denmark)

    Czarnitzki, Dirk; Hussinger, Katrin; Schneider, Cédric

    2011-01-01

    We investigate whether standard indicators can distinguish between “wacky” patents and a control group. Forward citations are good predictors of importance. However, “wacky” patents have higher originality, generality and citation lags, suggesting that these indicators should be interpreted...

  8. Online Patent Searching: The Realities.

    Science.gov (United States)

    Kaback, Stuart M.

    1983-01-01

    Considers patent subject searching capabilities of major online databases, noting patent claims, "deep-indexed" files, test searches, retrieval of related references, multi-database searching, improvements needed in indexing of chemical structures, full text searching, improvements needed in handling numerical data, and augmenting a…

  9. Pesticides and the Patent Bargain

    NARCIS (Netherlands)

    Timmermann, C.A.

    2015-01-01

    In order to enlarge the pool of knowledge available in the public domain, temporary exclusive rights (i.e. patents) are granted to innovators who are willing to fully disclose the information needed to reproduce their invention. After the 20-year patent protection period elapses, society should be

  10. Absorptive routines and international patent performance

    Directory of Open Access Journals (Sweden)

    Fernando E. García-Muiña

    2017-04-01

    We enrich the treatment of the absorptive capacity phases including the moderating effects between routines associated to the traditional potential-realized absorptive capacities. Taking into account external knowledge search strategies, the deeper external relationships, the better transference and appropriation of specific external knowledge. Nevertheless, when the moderating role of assimilation is included, cooperation agreements appear as the most efficient source of external knowledge. Finally, we show that technological tools let firms store and structure the information making easier its use for international patenting. This positive effect is reinforced in the presence of exploitation routines, since technological knowledge will better fit to the industry's key factors of success.

  11. Literaturhinweise / Axel Bormann

    Index Scriptorium Estoniae

    Bormann, Axel

    2005-01-01

    Arvustus: Klauberg, Theis. Gesellschaftsrecht in Estland, Lettland, Litauen : eine Einführung mit vergleichenden Tabellen. Heidelberg [etc.] : Rehm, 2004. - XIV, 116 lk. - (Gesellschaftsrecht - international)

  12. Sources of inspiration? Making sense of scientific references in patents

    NARCIS (Netherlands)

    Callaert, Julie; Pellens, Maikel; van Looy, Bart

    2013-01-01

    Scientific references in patent documents can be used as indicators signaling science-technology interactions. Whether they reflect a direct ‘knowledge flow’ from science to technology is subject of debate. Based on 33 interviews with inventors at Belgian firms and knowledge-generating institutes

  13. Patent based innovation and development: issues, challenges and future

    International Nuclear Information System (INIS)

    Noraini Ibrahim

    2001-01-01

    The main purpose of this paper is to analyse the extent to which science and technology (S and T) policy has been integrated to patent based innovation within the context of national development objective. Could the institutionalisation of patent based innovation in Malaysia be effectively implemented ? The main argument is that patent based innovation must be integrated into the national S and T policy as a dynamic and proactive system. This paper argued that the dependency has an effect to the consequent of relationship imbalance between Malaysia and advanced nations as the main technology supplier within the international business economy. This paper adopts the interdisciplinary of social sciences using system-oriented analysis. The objective of the S and T is to enhance the capacity of national S and T resources as well as to develop the capacity of the local to select, negotiate, adopt, modify, and improve imported technology. Nevertheless, even though the S and T policy was launched in 1986, the impetus of government commitment towards the realisation of S and T policy became more pronounced only in the middle of the 90s. The Ministry of Sciences, Technology and Environment recognises the importance of creating a climate of science and technology as a critical prerequisite for national development. Various activities at the state and national levels have been organised to promote awareness and adoption of technology to the community. The Ministry that acts as the secretariat to the National Science and Development Council aims to reinforce the foundation based on S and T activities. Malaysia also should encourage activities that general technical innovations that would be integrated into patent based innovation as one of the component in the national innovation system. While this is so, an effective assimilation of technical innovation that is developed within the framework of the national innovation system is yet to be realised. Patent based innovation as a

  14. Patent data mining: a tool for accelerating HIV vaccine innovation.

    Science.gov (United States)

    Clark, K; Cavicchi, J; Jensen, K; Fitzgerald, R; Bennett, A; Kowalski, S P

    2011-05-31

    Global access to advanced vaccine technologies is challenged by the interrelated components of intellectual property (IP) management strategies, technology transfer (legal and technical) capabilities and the capacity necessary for accelerating R&D, commercialization and delivery of vaccines. Due to a negative association with the management of IP, patents are often overlooked as a vast resource of freely available, information akin to scientific journals as well as business and technological information and trends fundamental for formulating policies and IP management strategies. Therefore, a fundamental step towards facilitating global vaccine access will be the assembly, organization and analysis of patent landscapes, to identify the amount of patenting, ownership (assignees) and fields of technology covered. This is critical for making informed decisions (e.g., identifying licensees, building research and product development collaborations, and ascertaining freedom to operate). Such information is of particular interest to the HIV vaccine community where the HIV Vaccine Enterprise, have voiced concern that IP rights (particularly patents and trade secrets) may prevent data and materials sharing, delaying progress in research and development of a HIV vaccine. We have compiled and analyzed a representative HIV vaccine patent landscape for a prime-boost, DNA/adenoviral vaccine platform, as an example for identifying obstacles, maximizing opportunities and making informed IP management strategy decisions towards the development and deployment of an efficacious HIV vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Patent arterial duct

    Directory of Open Access Journals (Sweden)

    Martin Robin P

    2009-07-01

    Full Text Available Abstract Patent arterial duct (PAD is a congenital heart abnormality defined as persistent patency in term infants older than three months. Isolated PAD is found in around 1 in 2000 full term infants. A higher prevalence is found in preterm infants, especially those with low birth weight. The female to male ratio is 2:1. Most patients are asymptomatic when the duct is small. With a moderate-to-large duct, a characteristic continuous heart murmur (loudest in the left upper chest or infraclavicular area is typical. The precordium may be hyperactive and peripheral pulses are bounding with a wide pulse pressure. Tachycardia, exertional dyspnoea, laboured breathing, fatigue or poor growth are common. Large shunts may lead to failure to thrive, recurrent infection of the upper respiratory tract and congestive heart failure. In the majority of cases of PAD there is no identifiable cause. Persistence of the duct is associated with chromosomal aberrations, asphyxia at birth, birth at high altitude and congenital rubella. Occasional cases are associated with specific genetic defects (trisomy 21 and 18, and the Rubinstein-Taybi and CHARGE syndromes. Familial occurrence of PAD is uncommon and the usual mechanism of inheritance is considered to be polygenic with a recurrence risk of 3%. Rare families with isolated PAD have been described in which the mode of inheritance appears to be dominant or recessive. Familial incidence of PAD has also been linked to Char syndrome, familial thoracic aortic aneurysm/dissection associated with patent arterial duct, and familial patent arterial duct and bicuspid aortic valve associated with hand abnormalities. Diagnosis is based on clinical examination and confirmed with transthoracic echocardiography. Assessment of ductal blood flow can be made using colour flow mapping and pulsed wave Doppler. Antenatal diagnosis is not possible, as PAD is a normal structure during antenatal life. Conditions with signs and symptoms of

  16. Patent landscape of countermeasures against smallpox and estimation of grant attraction capability through patent landscape data.

    Science.gov (United States)

    Mayburd, Anatoly L; Kedia, Govind; Evans, Haydn W; Kaslival, Pritesh C

    2010-11-01

    The study was concerned with countermeasures against a possible smallpox outbreak. In the process of assessment 18 landscaping sectors were defined and described, the advantages and drawbacks of the corresponding countermeasures being reviewed. The data of the previously published influenza landscape were revisited. The current economic climate of deficit cutting (austerity) also puts emphasis on the optimization of capital investment. We used the materials of the landscape to define and analyze metrics of capital placement optimization. Value score was obtained by fitting patent landscape internals to the sale price of individual patents. Success score was obtained as a product of a-priori parameters that measure likelihood of emergence of a marketable product in a technological sector. Both scores were combined in a qualitative metric. Our methodology defined weight as a product of the sector size by the success score. We hypothesized - based on the material of two landscapes- that a life cycle of a technology begins in IP space with a high patent quality low volume "bud" of low weight, reaches maximum weight and then weight falls again when the technology becomes outdated. The weight and the annual dynamic of weight can serve a measure of investment risk and return. In this report we modeled investment by issue of government grants or purchase of patents by government. In the smallpox landscape the number of patents purchased by government agencies was the highest in the sectors with the highest weight and the trend was confirmed by the count of NIH grants issued in support of the technological sectors. In the influenza landscape only grant issue count was statistically meaningful and the trend was also confirmed. To better fit the grant support levels, the weight expression was optimized by using training coefficients. We propose to use value scores for evaluation of individual patent publications/company portfolios and to use weights for assessment of

  17. A contribuição de patentes para a inovação sustentável: o caso de um trocador de calor

    Directory of Open Access Journals (Sweden)

    Carlos Mamori Kono

    2014-01-01

    Full Text Available Patents are useful indicators of innovation, although still of a very limited use. In patenting, the need for the precise registration of a method, process, or system facilitates understanding it and eventually motivates the scientific community to carry out research in a given area, thus accelerating technological progress. Patent data are not static; patents cite other connected patents, providing a dynamic view of technological antecedents and descendants leading to state-of-the-art knowledge. This article is an exercise on the usefulness of patents as a source of technological innovation. To do this, we searched patent databases considered as sources of technological innovation in order to introduce improvements in a heat-exchanging device coupled to an electric shower. The results enabled finding the state-of-the-art of the technology and led to suggestions of possible innovations for the product. This allowed us to improve the sustainability potential of this technology.

  18. Patents Assessed through Sectoral Operational Programs

    Directory of Open Access Journals (Sweden)

    Paula – Angela VIDRAȘCU

    2014-06-01

    Full Text Available According to the International Accounting Standards – IAS 38 „Intangible assets”; these assets are identifiable non-monetary assets under construction were considered without physical substance. Lack actual physical form must not be understood that an intangible asset would have no material support, because the presence of any intangible asset can be demonstrated only by a support material form. Exmple: frequently encounter compact-disc (in case a software, legal documentation (in the case of licences, trade marks and patents of invention, contracts, permits and licences, technical documentation or films. Nowadays we are constantly subjected to the changing flow of information that is found in a perpetual technological change which started the emergence of a new stage in the society development that which carries the name of knowledge. The object of my research is the patent for the structural funds reimbursable project submitted in the "Operational Program, Economic Competitiveness" Operation 2.3.1. "Support for start-ups and innovative spin-offs. Patent is an official document certifying the inventor, the exclusive right to produce a certain good or product or use a particular process. Remember that evaluation of intangible assets is the most complex and systematic procedure.

  19. Economic Justification of Patents and Exceptions to Patentability

    DEFF Research Database (Denmark)

    Nordberg, Ana

    2012-01-01

    The present article is the conclusion of a review of economic justifications for patent rights conducted with the objective of determining whether such arguments are per se capable of sustaining the existence of a different patentability regime for inventions of methods for treatment and diagnostic...... methods (art.53 (c) European Patent Convention). It starts by exploring the normative background and summarily describes the different types of claims allowed under the current legal framework and their differences. The following sections will describe and apply the main economic arguments sustaining...... patent rights inventions of methods for treatment and diagnostic methods. These reasoning will be later confronted with contra-arguments. This piece will finalize with the formulation of conclusions extracted from the previous debate, inter-alia that economic reasoning does not per se sustain...

  20. Developing a Systematic Patent Search Training Program

    Science.gov (United States)

    Zhang, Li

    2009-01-01

    This study aims to develop a systematic patent training program using patent analysis and citation analysis techniques applied to patents held by the University of Saskatchewan. The results indicate that the target audience will be researchers in life sciences, and aggregated patent database searching and advanced search techniques should be…

  1. 78 FR 31885 - Patent Term Extension

    Science.gov (United States)

    2013-05-28

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Patent Term Extension ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its... States Patent and Trademark Office, P.O. Box 1450, Alexandria, VA 22313-1450. Federal Rulemaking Portal...

  2. 78 FR 7759 - Patent Cooperation Treaty

    Science.gov (United States)

    2013-02-04

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Patent Cooperation Treaty ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its... States Patent and Trademark Office, P.O. Box 1450, Alexandria, VA 22313-1450. Federal Rulemaking Portal...

  3. 75 FR 20561 - Patent Term Extension

    Science.gov (United States)

    2010-04-20

    ... DEPARTMENT OF COMMERCE Patent and Trademark Office Patent Term Extension ACTION: Proposed collection; comment request. SUMMARY: The United States Patent and Trademark Office (USPTO), as part of its... Officer, Office of the Chief Information Officer, United States Patent and Trademark Office, P.O. Box 1450...

  4. 76 FR 72000 - Patent, Trademark & Copyright Acts

    Science.gov (United States)

    2011-11-21

    ... DEPARTMENT OF THE INTERIOR Geological Survey Patent, Trademark & Copyright Acts AGENCY: U.S... Consultants, 1255 Roberts Boulevard NW., Suite 200, Kennesaw, GA 30144, on U.S. Patent Application Serial No. 12/133,666, and a divisional patent application to be filed shortly at the Patent and Trademark...

  5. Patents and Publics: Engaging Museum Audiences with Issues of Ownership and Invention

    Directory of Open Access Journals (Sweden)

    James F. Stark

    2015-04-01

    Full Text Available It is all very well to note the hyperbole about patents and ‘intellectual property’ in the recent battles between technology companies such as Apple, Samsung and HTC. But how can museums productively use collection items marked with a patent beyond workaday tasks of identification and cataloguing? We argue that information on patents can enhance visitors’ critical engagement with museum displays; complex ownership claims and counter-claims in patent disputes can underpin lively narratives based around museum objects. Asking why some objects and not others were patented, and how historical consumers responded to that status of ‘patented’ enables us to look at these objects afresh. In particular we analyse the responses of public consultation groups to patenting in the medical trade, as well as the engagement of museum staff with these issues. Such consultation processes offer information that can be used to enhance museum displays with engaging narratives of ownership and invention.

  6. Religious coalition opposes gene patents.

    Science.gov (United States)

    James, J S

    1995-05-19

    The biotechnology industry is concerned about a coalition of mainstream religious leaders, working with Jeremy Rifkin of the Foundation of Economic Trends, who oppose the patenting of human and animal life forms, body parts, and genes. The coalition called a press conference on May 18 to ask the government to prohibit the current patenting practices for genetic engineering. The biotechnology industry argues that patents indicate that a company's research tool has significant value, and encourages capitalists to invest their dollars in the development of new treatments for diseases. They also argue that the 29 biotech drugs that are on the market have been developed as a result of patents on genes. Although most business leaders are united in opposing restrictions, many scientists are divided, citing both religious and scientific reasons.

  7. Universities’ Intellectual Property: Path for Innovation or Patent Competition?

    Directory of Open Access Journals (Sweden)

    Gustavo Dalmarco

    2011-09-01

    Full Text Available Technological innovation is represented by the conversion of knowledge into new products and processes which, when commercialized, generate wealth. In relations with companies, universities’ role is to develop scientific knowledge, fostering industry’s R&D activities. This article proposes an analysis of the technology transfer process performed by public universities in Brazil. Results demonstrate that universities are facing difficulties in requesting and licensing patents based on scientific results, due to lack of commercial contact with companies and their limitations in adapting available technologies. The increase in scientific output is not being effectively transformed into new technologies for products and services, exposing the necessity for new policies to approach university-industry relations. For universities, this may mean rethinking the role of patents in the technology transfer process, such as increasing co-authorship with companies and have companies support technological research within the university, instead of investing in legal protection, distant from market needs.

  8. Patent Law for Computer Scientists

    Science.gov (United States)

    Closa, Daniel; Gardiner, Alex; Giemsa, Falk; Machek, Jörg

    More than five centuries ago the first patent statute was passed by the Venetian senate. It already had most of the features of modern patent law, recognizing the public interest in innovation and granting exclusive right in exchange for a full disclosure. Some 350 years later the industrial revolution led to globalisation. The wish to protect intellectual property on a more international level evolved and supranational treaties were negotiated. Patent laws are still different in many countries, however, and inventors are sometimes at a loss to understand which basic requirements should be satisfied if an invention is to be granted a patent. This is particularly true for inventions implemented on a computer. While roughly a third of all applications (and granted patents) relate, in one way or another, to a computer, applications where the innovation mainly resides in software or in a business method are treated differently by the major patent offices. The procedures at the USPTO, JPO and EPO and, in particular, the differences in the treatment of applications centring on software are briefly explained. In later sections of this book, a wealth of examples will be presented. The methodology behind the treatment of these examples is explained.

  9. Text mining factor analysis (TFA) in green tea patent data

    Science.gov (United States)

    Rahmawati, Sela; Suprijadi, Jadi; Zulhanif

    2017-03-01

    Factor analysis has become one of the most widely used multivariate statistical procedures in applied research endeavors across a multitude of domains. There are two main types of analyses based on factor analysis: Exploratory Factor Analysis (EFA) and Confirmatory Factor Analysis (CFA). Both EFA and CFA aim to observed relationships among a group of indicators with a latent variable, but they differ fundamentally, a priori and restrictions made to the factor model. This method will be applied to patent data technology sector green tea to determine the development technology of green tea in the world. Patent analysis is useful in identifying the future technological trends in a specific field of technology. Database patent are obtained from agency European Patent Organization (EPO). In this paper, CFA model will be applied to the nominal data, which obtain from the presence absence matrix. While doing processing, analysis CFA for nominal data analysis was based on Tetrachoric matrix. Meanwhile, EFA model will be applied on a title from sector technology dominant. Title will be pre-processing first using text mining analysis.

  10. Patterns of Creation and Discovery: An Analysis of Defense Laboratory Patenting and Innovation

    Science.gov (United States)

    2013-01-01

    or by tracking the accumulation of patents within technology classes as demonstrated in Eusebi & Silberglitt (N.d.), Chen et al. (2010), Andersen ...In 2012, Aggarwal and Sanghera received the Dr. Arthur E. Bisson Prize for Naval Technology Achievement which recognizes "individuals who have...emerging market conditions ( Andersen , 1999; Ernst, 1997). These suggestions are based on the theory that the rate of patent filings within a technology

  11. Patents, Inducement Prizes, and Contestant Strategy

    DEFF Research Database (Denmark)

    Davis, Jerome; Davis, Lee N.

    2006-01-01

    Debate over the merits of patents versus inducement prizes has tended to ignore the signaling roles of patents, and totally ignores the impact of patent signaling on prize contests. This paper asks: How does patent signaling affect the strategic choices of firms considering entering prize contests......? First, we consider contests that do not allow patenting, then contests that do. If patenting is not allowed, we argue, patent-holders, both internal and external to the contest, can adversely impact prize contests by claiming prize winner violation of their patents, and suing for damages. The likelihood...... of such challenges being made can deter entry, particularly in contests requiring large sunk costs. Furthermore, the firm's decisionmaking process will discriminate against entering prize contests and favor R&D projects with patentable outcomes. Together, these problems may circumscribe any future wider role...

  12. How Much are Flexibility and Uncertainty Worth in Patent Licensing?

    DEFF Research Database (Denmark)

    Leone, Maria Isabella; Oriani, Raffaele; Reichstein, Toke

    2015-01-01

    As patent licensing has become the prime driver of technology trade, understanding the rationales behind a properly-defined payment structure of the agreements is essential. Specifically, among the other remuneration components, upfront fees are critical in license negotiations since they imply a...

  13. Ethics in scientific results application: Gene and life forms patenting

    Directory of Open Access Journals (Sweden)

    Konstantinov Kosana

    2010-01-01

    Full Text Available The remarkable development and application of new genetic technologies over the past decades has been accompanied by profound changes in the way in which research is commercialized in the life sciences. As results, new varieties of commercially grown crops with improved or new traits are developed. Many thousands of patents which assert rights over DNA sequences have been granted to researchers across the public and private sector. The effects of many of these patents are extensive, because inventors who assert rights over DNA sequences obtain protection on all uses of the sequences. Extremely valuable to breeders in the national agricultural research system is the ability to genotype their collections to get a clear picture of their diversity and how diversity could be enhanced through sharing and access to global collections. The issue of the eligibility for patenting of DNA sequences needs to be reopened. Patents that assert rights over DNA sequences and their uses are, in some cases, supportable, but in others, should be treated with great caution. Rights over DNA sequences as research tools should be discouraged. That the best way to discourage the award of such patents is by stringent application of the criteria for patenting, particularly utility. A more equitable, ethically - based food and agricultural system must incorporate concern for three accepted global goals: improved well being, protection of the environment and improved public health (particular point food from GMO. To mitigate conflict one of the approach to solve problem is ethical and truthful label of GM food, because consumers have a right to choose whether to eat genetically modified foods or not. Interesting examples and risks as consequences of free availability of genetic resources utilization, its transformation, patenting of 'new' organism and selling it back to the genetic resource owner are presented. Society has obligations to raise levels of nutrition and

  14. 'Patents and Downstream Innovation Suppression - Fact or Fiction?'

    DEFF Research Database (Denmark)

    Howells, John

    Merges and Nelson have provided an empirically grounded argument that firms use pioneer patents of 'broad' scope to block downstream technological development (Merges and Nelson 1990). If this is a regular occurrence then, as they claim, they have faulted Kitch's 'prospect theory' of patents (Kitch...... 1977), a theory that is a version of the classic justification for the award of the exclusive right - that it should protect the incentive to develop property. Merges and Nelson insist that their thesis should be supported by empirical evidence and they turn to historical accounts as an important form...

  15. Identification of the Key Fields and Their Key Technical Points of Oncology by Patent Analysis.

    Science.gov (United States)

    Zhang, Ting; Chen, Juan; Jia, Xiaofeng

    2015-01-01

    This paper aims to identify the key fields and their key technical points of oncology by patent analysis. Patents of oncology applied from 2006 to 2012 were searched in the Thomson Innovation database. The key fields and their key technical points were determined by analyzing the Derwent Classification (DC) and the International Patent Classification (IPC), respectively. Patent applications in the top ten DC occupied 80% of all the patent applications of oncology, which were the ten fields of oncology to be analyzed. The number of patent applications in these ten fields of oncology was standardized based on patent applications of oncology from 2006 to 2012. For each field, standardization was conducted separately for each of the seven years (2006-2012) and the mean of the seven standardized values was calculated to reflect the relative amount of patent applications in that field; meanwhile, regression analysis using time (year) and the standardized values of patent applications in seven years (2006-2012) was conducted so as to evaluate the trend of patent applications in each field. Two-dimensional quadrant analysis, together with the professional knowledge of oncology, was taken into consideration in determining the key fields of oncology. The fields located in the quadrant with high relative amount or increasing trend of patent applications are identified as key ones. By using the same method, the key technical points in each key field were identified. Altogether 116,820 patents of oncology applied from 2006 to 2012 were retrieved, and four key fields with twenty-nine key technical points were identified, including "natural products and polymers" with nine key technical points, "fermentation industry" with twelve ones, "electrical medical equipment" with four ones, and "diagnosis, surgery" with four ones. The results of this study could provide guidance on the development direction of oncology, and also help researchers broaden innovative ideas and discover new

  16. IMPROVING (SOFTWARE) PATENT QUALITY THROUGH THE ADMINISTRATIVE PROCESS.

    Science.gov (United States)

    Rai, Arti K

    2013-11-24

    The available evidence indicates that patent quality, particularly in the area of software, needs improvement. This Article argues that even an agency as institutionally constrained as the U.S. Patent and Trademark Office ("PTO") could implement a portfolio of pragmatic, cost-effective quality improvement strategies. The argument in favor of these strategies draws upon not only legal theory and doctrine but also new data from a PTO software examination unit with relatively strict practices. Strategies that resolve around Section 112 of the patent statute could usefully be deployed at the initial examination stage. Other strategies could be deployed within the new post-issuance procedures available to the agency under the America Invents Act. Notably, although the strategies the Article discusses have the virtue of being neutral as to technology, they are likely to have a very significant practical impact in the area of software.

  17. The patent, object of research in Information Science and Communication

    Directory of Open Access Journals (Sweden)

    Luc Quoniam

    2014-04-01

    Full Text Available In this study are addressed some dimensions of intellectual property, especially patents and their way of making some tangible outcomes of research and development, playing a key role in the field of strategy, involving the returns on investments and exploration rights to certain inventions. However, the general objective of this study is to present aspects of the information available in patent applications and the possibility of using them to transfer technology between countries, organizations, contribute to the research of social responsibility, valuing natural resources and provide access to medicines, once these are aspects little attention in the literature. Considering the patent as an object of study in the humanities and social sciences, is evidenced by the cases cited, the potential contribution to innovation, research and development organizations, regions and countries.

  18. Search Technologies | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  19. Available Technologies | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    Our team of technology transfer specialists has specialized training in invention reporting, patenting, patent strategy, executing technology transfer agreements and marketing. TTC is comprised of professionals with diverse legal, scientific, and business/marketing expertise. Most of our staff hold doctorate-level technical and/or legal training.

  20. The Unified Patent Court (UPC) in Action - How Will the Design of the UPC Affect Patent Law?

    DEFF Research Database (Denmark)

    Petersen, Clement Salung; Riis, Thomas; Schovsbo, Jens Hemmingsen

    2014-01-01

    . The article points out that the UPC because of this design will be biased towards technology based values and uniformity at the expense of other values and interests e.g. non-economic public interests, and values associated with diversity. The practical effects of these biases are analysed regarding cases......The new common judiciary for European patents (UPC) will play a crucial role in the future European patent system. The UPC will be a very specialised court that i.a. recruits judges from specialists’ circles and has as part of its mission to develop a coherent and autonomous body of case law...

  1. Study on a Preliminary Survey and Analysis of HLW Management Technology Suitable for Nuclear Industrial Environment in Korea

    International Nuclear Information System (INIS)

    Kim, Eun Ka; Suh, In Suk; Ro, Seong Gy; Yoo, Kun Joong; Yoo, Jae Hyung; Cho, Sung Soo

    2010-12-01

    The purpose of this study is to suggest development direction of related technologies to analyze patented technology filed as a leading technology and to identify the technology trend for developing HLW management technology suitable for atomic industrial environment in Korea. For patent analysis of HLW management technology, international patent data were collected. And international application number, patent share of applicant and nationality, annual number of applications, application trends of assignees and detail technology, and frequency of patent citations / citations-to were analyzed by statistical analysis. Technical level and competitiveness through quantitative analysis by indicators of patent analysis were confirmed. And technology developments of blank technology, similarity analysis, the point of the main patent and a range of patent rights were analyzed through in-depth analysis. Trends of the patented technology of our country and world patent technology in such results have been identified, and statistical data on patents were secured. Especially in HLW management technology, patent application in Korea compared ti United States, Japan and European Union was began much later for the '90s, and are showing the annual increase on trend of patent application. Patent trend in Korea corresponds to development generation, while declining in foreign patent. The result of this study will be usefully applied to setting a development direction and blank technology of patent technology to pursue future in Korea

  2. Economic development evaluation based on science and patents

    Science.gov (United States)

    Jokanović, Bojana; Lalic, Bojan; Milovančević, Miloš; Simeunović, Nenad; Marković, Dusan

    2017-09-01

    Economic development could be achieved through many factors. Science and technology factors could influence economic development drastically. Therefore the main aim in this study was to apply computational intelligence methodology, artificial neural network approach, for economic development estimation based on different science and technology factors. Since economic analyzing could be very challenging task because of high nonlinearity, in this study was applied computational intelligence methodology, artificial neural network approach, to estimate the economic development based on different science and technology factors. As economic development measure, gross domestic product (GDP) was used. As the science and technology factors, patents in different field were used. It was found that the patents in electrical engineering field have the highest influence on the economic development or the GDP.

  3. Patent quality and incentives at the patent office

    NARCIS (Netherlands)

    Schuett, F.

    2013-01-01

    Patent examination is a problem of moral hazard followed by adverse selection: examiners must have incentives to exert effort, but also to truthfully reveal the evidence they find. I develop a theoretical model to study the design of incentives for examiners. The model can explain the puzzling

  4. 48 CFR 1427.201 - Patent and copyright infringement liability.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent and copyright... INTERIOR GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1427.201 Patent and copyright infringement liability. ...

  5. 48 CFR 27.201 - Patent and copyright infringement liability.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent and copyright... REGULATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 27.201 Patent and copyright infringement liability. ...

  6. Fundamentals of patenting and licensing for scientists and engineers

    National Research Council Canada - National Science Library

    Ma, M. Y. (Matthew Y.)

    2009-01-01

    ... ...28 3.2 Types of Patents...28 3.3 Patent Dates ...29 viiviii Fundamentals of Patenting and Licensing for Scientists and Engineers 3.4 Eligibility of Priority Date ...30 3.5 Patentability ...32...

  7. Effect of firm variables on patent price

    Directory of Open Access Journals (Sweden)

    Shyam Sreekumaran Nair

    2012-03-01

    Full Text Available In this study, using singleton patent auction price data from Ocean Tomo, LLC, we analyse the effect of firm variables on patent price. Patents owned by small firms attract higher price than patents owned by large firms, if they engage in multi-country filings. The patents owned by small firms get cited more than the patents owned by large firms. The patents owned by individual inventors attract a higher price than the patents owned by organisations when multi-country filings are not included. We believe that the lack of resources is preventing individual inventors from engaging in multi-country filings and maximising the revenue from their invention. A larger representative data should be used to replicate the results before generalising it.

  8. Can this kind of idea be a patent?

    International Nuclear Information System (INIS)

    Yu, Jae Bok

    2004-08-01

    This book mentions patent such as application, what is patents, patent law, procedure and patent attorney, which includes business idea is patent. Is internet domain name or name-brand? We can make a big money with others idea, the difference among patent, trademark, utility model rights and registration of design, priority system, new weapon in digital period, patent is a knife and a shield, the cost from application to registration, what is hunting of patent information, writing document for patent, patent examination and patent lawyer.

  9. Can this kind of idea be a patent?

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Jae Bok

    2004-08-15

    This book mentions patent such as application, what is patents, patent law, procedure and patent attorney, which includes business idea is patent. Is internet domain name or name-brand? We can make a big money with others idea, the difference among patent, trademark, utility model rights and registration of design, priority system, new weapon in digital period, patent is a knife and a shield, the cost from application to registration, what is hunting of patent information, writing document for patent, patent examination and patent lawyer.

  10. The Applicability of Patented Technologies to Sonobuoys

    Science.gov (United States)

    1988-06-30

    Ave, Boulder, CO 80301 2. Compagnie Generale de Geophysique 6 Rue Galvani Paris, France 3. EIC Laboratories, Incorporated Newton, MA 02146 4. Edo...Co. 2 Compagnie de Geophysique , France 3 Cooper, Charles E. 2 M Crown Controls Corporation 1 ,6 Cyr, Reginald J. 1 DeltaLab Research, Incorporated 1...Int’l App ....... 7,5 [73) Assignees: Institut Francais du Petrole. OTHER PUBLICATIONS -" Rueil-Malmaison; Compagnie Generale de Geophysique , Massy

  11. Increasing the Discovery and Use of Non-Patent Literature (NPL): Scientific Publications in Patent Examination

    OpenAIRE

    F. Loizides; B. Diallo; A. Pollard; A. Mavri

    2017-01-01

    In this work we present findings on non-patent literature use, and specifically scientific publications such as academic articles. We interview patent examiners and observe their prior art searching in order to provide insights into the perceived usage of non-patent literature and produce high level requirements for advancing non-patent literature search tools.

  12. 77 FR 4509 - Patent Public Advisory Committee Public Hearings on the Proposed Patent Fee Schedule

    Science.gov (United States)

    2012-01-30

    ... patent fees. The publication of that Notice will open a comment window through which the public may...-P-2012-0002] Patent Public Advisory Committee Public Hearings on the Proposed Patent Fee Schedule... Trademark Office (USPTO) may set or adjust by rule any patent or trademark fee established, authorized, or...

  13. Beyond Invention: Patent as Knowledge Law

    OpenAIRE

    Madison, Michael

    2017-01-01

    The decision of the Supreme Court of the United States in Bilski v. Kappos, concerning the legal standard for determining patentable subject matter under the American Patent Act, is used as a starting point for a brief review of historical, philosophical, and cultural influences on subject matter questions in both patent and copyright law. The article suggests that patent and copyright law jurisprudence was constructed initially by the Court with explicit attention to the relationship between...

  14. 14 CFR 1260.28 - Patent rights.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Patent rights. 1260.28 Section 1260.28... Provisions § 1260.28 Patent rights. Patent Rights May 2006 As stated at § 1260.136, this award is subject to... “Patent Rights (Small Business Firms and Nonprofit Organizations)” and the following: (a) Where the term...

  15. Two attempts at grounding social critique in „ordinary“ actors’ perspectives: The critical theories of Nancy Fraser and Axel Honneth

    Directory of Open Access Journals (Sweden)

    Ivković Marjan

    2014-01-01

    Full Text Available This paper analyzes two contemporary, „third-generation“ perspectives within critical theory - Nancy Fraser’s and Axel Honneth’s - with the aim of examining the degree to which the two authors succeed in grounding the normative criteria of social critique in the perspectives of ’ordinary’ social actors, as opposed to speculative social theory. To that end, the author focuses on the influential debate between Fraser and Honneth Redistribution or Recognition? which concerns the appropriate normative foundations of a „post-metaphysical“ critical theory, and attempts to reconstruct the fundamental 29 disagreements between Fraser and Honneth over the meaning and tasks of critical theory. The author concludes that both critical theorists ultimately secure the normative foundations of critique through substantive theorizations of the social, which frame the two authors’ „reconstructions“ of the normativity of everyday social action, but argues that post-metaphysical critical theory does not have to abandon comprehensive social theory in order to be epistmologically „non-authoritarian“. [Projekat Ministarstva nauke Republike Srbije, br. 43007: Ethics and Politics of Environment: Institutions, Techniques and Norms Facing the Challenge of Environmental Change

  16. Patentability aspects of computational cancer models

    Science.gov (United States)

    Lishchuk, Iryna

    2017-07-01

    Multiscale cancer models, implemented in silico, simulate tumor progression at various spatial and temporal scales. Having the innovative substance and possessing the potential of being applied as decision support tools in clinical practice, patenting and obtaining patent rights in cancer models seems prima facie possible. What legal hurdles the cancer models need to overcome for being patented we inquire from this paper.

  17. 43 CFR 402.10 - Patent.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Patent. 402.10 Section 402.10 Public Lands... LANDS IN FEDERAL RECLAMATION PROJECTS Public Lands § 402.10 Patent. When a purchaser has complied fully... and patent and shall state the statutory authority for such liens. The receipt shall be submitted to...

  18. 48 CFR 970.2703 - Patent rights.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent rights. 970.2703 Section 970.2703 Federal Acquisition Regulations System DEPARTMENT OF ENERGY AGENCY SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2703 Patent rights. ...

  19. 48 CFR 35.012 - Patent rights.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Patent rights. 35.012 Section 35.012 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SPECIAL CATEGORIES OF CONTRACTING RESEARCH AND DEVELOPMENT CONTRACTING 35.012 Patent rights. For a discussion of patent rights, see...

  20. Patent analysis to identify shale gas development in China and the United States

    International Nuclear Information System (INIS)

    Lee, Woo Jin; Sohn, So Young

    2014-01-01

    Shale gas has become an increasingly important form of hydrocarbon energy, and related technologies reflect the geographical characteristics of the countries where the gas is extracted and stored. The United States (U.S.) produces most of the world’s shale gas, while China has the world’s largest shale gas reserves. In this research, we focused on identifying the trends in shale-gas related technologies registered to the United States Patent and Trademark Office (USPTO) and to the State Intellectual Property Office of the People’s Republic of China (SIPO) respectively. To cluster shale-gas related technologies, we text-mined the abstracts of patent specifications. It was found that in the U.S., the key advanced technologies were related to hydraulic fracturing, horizontal drilling, and slick water areas, whereas China had a focus on proppants. The results of our study are expected to assist energy experts in designing energy policies related to technology importation. - Highlights: • We analyzed shale gas-related patent applications in the USPTO and SIPO. • We clustered shale gas patents by text mining patent abstract. • Differences were observed in shale gas technologies developed in the U.S. and China. • We proposed the policies of shale gas exploration and development based on patent analysis

  1. The Transaction Cost Benefits of Electronic Patent Licensing Platforms: A Discussion at the Example of the PatentBooks Model

    OpenAIRE

    Ghafele, Roya; Gibert, Benjamin

    2011-01-01

    Current mechanisms to compensate inventors and improve legal access to their inventions remain ineffective. Manufacturers encounter significant transaction costs in the process of licensing the multitude of patent rights implicated in their products. High-technology product manufacturing requires access to a diverse pool of technologies that are owned by different organizations all over the world. The transaction costs of licensing these disparate rights are inhibiting unlicensed manufacturer...

  2. 37 CFR 1.705 - Patent term adjustment determination.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patent term adjustment determination. 1.705 Section 1.705 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES Adjustment and Extension of Patent Term...

  3. CLASSICS UNITED STATES PATENT OFFICE

    Indian Academy of Sciences (India)

    IAS Admin

    From the profits, he became a very rich man and was able ... The Schedule referred to in these Letters Patent and making part of the same. TO ALL ... This is the real character and purpose of my invention; and in order to enable others ... kneading, it is rubbed through a hair, silk, or brass-wire sieve, (iron corrodes) and any.

  4. Patents - Overlooked Source of Information

    Czech Academy of Sciences Publication Activity Database

    Matějíček, Jiří; Ilavský, J.

    2004-01-01

    Roč. 13, č. 4 (2004), s. 473-476 ISSN 1059-9630 Institutional research plan: CEZ:AV0Z2043910 Keywords : patent * database * thermal spraying Subject RIV: JK - Corrosion ; Surface Treatment of Materials Impact factor: 1.068, year: 2004

  5. International patent analysis of water source heat pump based on orbit database

    Science.gov (United States)

    Li, Na

    2018-02-01

    Using orbit database, this paper analysed the international patents of water source heat pump (WSHP) industry with patent analysis methods such as analysis of publication tendency, geographical distribution, technology leaders and top assignees. It is found that the beginning of the 21st century is a period of rapid growth of the patent application of WSHP. Germany and the United States had done researches and development of WSHP in an early time, but now Japan and China have become important countries of patent applications. China has been developing faster and faster in recent years, but the patents are concentrated in universities and urgent to be transferred. Through an objective analysis, this paper aims to provide appropriate decision references for the development of domestic WSHP industry.

  6. Studies of world carbon fiber industry from a perspective of patent analysis

    Institute of Scientific and Technical Information of China (English)

    郑佳

    2016-01-01

    Patents are the manifestation of the industry R&D endeavor;therefore, World carbon fiber in-dustry from the perspective of patent analysis is studied .Findings from the analysis show a continual increase of carbon fibers patents since 1969 , and the growth rate began even faster after the year of 2005.Five countries (Japan, China, US, Germany and Korea) took dominant positions in global carbon fibers R&D , and the sum of patents applied in these five countries accounted for 80%of the total patents in the world .Corporations do play an active role in global carbon fibers R&D , and over 60%of patents were applied by corporations .Among them , the top 3 corporations were all from Ja-pan, which had much more patents than the other patent assignees .Furthermore, most corporations were not active in cooperation with others , except Toyota Motor Corp .Global carbon fibers R&D fo-cused on sheet manufacture cloth , core wire layer , heat connect provide and filter activated draw . And there is big difference between Japan and China in the R&D focus .China ’ s corporations have exhibited rapid growth in the number of patent applications in recent years , but there is still a large gap between China and foreign countries in view of global patent layout and influence .By providing the insight into the evolution of global carbon fibers industrial and technological development through the perspective of patent analysis , this study hopes to provide an objective statistic reference for fu-ture policy directions and academic researches .

  7. Implementation of Research and Development Based on Patent Natural Ingredients and Potential Utilization of Tradition Medicine

    Directory of Open Access Journals (Sweden)

    Tommy Hendrix

    2016-12-01

    Full Text Available The results of research and development based on natural ingredients for traditional medicines become an interesting topic to discuss at this point; it’s shown from increasing number in utilization. The use of traditional medicine especially on natural ingredients at this moment becomes effective solution to increase the level of market acceptance in herbal extracts, including an affordable purchase from potential utilization of natural resources which are owned. By using Matheo Patent XE Ver 10.2 as methodology of searching, we can know potentials useful through strategy, research and development, patent analysis and patent collaboration among users in utilization of Natural Ingredient for Traditional Medicine. From the data result shows majority in the field of chemistry for human necessity related to Health; Amusement; Medical or Veterinary Science; Hygiene sectors with total patent 108, family 65. The use of patent analysis is a way to find how the development of technology and products that have been produced and how commercial processes connecting with technology users, especially in traditional medicine. From the data that exist in particular of patents, it is critical to identify the number of patents that has been registered through the innovation process development including technology dissemination is used.

  8. The practical Einstein experiments, patents, inventions

    CERN Document Server

    Illy, József

    2012-01-01

    Albert Einstein may be best known as the wire-haired whacky physicist who gave us the theory of relativity, but that's just one facet of this genius' contribution to human knowledge and modern science. As Jozsef Illy expertly shows in this book, Einstein had an eminently practical side as well. As a youth, Einstein was an inveterate tinkerer in the electrical supply factory his father and uncle owned and operated. His first paid job was as a patent examiner. Later in life, Einstein contributed to many inventions, including refrigerators, microphones, and instruments for aviation. In published papers, Einstein often provided ways to test his theories and fundamental problems of the scientific community of his times. He delved deeply into a variety of technological innovations, most notably the gyrocompass, and consulted for industry in patent cases and on other legal matters. Einstein also provided explanations for common and mundane phenomena, such as the meandering of rivers. In these and other hands-on exam...

  9. Cross-Border Patent Disputes: Unified Patent Court or International Commercial Arbitration?

    OpenAIRE

    Alba Betancourt, Ana

    2016-01-01

    Currently, the enforcement of a patent that is registered in several countries involves the risk of getting different and conflicting decisions from the national courts. In 2013, 25 European countries entered in an agreement that aims to homogenise the patent system by creating the European patent with unitary effect and a Unified Patent Court (UPC). This article focuses on the UPC, which aims to have a single court proceeding for cross-border patent conflicts. Does the UPC system represent a...

  10. Technology and the diffusion of renewable energy

    International Nuclear Information System (INIS)

    Popp, David; Hascic, Ivan; Medhi, Neelakshi

    2011-01-01

    We consider investment in wind, solar photovoltaic, geothermal, and electricity from biomass and waste across 26 OECD countries from 1991 to 2004. Using the PATSTAT database, we obtain a comprehensive list of patents for each of these technologies throughout the world, which we use to assess the impact of technological change on investment in renewable energy capacity. We consider four alternative methods for counting patents, using two possible filters: weighting patents by patent family size and including only patent applications filed in multiple countries. For each patent count, we create knowledge stocks representing the global technological frontier. We find that technological advances do lead to greater investment, but the effect is small. Investments in other carbon-free energy sources, such as hydropower and nuclear power, serve as substitutes for renewable energy. Comparing the effectiveness of our four patent counts, we find that both using only patents filed in multiple countries and weighting by family size improve the fit of the model.

  11. An Overview on Indian Patents on Biotechnology.

    Science.gov (United States)

    Mallick, Anusaya; Chandra Santra, Subhas; Samal, Alok Chandra

    2015-01-01

    The application of biotechnology is a potential tool for mitigating the present and future fooding and clothing demands in developing countries like India. The commercialization of biotechnological products might benefiting the poor`s in developing countries are unlikely to be developed. Biotechnology has the potential to provide a wide range of products and the existing production skills in the industrial, pharmaceuticals and the agricultural sector. Ownership of the intellectual property rights is the key factors in determining the success of any technological invention, which was introduced in the market. It provides the means for technological progress to continue of the industry of the country. The new plans, animal varieties, new methods of treatments, new crops producing food articles as such are the inventions of biotechnology. Biotechnology is the result of the application of human intelligence and knowledge to the biological processes. Most of the tools of biotechnology have been developed, by companies, governments, research in- stitutes and universities in developed nations. These human intellectual efforts deserve protection. India is a developing country with advance biotechnology based segments of pharmaceutical and agricultural industries. The Trade Related Intellectual Property Rights (TRIPS) is not likely to have a significant impact on incentives for innovation creation in the biotechnology sectors. In the recent years, the world has seen the biotechnology sector as one of greatest investment area through the Patent Law and will giving huge profit in future. The Research and Development in the field of biotechnology should be encouraged for explor- ing new tools and improve the biological systems for interest of the common people. Priority should be given to generation, evaluation, protection and effective commercial utilization of tangible products of intellectual property in agriculture and pharmaceuticals. To support the future growth and

  12. Connecting NSF funding to patent innovation in nanotechnology (2001-2004)

    International Nuclear Information System (INIS)

    Huang Zan; Chen Hsinchun; Li Xin; Roco, Mihail C.

    2006-01-01

    Nanotechnology research has experienced growth rapid in knowledge and innovations; it also attracted significant public funding in recent years. Several countries have recognized nanotechnology as a critical research domain that promises to revolutionize a wide range of fields of applications. In this paper, we present an analysis of the funding for nanoscale science and engineering (NSE) at the National Science Foundation (NSF) and its implications on technological innovation (number of patents) in this field from 2001 to 2004. Using a combination of basic bibliometric analysis and content visualization tools, we identify growth trends, research topic distribution, and the evolution in NSF funding and commercial patenting activities recorded at the United States Patent Office (USPTO). The patent citations are used to compare the impact of the NSF-funded research on nanotechnology development with research supported by other sources in the United States and abroad. The analysis shows that the NSF-funded researchers and patents authored by them have significantly higher impact based on patent citation measures in the four-year period than other comparison groups. The NSF-authored patent impact is growing faster with the lifetime of a patent, indicating the long-term importance of fundamental research

  13. Entrepreneurial patent management in pharmaceutical startups.

    Science.gov (United States)

    Holgersson, Marcus; Phan, Tai; Hedner, Thomas

    2016-07-01

    Startups fill an increasingly important role as innovators in the pharmaceutical industry, and patenting is typically central to their success. This article aims to explore patent management in pharmaceutical startups. The results show that startups need to deal with several challenges related to patenting and an 'entrepreneurial' approach to patent management is called for. Resource constraints, venture capital provision, exits and other conditions and events must be readily considered in the patent management process to build a successful pharmaceutical venture, something that could benefit the pharmaceutical industry as a whole. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Patent data mining method and apparatus

    Science.gov (United States)

    Boyack, Kevin W.; Grafe, V. Gerald; Johnson, David K.; Wylie, Brian N.

    2002-01-01

    A method of data mining represents related patents in a multidimensional space. Distance between patents in the multidimensional space corresponds to the extent of relationship between the patents. The relationship between pairings of patents can be expressed based on weighted combinations of several predicates. The user can select portions of the space to perceive. The user also can interact with and control the communication of the space, focusing attention on aspects of the space of most interest. The multidimensional spatial representation allows more ready comprehension of the structure of the relationships among the patents.

  15. The Patentability of Stem Cells in Australia.

    Science.gov (United States)

    Petering, Jenny; Cowin, Prue

    2015-07-01

    The potential therapeutic applications of stem cells are unlimited. However, the ongoing political and social debate surrounding the intellectual property and patenting considerations of stem cell research has led to the implementation of strict legislative regulations. In Australia the patent landscape surrounding stem cells has evolved considerably over the past 20 years. The Australian Patents Act 1990 includes a specific exclusion to the patentability of human beings and of biological processes for their generation. However, this exclusion has received no judicial consideration to date, and so its scope and potential impact on stem cell patents is unclear. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  16. Technology forum Berlin '82. Technologieforum Berlin '82

    Energy Technology Data Exchange (ETDEWEB)

    1982-01-01

    36 articles are represented concerning mechanical engineering, materials, chemicals, communications and telecommunications technology, metal working, precision engineering and optics, microelectronics, plastics, information supplying, patent realization and technology transfer.

  17. Analysis of US patents on spacer grids

    International Nuclear Information System (INIS)

    Kim, Hyung Kyu; Song, Kee Nam; Yoon, Kyung Ho; Kang, Hong Seok; Kim, Hyung Kyu; Jeon, Tae Hyun; Oh, Dong Seok; In, Wang Ki; Bang, Jae Keun; Oh, Seung Eun; Seo, Jeong Min; Lee, Jin Seok; Park, Seong Keun

    1997-06-01

    The total of 137 US patents on spacer grids patented from 1968 through 1993 are analyzed and summarized. Database is constituted with designing the appropriate fields by which each patent can be identified. The fields consist of patent number, inventor, assignee, date of patent, title and major foci of the patent. The major foci are again classified by detailed subjects such as the fretting failure and fuel rod support-related, the strength-related, the fabrication-related as for mechanical subjects, while the cooling performance-related and the pressure drop-related as for thermal-hydraulic one. The 92% of the patents analyzed were issued form nuclear companies of USA, France and Germany. Among the patents dealing with mechanical subjects, the fretting failure and fuel rod support-related is more than the pressure drop-related among the patents of thermal-hydraulic subjects. The number of patents issued from Japan ranks just after Germany i.e., the 4th country. It is thought that much concern as well as investment should be increased in this field, the patent of nuclear components. (author). 2 tabs., 5 figs

  18. Analysis of US patents on spacer grids

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyung Kyu; Song, Kee Nam; Yoon, Kyung Ho; Kang, Hong Seok; Kim, Hyung Kyu; Jeon, Tae Hyun; Oh, Dong Seok; In, Wang Ki; Bang, Jae Keun [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of); Oh, Seung Eun; Seo, Jeong Min; Lee, Jin Seok; Park, Seong Keun [Korea Nuclear Fuel Company, Taejon (Korea, Republic of)

    1997-06-01

    The total of 137 US patents on spacer grids patented from 1968 through 1993 are analyzed and summarized. Database is constituted with designing the appropriate fields by which each patent can be identified. The fields consist of patent number, inventor, assignee, date of patent, title and major foci of the patent. The major foci are again classified by detailed subjects such as the fretting failure and fuel rod support-related, the strength-related, the fabrication-related as for mechanical subjects, while the cooling performance-related and the pressure drop-related as for thermal-hydraulic one. The 92% of the patents analyzed were issued form nuclear companies of USA, France and Germany. Among the patents dealing with mechanical subjects, the fretting failure and fuel rod support-related is more than the pressure drop-related among the patents of thermal-hydraulic subjects. The number of patents issued from Japan ranks just after Germany i.e., the 4th country. It is thought that much concern as well as investment should be increased in this field, the patent of nuclear components. (author). 2 tabs., 5 figs.

  19. A review of the health and economic implications of patent protection, with a specific focus on Thailand.

    Science.gov (United States)

    Yamabhai, Inthira; Smith, Richard D

    2012-08-01

    Although it has been two decades since the Thai Patent Act was amended to comply with the Agreement on Trade-Related Aspects of Intellectual Property Rights (TRIPS), there has been little emphasis given to assessing the implications of this amendment. The purpose of this review is to summarize the health and economic impact of patent protection, with a focus on the experience of Thailand. A review of national and international empirical evidence on the health and economic implications of patents from 1980 to 2009 was undertaken. The findings illustrate the role of patent protection in four areas: price, present access, future access, and international trade and investment. Forty-three empirical studies were found, three of which were from Thai databases. Patenting does increase price, although the size of effect differs according to the methodology and country. Although weakening patent rights could increase present access, evidence suggests that strengthening patenting may benefit future access; although this is based on complex assumptions and estimations. Moreover, while patent protection appears to have a positive impact on trade flow, the implication for foreign direct investment (FDI) is equivocal. Empirical studies in Thailand, and other similar countries, are rare, compromising the robustness and generalizability of conclusions. However, evidence does suggest that patenting presents a significant inter-temporal challenge in balancing aspects of current versus future access to technologies. This underlines the urgent need to prioritize health research resources to assess the wider implications of patent protection.

  20. Idea on patent ; It is high time to stress quality

    International Nuclear Information System (INIS)

    2012-03-01

    This book deals with patent stressing on the quality, which includes from idea to technical business, It's simple to register the computer program, why do patent lawyer appoint the patent attorney's office? construction of patent right range, a good patent and a bad patent, strong patent and weak patent. It doesn't allow for Dus to use as we like, each patent has different value, Let's write technical specifications, advice on talking for invention with a patent attorney's office and what kind of task do intellectual property division do?

  1. IMPROVEMENT OF LIFE SUPPORT SYSTEMS OF PASSENGER ROLLING STOCK: PATENT REVIEW

    Directory of Open Access Journals (Sweden)

    S. R. Kolesnykov

    2018-02-01

    Full Text Available Purpose. Inventors and researchers of the world are focused on improvements of basic life support systems including provision of quality microclimate parameters in a car of the rolling stock. The research is aimed at reviewing and analyzing patents in the field of climate comfort, heating, ventilation and air conditioning (CCHVAC of railway passenger cars (the chronological framework: 2011-2017 from the date of publication. Мethodology. During the study there were reviewed patents (foreign and domestic ones in the field of CCHVAC in passenger vehicles, in particular railway cars, their optimization and ways of managing them. Patent search was carried out according to certain search criteria: keywords, time frames and in various patent systems of the world. An interdisciplinary approach was used. Findings. Based on the search results, 157 patents were found, 21 documents of which were selected for analysis. Patents are systematized into three groups: "New technical and technological solutions in systems and functioning facilities of HVAC ", "New and improved solutions for HVAC system management in a vehicle", "Air ozonation in passenger cars". It is established that all patents have one of the aspects that have solutions to the issues of more environmentally friendly, energy efficient and safe application of CCHVAC systems in railway transport. Originality. It was proved a high level of link penetration in various technical fields, which include patents with CCHVAC. It is established that it is characteristic for them to designate the majority of patent solutions for use not in the purely railway industry, but in transport in general. Practical value. Confirmation of the high level of link penetration in various technical fields will make it possible to reflect technical problems with CCHVAC and technologies for their solution throughout the world. This will contribute to a more intensive technological upgrade in the improvement of life support

  2. The Neglected Patent Controversies in the Twenty First Century

    Directory of Open Access Journals (Sweden)

    Birgitte Andersen

    2003-01-01

    Full Text Available Na virada do século, assistimos a um reforço do sistema de patentes. No entanto, os gestores de políticas deixam sistematicamente de lado as controvérsias sobre patentes. Este artigo examina criticamente as complexas relações entre, por um lado, as razões para os direitos de patente e, por outro lado, seus efeitos sociais e econômicos. Só quando entendermos essa relação, seremos capazes de projetar regimes adequados de Direitos de Propriedade Intelectual (DPI para o novo paradigma tecnoeconômico de microeletrônica baseada em conhecimento e invenções de amplo alcance implementadas por computador. O foco se concentra nas razões morais, nas razões de incentivo econômico, e nas razões de aumento da concorrência e "proteção do talento empresarial no mercado", e nas razões econômicas para organizar ciência, tecnologia e criatividade. Afirma-se aqui que os sistemas de patentes não são neutros, eles estabelecem as regras do jogo em que indivíduos e organizações são os jogadores.At the turn of the century we have seen a tightening of the patent system. However, policy makers systematically neglect the patent controversies. This article critically reviews the complex relationships between the rationales for patent rights on the one hand, and the social and economic effects of such on the other hand. Only when we understand this relationship, will we be able to design appropriate Intellectual Property Right (IPR regimes for the new technoeconomic paradigm of knowledge-based micro-electronics and computer implemented pervasive inventions. Focus is on moral rationales, economic incentive rationales, increased competition and "market protection of entrepreneurial talent" rationales, and the economic rationales for organizing science, technology and creativity. It is argued that patent systems are not neutral, but set the rules of the game in which individuals and organizations are the players.

  3. Information Extraction From Chemical Patents

    Directory of Open Access Journals (Sweden)

    Sandra Bergmann

    2012-01-01

    Full Text Available The development of new chemicals or pharmaceuticals is preceded by an indepth analysis of published patents in this field. This information retrieval is a costly and time inefficient step when done by a human reader, yet it is mandatory for potential success of an investment. The goal of the research project UIMA-HPC is to automate and hence speed-up the process of knowledge mining about patents. Multi-threaded analysis engines, developed according to UIMA (Unstructured Information Management Architecture standards, process texts and images in thousands of documents in parallel. UNICORE (UNiform Interface to COmputing Resources workflow control structures make it possible to dynamically allocate resources for every given task to gain best cpu-time/realtime ratios in an HPC environment.

  4. Technological innovation in neurosurgery: a quantitative study.

    Science.gov (United States)

    Marcus, Hani J; Hughes-Hallett, Archie; Kwasnicki, Richard M; Darzi, Ara; Yang, Guang-Zhong; Nandi, Dipankar

    2015-07-01

    Technological innovation within health care may be defined as the introduction of a new technology that initiates a change in clinical practice. Neurosurgery is a particularly technology-intensive surgical discipline, and new technologies have preceded many of the major advances in operative neurosurgical techniques. The aim of the present study was to quantitatively evaluate technological innovation in neurosurgery using patents and peer-reviewed publications as metrics of technology development and clinical translation, respectively. The authors searched a patent database for articles published between 1960 and 2010 using the Boolean search term "neurosurgeon OR neurosurgical OR neurosurgery." The top 50 performing patent codes were then grouped into technology clusters. Patent and publication growth curves were then generated for these technology clusters. A top-performing technology cluster was then selected as an exemplar for a more detailed analysis of individual patents. In all, 11,672 patents and 208,203 publications related to neurosurgery were identified. The top-performing technology clusters during these 50 years were image-guidance devices, clinical neurophysiology devices, neuromodulation devices, operating microscopes, and endoscopes. In relation to image-guidance and neuromodulation devices, the authors found a highly correlated rapid rise in the numbers of patents and publications, which suggests that these are areas of technology expansion. An in-depth analysis of neuromodulation-device patents revealed that the majority of well-performing patents were related to deep brain stimulation. Patent and publication data may be used to quantitatively evaluate technological innovation in neurosurgery.

  5. Unveiling the geography of historical patents in the United States from 1836 to 1975

    Science.gov (United States)

    Petralia, Sergio; Balland, Pierre-Alexandre; Rigby, David L.

    2016-01-01

    It is clear that technology is a key driver of economic growth. Much less clear is where new technologies are produced and how the geography of U.S. invention has changed over the last two hundred years. Patent data report the geography, history, and technological characteristics of invention. However, those data have only recently become available in digital form and at the present time there exists no comprehensive dataset on the geography of knowledge production in the United States prior to 1975. The database presented in this paper unveils the geography of historical patents granted by the United States Patent and Trademark Office (USPTO) from 1836 to 1975. This historical dataset, HistPat, is constructed using digitalized records of original patent documents that are publicly available. We describe a methodological procedure that allows recovery of geographical information on patents from the digital records. HistPat can be used in different disciplines ranging from geography, economics, history, network science, and science and technology studies. Additionally, it is easily merged with post-1975 USPTO digital patent data to extend it until today. PMID:27576103

  6. Assessing the Inventiveness of Bio-Pharmaceuticals under European and US Patent Law

    DEFF Research Database (Denmark)

    Minssen, Timo

    , is utterly wrong, since any DNA and the information it contains is the embodiment of the code of life and should be regarded part of the common heritage of mankind. Some patent opponents go even further and argue for a prohibition of patents on proteins. Others, and in particular the life science industry...... specifically, it investigates how the European and US patent systems interpret and apply the so called "inventive step" (Europe) or "non-obviousness" requirement (U.S.) vis-à-vis bio-pharmaceutical technology with a special emphasis on DNA-and protein related inventions. In addition to evaluating the de lata...

  7. The process of filing patent applications in the view of ICT inventors

    Energy Technology Data Exchange (ETDEWEB)

    Gimenes, Celso Huerta; Politano, Rodolfo; Andrade, Delvonei Alves de, E-mail: cgimenes@Ipen.br, E-mail: politano@ipen.br, E-mail: delvonei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    This article analyzed the patent files of the National Commission of Nuclear Energy, CNEN, at the National Institute of Industrial Property - INPI (U.S. Intellectual Property Commission - CIPC). The following institutions were considered: the Institute for Energy and Nuclear Research - IPEN and the Nuclear Technology Development Center. The process of patent requests, under the view of ICT inventors, was verified. From these results, an increase in the register requests was found, with a stable number of inventors. Hence, it is worth highlighting the necessity to strengthen the dissemination of the legislation, as well as to show the advantages the Inventor would have by presenting a curriculum with many patents. (author)

  8. The process of filing patent applications in the view of ICT inventors

    International Nuclear Information System (INIS)

    Gimenes, Celso Huerta; Politano, Rodolfo; Andrade, Delvonei Alves de

    2013-01-01

    This article analyzed the patent files of the National Commission of Nuclear Energy, CNEN, at the National Institute of Industrial Property - INPI (U.S. Intellectual Property Commission - CIPC). The following institutions were considered: the Institute for Energy and Nuclear Research - IPEN and the Nuclear Technology Development Center. The process of patent requests, under the view of ICT inventors, was verified. From these results, an increase in the register requests was found, with a stable number of inventors. Hence, it is worth highlighting the necessity to strengthen the dissemination of the legislation, as well as to show the advantages the Inventor would have by presenting a curriculum with many patents. (author)

  9. Patent first, ask questions later: morality and biotechnology in patent law.

    Science.gov (United States)

    Bagley, Margo A

    2003-12-01

    This Article explores the U.S. "patent first, ask questions later" approach to determining what subject matter should receive patent protection. Under this approach, the U.S. Patent and Trademark Office (USPTO or the Agency) issues patents on "anything under the sun made by man," and to the extent a patent's subject matter is sufficiently controversial, Congress acts retrospectively in assessing whether patents should issue on such interventions. This practice has important ramifications for morally controversial biotechnology patents specifically, and for American society generally. For many years a judicially created "moral utility" doctrine served as a type of gatekeeper of patent subject matter eligibility. The doctrine allowed both the USTPO and courts to deny patents on morally controversial subject matter under the fiction that such inventions were not "useful." The gate, however, is currently untended. A combination of the demise of the moral utility doctrine, along with expansive judicial interpretations of the scope of patent-eligible subject matter, has resulted in virtually no basis on which the USTPO or courts can deny patent protection to morally controversial, but otherwise patentable, subject matter. This is so despite position statements by the Agency to the contrary. Biotechnology is an area in which many morally controversial inventions are generated. Congress has been in react-mode following the issuance of a stream of morally controversial biotech patents, including patents on transgenic animals, surgical methods, and methods of cloning humans. With no statutory limits on patent eligibility, and with myriad concerns complicating congressional action following a patent's issuance, it is not Congress, the representative of the people, determining patent eligibility. Instead, it is patent applicants, scientific inventors, who are deciding matters of high public policy through the contents of the applications they file with the USTPO. This Article

  10. Unveiling the geography of historical patents in the United States from 1836 to 1975

    NARCIS (Netherlands)

    Petralia, Sergio; Balland, Pierre-Alexandre; Rigby, David L

    2016-01-01

    It is clear that technology is a key driver of economic growth. Much less clear is where new technologies are produced and how the geography of U.S. invention has changed over the last two hundred years. Patent data report the geography, history, and technological characteristics of invention.

  11. Patents and innovation in cancer therapeutics: lessons from CellPro.

    Science.gov (United States)

    Bar-Shalom, Avital; Cook-Deegan, Robert

    2002-01-01

    This article discusses the interaction between intellectual property and cancer treatment. CellPro developed a stem cell separation technology based on research at the Fred Hutchinson Cancer Center. A patent with broad claims to bone marrow stem cell antibodies had been awarded to Johns Hopkins University and licensed to Baxter Healthcare under the 1980 Bayh-Dole Act to promote commercial use of inventions from federally funded research. CellPro got FDA approval more than two years before Baxter but lost patent infringement litigation. NIH elected not to compel Hopkins to license its patents to CellPro. CellPro went out of business, selling its technology to its competitor. Decisions at both firms and university licensing offices, and policies at the Patent and Trademark Office, NIH, and the courts influenced the outcome.

  12. Reviews on the Japanese Patent Applications Regarding Nickel/Metal Hydride Batteries

    Directory of Open Access Journals (Sweden)

    Taihei Ouchi

    2016-06-01

    Full Text Available The Japanese Patent Applications filed on the topic of nickel/metal hydride (Ni/MH batteries have been reviewed. Patent applications filed by the top nine battery manufacturers (Matsushita, Sanyo, Hitachi Maxell, Yuasa, Toshiba, FDK, Furukawa, Japan Storage, and Shin-kobe, five component suppliers (Tanaka, Mitsui, Santoku, Japan Metals & Chemicals Co. (JMC, and Shin-Etsu, and three research institutes (Industrial Research Institute (ISI, Agency of Industrial Science and Technology (AIST, and Toyota R & D were chosen as the main subjects for this review, based on their production volume and contribution to the field. By reviewing these patent applications, we can have a clear picture of the technology development in the Japanese battery industry. These patent applications also provide insights, know-how, and future directions for engineers and scientists working in the rechargeable battery field.

  13. Nano-enabled tribological thin film coatings: global patent scenario.

    Science.gov (United States)

    Sivudu, Kurva S; Mahajan, Yashwant R; Joshi, Shrikant V

    2014-01-01

    The aim of this paper is to present current status and future prospects of nano-enabled tribological thin film coatings based on worldwide patent landscape analysis. The study also presents an overview of technological trends by carrying out state-of-the-art literature analysis, including survey of corporate websites. Nanostructured tribological coatings encompass a wide spectrum of nanoscale microstructures, including nanocrystalline, nanolayered, nano-multilayered, nanocomposite, nanogradient structures or their unique combinations, which are composed of single or multi-component phases. The distinct microstructural features of the coatings impart outstanding tribological properties combined with multifunctional attributes to the coated components. Their unique combination of remarkable properties make them ideal candidates for a wide range of applications in diverse fields such as cutting and metalworking tools, biomedical devices, automotive engine components, wear parts, hard disc drives etc. The patent landscape analysis has revealed that nano-enabled tribological thin film coatings have significant potential for commercial applications in view of the lion's share of corporate industry in patenting activity. The largest patent portfolio is held by Japan followed by USA, Germany, Sweden and China. The prominent players involved in this field are Mitsubishi Materials Corp., Sandvik Aktiebolag, Hitachi Ltd., Sumitomo Electric Industries Ltd., OC Oerlikon Corp., and so on. The outstanding potential of nanostructured thin film tribological coatings is yet to be fully unravelled and, therefore, immense opportunities are available in future for microstructurally engineered novel coatings to enhance their performance and functionality by many folds.

  14. Natural compounds for solar photoprotection: a patent review.

    Science.gov (United States)

    Serafini, Mairim R; Guimarães, Adriana G; Quintans, Jullyana S S; Araújo, Adriano A S; Nunes, Paula S; Quintans-Júnior, Lucindo J

    2015-04-01

    Ultraviolet irradiation has deleterious effects on human skin, including tanning, sunburn, cancer and connective tissue degradation (photoaging). Botanical antioxidants have been shown to be associated with reduced incidence of photocarcinogenesis and photoaging through their photoprotective profile. Here, the authors summarized therapeutic patent applications concerning the employment of medicinal plants on the technological development of a formulation with photoprotective or photoaging application. So, the patent search was conducted in the databases WIPO, Espacenet, USPTO and Derwent, using the keywords - photoaging, photoprotection and the IPC A61K 8/97 (cosmetics or similar cleaning supplies obtained from vegetable origin, for example, plant extracts) and A61K 36/00 (medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, for example, traditional herbal medicines). We found 180 patents, out of which 25 were evaluated using inclusion criteria as application of natural products with photoprotective or photoaging application. We found that some patents related to the cosmetic compositions for improving skin wrinkle and either preventing or reducing the signs of photoaging and sunburn. The cosmetic compositions are manufactured in the form of a lotion, gel, soluble liquid, cream, essence, oil-in-water-type or water-in-oil-type formulation, containing the vegetal extracts as an active ingredient.

  15. Identifying Emerging Trends of Financial Business Method Patents

    Directory of Open Access Journals (Sweden)

    Won Sang Lee

    2017-09-01

    Full Text Available Financial technology has become an important part of the banking industry in recent times. This study attempts to propose a framework to identify emerging areas and trends using financial business method patents. Based on the abstracts of financial business method patents registered at the United States Patent and Trademark Office, this study first applies latent Dirichlet allocation to identify emerging topics. The probability of the annual occurrence of each topic is adjusted through the exponentially weighted moving average to reflect the importance of the recent probability of topics. Each topic is classified as “hot” or “cold” depending on whether the exponentially weighted moving average of the probabilities exceeds the threshold. We applied survival analysis to the time gap of recurrently becoming hot from a cold status with the associated factor of financial business method patents. The findings suggest that the topic with the short granted period and high forward citation is likely to become hot. In addition, the topic that is aged and specific in narrow areas is likely to continuously change into the hot or cold status. The approach proposed in this study contributes toward understanding topic emergence in the financial area and pursuing sustainable development.

  16. The Relationship Between Direct Government Support for R&D and Patents in Emerging Economies: A Turkish Case Study

    OpenAIRE

    Rustem Baris Yesilay; Ilker Murat Ar; Serdal Temel

    2015-01-01

    Emerging economies have been trying to improve economic growth with the help of different policies like R&D, technology development, technology transfer and patents. Despite the large amount of literature on the relationship between technology, direct government R&D support, R&D activities and patents, it has not been clearly defined in emerging economies. With this research based on 191 observations from companies in the Aegean Region of Turkey, we have found significant relationships betwee...

  17. Análisis Morfológico de Patentes para Desarrollar un Producto de Seguridad Vehicular

    Directory of Open Access Journals (Sweden)

    Sara Ortiz Cantú

    2013-04-01

    Full Text Available This paper provides the basis for technological intelligence for a vehicle safety project, specifically to avoid rear-end collisions between cars. The framework adopts the general model of innovation proposed by Myers and Marquis. A morphological analysis of patents based on keywords was done to find the settings already used (protected in the patents analyzed. By listing the occupied configurations of collected patents, the unoccupied territory of configurations are suggested as technology opportunities. This analysis provides: 1 the state of art and not to reinvent the wheel, 2 avoid infringement to industrial property, and 3 discover white spaces as technological opportunities.

  18. The NBER Patent Citation Data File: Lessons, Insights and Methodological Tools

    OpenAIRE

    Bronwyn H. Hall; Adam B. Jaffe; Manuel Trajtenberg

    2001-01-01

    This paper describes the database on U.S. patents that we have developed over the past decade, with the goal of making it widely accessible for research. We present main trends in U. S. patenting over the last 30 years, including a variety of original measures constructed with citation data, such as backward and forward citation lags, indices of 'originality' and 'generality', self-citations, etc. Many of these measures exhibit interesting differences across the six main technological categor...

  19. Innovación Tecnológica en Empresas Chilenas: Un Estudio Empírico Basado en Patentes

    Directory of Open Access Journals (Sweden)

    Rodrigo Fuentes Solís

    2016-12-01

    Full Text Available Technological Innovation in Chilean Firms: An Empirical Study Based on Patents Literature has focused on studying patents in particular industries, subsectors or firms, mainly in developed countries. The level or quantity of patents in Chile during the period 2007-2012 on average reached 12 triadic families, while in countries like Argentina and Mexico presented averages of 12 and 15 respectively. The overall average for the same period amounted to 48,242 OECD triadic patent families. This shows the interest of the scientific community to study the phenomenon of patent creation, and, on the other hand, the large technological gap between developed and developing countries. We propose to study the determinants of patenting in Chilean firms, as a case of a developing country. We use a probit model where the dependent variable takes value one if the firm has or is in the process of obtaining an invention patent (technological and zero if not. Our database has 4,338 Chilean firms, is cross-sectional and corresponds to an extract of the Eighth Survey of Innovation in Firms 2011-2012. The results show that the age of the firm, the base of existing knowledge, and the use of governmental instruments to support R&D have a positive effect on creation of patents.

  20. US patent interferences vs. international first-to-file patent systems, and current GATT problems

    International Nuclear Information System (INIS)

    Parkhurst, R.W.; Serbinowski, P.A.

    1991-01-01

    Simultaneous superconductivity research activities by different entities have resulted in numerous US patent applications, some of which may claim identical inventions and thus likely will be involved in interference proceedings in the US Patent and Trademark Office to determine which inventors are entitled to priority of invention and the resulting US patent. The determination in an interference proceeding of what inventors were the first-to-invent a patentable invention is contrasted with the patent systems in the rest of the world where the first inventor to file his patent application automatically gains priority. This issue and other aspects of US patent law are the subjects of criticism of US patent law and practice in the current Uruguay round of talks on the General Agreement on Trade and Tariffs (GATT). Interesting aspects of each of these subjects will be discussed

  1. Marketing of Patents for Innovation: A Study in Brazilian Multicase Universities

    Directory of Open Access Journals (Sweden)

    Felipe de Almeida Malvezzi

    2014-11-01

    Full Text Available Ways to make patents Brazilian universities in innovation has been discussed both by academia and by the funding agencies in order to generate, in addition to knowledge, social and economic benefits to the university and to society in general. In this sense, this research aimed to understand the strategies and marketing practices developed by Brazilian universities for the promotion and commercialization of patent records, aiming at innovation. The assumption for this research is that the use of marketing strategies is a necessary and fundamental for the successful transfer of patents when it sees technological innovation. The research is exploratory qualitative approach based on references, interviews and multi case study. After gathering and analyzing data involving UNICAMP, USP and UFMG in promoting and marketing your patents, it was observed that the main marketing practices identified were: inventory and classification of patents, agents of innovation, integrated marketing communication, technological showcase, executive summary of patents, event promotion and institutional visits. We also conclude, in the context of marketing innovation management at the university, the biggest challenge is to work radical and incremental innovation differently and simultaneously, since both are necessary for scientific and technological development in the short and long term. 

  2. [Development strategy of Paris based on combination of domestic patent and current resource application and development].

    Science.gov (United States)

    Zhao, Fei-Ya; Tao, Ai-En; Xia, Cong-Long

    2018-01-01

    Paris is a commonly used traditional Chinese medicine (TCM), and has antitumor, antibacterial, sedative, analgesic and hemostatic effects. It has been used as an ingredient of 81 Chinese patent medicines, with a wide application and large market demand. Based on the data retrieved from state Intellectual Property Office patent database, a comprehensive analysis was made on Paris patents, so as to explore the current features of Paris patents in the aspects of domestic patent output, development trend, technology field distribution, time dimension, technology growth rate and patent applicant, and reveal the development trend of China's Paris industry. In addition, based on the current Paris resource application and development, a sustainable, multi-channel and multi-level industrial development approach was built. According to the results, studies of Paris in China are at the rapid development period, with a good development trend. However, because wild Paris resources tend to be exhausted, the studies for artificial cultivation technology should be strengthened to promote the industrial development. Copyright© by the Chinese Pharmaceutical Association.

  3. 37 CFR 1.81 - Drawings required in patent application.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Drawings required in patent..., DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions The Drawings § 1.81 Drawings required in patent application. (a) The applicant for a patent is required to furnish...

  4. 37 CFR 1.41 - Applicant for patent.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Applicant for patent. 1.41 Section 1.41 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Who May Apply for A...

  5. 37 CFR 1.14 - Patent applications preserved in confidence.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patent applications preserved in confidence. 1.14 Section 1.14 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES General Provisions...

  6. 37 CFR 1.314 - Issuance of patent.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Issuance of patent. 1.314 Section 1.314 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Allowance and Issue of...

  7. 37 CFR 11.9 - Limited recognition in patent matters.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Limited recognition in patent matters. 11.9 Section 11.9 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE REPRESENTATION OF OTHERS BEFORE THE UNITED STATES PATENT AND TRADEMARK OFFICE...

  8. 37 CFR 1.215 - Patent application publication.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Patent application publication. 1.215 Section 1.215 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Publication...

  9. 37 CFR 1.315 - Delivery of patent.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Delivery of patent. 1.315 Section 1.315 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Allowance and Issue of...

  10. Patents - Superconductor materials, processes and devices

    International Nuclear Information System (INIS)

    Test, A.

    1987-01-01

    A patent is a grant by a country to an inventor or his assignee of the right to exclude others for a limited period of time from making, using or selling the patented invention within its territory. It is reported that basic patents have been filed by IBM and the University of Houston to protect a broad range of warm superconducting materials or compounds. It is believed that other researchers are seeking patents to protect related or improved materials, processes and apparatus. Because of the importance of this field and to speed up the patent process, the United States Patent Office is giving, upon request, special expedited status to these patent applications. A survey of Japanese companies shows that more than 1500 patents have been applied for in Japan relating to superconducting materials, compositions, apparatus using superconductors and improvements. It appears that the goal of the Japanese companies is to obtain a patent position in Japan so that they can trade with companies wishing to do business in Japan for rights in other parts of the world

  11. The History of Patenting Genetic Material.

    Science.gov (United States)

    Sherkow, Jacob S; Greely, Henry T

    2015-01-01

    The US Supreme Court's recent decision in Association for Molecular Pathology v. Myriad Genetics, Inc. declared, for the first time, that isolated human genes cannot be patented. Many have wondered how genes were ever the subjects of patents. The answer lies in a nuanced understanding of both legal and scientific history. Since the early twentieth century, "products of nature" were not eligible to be patented unless they were "isolated and purified" from their surrounding environment. As molecular biology advanced, and the capability to isolate genes both physically and by sequence came to fruition, researchers (and patent offices) began to apply patent-law logic to genes themselves. These patents, along with other biological patents, generated substantial social and political criticism. Myriad Genetics, a company with patents on BRCA1 and BRCA2, two genes critical to assessing early-onset breast and ovarian cancer risk, and with a particularly controversial business approach, became the antagonist in an ultimately successful campaign to overturn gene patents in court. Despite Myriad's defeat, some questions concerning the rights to monopolize genetic information remain. The history leading to that defeat may be relevant to these future issues.

  12. Patents and Innovation: Friends or Foes?

    OpenAIRE

    Lévêque, François

    2007-01-01

    Over 2 million patents are currently in force in the EU and in the USA. Do they testify innovation is blockaded for they restrict freedom in research or do they give evidence innovation is flourishing for patent law provides incentives to invent new products and processes? In other terms do patents freeze or spur innovation? The question arises for massive anecdotal evidence shows the patent system may have turned on its head, e.g., USPTO and EPO examiners spend less than 30 hours pe...

  13. Gauging a Firm's Innovative Performance Using an Integrated Structural Index for Patents

    Directory of Open Access Journals (Sweden)

    Xiaojun Hu

    2016-03-01

    Full Text Available Purpose: In this contribution we try to find new indicators to measure characteristics of a firm's patents and their influence on a company's profits. Design/methodology/approach: We realize that patent evaluation and influence on a company's profits is a complicated issue requiring different perspectives. For this reason we design two types of structural h-indices, derived from the International Patent Classification (IPC. In a case study we apply not only basic statistics but also a nested case-control methodology. Findings: The resulting indicator values based on a large dataset (19,080 patents in total from the pharmaceutical industry show that the new structural indices are significantly correlated with a firm's profits. Research limitations: The new structural index and the synthetic structural index have just been applied in one case study in the pharmaceutical industry. Practical implications: Our study suggests useful implications for patentometric studies and leads to suggestions for different sized firms to include a healthy research and development (R&D policy management. The structural h-index can be used to gauge the profits resulting from the innovative performance of a firm's patent portfolio. Originality/value: Traditionally, the breadth and depth of patents of a firm and their citations are considered separately. This approach, however, does not provide an integrated insight in the major characteristics of a firm's patents. The Sh(Y index, proposed in our investigation, can reflect a firm's innovation activities, its technological breadth, and its influence in an integrated way.

  14. Law machines: scale models, forensic materiality and the making of modern patent law.

    Science.gov (United States)

    Pottage, Alain

    2011-10-01

    Early US patent law was machine made. Before the Patent Office took on the function of examining patent applications in 1836, questions of novelty and priority were determined in court, within the forum of the infringement action. And at all levels of litigation, from the circuit courts up to the Supreme Court, working models were the media through which doctrine, evidence and argument were made legible, communicated and interpreted. A model could be set on a table, pointed at, picked up, rotated or upended so as to display a point of interest to a particular audience within the courtroom, and, crucially, set in motion to reveal the 'mode of operation' of a machine. The immediate object of demonstration was to distinguish the intangible invention from its tangible embodiment, but models also'machined' patent law itself. Demonstrations of patent claims with models articulated and resolved a set of conceptual tensions that still make the definition and apprehension of the invention difficult, even today, but they resolved these tensions in the register of materiality, performativity and visibility, rather than the register of conceptuality. The story of models tells us something about how inventions emerge and subsist within the context of patent litigation and patent doctrine, and it offers a starting point for renewed reflection on the question of how technology becomes property.

  15. Recent Advances in Vaccines Against Leishmania Based on Patent Applications.

    Science.gov (United States)

    Thomaz-Soccol, Vanete; Ferreira da Costa, Eduardo Scopel; Karp, Susan Grace; Junior Letti, Luiz Alberto; Soccol, Flavia Thomaz; Soccol, Carlos Ricardo

    2018-01-01

    Leishmaniasis is caused by parasites of the genus Leishmania, and represents a group of chronic diseases with an epidemiological and clinical diversity. The disease is endemic in tropical regions, being found in 98 countries, affecting around 12 million people, with an estimated increase of 1.5 million per year. The present review aims to analyze recent and most important patents regarding development of vaccines to improve immunization against leishmaniasis. For this purpose, the Web of Science - Derwent Innovations Index was consulted. There is also a short description of the licensed vaccines already on the market for commercialization, and a critical opinion on future developments. The data herein presented comprises national and international filings, thus considering the patent's country of origin, and can be used an indicator of a country's technological development regarding a specific field. Several types of vaccines against Leishmania were studied. The main classes comprise: vaccines using live cells (virulent or attenuated); dead cells; containing recombinant protein; using DNA of the parasite. United States (74 patents) leads the ranking of patent applications for vaccines against Leishmania, followed by Brazil (36 patents), which is an endemic region of leishmaniasis with 20,000 human cases of cutaneous leishmaniasis and over 3,000 cases of visceral form. This review showed that there is still a lot of space for development regarding the creation of a feasible, effective vaccine against leishmaniasis. The scientific community appears to be taking steps in the right direction, though. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  16. Interactive overlay maps for US Patent (USPTO) data based on International Patent Classifications (IPC)

    NARCIS (Netherlands)

    Leydesdorff, L.; Kushnir, D.; Rafols, I.

    2014-01-01

    We report on the development of an interface to the US Patent and Trademark Office (USPTO) that allows for the mapping of patent portfolios as overlays to basemaps constructed from citation relations among all patents contained in this database during the period 1976-2011. Both the interface and the

  17. Using Patent Classification to Discover Chemical Information in a Free Patent Database: Challenges and Opportunities

    Science.gov (United States)

    Ha¨rtinger, Stefan; Clarke, Nigel

    2016-01-01

    Developing skills for searching the patent literature is an essential element of chemical information literacy programs at the university level. The present article creates awareness of patents as a rich source of chemical information. Patent classification is introduced as a key-component in comprehensive search strategies. The free Espacenet…

  18. 78 FR 51177 - Notice of Intent To Grant Partially Exclusive Patent License; ICAP Patent Brokerage, LLC

    Science.gov (United States)

    2013-08-20

    ... DEPARTMENT OF DEFENSE Department of the Navy Notice of Intent To Grant Partially Exclusive Patent License; ICAP Patent Brokerage, LLC AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant to ICAP Patent Brokerage, LLC, a revocable...

  19. 78 FR 72872 - Notice of Intent To Grant Partially Exclusive Patent License; ICAP Patent Brokerage, LLC

    Science.gov (United States)

    2013-12-04

    ... DEPARTMENT OF DEFENSE Department of the Navy Notice of Intent To Grant Partially Exclusive Patent License; ICAP Patent Brokerage, LLC AGENCY: Department of the Navy, DoD. ACTION: Notice. SUMMARY: The Department of the Navy hereby gives notice of its intent to grant to ICAP Patent Brokerage, LLC, a revocable...

  20. Axel Olrik’in Epik Yasaları Işığında Oğuz Kağan Destanı’na Bir Bakış A Glance At Oghuz Khagan Saga In The Light Of Axel Olrik’s Epic Laws

    Directory of Open Access Journals (Sweden)

    Ferhat ÇİFTÇİ

    2013-07-01

    Full Text Available Human beings’ relation with time and space has very ancientoffsets. It would be reasonable to seek the first data of these offsets innationalization processes as human beings realized their existencethrough social consensus. This social consensus has certainphenomena which mainly appear in cultural forms. The first data andassigning meanings during nations’ presenting their social existence aremainly found in epics. Therefore, it would be reasonable to focus onepics with a view that they are the codes of nations’ social memories. Itis a known fact that, beginning from their first ancestors, human beingshave always acted in accordance with some main purposes and themes.Therefore the importance of epics is paramount in terms of thearchetypes they accommodate. It is known that these archetypes notonly provide a means to read the past, but also shed light on ourpresent. This provides a remarkable opportunity to reach the roots ofthe cultural phenomena of nations and societies. When we look at theTurkish epics, we are welcomed by Oghuz Khagan Saga, which can becounted as an important leap forward in terms of Turks’ nationalizationprocess. There are different methods to understand and explain orassign meanings to epics. One of these methods is Axel Olrik’s “EpicLaws Theory”, one of the methods of Historical-Geographical FinnishSchool. This theory aims at approaching mythological works with auniversal standardization and evaluating these mythological workswithin the frame of certain principles. The aim of the present article isto read Oghuz Khagan Saga, fraught with symbols in terms of Turkishhistory’s mythical offsets, in the light of Axel Olrik’s epic laws and todiscuss the data obtained thereof in the context of the epic and itsnature. İnsanoğlunun zaman ve mekânla olan ilişkisi oldukça kadim uzantılara sahiptir. Bu uzantıların ilk verilerini milletleşme süreçlerinde aramak gerekir. Çünkü insanoğlu, yery

  1. Investigation of Strategic Changes Using Patent Co-Inventor Network Analysis: The Case of Samsung Electronics

    Directory of Open Access Journals (Sweden)

    Sungchul Choi

    2016-12-01

    Full Text Available The aim of this paper is to propose a method to investigate a firm’s strategic changes. Technologies or technological capabilities are a major resource for achieving competitive advantages, so a firm’s R&D effort to improve capabilities on specific technologies is aligned with strategic direction. Therefore, this research analyzes changes in R&D efforts by identifying key R&D personnel using patent co-inventor network and social network analysis. Based on characteristics of application and granted patents, the method analyzes current and future R&D efforts and so identifies strategic changes of a firm. We conducted an empirical analysis using the patents of Samsung Electronics. Our method analyzed the current and future strategies of Samsung Electronics and the result shows clear strategic changes in their focal technologies and business.

  2. What is your reasonable expectation of success in obtaining pharmaceutical or biotechnology patents having nonobvious claimed inventions that the courts will uphold? An overview of obviousness court decisions.

    Science.gov (United States)

    Pereira, Daniel J; Kunin, Stephen G

    2014-12-04

    This article explores the legal basis for establishing the nonobviousness of patent claims in the life sciences fields of technology drawn from the guidance provided in published decisions of the U.S. Patent and Trademark Office's Patent Trial and Appeal Board, federal district courts, the Federal Circuit Court of Appeals, and the U.S. Supreme Court. Our analysis, although equally applicable to all disciplines and technologies, focuses primarily on decisions of greatest import affecting patents in the fields of pharmaceutical chemistry and biotechnology. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  3. Grant Patents on Animals? An Ethical and Legal Battle Looms.

    Science.gov (United States)

    Wheeler, David L.

    1987-01-01

    Rulings on applications for animal patents being considered by the U.S. Patent and Trademark Office could profoundly influence university patent and research income. Many animal-rights advocates have expressed philosophical objections to genetic engineering of animals. (MLW)

  4. NREL Patents Method for Continuous Monitoring of Materials During

    Science.gov (United States)

    Manufacturing | News | NREL NREL Patents Method for Continuous Monitoring of Materials During Manufacturing News Release: NREL Patents Method for Continuous Monitoring of Materials During Manufacturing NREL's Energy Systems Integration Facility (ESIF). More information, including the published patent, can

  5. High resolution carbon isotope stratigraphy and glendonite occurrences of the Christopher Formation, Sverdrup Basin (Axel Heiberg Island, Canada): implications for mid Cretaceous high latitude climate change

    Science.gov (United States)

    Herrle, Jens O.; Schröder-Adams, Claudia J.; Galloway, Jennifer M.; Pugh, Adam T.

    2013-04-01

    Understanding the evolution of Canada's Arctic region, as a crucial component of Earth's climate system, is fundamental to assess short and long-term climate, environmental, and paleogeographic change. However, the stratigraphy and paleoenvironmental evolution of the Cretaceous Arctic is poorly constrained and a detailed bio- and chemostratigraphic correlation of major mid-Cretaceous paleoceanographic turning points such as Oceanic Anoxic Events, cold snaps, and biotic turnovers with key locations of the high- and low latitudes is missing. Here we present for the first time a high resolution bio- and carbon isotope stratigraphy of the Arctic Albian Christopher Formation of the Sverdrup Basin at Glacier Fiord in the southern part of Axel Heiberg Island, Canadian High Arctic. By using these techniques we developed a high temporal framework to record major environmental changes as it is indicated by the occurrence of glendonites and sandstone intervals of our studied Albian succession. The Albian Christopher Formation is a shale dominated marine unit with a thickness of approximately 1200 m. Several transgressive/ regressive cycles can be recognized by prograding shoreface units that break up mudrock deposition. In addition, glendonites are mainly found in the lower part of the Christopher Formation. Glendonites are pseudomorphs of calcite, after the metastable mineral ikaite, and have been often described from high latitude Permian, Jurassic and Cretaceous marine environments from the Canadian Arctic, Spitsbergen and Australia. The formation of glendonites takes place in the uppermost layer of the sediment and requires near-freezing temperatures, high salinity, and orthophosphate-rich bottom water. Although the presence of glendonites implies a range of paleoenvironmental conditions there is a consensus in the scientific literature that they reflect cooler paleoenvironmental conditions. Preliminary bio- and carbon isotope stratigraphic results suggest that the

  6. Technology Road Mapping for Innovation Pathways of Fibrates: A ...

    African Journals Online (AJOL)

    Purpose: To examine international technology development of fibrates based on a cross-database quantitative patent review and to describe the evolution pathway for fibrates by means of a technology roadmap. Methods: The patent data were collected in March 2013 from United States Patent and Trademark Office ...

  7. The Patent and the Paper: a Few Thoughts on Late Modern Science and Intellectual Property

    Directory of Open Access Journals (Sweden)

    Eva Hemmungs Wirtén

    2015-01-01

    Full Text Available Marie and Pierre Curie's decision not to patent the discovery (1898 and later isolation (1902 of radium is perhaps the most famous of all disinterested decisions in the history of science. To choose publishing instead of patenting and openness instead of enclosure was hardly a radical choice at the time. Traditionally, we associate academic publishing with 'pure science' and Mertonian ideals of openness, sharing and transparency. Patenting on the other hand, as a byproduct of 'applied science' is intimately linked to an increased emphasis and dependency on commercialization and technology transfer within academia. Starting from the Curies' mythological decision I delineate the contours of an increasing convergence of the patent and the paper (article from the end of the nineteenth-century until today. Ultimately, my goal is to suggest a few possible ways of addressing the hybrid space that today constitute the terrain of late modern science and intellectual property.

  8. Using publicly available internet tools to teach patent research and development

    DEFF Research Database (Denmark)

    Jensen, Søren; Tanev, Stoyan

    2013-01-01

    The management of Intellectual property rights is becoming increasingly important in the 21st century knowledge society. Patents are especially important for engineering design and R&D teams. However, there is a lack of educational resources in this area. There is an increasing need to enhance...... efficiency is especially important within the context of the economic challenges which are drastically limiting the financial resources of all universities. In a previous contribution presented at the ICEIRD 2012 conference we have discussed our finding that technology entrepreneurs in general are interested...... in more education on the patent system [1]. In this paper we will examine the current literature addressing the subject of teaching patent development to engineering students and entrepreneurs. The review will primarily focus on literature that supports the teaching of patents to engineering students...

  9. Evolution of Industry Knowledge in the Public Domain: Prior Art Searching for Software Patents

    Directory of Open Access Journals (Sweden)

    Jinseok Park

    2005-03-01

    Full Text Available Searching prior art is a key part of the patent application and examination processes. A comprehensive prior art search gives the inventor ideas as to how he can improve or circumvent existing technology by providing up to date knowledge on the state of the art. It also enables the patent applicant to minimise the likelihood of an objection from the patent office. This article explores the characteristics of prior art associated with software patents, dealing with difficulties in searching prior art due to the lack of resources, and considers public contribution to the formation of prior art databases. It addresses the evolution of electronic prior art in line with technological development, and discusses laws and practices in the EPO, USPTO, and the JPO in relation to the validity of prior art resources on the Internet. This article also investigates the main features of searching sources and tools in the three patent offices as well as non-patent literature databases. Based on the analysis of various searching databases, it provides some strategies of efficient prior art searching that should be considered for software-related inventions.

  10. Patents on periphery of the Amazon rainforest.

    Science.gov (United States)

    de Moura, Emanoel G; Araújo, José R G; Monroe, Paulo H M; de O Nascimento, Ivaneide; Aguiar, Alana C F

    2009-06-01

    In the humid tropics, on the edges of the Amazon forest, the technological challenges to establishing and maintaining productive and sustainable agricultural systems have yet to be overcome. The groups involved in agriculture in the north of Brazil still engage in the practice of slash and burn in order to prepare and fertilize the soil. This produces negative effects for the local and global environment, without the counter-effect of providing social benefits to rural communities. Whether this process continues is of fundamental importance to many countries because it means that slash and burn agriculture is advancing on the Amazon rainforest, with a negative effect on every dimension of national policy. Beyond social political problems the biggest challenge for researchers in the field of tropical agriculture is to offer technological alternatives that can sustain agriculture in soils derived from sedimentary rocks that have been subjected to a high degree of weathering. In this article patented information is also discussed. Experiments undertaken in this region recommend taking advantage of the rapid growth of plants in the tropics. We aimed at proposing a suitable alternative system for a sustainable soil management in the particular conditions of humid tropics, named as "no-till in alley cropping using tree leguminous mulch." This system offers the advantages of: bringing together, in the same space and at the same time, the processes of cultivation and the regeneration of soil fertility.

  11. Recent patents on the extraction of carotenoids.

    Science.gov (United States)

    Riggi, Ezio

    2010-01-01

    This article reviews the patents that have been presented during the last decade related to the extraction of carotenoids from various forms of organic matter (fruit, vegetables, animals), with an emphasis on the methods and mechanisms exploited by these technologies, and on technical solutions for the practical problems related to these technologies. I present and classify 29 methods related to the extraction processes (physical, mechanical, chemical, and enzymatic). The large number of processes for extraction by means of supercritical fluids and the growing number of large-scale industrial plants suggest a positive trend towards using this technique that is currently slowed by its cost. This trend should be reinforced by growing restrictions imposed on the use of most organic solvents for extraction of food products and by increasingly strict waste management regulations that are indirectly promoting the use of extraction processes that leave the residual (post-extraction) matrix substantially free from solvents and compounds that must subsequently be removed or treated. None of the reviewed approaches is the best answer for every extractable compound and source, so each should be considered as one of several alternatives, including the use of a combination of extraction approaches.

  12. The Unified Patent Court (UPC) in Action

    DEFF Research Database (Denmark)

    Petersen, Clement Salung; Schovsbo, Jens Hemmingsen; Riis, Thomas

    2015-01-01

    The new common judiciary for European patents (UPC) will play a crucial role in the future European patent system. The UPC will be a very specialised court that i.a. recruits judges from specialists’ circles and has as part of its mission to develop a coherent and autonomous body of case law...

  13. Patentability of methods of human enhancement

    DEFF Research Database (Denmark)

    Nordberg, Ana

    2015-01-01

    This article explores how to apply patentability rules to human enhancement, particularly focusing on Article 53(c) of the European Patent Convention (EPC). The global size and value of the cosmetic and wellness market and industry allow for the prediction of considerable market potential for hum...... future evolution and the corresponding public policy choices. This article seeks to provide prospective patentees with guidance and awareness concerning the patentability of methods for human enhancement.......This article explores how to apply patentability rules to human enhancement, particularly focusing on Article 53(c) of the European Patent Convention (EPC). The global size and value of the cosmetic and wellness market and industry allow for the prediction of considerable market potential for human...... enhancement. Patents will be instrumental for companies to protect investment in innovation and tap into this potentially valuable market. The European patent system contains, in Article 53(c) EPC, an exception from patentability for methods for treatment and diagnostic methods. Such rule was created...

  14. Disclosure rules and declared essential patents

    NARCIS (Netherlands)

    Bekkers, R.N.A.; Catalini, C.; Martinelli, Arianna; Righi, C.; Simcoe, T.

    Many standard setting organizations (SSOs) require participants to disclose patents that might be infringed by implementing a proposed standard, and commit to license their “essential” patents on terms that are at least fair, reasonable and non-discriminatory (FRAND). Data from these SSO

  15. Patent protection and licensing in microfluidics.

    Science.gov (United States)

    Yetisen, Ali K; Volpatti, Lisa R

    2014-07-07

    Microfluidic devices offer control over low-volume samples in order to achieve high-throughput analysis, and reduce turnaround time and costs. Their efficient commercialisation has implications for biomedical sciences, veterinary medicine, environmental monitoring and industrial applications. In particular, market diffusion of microfluidic laboratory and point-of-care diagnostic devices can contribute to the improvement of global health. In their commercialisation, consultancy and patent protection are essential elements that complement academic publishing. The awareness of knowledge transfer strategies can help academics to create value for their research. The aim of this article is to provide a guidance to (1) overview the terminology in patent law, (2) elucidate the process of filing a patent in the US, EU, Japan and internationally, (3) discuss strategies to licence a patent, and (4) explain tactics to defend a patent in a potential infringement. Awareness of the patent law and rights allows obtaining optimised, valid and valuable patents, while accelerating implementation to market route. Striking a balance between academic publishing, consultancy to industry and patent protection can increase commercial potential, enhance economic growth and create social impact.

  16. DOE patents available for licensing: a bibliography

    International Nuclear Information System (INIS)

    Thoeming, G.H.

    1982-06-01

    Abstracts and indexes are provided for 1344 DOE patents or patent applications concerning any aspect of energy production, conservation, and utilization. The entries are arranged by subject category as shown in the table of contents. The bibliography covers the period from January 1974 through December 1980

  17. Grado del sistema tecnológico de los inventores peruanos: producción de patentes (2003/2013

    Directory of Open Access Journals (Sweden)

    Adilson Luiz Pinto

    2018-05-01

    Full Text Available The patent registration is considered one of the industrial and scientific development indexes of countries, once used to measure the capacity of this activity in the transformation of knowledge into products, processes or technological innovation. In view of the whole scientific, technological and innovation contexts activities in Peru, we ask: how does the patent production process behave in the country? The main focus is to identify the production of patents, as well as their inventors. The main objective of this study is to determine the degree of patent productivity in Peru. The search strategy was based on the Esp@cenet patent base, in the Inventors field, using the expression "[PE]" representing the country of inventor, selecting the period of study mentioned above. In a second step, a data cleansing was performed to identify if the strategy was successful, 1104 patents were identified, which were tabulated later. Among the several results of this research, an interesting observation is the predominance of US patent citations, practically monopolizing the sample. On 47 occasions the US country appears, while patents from Germany are cited 4 times and from Great Britain 2 times. During the study period, a 60 % increase in patent registrations was observed. The main patent producers in Peru have interesting characteristics, where one can notice a market reserve in some segments such as hygiene, consumer products and daily life. Finally, one can identify a technological and innovation predominance in sectors where the industry is installed and that has direct interference in the products that are directed to the Peruvian population.

  18. Herbal drug patenting in India: IP potential.

    Science.gov (United States)

    Sahoo, Niharika; Manchikanti, Padmavati; Dey, Satya Hari

    2011-09-01

    Herbal drugs are gaining worldwide prominence due to their distinct advantages. Developing countries have started exploring the ethnopharmacological approach of drug discovery and have begun to file patents on herbal drugs. The expansion of R&D in Indian herbal research organizations and presence of manufacturing units at non-Indian sites is an indication of the capability to develop new products and processes. The present study attempts to identify innovations in the Indian herbal drug sector by analyzing the patenting trends in India, US and EU. Based on key word and IPC based search at the IPO, USPTO, Esp@cenet and WIPO databases, patent applications and grant in herbal drugs by Indian applicants/assignees was collected for the last ten years (from 1st January 2001 to 31st October 2010). From this collection patents related to human therapeutic use only were selected. Analysis was performed to identify filing trends, major applicants/assignees, disease area and major plant species used for various treatments. There is a gradual increase in patent filing through the years. In India, individual inventors have maximum applications and grants. CSIR, among research organizations and Hindustan Unilever, Avesthagen, Piramal Life Science, Sahajanand Biotech and Indus Biotech among the companies have the maximum granted patents in India, US and EU respectively. Diabetes, cancer and inflammatory disorders are the major areas for patenting in India and abroad. Recent patents are on new herbal formulations for treatment of AIDS, hepatitis, skin disorders and gastrointestinal disorders. A majority of the herbal patents applications and grants in India are with individual inventors. Claim analysis indicates that these patents include novel multi-herb compositions with synergistic action. Indian research organizations are more active than companies in filing for patents. CSIR has maximum numbers of applications not only in India but also in the US and EU. Patents by research

  19. Simultaneous invention and the patent law

    DEFF Research Database (Denmark)

    Howells, John

    inventions they often find this to challenge the idea that patent law (which rewards only the first inventor with exclusive rights) is needed to encourage invention and innovation. We review the empirical evidence alleged to show that simultaneous invention is prevalent for important inventions. In general...... is typical of important pioneer inventions in both survey evidence and alleged illustrative cases of simultaneous invention. We show this in the cases of Edison, the Wright brothers, the Selden automobile patent vis a vis Ford, Watt and the steam engine. We then point out that patent law inherently ensures...... that patent protection is not extended to near simultaneous inventions. There remain a number of simultaneous inventions discovered through interference proceedings but we find the number too small to mount a serious challenge to the general operation of patent law....

  20. The Patent Literature As A Shortcut To Identify Knowledge Suppliers

    DEFF Research Database (Denmark)

    Søberg, Peder Veng

    patents which decreases the time span between a patent is filed and its value can be evaluated when searching the patent literature. A potential benefit thereof could be that the patent literature could become relevant in order to identify potential knowledge suppliers.......The present paper explores characteristics of valuable patents that have been subject to litigation which resulted in some of the largest fines to patent infringers reported in history. The valuable patents are compared with less valuable patents in order to identify new methods of evaluating...

  1. The evolution of green patenting activity in the automotive sector (1965-2012)

    DEFF Research Database (Denmark)

    Faria, Lourenco; Andersen, Maj Munch

    are diversifying their patent portfolios in response to institutional and demand pressures, as well as new technologic opportunities, in order to generate competitive advantages derived from the introduction of alternative, greener technologies, emerging and becoming more pronounced after the financial crisis...

  2. Ewan and Cooper processes unite in 'paradigm shifting' patent

    Energy Technology Data Exchange (ETDEWEB)

    Tang, R.; Sanyal, P. [International Environmental and Energy Consultants (United States)

    2010-11-15

    A freshly patented technology aimed at removing over 99% of the flue emissions and over 90% of CO{sub 2}, the CEFCO process, is being presented as a comprehensive maximum achievable control technology (MACT) solution to enable coal and oil fired plants to meet tightening US emission standards. 3 figs.

  3. Hydrogen patent portfolios in the automotive industry - the search for promising storage methods

    NARCIS (Netherlands)

    Bakker, S.

    2010-01-01

    In the development of hydrogen vehicle technologies, the automotive industry adopts a portfolio approach; a multitude of technological options is developed for hydrogen storage and conversion. Patent portfolios of car manufacturers are used as indicators of the variation and selection dynamics of

  4. Is the prominent scientist the one who becomes an inventor? A matching of Swedish academic pairs in nanoscience to examine the effect of publishing on patenting

    OpenAIRE

    Evangelos, Bourelos; Beyhan, Berna; McKelvey, Maureen

    2017-01-01

    Nanoscience is an interdisciplinary field in which science, in terms of publications, and technology, in terms of inventions, are closely related. Sweden represents an interesting setting to examine how they are related because a high proportion of the total Swedish academic patents can be classified as nanoscience. Combining bibliometric data from the Web of Science, patent data from European Patent Office and data from Swedish universities, this article identifies all authors and all invent...

  5. The revival of Phage Therapy to fight Antimicrobial Resistance – Part II: What about patent protection and alternative incentives?

    DEFF Research Database (Denmark)

    Minssen, Timo

    2014-01-01

    Three days ago I commented on a couple of legal issues raised in the recent Nature report “Phage therapy gets revitalized” by Sara Reardon. One challenge concerns the reluctance of pharma companies to broadly invest in the development of phage therapies. As pointed out in the report, this does....... Like in Europe, the first door to patentability that phage-related technology would need to pass concerns patent eligibility. In the last years the US Supreme Court has rendered an astonishing number of fundamental patent-decisions, including not less than four (!) landmark judgments on patent...... occurring viruses, such as phages, and the processes in which these are used. Myriad and Prometheus could thus have a fundamental impact on many patent portfolios relating to phage therapy and thus business involvement. In that context, it is important to realize that an important component of proper use...

  6. Patents Consulting Use Potential for Determining the State of the Art. Analysis in Microgrids with Renewable Energy Sources

    Directory of Open Access Journals (Sweden)

    Tomás Valencia-Zuluaga

    2017-06-01

    Full Text Available In this document, we aim to show how important patent research is for technological and scientific development. We expose some of the main characteristics of patents, as well as the advantages that these documents have over the most commonly used sources of information in research, such as scientific and professional papers. We also cover the International Patent Classification, which should be known if one hopes to extract any valuable information from patents. Finally, we put everything into practice with a case of study regarding microgrids in power systems, with high penetration of renewable energy sources. With this study case, we invite the reader to include patent consulting into his or her literature research habits.

  7. Origen y evolución de las patentes y marcas en biomecánica deportiva. (Origin and evolution of patents and trademarks in sports biomechanics.

    Directory of Open Access Journals (Sweden)

    José L. González-Montesinos

    2012-10-01

    Full Text Available ResumenLa Biomecánica es una disciplina científica cuyo origen se remonta varios siglos atrás, cuando distintos precursores utilizaron diferentes ciencias para analizar el movimiento humano y animal. El desarrollo tecnológico ha propiciado la invención de distintos dispositivos los cuales han sido utilizados en estudios biomecánicos. Dichos dispositivos han facilitado la toma y análisis de datos relacionados con el movimiento y sus causas. La Oficina Española de Patentes y Marcas (O.E.P.M. es el organismo encargado de registrar y patentar las invenciones en España. Para ello, la patente presentada debe de cumplir con unos requisitos y superar una evaluación técnica. Actualmente podemos encontrar distintas patentes para realizar análisis cinemáticos y cinéticos del movimiento, formadas por emisores y receptores de láser, cámaras de alta velocidad, sensores de presión, etc. Numerosas investigaciones relacionadas con la biomecánica deportiva utilizan estos dispositivos para obtener datos más precisos, mejorando la calidad de la investigación y, en algunos casos, posibilitando la mejora del rendimiento físico y/o deportivo. El propósito del presente artículo, consiste en exponer la evolución de la biomecánica en general y deportiva en particular, realizar una revisión sobre patentes relacionadas con la biomecánica del deporte, y reflejar sobre cómo y donde registrar las invenciones. Para ello se han utilizado las plataformas digitales y bases de datos Esp@cenet, Invesnes para la revisión de patentes con origen español, y Google Patent para otras patentes registradas en oficinas de fuera de España.AbstractThe biomechanics is a science discipline that originated centuries ago when various precursors used different sciences to analyze human and animal movement. Technological development has led to the invention of various devices which have been used in biomechanical studies. Such devices have facilitated the collection

  8. AVC/H.264 patent portfolio license

    Science.gov (United States)

    Skandalis, Dean A.

    2006-08-01

    MPEG LA, LLC offers a joint patent license for the AVC (a/k/a H.264) Standard (ISO/IEC IS 14496-10:2004). Like MPEG LA's other licenses, the AVC Patent Portfolio License is offered for the convenience of the marketplace as an alternative enabling users to access essential intellectual property owned by many patent holders under a single license rather than negotiating licenses with each of them individually. The AVC Patent Portfolio License includes essential patents owned by DAEWOO Electronics Corporation; Electronics and Telecommunications Research Institute (ETRI); France Telecom, societe anonyme; Fujitsu Limited; Hitachi, Ltd.; Koninklijke Philips Electronics N.V.; LG Electronics Inc.; Matsushita Electric Industrial Co., Ltd.; Microsoft Corporation; Mitsubishi Electric Corporation; Robert Bosch GmbH; Samsung Electronics Co., Ltd.; Sedna Patent Services, LLC; Sharp Kabushiki Kaisha; Siemens AG; Sony Corporation; The Trustees of Columbia University in the City of New York; Toshiba Corporation; UB Video Inc.; and Victor Company of Japan, Limited. Another is expected also to join as of August 1, 2006. MPEG LA's objective is to provide worldwide access to as much AVC essential intellectual property as possible for the benefit of AVC users. Therefore, any party that believes it has essential patents is welcome to submit them for evaluation of their essentiality and inclusion in the License if found essential.

  9. The Transformation of Science Into Patented Inventions

    DEFF Research Database (Denmark)

    Beukel, Karin

    This paper presents the results of a grounded theory study of the transformation of scientific discoveries into patented inventions. Using an algebraic interpretive approach, the narratives collected during interviews are analyzed as Bayesian inferences and the developed theory is tested. The fin......This paper presents the results of a grounded theory study of the transformation of scientific discoveries into patented inventions. Using an algebraic interpretive approach, the narratives collected during interviews are analyzed as Bayesian inferences and the developed theory is tested....... The findings recast the relationship between science and patents as a process in which the way the transformation of the scientific invention is handled has an effect on the breadth of the patent scope. Unleashing patent scope surplus is dependent on processes related to abstraction and cognitive variety......, which can be mobilized by patent experts with both an in-depth understanding of the scientific discovery, due to their educational background in the life sciences, and capabilities within the legal framework for patenting. More specifically, the findings reveal previously unreported aspects...

  10. Therapeutic and cosmetic applications of mangiferin: a patent review.

    Science.gov (United States)

    Telang, Manasi; Dhulap, Sivakami; Mandhare, Anita; Hirwani, Rajkumar

    2013-12-01

    Mangiferin, a natural C-glucoside xanthone [2-C-β-D-glucopyranosyl-1, 3, 6, 7-tetrahydroxyxanthone], is abundantly present in young leaves and stem bark of the mango tree. The xanthonoid structure of mangiferin with C-glycosyl linkage and polyhydroxy components contributes to its free radical-scavenging ability, leading to a potent antioxidant effect as well as multiple biological activities. An extensive search was carried out to collect patent information on mangiferin and its derivatives using various patent databases spanning all priority years to date. The patents claiming therapeutic and cosmetic applications of mangiferin and its derivatives were analyzed in detail. The technology areas covered in this article include metabolic disorders, cosmeceuticals, multiple uses of the same compound, miscellaneous uses, infectious diseases, inflammation, cancer and autoimmune disorders, and neurological disorders. Mangiferin has the potential to modulate multiple molecular targets including nuclear factor-kappa B (NF-κB) signaling and cyclooxygenase-2 (COX-2) protein expression. Mangiferin exhibits antioxidant, antidiabetic, antihyperuricemic, antiviral, anticancer and antiinflammatory activities. The molecular structure of mangiferin fulfils the four Lipinski's requisites reported to favor high bioavailability by oral administration. There is no evidence of adverse side effects of mangiferin so far. Mangiferin could thus be a promising candidate for development of a multipotent drug.

  11. Exploring Contextual Models in Chemical Patent Search

    Science.gov (United States)

    Urbain, Jay; Frieder, Ophir

    We explore the development of probabilistic retrieval models for integrating term statistics with entity search using multiple levels of document context to improve the performance of chemical patent search. A distributed indexing model was developed to enable efficient named entity search and aggregation of term statistics at multiple levels of patent structure including individual words, sentences, claims, descriptions, abstracts, and titles. The system can be scaled to an arbitrary number of compute instances in a cloud computing environment to support concurrent indexing and query processing operations on large patent collections.

  12. Quinoxaline derivatives: a patent review (2006--present).

    Science.gov (United States)

    González, Mercedes; Cerecetto, Hugo

    2012-11-01

    Quinoxaline scaffold is included in a large number of therapeutic agents because of its physicochemical properties that make the difference between them and the carbono analogue, naphthalene. This review of patented products presents the quinoxaline heterocycle as part of the structural patent claims from a medicinal chemistry perspective. We centred our discussion in the various drug patent applications of the quinoxaline and its derivatives. The applications are based firstly in the specific enzyme target with very low development in the disease treatment. Only for cancer and antimicrobial agents they were specifically determined but little is mentioned in order to insight in the last development activities.

  13. Past, present and future of pharmaceutical patents under Korea-US Trade Agreement.

    Science.gov (United States)

    Shin, Yoon Suk

    2016-07-01

    The introduction of substance patents in 1987 was viewed with apprehension as it was believed that the system would only reinforce the domination of the technology of advanced countries based on the trade agreement between Korea and the USA. However, substance patents provided the Korean pharmaceutical industry with the driving force required to develop new substances, and the Korean pharmaceutical industry has been constantly improving its research and development capability. The patent-approval linkage system was implemented according to the Korea-US Free Trade Agreement in 2015. The system comprises the following: registering the drugs in the Green List, notifying the listed patent and marketing approval holders about the application for generic marketing approval, patent holder's request for staying generic sales and first generic exclusivity. Korean generic companies are expected to have opportunities that enable them to challenge the global market by accumulating experience of designing of generic products, making patent challenges and strategically developing of new drugs or incrementally modified drugs through the linkage system.

  14. Nanotechnology patenting trends through an environmental lens: analysis of materials and applications

    International Nuclear Information System (INIS)

    Leitch, Megan E.; Casman, Elizabeth; Lowry, Gregory V.

    2012-01-01

    Many international groups study environmental health and safety (EHS) concerns surrounding the use of engineered nanomaterials (ENMs). These researchers frequently use the “Project on Emerging Nanotechnologies” (PEN) inventory of nano-enabled consumer products to prioritize types of ENMs to study because estimates of life-cycle ENM releases to the environment can be extrapolated from the database. An alternative “snapshot” of nanomaterials likely to enter commerce can be determined from the patent literature. The goal of this research was to provide an overview of nanotechnology intellectual property trends, complementary to the PEN consumer product database, to help identify potentially “risky” nanomaterials for study by the nano-EHS community. Ten years of nanotechnology patents were examined to determine the types of nano-functional materials being patented, the chemical compositions of the ENMs, and the products in which they are likely to appear. Patenting trends indicated different distributions of nano-enabled products and materials compared to the PEN database. Recent nanotechnology patenting is dominated by electrical and information technology applications rather than the hygienic and anti-fouling applications shown by PEN. There is an increasing emphasis on patenting of nano-scale layers, coatings, and other surface modifications rather than traditional nanoparticles, and there is widespread use of nano-functional semiconductor, ceramic, magnetic, and biological materials that are currently less studied by EHS professionals. These commonly patented products and the nano-functional materials they contain may warrant life-cycle evaluations to determine the potential for environmental exposure and toxicity. The patent and consumer product lists contribute different and complementary insights into the emerging nanotechnology industry and its potential for introducing nanomaterials into the environment.

  15. Nanotechnology patenting trends through an environmental lens: analysis of materials and applications

    Energy Technology Data Exchange (ETDEWEB)

    Leitch, Megan E. [Carnegie Mellon University, Department of Civil and Environmental Engineering, Center for the Environmental Implications of NanoTechnology (CEINT) (United States); Casman, Elizabeth [Carnegie Mellon University, Department of Engineering and Public Policy, Center for the Environmental Implications of NanoTechnology (CEINT) (United States); Lowry, Gregory V., E-mail: glowry@cmu.edu [Carnegie Mellon University, Department of Civil and Environmental Engineering, Center for the Environmental Implications of NanoTechnology (CEINT) (United States)

    2012-12-15

    Many international groups study environmental health and safety (EHS) concerns surrounding the use of engineered nanomaterials (ENMs). These researchers frequently use the 'Project on Emerging Nanotechnologies' (PEN) inventory of nano-enabled consumer products to prioritize types of ENMs to study because estimates of life-cycle ENM releases to the environment can be extrapolated from the database. An alternative 'snapshot' of nanomaterials likely to enter commerce can be determined from the patent literature. The goal of this research was to provide an overview of nanotechnology intellectual property trends, complementary to the PEN consumer product database, to help identify potentially 'risky' nanomaterials for study by the nano-EHS community. Ten years of nanotechnology patents were examined to determine the types of nano-functional materials being patented, the chemical compositions of the ENMs, and the products in which they are likely to appear. Patenting trends indicated different distributions of nano-enabled products and materials compared to the PEN database. Recent nanotechnology patenting is dominated by electrical and information technology applications rather than the hygienic and anti-fouling applications shown by PEN. There is an increasing emphasis on patenting of nano-scale layers, coatings, and other surface modifications rather than traditional nanoparticles, and there is widespread use of nano-functional semiconductor, ceramic, magnetic, and biological materials that are currently less studied by EHS professionals. These commonly patented products and the nano-functional materials they contain may warrant life-cycle evaluations to determine the potential for environmental exposure and toxicity. The patent and consumer product lists contribute different and complementary insights into the emerging nanotechnology industry and its potential for introducing nanomaterials into the environment.

  16. Patent border wars: defining the boundary between scientific discoveries and patentable inventions.

    Science.gov (United States)

    Holman, Christopher M

    2007-12-01

    Drawing an appropriate boundary between unpatentable natural phenomena and patentable inventions is crucial in preventing the patent laws from unduly restricting access to fundamental scientific discoveries. Some would argue that, particularly in the U.S., patents are being issued that purport to claim a novel product or process but that, in effect, encompass any practical application of a fundamental biological principle. Examples include gene patents, which Congress is considering banning, and patents relating to biological correlations and pathways, such as the patents at issue in the headline-grabbing LabCorp v. Metabolite and Ariad v. Eli Lilly litigations. In view of the mounting concern, it seems likely that Congress and/or the courts will address the issue, and perhaps substantially shift the boundary.

  17. 78 FR 62367 - Changes To Implement the Patent Law Treaty

    Science.gov (United States)

    2013-10-21

    ... Office 37 CFR Parts 1, 3 and 11 Changes To Implement the Patent Law Treaty; Final Rule #0;#0;Federal... 0651-AC85 Changes To Implement the Patent Law Treaty AGENCY: United States Patent and Trademark Office, Commerce. ACTION: Final rule. SUMMARY: The Patent Law Treaties Implementation Act of 2012 (PLTIA) amends...

  18. 78 FR 21787 - Changes To Implement the Patent Law Treaty

    Science.gov (United States)

    2013-04-11

    ... Trademark Office 37 CFR Parts 1 and 3 Changes To Implement the Patent Law Treaty; Proposed Rule #0;#0...-0007] RIN 0651-AC85 Changes To Implement the Patent Law Treaty AGENCY: United States Patent and Trademark Office, Commerce. ACTION: Notice of proposed rulemaking. SUMMARY: The Patent Law Treaties...

  19. 48 CFR 1327.201 - Patent and copyright infringement liability.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent and copyright infringement liability. 1327.201 Section 1327.201 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Patents and Copyrights 1327.201 Patent and...

  20. 48 CFR 970.2702-3 - Patent indemnity.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Patent indemnity. 970.2702... SUPPLEMENTARY REGULATIONS DOE MANAGEMENT AND OPERATING CONTRACTS Patents, Data, and Copyrights 970.2702-3 Patent indemnity. (a) Contracting officers must use the clause at 970.5227-6, Patent Indemnity—Subcontracts to...