WorldWideScience

Sample records for autosomal-dominant distal myopathy

  1. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Energy Technology Data Exchange (ETDEWEB)

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

    1995-02-01

    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  2. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Science.gov (United States)

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

    2017-08-01

    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. DISTAL MYOPATHIES

    Science.gov (United States)

    Dimachkie, Mazen M.; Barohn, Richard J.

    2014-01-01

    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  4. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  5. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Directory of Open Access Journals (Sweden)

    Ting Chen

    2016-01-01

    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  6. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Science.gov (United States)

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

    2013-10-01

    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  7. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Directory of Open Access Journals (Sweden)

    Aralikatte Onkarappa Saroja

    2013-01-01

    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  8. Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

    DEFF Research Database (Denmark)

    Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

  9. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Science.gov (United States)

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  10. Genetics Home Reference: CAV3-related distal myopathy

    Science.gov (United States)

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  11. Mutation Spectrum in the Large GTPase Dynamin 2, and Genotype–Phenotype Correlation in Autosomal Dominant Centronuclear Myopathy

    Science.gov (United States)

    Böhm, Johann; Biancalana, Valérie; DeChene, Elizabeth T.; Bitoun, Marc; Pierson, Christopher R.; Schaefer, Elise; Karasoy, Hatice; Dempsey, Melissa A.; Klein, Fabrice; Dondaine, Nicolas; Kretz, Christine; Haumesser, Nicolas; Poirson, Claire; Toussaint, Anne; Greenleaf, Rebecca S.; Barger, Melissa A.; Mahoney, Lane J.; Kang, Peter B.; Zanoteli, Edmar; Vissing, John; Witting, Nanna; Echaniz-Laguna, Andoni; Wallgren-Pettersson, Carina; Dowling, James; Merlini, Luciano; Oldfors, Anders; Ousager, Lilian Bomme; Melki, Judith; Krause, Amanda; Jern, Christina; Oliveira, Acary S. B.; Petit, Florence; Jacquette, Aurélia; Chaussenot, Annabelle; Mowat, David; Leheup, Bruno; Cristofano, Michele; Aldea, Juan José Poza; Michel, Fabrice; Furby, Alain; Llona, Jose E. Barcena; Van Coster, Rudy; Bertini, Enrico; Urtizberea, Jon Andoni; Drouin-Garraud, Valérie; Béroud, Christophe; Prudhon, Bernard; Bedford, Melanie; Mathews, Katherine; Erby, Lori A. H.; Smith, Stephen A.; Roggenbuck, Jennifer; Crowe, Carol A.; Spitale, Allison Brennan; Johal, Sheila C.; Amato, Anthony A.; Demmer, Laurie A.; Jonas, Jessica; Darras, Basil T.; Bird, Thomas D.; Laurino, Mercy; Welt, Selman I.; Trotter, Cynthia; Guicheney, Pascale; Das, Soma; Mandel, Jean-Louis; Beggs, Alan H.; Laporte, Jocelyn

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzyme regulating cytoskeleton and membrane trafficking in cells. To date, 40 families with CNM-related DNM2 mutations have been described, and here we report 60 additional families encompassing a broad genotypic and phenotypic spectrum. In total, 18 different mutations are reported in 100 families and our cohort harbors nine known and four new mutations, including the first splice-site mutation. Genotype–phenotype correlation hypotheses are drawn from the published and new data, and allow an efficient screening strategy for molecular diagnosis. In addition to CNM, dissimilar DNM2 mutations are associated with Charcot–Marie–Tooth (CMT) peripheral neuropathy (CMTD1B and CMT2M), suggesting a tissue-specific impact of the mutations. In this study, we discuss the possible clinical overlap of CNM and CMT, and the biological significance of the respective mutations based on the known functions of dynamin 2 and its protein structure. Defects in membrane trafficking due to DNM2 mutations potentially represent a common pathological mechanism in CNM and CMT. PMID:22396310

  12. [Autosomal dominant polycystic kidney].

    Science.gov (United States)

    Jorge Adad, S; Estevão Barbosa, M; Fácio Luíz, J M; Furlan Rodrigues, M C; Iwamoto, S

    1996-01-01

    A 48-year-old male had autosomic dominant polycystic kidneys with dimensions, to the best of our knowledge, never previously reported; the right kidney weighed 15,100 g and measured 53 x 33 x 9cm and the left one 10.200 g and 46 x 21 x 7cm, with cysts measuring up to 14cm in diameter. Nephrectomy was done to control persistent hematuria and to relief disconfort caused by the large kidneys. The renal function is stable four years after transplantation.

  13. Autosomal dominant adult neuronal ceroid lipofuscinosis

    NARCIS (Netherlands)

    Nijssen, Peter C.G.

    2011-01-01

    this thesis investigates a family with autosomal dominant neuronal ceroid lipofuscinosis, with chapters on clinical neurology, neuropathology, neurogenetics, neurophysiology, auditory and visual aspects.

  14. Autosomal dominant hereditary ataxia in Sri Lanka

    OpenAIRE

    Sumathipala, Dulika S; Abeysekera, Gayan S; Jayasekara, Rohan W; Tallaksen, Chantal ME; Dissanayake, Vajira HW

    2013-01-01

    Background Spinocerebellar ataxias (SCA) are a group of hereditary neurodegenerative disorders. Prevalence of SCA subtypes differ worldwide. Autosomal dominant ataxias are the commonest types of inherited ataxias seen in Sri Lanka. The aim of the study is to determine the genetic etiology of patients with autosomal dominant ataxia in Sri Lanka and to describe the clinical features of each genetic subtype. Methods ...

  15. Autosomal dominant inheritance of Weaver syndrome.

    OpenAIRE

    Fryer, A; Smith, C; Rosenbloom, L; Cole, T

    1997-01-01

    Most report of Weaver syndrome have been sporadic cases and the genetic basis of the syndrome is uncertain. This report of an affected father and daughter provides evidence for autosomal dominant inheritance.

  16. Genetics Home Reference: autosomal dominant hypocalcemia

    Science.gov (United States)

    ... individuals have features of a kidney disorder called Bartter syndrome in addition to hypocalcemia. These features can include ... sometimes referred to as autosomal dominant hypocalcemia with Bartter syndrome or Bartter syndrome type V. There are two ...

  17. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Science.gov (United States)

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

    2016-08-12

    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  18. Autosomal-dominant osteopetrosis: An incidental finding

    Directory of Open Access Journals (Sweden)

    Rajathi Maria

    2010-01-01

    Full Text Available Osteopetrosis is a descriptive term that refers to a group of rare, heritable disorders of the skeleton. Osteopetrotic conditions vary greatly in their presentation and severity, from just as an incidental finding on radiographs to causing life-threatening complications such as bone marrow suppression. It is caused by failure of osteoclast development and function. Osteopetrosis can be inherited as autosomal-recessive, autosomal-dominant or as X-linked traits, with the most severe forms being the autosomal-recessive ones. The severity of the disease is mild to moderate in the autosomal-dominant forms, with normal life expectancy. Diagnosis is largely based on clinical and radiographic evaluation. The present paper reports a case of autosomal-dominant osteopetrosis complicated by osteomyelitis with a short review of the condition.

  19. Autosomal dominant craniometaphyseal dysplasia with atypical features.

    Science.gov (United States)

    McKay, D R; Fialkov, J A

    2002-03-01

    Craniometaphyseal dysplasia (CMD) is a rare genetic disorder of bone modelling characterised by hyperostosis and sclerosis of the craniofacial bones, and abnormal modelling of the metaphyses. Clinically, autosomal dominant (AD) CMD is characterised by facial distortion and cranial-nerve compression. The goals of surgical treatment for AD CMD are cosmetic recontouring of the sclerotic craniofacial bones, correction of nasal obstruction and correction or prevention of neurological manifestations. We describe the successful correction of AD CMD craniofacial manifestations in an individual with atypical findings, and outline an approach for correcting the craniofacial deformities associated with this rare disorder. Copyright 2002 The British Association of Plastic Surgeons.

  20. Clinical neurogenetics: autosomal dominant spinocerebellar ataxia.

    Science.gov (United States)

    Shakkottai, Vikram G; Fogel, Brent L

    2013-11-01

    The autosomal dominant spinocerebellar ataxias are a diverse and clinically heterogeneous group of disorders characterized by degeneration and dysfunction of the cerebellum and its associated pathways. Clinical and diagnostic evaluation can be challenging because of phenotypic overlap among causes, and a stratified and systematic approach is essential. Recent advances include the identification of additional genes causing dominant genetic ataxia, a better understanding of cellular pathogenesis in several disorders, the generation of new disease models that may stimulate development of new therapies, and the use of new DNA sequencing technologies, including whole-exome sequencing, to improve diagnosis. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Autosomal dominant cortical tremor, myoclonus and epilepsy.

    Science.gov (United States)

    Striano, Pasquale; Zara, Federico

    2016-09-01

    The term 'cortical tremor' was first introduced by Ikeda and colleagues to indicate a postural and action-induced shivering movement of the hands which mimics essential tremor, but presents with the electrophysiological findings of cortical reflex myoclonus. The association between autosomal dominant cortical tremor, myoclonus and epilepsy (ADCME) was first recognized in Japanese families and is now increasingly reported worldwide, although it is described using different acronyms (BAFME, FAME, FEME, FCTE and others). The disease usually takes a benign course, although drug-resistant focal seizures or slight intellectual disability occur in some cases. Moreover, a worsening of cortical tremor and myoclonus is common in advanced age. Although not yet recognized by the International League Against Epilepsy (ILAE), this is a well-delineated epilepsy syndrome with remarkable features that clearly distinguishes it from other myoclonus epilepsies. Moreover, genetic studies of these families show heterogeneity and different susceptible chromosomal loci have been identified.

  2. MRI of autosomal dominant pure spastic paraplegia

    DEFF Research Database (Denmark)

    Krabbe, K.; Nielsen, J.E.; Fallentin, E.

    1997-01-01

    We examined 16 patients with autosomal dominant pure spastic paraplegia (HSP) and 15 normal controls matched for age and sex using MRI of the brain and spinal cord. Images were assessed qualitatively by two independent radiologists, blinded to the clinical diagnosis. Areas of the brain and corpus...... callosum on one midsagittal slice and the area of the brain on one axial slice were measured and a "corpus-callosum index" expressing the size of the corpus callosum relative to that of the brain was calculated. Cross-sectional areas and anteroposterior and transverse diameters of the spinal cord...... at the levels of C 2, C 5, T 3, T 6, T 9 and T 11 were measured. No significant differences between patients and controls were found on qualitative evaluation of the images. The patients had a significantly smaller corpus callosum and "corpus-callosum index" than controls. This finding, not reported previously...

  3. MRI of autosomal dominant pure spastic paraplegia

    International Nuclear Information System (INIS)

    Krabbe, K.; Fallentin, E.; Herning, M.; Nielsen, J.E.; Fenger, K.

    1997-01-01

    We examined 16 patients with autosomal dominant pure spastic paraplegia (HSP) and 15 normal controls matched for age and sex using MRI of the brain and spinal cord. Images were assessed qualitatively by two independent radiologists, blinded to the clinical diagnosis. Areas of the brain and corpus callosum on one midsagittal slice and the area of the brain on one axial slice were measured and a ''corpus-callosum index'' expressing the size of the corpus callosum relative to that of the brain was calculated. Cross-sectional areas and anteroposterior and transverse diameters of the spinal cord at the levels of C 2, C 5, T 3, T 6, T 9 and T 11 were measured. No significant differences between patients and controls were found on qualitative evaluation of the images. The patients had a significantly smaller corpus callosum and ''corpus-callosum index'' than controls. This finding, not reported previously, might indicate that the disease process in pure HSP is not confined to the spinal cord. The anteroposterior diameters of the spinal cord at T 3 and T 9 were significantly smaller in patients than in controls. This might correspond to the degeneration of the pyramidal tracts and the dorsal columns described at neuropathological examination. (orig.). With 1 fig., 3 tabs

  4. MRI of autosomal dominant pure spastic paraplegia

    Energy Technology Data Exchange (ETDEWEB)

    Krabbe, K.; Fallentin, E.; Herning, M. [Danish Research Center of Magnetic Resonance, Hvidovre Hospital, Kettegaard alle 30, DK-2650 Hvidovre (Denmark); Nielsen, J.E.; Fenger, K. [Institute of Medical Biochemistry and Genetics, Laboratory of Medical Genetics, Section of Neurogenetics, University of Copenhagen (Denmark)

    1997-10-01

    We examined 16 patients with autosomal dominant pure spastic paraplegia (HSP) and 15 normal controls matched for age and sex using MRI of the brain and spinal cord. Images were assessed qualitatively by two independent radiologists, blinded to the clinical diagnosis. Areas of the brain and corpus callosum on one midsagittal slice and the area of the brain on one axial slice were measured and a ``corpus-callosum index`` expressing the size of the corpus callosum relative to that of the brain was calculated. Cross-sectional areas and anteroposterior and transverse diameters of the spinal cord at the levels of C 2, C 5, T 3, T 6, T 9 and T 11 were measured. No significant differences between patients and controls were found on qualitative evaluation of the images. The patients had a significantly smaller corpus callosum and ``corpus-callosum index`` than controls. This finding, not reported previously, might indicate that the disease process in pure HSP is not confined to the spinal cord. The anteroposterior diameters of the spinal cord at T 3 and T 9 were significantly smaller in patients than in controls. This might correspond to the degeneration of the pyramidal tracts and the dorsal columns described at neuropathological examination. (orig.). With 1 fig., 3 tabs.

  5. Autosomal Dominant Growth Hormone Deficiency (Type II).

    Science.gov (United States)

    Alatzoglou, Kyriaki S; Kular, Dalvir; Dattani, Mehul T

    2015-06-01

    Isolated growth hormone deficiency (IGHD) is the commonest pituitary hormone deficiency resulting from congenital or acquired causes, although for most patients its etiology remains unknown. Among the known factors, heterozygous mutations in the growth hormone gene (GH1) lead to the autosomal dominant form of GHD, also known as type II GHD. In many cohorts this is the commonest form of congenital isolated GHD and is mainly caused by mutations that affect the correct splicing of GH-1. These mutations cause skipping of the third exon and lead to the production of a 17.5-kDa GH isoform that exerts a dominant negative effect on the secretion of the wild type GH. The identification of these mutations has clinical implications for the management of patients, as there is a well-documented correlation between the severity of the phenotype and the increased expression of the 17.5-kDa isoform. Patients with type II GHD have a variable height deficit and severity of GHD and may develop additional pituitary hormone defiencies over time, including ACTH, TSH and gonadotropin deficiencies. Therefore, their lifelong follow-up is recommended. Detailed studies on the effect of heterozygous GH1 mutations on the trafficking, secretion and action of growth hormone can elucidate their mechanism on a cellular level and may influence future treatment options for GHD type II.

  6. Myopathies

    Science.gov (United States)

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  7. Genetics Home Reference: autosomal dominant leukodystrophy with autonomic disease

    Science.gov (United States)

    ... have muscle stiffness (spasticity) or weakness and involuntary rhythmic shaking, called intention tremor because it worsens during ... Hobson G, Brusco A, Brussino A, Padiath QS. Analysis of LMNB1 duplications in autosomal dominant leukodystrophy provides ...

  8. Genetics Home Reference: autosomal dominant congenital stationary night blindness

    Science.gov (United States)

    ... collapse boxes. Description Autosomal dominant congenital stationary night blindness is a disorder of the retina , which is the specialized tissue at the back of the eye that detects light and color. People with this condition typically have difficulty seeing ...

  9. Genetics Home Reference: autosomal dominant nocturnal frontal lobe epilepsy

    Science.gov (United States)

    ... with ADNFLE have experienced psychiatric disorders (such as schizophrenia), behavioral problems, or intellectual disability. It is unclear ... Epilepsy Society Citizens United for Research in Epilepsy (CURE) GeneReviews (1 link) Autosomal Dominant Nocturnal Frontal Lobe ...

  10. Autosomal dominant frontometaphyseal dysplasia : Delineation of the clinical phenotype

    NARCIS (Netherlands)

    Wade, Emma M.; Jenkins, Zandra A.; Daniel, Philip B.; Morgan, Tim; Addor, Marie C.; Ades, Lesley C.; Bertola, Debora; Bohring, Axel; Carter, Erin; Cho, Tae-Joon; de Geus, Christa M.; Duba, Hans-Christoph; Fletcher, Elaine; Hadzsiev, Kinga; Hennekam, Raoul C. M.; Kim, Chong A.; Krakow, Deborah; Morava, Eva; Neuhann, Teresa; Sillence, David; Superti-Furga, Andrea; Veenstra-Knol, Hermine E.; Wieczorek, Dagmar; Wilson, Louise C.; Markie, David M.; Robertson, Stephen P.

    Frontometaphyseal dysplasia (FMD) is caused by gain-of-function mutations in the X-linked gene FLNA in approximately 50% of patients. Recently we characterized an autosomal dominant form of FMD (AD-FMD) caused by mutations in MAP3K7, which accounts for the condition in the majority of patients who

  11. Autosomal dominant frontometaphyseal dysplasia: Delineation of the clinical phenotype

    NARCIS (Netherlands)

    Wade, Emma M.; Jenkins, Zandra A.; Daniel, Philip B.; Morgan, Tim; Addor, Marie C.; Adés, Lesley C.; Bertola, Debora; Bohring, Axel; Carter, Erin; Cho, Tae-Joon; de Geus, Christa M.; Duba, Hans-Christoph; Fletcher, Elaine; Hadzsiev, Kinga; Hennekam, Raoul C. M.; Kim, Chong A.; Krakow, Deborah; Morava, Eva; Neuhann, Teresa; Sillence, David; Superti-Furga, Andrea; Veenstra-Knol, Hermine E.; Wieczorek, Dagmar; Wilson, Louise C.; Markie, David M.; Robertson, Stephen P.

    2017-01-01

    Frontometaphyseal dysplasia (FMD) is caused by gain-of-function mutations in the X-linked gene FLNA in approximately 50% of patients. Recently we characterized an autosomal dominant form of FMD (AD-FMD) caused by mutations in MAP3K7, which accounts for the condition in the majority of patients who

  12. Genetics Home Reference: autosomal dominant partial epilepsy with auditory features

    Science.gov (United States)

    ... for This Condition ADLTE ADPEAF Autosomal dominant lateral temporal lobe epilepsy Epilepsy, partial, with auditory features ETL1 Related Information ... W, Nakken KO, Fischer C, Steinlein OK. Familial temporal lobe epilepsy with aphasic seizures and linkage to chromosome 10q22- ...

  13. A further patient with Pai syndrome with autosomal dominant inheritance?

    OpenAIRE

    Rudnik-Schöneborn, S; Zerres, K

    1994-01-01

    We report a patient with median cleft of the upper lip, cutaneous facial polyps, and lipoma of the corpus callosum who represents a further case of Pai syndrome. The father of the patient showed coloboma of the right iris and shared some facial dysmorphism with his son, thus raising the question of autosomal dominant inheritance.

  14. Case report: Autosomal dominant non-epidermolytic palmoplantar ...

    African Journals Online (AJOL)

    Palmoplantar keratoderma (PPK) is a hereditary cutaneous disorder characterized by a marked hyperkeratosis of the palms and soles. A variant that was inherited in an autosomal dominant form was highlighted in a 20-month-old girl-child. The proband was brought to the Paediatric Outpatient Department by her mother ...

  15. Myopathy

    Science.gov (United States)

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

  16. Autosomal dominant arteriopathy with sub cortical infarcts and leucoencephalopathy (CADASIL)

    International Nuclear Information System (INIS)

    Ojeda, Adriana; Tiezzi, Gerardo; Uriarte, Ana M.; Eguren, Leonor

    2002-01-01

    Cerebral autosomal dominant arteriopathy with sub cortical infarcts and leucoencephalopathy (CASADIL) is a systemic hereditary, vascular disease that involves small arteries. Recurrent ischemia, pseudo bulbar paralysis and dementia are characteristic. Other manifestations include migraine and depression. We report an Argentine family with VI generations with evidence of disease in IV. MR examinations were performed on 21 family members (both symptomatic and asymptomatic). The main findings on MR on symptomatic and asymptomatic patients were small lesions with high signal on T2 localised in periventricular white matter, brain stem, basal ganglia and thalamus, and confluent patches on white matter although with high signal on T2 images, usually symmetric. In conclusion we can assess that diffuse myelin loss and small infarcts occurring in cerebral autosomal dominant arteriopathy with subcortical infarcts and leucoencephalopathy well demonstrated with MR. In addition, some of the abnormalities in pre symptomatic patients can be identified on MR images. (author)

  17. Mutations in AAGAB underlie autosomal dominant punctate palmoplantar keratoderma.

    Science.gov (United States)

    Dinani, N; Ali, M; Liu, L; McGrath, J; Mellerio, J

    2017-04-01

    Punctate palmoplantar keratoderma type 1 (PPPK1) is a rare autosomal dominant inherited skin disease, characterized by multiple hyperkeratotic lesions on the palms and soles. The causative gene for PPPK1 has been identified as AAGAB, which encodes α- and γ-adaptin-binding protein p34. We describe the clinical features in three unrelated families with PPPK1, and report three recurrent causative mutations in AAGAB. © 2017 British Association of Dermatologists.

  18. Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

    Science.gov (United States)

    Naddaf, Elie; Waclawik, Andrew J

    2015-03-01

    Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

  19. Pathogenesis and potential therapy of autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    O.O. Melnyk

    2017-10-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is a hereditary disease characterized by progressive growth of the cyst and an increase in the total volume of the kidneys which leads to kidney failure. The main causes of ADPKD are mutations in the genes PKD1 and PKD2 which encode the formation of polycystin-1 and polycystin-2 proteins. There is a connection between structural and functional defects in the primary cilia with the ADPKD. The most promising drugs for the treatment of ADPKD today are vasopressin-2 receptor antagonists, m-TOR and c-AMP inhibitors.

  20. Gene therapy in animal models of autosomal dominant retinitis pigmentosa

    Science.gov (United States)

    Rossmiller, Brian; Mao, Haoyu

    2012-01-01

    Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406

  1. Autosomal dominant syndrome resembling Coffin-Siris syndrome.

    Science.gov (United States)

    Flynn, Maureen A; Milunsky, Jeff M

    2006-06-15

    Coffin-Siris syndrome is a multiple congenital anomaly/mental retardation syndrome with phenotypic variability [OMIM 135900]. The diagnosis is based solely on clinical findings, as there is currently no molecular, biochemical, or cytogenetic analysis available to confirm a diagnosis. Although typically described as an autosomal recessive disorder, autosomal dominant inheritance has also been infrequently reported. We describe a mother and her two daughters who all have features that resemble Coffin-Siris syndrome. However, this is not a completely convincing diagnosis given that hypertelorism is not a feature of Coffin-Siris syndrome and the family is relatively mildly affected. Yet, this family provides further evidence of an autosomal dominant mode of inheritance for a likely variant of Coffin-Siris syndrome (at least in some families). In addition, Sibling 1 had premature thelarche. She is the second reported individual within the spectrum of Coffin-Siris syndrome to have premature thelarche, indicating that it may be a rare clinical feature. Copyright 2006 Wiley-Liss, Inc.

  2. Evidence for autosomal dominant inheritance of ablepharon-macrostomia syndrome.

    Science.gov (United States)

    Rohena, Luis; Kuehn, Devon; Marchegiani, Shannon; Higginson, Jason D

    2011-04-01

    Ablepharon-macrostomia syndrome (AMS) is characterized by absent or short eyelids, macrostomia, ear anomalies, absent lanugo and hair, redundant skin, abnormal genitalia, and developmental delay in two-thirds of the reported patients. Additional anomalies include dry skin, growth retardation, hearing loss, camptodactyly, hypertelorism, absent zygomatic arches, and umbilical abnormalities. We present the second familial case of ablepharon-macrostomia syndrome in a newborn female and her 22-year-old father making autosomal dominant inheritance more likely than the previously proposed autosomal recessive transmission for this disorder. These cases likely represent the 16th and 17th reported cases of AMS and the first case suspected on prenatal ultrasound. Additionally, the child shows more prominent features of the disorder when compared to her father documenting variable expression and possible anticipation. This article is a US Government work and, as such, is in the public domain in the United States of America. Published 2011 Wiley-Liss, Inc.

  3. Autism in siblings with autosomal dominant nocturnal frontal lobe epilepsy.

    Science.gov (United States)

    Miyajima, Tomoko; Kumada, Tomohiro; Saito, Keiko; Fujii, Tatsuya

    2013-02-01

    In 1999, Hirose et al. reported a Japanese family with autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) associated with a neuronal nicotinic acetylcholine receptor α4 subunit mutation (S252L). We followed the siblings of this family, and found that the elder brother had Asperger's disorder without mental retardation (MR) and the younger brother had autistic disorder with profound MR. The clinical epileptic features of the siblings were very similar, and both had deficits in socialization, but their cognitive development differed markedly. It thus seems that epilepsy is the direct phenotype of the S252L mutation, whereas other various factors modulate the cognitive and social development. No patients with ADNFLE have previously been reported to have autism spectrum disorder or profound MR. Copyright © 2012 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  4. Autosomal dominant inheritance Caffey-Silverman disease hyperostosis corticalis infantum

    International Nuclear Information System (INIS)

    Rogoyski, A.; Jakubowska, K.; Tronowska, T.D.

    1984-01-01

    A case of Caffey-Silverman disease is described in an infant aged 4.5 months. The case was erroneously diagnosed in the initial stage of the disease as osteitis. The correct diagnosis was established after radiological examination of the skeleton. The pathological lesions involved the mandible, both clavicles, all ribs, left shoulder blade, both radial bones and left ulna. Follow-up radiological examination after 12 months demonstrated nearly complete disappearance of the previously observed skeletal changes. At the age of 18 months the condition of the child was good and its development was normal. Radiological changes indicating past Caffey-Silverman disease were disclosed in the mother and maternal grandmother of the child. This indicates an autosomal dominant type of inheritance of the disease. (Author)

  5. A Japanese Family With Autosomal Dominant Oculocutaneous Albinism Type 4.

    Science.gov (United States)

    Oki, Ryoko; Yamada, Kisaburo; Nakano, Satoko; Kimoto, Kenichi; Yamamoto, Ken; Kondo, Hiroyuki; Kubota, Toshiaki

    2017-02-01

    We report the clinical characteristics of a Japanese family with autosomal dominant oculocutaneous albinism and a SLC45A2 gene mutation. A total of 16 members of a Japanese family with general hypopigmentation and foveal hypoplasia underwent detailed clinical examinations. We evaluated the severity of foveal hypoplasia using spectral-domain optical coherence tomography (SD-OCT) and graded it according to the criteria of Thomas et al. DNA was extracted from 17 family members and used for genome-wide single nucleotide polymorphism genotyping and linkage analysis. Mutational search was performed for the SLC45A2 gene responsible for oculocutaneous albinism type 4 (OCA4). All 16 patients exhibited hypopigmentation of their hair and/or iris. They showed foveal hypoplasia, including 3 patients with grade 1 foveal hypoplasia, 7 with grade 2, and 6 with grade 3. No patient had grade 4 foveal hypoplasia. Optical coherence tomography showed macular ganglion cell complex thinning in the temporal area, and a slight reduction of visual field sensitivity in the centrotemporal area. A maximum multipoint parametric logarithm of the odds (LOD) score of approximately 2.00 to 3.56 was obtained on chromosome 5, spanning approximately 7.2 Mb between rs13187570 and rs395967 that included the SLC45A2 gene. All affected members showed a novel heterozygous variant, c.208T>C (p.Y70H), in the SLC45A2 gene, which supported a diagnosis of OCA4. The present study reports a very rare family with autosomal dominant OCA4 whose diagnosis was confirmed by a mutational analysis. Most family members exhibited mild general hypopigmentation and low-grade foveal hypoplasia.

  6. Monozygotic twins with CAPN5 autosomal dominant neovascular inflammatory vitreoretinopathy

    Directory of Open Access Journals (Sweden)

    Rowell HA

    2012-12-01

    Full Text Available Hannah A Rowell,1,2 Alexander G Bassuk,3,4 Vinit B Mahajan1,21Omics Laboratory, 2Department of Ophthalmology and Visual Sciences, 3Department of Pediatrics, 4Department of Neurology, University of Iowa, Iowa City, IA, USABackground: The purpose of this study was to describe the clinical findings in a set of monozygotic twins with autosomal dominant neovascular inflammatory vitreoretinopathy (ADNIV over a 23-year period.Methods: A pair of female twins were examined between 26 and 49 years of age. The concordance and discordance of their clinical features were determined. The CAPN5 gene was sequenced using genomic DNA.Results: Both twins of an affected father demonstrated Stage I ADNIV with mild vitreous cells and a negative b-wave on electroretinography. Genetic analysis confirmed a guanine to thymine nucleotide (c.728G>T, pArg243Leu mutation in the CAPN5 gene. Over the course of 23 years, each twin progressed to stage III disease, showing posterior uveitis, cystoid macular edema, intraocular fibrosis, early retinal neovascularization, retinal degeneration, and cataract. Disease progression varied moderately between each twin and was asymmetrical between eyes. Twin A had 20/70 and 20/125 in the right and left eye, respectively, and underwent vitrectomy surgery and intravitreal injections with bevacizumab for recurrent cystoid macular edema. Twin B maintained 20/20 and 20/40 in the right and left eye, respectively without intervention.Conclusion: There was asymmetry between the eyes and some discordance in the rate of disease progression in these monozygotic twins with ADNIV. The overall high disease concordance suggests genetic factors play a major role in clinical manifestations in CAPN5 vitreoretinopathy.Keywords: autosomal dominant neovascular inflammatory vitreoretinopathy, ADNIV, CAPN5, calpain-5, monozygotic twins

  7. Caffeine intake by patients with autosomal dominant polycystic kidney disease

    International Nuclear Information System (INIS)

    Vendramini, L.C.; Nishiura, J.L.; Baxmann, A.C.; Heilberg, I.P.

    2012-01-01

    Because caffeine may induce cyst and kidney enlargement in autosomal dominant polycystic kidney disease (ADPKD), we evaluated caffeine intake and renal volume using renal ultrasound in ADPKD patients. Caffeine intake was estimated by the average of 24-h dietary recalls obtained on 3 nonconsecutive days in 102 ADPKD patients (68 females, 34 males; 39 ± 12 years) and compared to that of 102 healthy volunteers (74 females, 28 males; 38 ± 14 years). The awareness of the need for caffeine restriction was assessed. Clinical and laboratory data were obtained from the medical records of the patients. Mean caffeine intake was significantly lower in ADPKD patients versus controls (86 vs 134 mg/day), and 63% of the ADPKD patients had been previously aware of caffeine restriction. Caffeine intake did not correlate with renal volume in ADPKD patients. There were no significant differences between the renal volumes of patients in the highest and lowest tertiles of caffeine consumption. Finally, age-adjusted multiple linear regression revealed that renal volume was associated with hypertension, chronic kidney disease stage 3 and the time since diagnosis, but not with caffeine intake. The present small cross-sectional study indicated a low level of caffeine consumption by ADPKD patients when compared to healthy volunteers, which was most likely due to prior awareness of the need for caffeine restriction. Within the range of caffeine intake observed by ADPKD patients in this study (0-471 mg/day), the renal volume was not directly associated with caffeine intake

  8. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  9. Caffeine intake by patients with autosomal dominant polycystic kidney disease

    Energy Technology Data Exchange (ETDEWEB)

    Vendramini, L.C.; Nishiura, J.L.; Baxmann, A.C.; Heilberg, I.P. [Disciplina de Nefrologia, Departamento de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil)

    2012-07-20

    Because caffeine may induce cyst and kidney enlargement in autosomal dominant polycystic kidney disease (ADPKD), we evaluated caffeine intake and renal volume using renal ultrasound in ADPKD patients. Caffeine intake was estimated by the average of 24-h dietary recalls obtained on 3 nonconsecutive days in 102 ADPKD patients (68 females, 34 males; 39 ± 12 years) and compared to that of 102 healthy volunteers (74 females, 28 males; 38 ± 14 years). The awareness of the need for caffeine restriction was assessed. Clinical and laboratory data were obtained from the medical records of the patients. Mean caffeine intake was significantly lower in ADPKD patients versus controls (86 vs 134 mg/day), and 63% of the ADPKD patients had been previously aware of caffeine restriction. Caffeine intake did not correlate with renal volume in ADPKD patients. There were no significant differences between the renal volumes of patients in the highest and lowest tertiles of caffeine consumption. Finally, age-adjusted multiple linear regression revealed that renal volume was associated with hypertension, chronic kidney disease stage 3 and the time since diagnosis, but not with caffeine intake. The present small cross-sectional study indicated a low level of caffeine consumption by ADPKD patients when compared to healthy volunteers, which was most likely due to prior awareness of the need for caffeine restriction. Within the range of caffeine intake observed by ADPKD patients in this study (0-471 mg/day), the renal volume was not directly associated with caffeine intake.

  10. Preimplantation Genetic Diagnosis Counseling in Autosomal Dominant Polycystic Kidney Disease.

    Science.gov (United States)

    Murphy, Erin L; Droher, Madeline L; DiMaio, Miriam S; Dahl, Neera K

    2018-03-30

    Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common hereditary forms of chronic kidney disease. Mutations within PKD1 or PKD2 lead to innumerable fluid-filled cysts in the kidneys and in some instances, end-stage renal disease (ESRD). Affected individuals have a 50% chance of passing the mutation to each of their offspring. Assisted reproductive technology using preimplantation genetic diagnosis (PGD) allows these individuals to reduce this risk to 1% to 2%. We assess the disease burden of 8 individuals with ADPKD who have undergone genetic testing in preparation for PGD. Clinical features that predict high risk for progression to ESRD in patients with ADPKD include genotype, early onset of hypertension, a urologic event before age 35 years, and a large height-adjusted total kidney volume. Patients may have a family history of intracranial aneurysms or complications involving hepatic cysts, which may further influence the decision to pursue PGD. We also explore the cost, risks, and benefits of using PGD. All patients with ADPKD of childbearing potential, regardless of risk for progression to ESRD or risk for a significant disease burden, will likely benefit from genetic counseling. Copyright © 2018 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  11. Autosomal dominant familial erythrocytosis due to autonomous erythropoietin production

    International Nuclear Information System (INIS)

    Distelhorst, C.W.; Wagner, D.S.; Goldwasser, E.; Adamson, J.W.

    1981-01-01

    A family is described in which four members spanning three consecutive generations have erythrocytosis associated with a normal hemoglobin oxygen affinity. When bone marrow from one affected family member was cultured in vitro, erythroid colonies formed only when erythropoietin was added to the culture. Serum erythropoietin, measured by radioimmunoassay, was significantly elevated above normal in each of the affected family members. Bioassayable erythropoietin was detected in the urine of two of the three affected family members. In two of the affected family members, erythropoietin was measured in serum by radioimmunoassay and in urine by bioassay before and for 4 days following an isovolemic phlebotomy, which reduced the red cell mass by 20%. Neither serum nor urinary erythropoietin levels changed following phlebotomy. The erythrocytosis in this family appears to be secondary to inappropriately increased erythropoietin production unassociated with a decrease in the blood oxygen-carrying capacity. This is the first instance in which autonomous erythropoietin production appears to be inherited on an autosomal dominant basis

  12. Is Autosomal Dominant Polycystic Kidney Disease Becoming a Pediatric Disorder?

    Directory of Open Access Journals (Sweden)

    Stéphanie De Rechter

    2017-12-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD affects 1 in 400 to 1,000 live births, making it the most common monogenic cause of renal failure. Although no definite cure is available yet, it is important to affect disease progression by influencing modifiable factors such as hypertension and proteinuria. Besides this symptomatic management, the only drug currently recommended in Europe for selected adult patients with rapid disease progression, is the vasopressin receptor antagonist tolvaptan. However, the question remains whether these preventive interventions should be initiated before extensive renal damage has occurred. As renal cyst formation and expansion begins early in life, frequently in utero, ADPKD should no longer be considered an adult-onset disease. Moreover, the presence of hypertension and proteinuria in affected children has been reported to correlate well with disease severity. Until now, it is controversial whether children at-risk for ADPKD should be tested for the presence of the disease, and if so, how this should be done. Herein, we review the spectrum of pediatric ADPKD and discuss the pro and contra of testing at-risk children and the challenges and unmet needs in pediatric ADPKD care.

  13. Monozygotic twins with CAPN5 autosomal dominant neovascular inflammatory vitreoretinopathy.

    Science.gov (United States)

    Rowell, Hannah A; Bassuk, Alexander G; Mahajan, Vinit B

    2012-01-01

    The purpose of this study was to describe the clinical findings in a set of monozygotic twins with autosomal dominant neovascular inflammatory vitreoretinopathy (ADNIV) over a 23-year period. A pair of female twins were examined between 26 and 49 years of age. The concordance and discordance of their clinical features were determined. The CAPN5 gene was sequenced using genomic DNA. Both twins of an affected father demonstrated Stage I ADNIV with mild vitreous cells and a negative b-wave on electroretinography. Genetic analysis confirmed a guanine to thymine nucleotide (c.728G>T, pArg243Leu) mutation in the CAPN5 gene. Over the course of 23 years, each twin progressed to stage III disease, showing posterior uveitis, cystoid macular edema, intraocular fibrosis, early retinal neovascularization, retinal degeneration, and cataract. Disease progression varied moderately between each twin and was asymmetrical between eyes. Twin A had 20/70 and 20/125 in the right and left eye, respectively, and underwent vitrectomy surgery and intravitreal injections with bevacizumab for recurrent cystoid macular edema. Twin B maintained 20/20 and 20/40 in the right and left eye, respectively without intervention. There was asymmetry between the eyes and some discordance in the rate of disease progression in these monozygotic twins with ADNIV. The overall high disease concordance suggests genetic factors play a major role in clinical manifestations in CAPN5 vitreoretinopathy.

  14. Autosomal dominant cyclic hematopoiesis: Genetics, phenotype, and natural history

    Energy Technology Data Exchange (ETDEWEB)

    Palmer, S.E.; Stephens, K.; Dale, D.C. [Univ. of Washington, Seattle, WA (United States)

    1994-09-01

    Autosomal dominant cyclic hematopoiesis (ADCH; cyclic neutropenia) is a rare disorder manifested by transient neutropenia that recurs every three weeks. To facilitate mapping the ADCH gene by genetic linkage analysis, we studied 9 ADCH families with 42 affected individuals. Pedigrees revealed AD inheritance with no evidence for decreased penetrance. Similar intra- and interfamilial variable expression was observed, with no evidence to support heterogeneity. At least 3 families displayed apparent new mutations. Many adults developed chronic neutropenia, while offspring always cycled during childhood. Children displayed recurrent oral ulcers, gingivitis, lymphadenopathy, fever, and skin and other infections with additional symptoms. Interestingly, there were no cases of neonatal infection. Some children required multiple hospitalizations for treatment. Four males under age 18 died of Clostridium sepsis following necrotizing enterocolitis; all had affected mothers. No other deaths due to ADCH were found; most had improvement of symptoms and infections as adults. Adults experienced increased tooth loss prior to age 30 (16 out of 27 adults, with 9 edentulous). No increase in myelodysplasia, malignancy, or congenital anomalies was observed. Recombinant G-CSF treatment resulted in dramatic improvement of symptoms and infections. The results suggest that ADCH is not a benign disorder, especially in childhood, and abdominal pain requires immediate evaluation. Diagnosis of ADCH requires serial blood counts in the proband and at least one CBC in relatives to exclude similar disorders. Genetic counseling requires specific histories as well as CBCs of each family member at risk to determine status regardless of symptom history, especially to assess apparent new mutations.

  15. Subjective memory complaints in preclinical autosomal dominant Alzheimer disease.

    Science.gov (United States)

    Norton, Daniel J; Amariglio, Rebecca; Protas, Hillary; Chen, Kewei; Aguirre-Acevedo, Daniel C; Pulsifer, Brendan; Castrillon, Gabriel; Tirado, Victoria; Munoz, Claudia; Tariot, Pierre; Langbaum, Jessica B; Reiman, Eric M; Lopera, Francisco; Sperling, Reisa A; Quiroz, Yakeel T

    2017-10-03

    To cross-sectionally study subjective memory complaints (SMC) in autosomal dominant Alzheimer disease (ADAD). We examined self-reported and study partner-based SMC in 52 young, cognitively unimpaired individuals from a Colombian kindred with early-onset ADAD. Twenty-six carried the PSEN-1 E280A mutation, averaging 7 years of age younger than the kindred's expected clinical onset. Twenty-six were age-matched noncarriers. Participants also underwent structural MRI and cognitive testing. Self-reported SMC were greater in carriers than noncarriers ( p = 0.02). Study partner-based SMC did not differ between groups ( p = 0.21), but in carriers increased with age ( r = 0.66, p < 0.001) and decreased with hippocampal volume ( r = -0.35, p = 0.08). Cognitively unimpaired PSEN-1 carriers have elevated SMC. Self-reported SMC may be a relatively early indicator of preclinical AD, while partner- reported SMC increases later in preclinical AD, closer to clinical onset. © 2017 American Academy of Neurology.

  16. [A family with autosomal dominant temporal lobe epilepsy accompanied by motor and sensory neuropathy].

    Science.gov (United States)

    Matsuoka, Takeshi; Furuya, Hirokazu; Ikezoe, Koji; Murai, Hiroyuki; Ohyagi, Yasumasa; Yoshiura, Takashi; Sasaki, Masayuki; Tobimatsu, Syozo; Kira, Jun-ichi

    2004-01-01

    We report a 20-year-old man with temporal lobe epilepsy (TLE) accompanied by hereditary motor and sensory neuropathy (HMSN). He had experienced complex partial seizures (CPS), which started with a nausea-like feeling, followed by loss of consciousness and automatism, since he was 6 years old. The frequency of attacks was at first decreased by phenytoin. However, attacks increased again when he was 18 years old. On admission, neurological examination showed mild weakness of the toes, pes cavus, hammer toe and mildly impaired vibratory sensation in his legs. Ten people in four generations of his family showed a history of epilepsy in the autosomal dominant inheritance form. His younger sister and mother had a history of epilepsy accompanied with pes cavus, hammer toe, weakness of toe and finger extension and mildly impaired vibratory sensation as well. Direct sequencing of the glioma-inactivated leucine-rich gene (LGI1), in which several mutations were reported in patients with familial lateral temporal lobe epilepsy, showed no specific mutation in this family. On consecutive video-EEG monitoring, paroxysmal rhythmic activity was confirmed in his left fronto-temporal region when he showed automatism, and then a generalized slow burst activity was detected when he lost consciousness. For his seizures, TLE with secondary generalization was diagnosed. In the nerve conduction study, delayed nerve conduction, distal motor latency and decreased amplitudes of the compound muscle action potentials (CMAP) of bilateral peroneal nerves were observed, indicating the existence of mild axonal degeneration. Based on these data, we consider that this family to be a new phenotype of autosomal dominant TLE accompanied by motor and sensory neuropathy.

  17. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Science.gov (United States)

    Yatabe, K; Kawai, M

    1997-08-01

    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  18. Molecular and cellular pathogenesis of autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    A.P. Bastos

    2011-07-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is one of the most common human life-threatening monogenic disorders. The disease is characterized by bilateral, progressive renal cystogenesis and cyst and kidney enlargement, often leading to end-stage renal disease, and may include extrarenal manifestations. ADPKD is caused by mutation in one of two genes, PKD1 and PKD2, which encode polycystin-1 (PC1 and polycystin-2 (PC2, respectively. PC2 is a non-selective cation channel permeable to Ca2+, while PC1 is thought to function as a membrane receptor. The cyst cell phenotype includes increased proliferation and apoptosis, dedifferentiation, defective planar polarity, and a secretory pattern associated with extracellular matrix remodeling. The two-hit model for cyst formation has been recently extended by the demonstration that early gene inactivation leads to rapid and diffuse development of renal cysts, while inactivation in adult life is followed by focal and late cyst formation. Renal ischemia/reperfusion, however, can function as a third hit, triggering rapid cyst development in kidneys with Pkd1 inactivation induced in adult life. The PC1-PC2 complex behaves as a sensor in the primary cilium, mediating signal transduction via Ca2+ signaling. The intracellular Ca2+ homeostasis is impaired in ADPKD, being apparently responsible for the cAMP accumulation and abnormal cell proliferative response to cAMP. Activated mammalian target for rapamycin (mTOR and cell cycle dysregulation are also significant features of PKD. Based on the identification of pathways altered in PKD, a large number of preclinical studies have been performed and are underway, providing a basis for clinical trials in ADPKD and helping the design of future trials.

  19. Prenatal diagnosis of recurrent autosomal dominant osteogenesis imperfecta associated with unaffected parents and paternal gonadal mosaicism

    Directory of Open Access Journals (Sweden)

    Chih-Ping Chen

    2013-03-01

    Conclusion: Recurrent autosomal dominant OI may occur in the offspring of unaffected parents with parental gonadal mosaicism. Genetic counseling of recurrent autosomal dominant OI should include a thorough mutational analysis of the family members, and mutational analysis of the sperm may detect paternal gonadal mosaicism for the mutation.

  20. Chorioretinal dysplasia-microcephaly-mental retardation syndrome : Another family with autosomal dominant inheritance

    NARCIS (Netherlands)

    Hordijk, R; VandeLogt, F; Houtman, WA; VanEssen, AJ

    1996-01-01

    We describe a boy and his father with the chorioretinal dysplasia-microcephaly-mental retardation syndrome (CDMMS). Our report extends the phenotypic spectrum of autosomal dominant CDMMS by describing microphthalmia for the first time in an autosomal dominant family. The boy was also severely

  1. Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

    International Nuclear Information System (INIS)

    Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu

    1987-01-01

    Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.)

  2. Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu

    1987-03-01

    Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.).

  3. A newly recognized autosomal dominant limb girdle muscular dystrophy with cardiac involvement

    NARCIS (Netherlands)

    van der Kooi, A. J.; Ledderhof, T. M.; de Voogt, W. G.; Res, C. J.; Bouwsma, G.; Troost, D.; Busch, H. F.; Becker, A. E.; de Visser, M.

    1996-01-01

    Sixty-five members of three families with limb girdle muscular dystrophy (LGMD) underwent neurological, cardiological, and ancillary investigations. Thirty-five individuals were diagnosed as having slowly progressive autosomal dominant LGMD. Symmetrical weakness started in the proximal lower limb

  4. Imaging of the Macula Indicates Early Completion of Structural Deficit in Autosomal-Dominant Optic Atrophy

    DEFF Research Database (Denmark)

    Rönnbäck, Cecilia; Milea, Dan; Larsen, Michael

    2013-01-01

    Optical coherence tomography (OCT) enables 3-dimensional imaging of the retina, including the layer of ganglion cells that supplies the optic nerve with its axons. We tested OCT as means of diagnosing and phenotyping autosomal-dominant optic atrophy (ADOA)....

  5. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Energy Technology Data Exchange (ETDEWEB)

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

    1995-08-28

    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  6. An 11-Year-Old Child with Autosomal Dominant Polycystic Kidney Disease Who Presented with Nephrolithiasis

    Directory of Open Access Journals (Sweden)

    Fatih Firinci

    2012-01-01

    Full Text Available Patients with autosomal dominant polycystic kidney disease become symptomatic and are diagnosed usually at adulthood. The rate of nephrolithiasis in these patients is 5–10 times the rate in the general population, and both anatomic and metabolic abnormalities play role in the formation of renal stones. However, nephrolithiasis is rare in childhood age group. In this paper, an 11-year-old child with autosomal dominant polycystic kidney disease presenting with nephrolithiasis is discussed.

  7. Autosomal dominant spastic paraplegia with peripheral neuropathy maps to chr12q23-24.

    Science.gov (United States)

    Schüle, R; Bonin, M; Dürr, A; Forlani, S; Sperfeld, A D; Klimpe, S; Mueller, J C; Seibel, A; van de Warrenburg, B P; Bauer, P; Schöls, L

    2009-06-02

    Hereditary spastic paraplegias (HSP) are genetically exceedingly heterogeneous. To date, 37 genetic loci for HSP have been described (SPG1-41), among them 16 loci for autosomal dominant disease. Notwithstanding, further genetic heterogeneity is to be expected in HSP, as various HSP families do not link to any of the known HSP loci. In this study, we aimed to map the disease locus in a German family segregating autosomal dominant complicated HSP. A genome-wide linkage analysis was performed using the GeneChip Mapping 10Kv2.0 Xba Array containing 10,204 SNP markers. Suggestive loci were further analyzed by mapping of microsatellite markers. One locus on chromosome 12q23-24, termed SPG36, was confirmed by high density microsatellite fine mapping with a significant LOD score of 3.2. SPG36 is flanked by markers D12S318 and D12S79. Linkage to SPG36 was excluded in >20 additional autosomal dominant HSP families. Candidate genes were selected and sequenced. No disease-causing mutations were identified in the coding regions of ATXN2, HSPB8, IFT81, Myo1H, UBE3B, and VPS29. SPG36 is complicated by a sensory and motor neuropathy; it is therefore the eighth autosomal dominant subtype of complicated HSP. We report mapping of a new locus for autosomal dominant hereditary spastic paraplegia (HSP) (SPG36) on chromosome 12q23-24 in a German family with autosomal dominant HSP complicated by peripheral neuropathy.

  8. Clinical and Radiological Findings of Autosomal Dominant Osteopetrosis Type II: A Case Report

    Directory of Open Access Journals (Sweden)

    Priyanka Kant

    2013-01-01

    Full Text Available Osteopetrosis is a rare inherited genetic disease characterized by sclerosis of the skeleton caused by the absence or malfunction of osteoclasts. Three distinct forms of the disease have been recognized, autosomal dominant osteopetrosis being the most common. Autosomal dominant osteopetrosis exhibits a heterogeneous trait with milder symptoms, often at later childhood or adulthood. The aim of this case report is to present the clinical and radiographic features of a 35-year-old female patient with autosomal dominant osteopetrosis type II who exhibited features of chronic generalised periodontitis, and the radiographs revealed generalised osteosclerosis and hallmark radiographic features of ADO type II, that is, “bone-within-bone appearance” and “Erlenmeyer-flask deformity.”

  9. Management of pain in autosomal dominant polycystic kidney disease and anatomy of renal innervation.

    Science.gov (United States)

    Tellman, Matthew W; Bahler, Clinton D; Shumate, Ashley M; Bacallao, Robert L; Sundaram, Chandru P

    2015-05-01

    Chronic pain is a prominent feature of autosomal dominant polycystic kidney disease that is difficult to treat and manage, often resulting in a decrease in quality of life. Understanding the underlying anatomy of renal innervation and the various etiologies of pain that occur in autosomal dominant polycystic kidney disease can help guide proper treatments to manage pain. Reviewing previously studied treatments for pain in autosomal dominant polycystic kidney disease can help characterize treatment in a stepwise fashion. We performed a literature search of the etiology and management of pain in autosomal dominant polycystic kidney disease and the anatomy of renal innervation using PubMed® and Embase® from January 1985 to April 2014 with limitations to human studies and English language. Pain occurs in the majority of patients with autosomal dominant polycystic kidney disease due to renal, hepatic and mechanical origins. Patients may experience different types of pain which can make it difficult to clinically confirm its etiology. An anatomical and histological evaluation of the complex renal innervation helps in understanding the mechanisms that can lead to renal pain. Understanding the complex nature of renal innervation is essential for surgeons to perform renal denervation. The management of pain in autosomal dominant polycystic kidney disease should be approached in a stepwise fashion. Acute causes of renal pain must first be ruled out due to the high incidence in autosomal dominant polycystic kidney disease. For chronic pain, nonopioid analgesics and conservative interventions can be used first, before opioid analgesics are considered. If pain continues there are surgical interventions such as renal cyst decortication, renal denervation and nephrectomy that can target pain produced by renal or hepatic cysts. Chronic pain in patients with autosomal dominant polycystic kidney disease is often refractory to conservative, medical and other noninvasive treatments

  10. Genomic deletions in OPA1 in Danish patients with autosomal dominant optic atrophy

    DEFF Research Database (Denmark)

    Almind, Gitte J; Grønskov, Karen; Milea, Dan

    2011-01-01

    Autosomal dominant optic atrophy (ADOA, Kjer disease, MIM #165500) is the most common form of hereditary optic neuropathy. Mutations in OPA1 located at chromosome 3q28 are the predominant cause for ADOA explaining between 32 and 89% of cases. Although deletions of OPA1 were recently reported...

  11. Autosomal dominant spastic paraplegia with peripheral neuropathy maps to chr12q23-24.

    NARCIS (Netherlands)

    Schule, R.; Bonin, M.; Durr, A.; Forlani, S.; Sperfeld, A.D.; Klimpe, S.; Mueller, J.C.; Seibel, A.; Warrenburg, B.P.C. van de; Bauer, P.; Schols, L.

    2009-01-01

    OBJECTIVE: Hereditary spastic paraplegias (HSP) are genetically exceedingly heterogeneous. To date, 37 genetic loci for HSP have been described (SPG1-41), among them 16 loci for autosomal dominant disease. Notwithstanding, further genetic heterogeneity is to be expected in HSP, as various HSP

  12. A novel mutation in the ELOVL4 gene causes autosomal dominant Stargardt-like macular dystrophy.

    NARCIS (Netherlands)

    Maugeri, A.; Meire, F.; Hoyng, C.B.; Vink, C.W.; Regemorter, N. van; Karan, G.; Yang, Z.; Cremers, F.P.M.; Zhang, K.

    2004-01-01

    PURPOSE: To conduct clinical and genetic studies in a European family with autosomal dominant Stargardt-like macular dystrophy (adSTGD-like MD) and to investigate the functional consequences of a novel ELOVL4 mutation. METHODS: Ophthalmic examination and mutation screening by direct sequencing of

  13. Cellular Energy Pathways as Novel Targets for the Therapy of Autosomal Dominant Polycystic Kidney Disease

    Science.gov (United States)

    2017-09-01

    Autosomal Dominant Polycystic Kidney Disease (ADPKD) is the most prevalent genetic disease, affecting at least 600,000 Americans . It is characterized...Pennathur, Michigan Metabolomics and Obesity Center (MMOC) at U. Michigan and statistical consultation from Dr. K. Abebe at U. Pittsburgh. Cell

  14. Current novel-gene-finding strategy for autosomal-dominant hypercholesterolaemia needs refinement

    NARCIS (Netherlands)

    Fouchier, Sigrid W.; Hutten, Barbara A.; Defesche, Joep C.

    2015-01-01

    Autosomal-dominant hypercholesterolaemia (ADH) is a heterogeneous common disorder, and uncovering the molecular determinants that underlie ADH is a major focus of cardiovascular research. However, despite rapid technical advances, efforts to identify novel ADH genes have yet not been very successful

  15. Plasma lipoprotein(a) levels in patients with homozygous autosomal dominant hypercholesterolemia

    NARCIS (Netherlands)

    Sjouke, Barbara; Yahya, Reyhana; Tanck, Michael W. T.; Defesche, Joep C.; de Graaf, Jacqueline; Wiegman, Albert; Kastelein, John J. P.; Mulder, Monique T.; Hovingh, G. Kees; Roeters van Lennep, Jeanine E.

    2017-01-01

    Patients with autosomal dominant hypercholesterolemia (ADH), caused by mutations in either low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), or proprotein convertase subtilisin-kexin type 9 (PCSK9) are characterized by high low-density lipoprotein cholesterol levels and in some

  16. Plasma lipoprotein(a) levels in patients with homozygous autosomal dominant hypercholesterolemia

    NARCIS (Netherlands)

    Sjouke, B.; Yahya, R.; Tanck, M.W.T.; Defesche, J.C.; Graaf, J. de; Wiegman, A.; Kastelein, J.J.; Mulder, M.T.; Hovingh, G.K.; Roeters van Lennep, J.E.

    2017-01-01

    BACKGROUND: Patients with autosomal dominant hypercholesterolemia (ADH), caused by mutations in either low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), or proprotein convertase subtilisin-kexin type 9 (PCSK9) are characterized by high low-density lipoprotein cholesterol levels and

  17. A new mutation causing autosomal dominant periodic fever syndrome in a Danish family

    DEFF Research Database (Denmark)

    Weyhreter, Heike; Schwartz, Marianne; Kristensen, Tim D

    2003-01-01

    We describe four members in a family of 8 individuals over 3 generations with the autosomal dominant inherited periodic fever syndrome tumor necrosis factor receptor-associated periodic syndrome (TRAPS). The patients had recurrent episodes of fever, abdominal pain, arthritis, and rash. We examined...

  18. [Clinical and molecular study in a family with autosomal dominant hypohidrotic ectodermal dysplasia].

    Science.gov (United States)

    Callea, Michele; Cammarata-Scalisi, Francisco; Willoughby, Colin E; Giglio, Sabrina R; Sani, Ilaria; Bargiacchi, Sara; Traficante, Giovanna; Bellacchio, Emanuele; Tadini, Gianluca; Yavuz, Izzet; Galeotti, Angela; Clarich, Gabriella

    2017-02-01

    Hypohidrotic ectodermal dysplasia (HED) is a rare disease characterized by deficiency in development of structure derived from the ectoderm and is caused by mutations in the genes EDA, EDAR, or EDARADD. Phenotypes caused by mutations in these three may exhibit similar clinical features, explained by a common signaling pathway. Mutations in EDA gene cause X linked HED, which is the most common form. Mutations in EDAR and EDARADD genes cause autosomal dominant and recessive form of HED. The most striking clinical findings in HED are hypodontia, hypotrichosis and hypohidrosis that can lead to episodes of hyperthermia. We report on clinical findings in a child with HED with autosomal dominant inheritance pattern with a heterozygous mutation c.1072C>T (p.Arg358X) in the EDAR gene. A review of the literature with regard to other cases presenting the same mutation has been carried out and discussed. Sociedad Argentina de Pediatría.

  19. Cellular Energy Pathways as Novel Targets for the Therapy of Autosomal Dominant Polycystic Kidney Disease

    Science.gov (United States)

    2016-09-01

    pathways that are involved in cyst development and expansion. These experiments will make use of cultured ADPKD cells and a mouse model of ADPKD to...AWARD NUMBER: W81XWH-15-1-0420 TITLE: Cellular Energy Pathways as Novel Targets for the Therapy of Autosomal Dominant Polycystic Kidney Disease...PRINCIPAL INVESTIGATOR: Kenneth R. Hallows, MD, PhD, FASN CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90089-0701

  20. Molecular Diagnostics in Autosomal Dominant Polycystic Kidney Disease: Utility and Limitations

    Science.gov (United States)

    Zhao, Xiao; Paterson, Andrew D.; Zahirieh, Alireza; He, Ning; Wang, Kairong; Pei, York

    2008-01-01

    Background and objectives: Gene-based mutation screening is now available and has the potential to provide diagnostic confirmation or exclusion of autosomal dominant polycystic kidney disease. This study illustrates its utility and limitations in the clinical setting. Design, setting, participants, & measurements: Using a molecular diagnostic service, genomic DNA of one affected individual from each study family was screened for pathologic PKD1 and PKD2 mutations. Bidirectional sequencing was performed to identify sequence variants in all exons and splice junctions of both genes and to confirm the specific mutations in other family members. In two multiplex families, microsatellite markers were genotyped at both PDK1 and PKD2 loci, and pair-wise and multipoint linkage analysis was performed. Results: Three of five probands studied were referred for assessment of renal cystic disease without a family history of autosomal dominant polycystic kidney disease, and two others were younger at-risk members of families with autosomal dominant polycystic kidney disease being evaluated as living-related kidney donors. Gene-based mutation screening identified pathogenic mutations that provided confirmation or exclusion of disease in three probands, but in the other two, only unclassified variants were identified. In one proband in which mutation screening was indeterminate, DNA linkage studies provided strong evidence for disease exclusion. Conclusions: Gene-based mutation screening or DNA linkage analysis should be considered in individuals in whom the diagnosis of autosomal dominant polycystic kidney disease is uncertain because of a lack of family history or equivocal imaging results and in younger at-risk individuals who are being evaluated as living-related kidney donors. PMID:18077784

  1. Acute abdomen and ascites as presenting features of autosomal dominant polycystic kidney disease

    OpenAIRE

    Chaudhary, Sanjay; Qian, Qi

    2012-01-01

    We describe a patient with sudden onset of abdominal pain and ascites, leading to the diagnosis of autosomal dominant polycystic kidney disease (ADPKD). Her presentation was consistent with acute liver cyst rupture as the cause of her acute illness. A review of literature on polycystic liver disease in patients with ADPKD and current management strategies are presented. This case alerts physicians that ADPKD could occasionally present as an acute abdomen; cyst rupture related to ADPKD may be ...

  2. Cellular Energy Pathways as Novel Targets for the Therapy of Autosomal Dominant Polycystic Kidney Disease

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-15-1-0419 TITLE: Cellular Energy Pathways as Novel Targets for the Therapy of Autosomal Dominant Polycystic Kidney Disease...COVERED 1 Sep 2016 - 31 Aug 2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Cellular Energy Pathways as Novel Targets for the Therapy of Autosomal...inappropriate cell growth, fluid secretion, and dysregulation of cellular energy metabolism. The enzyme AMPK regulates a number of cellular pathways, including

  3. A new variant of spondylometaphyseal dysplasia with autosomal dominant mode of inheritance.

    OpenAIRE

    García-Castro, J M; Isales-Forsythe, C M; Díaz de Garau, P

    1982-01-01

    Clinical and radiographic evaluation of an infant boy and his father revealed findings suggesting a new variant of spondylometaphyseal dysplasia with an apparently autosomal dominant mode of inheritance. The main clinical findings included short stature and marked ligamentous laxity in the infant. X-ray findings included severe and peculiar multiple metaphyseal involvement and striking vertebral undermineralisation in the infant, and platyspondyly in the father. However, all the epiphyses wer...

  4. Autosomal dominant cortical tremor, myoclonus, and epilepsy (ADCME: Probable first family from India

    Directory of Open Access Journals (Sweden)

    Chandra Mohan Sharma

    2014-01-01

    Full Text Available Autosomal dominant cortical tremor, myoclonus, and epilepsy (ADCME is an extremely rare syndrome characterized by familial occurrence of postural and action-induced tremors of the hands but showing electrophysiologic findings of cortical reflex myoclonus. Patients also have cognitive decline and tonic-clonic seizures, often precipitated by sleep deprivation or photic stimulation. We describe probably the first family from India of this ill-defined syndrome.

  5. EDAR mutation in autosomal dominant hypohidrotic ectodermal dysplasia in two Swedish families

    Directory of Open Access Journals (Sweden)

    Schmitt-Egenolf Marcus

    2006-11-01

    Full Text Available Abstract Background Hypohidrotic ectodermal dysplasia (HED is a genetic disorder characterized by defective development of teeth, hair, nails and eccrine sweat glands. Both autosomal dominant and autosomal recessive forms of HED have previously been linked to mutations in the ectodysplasin 1 anhidrotic receptor (EDAR protein that plays an important role during embryogenesis. Methods The coding DNA sequence of the EDAR gene was analyzed in two large Swedish three-generational families with autosomal dominant HED. Results A non-sense C to T mutation in exon 12 was identified in both families. This disease-specific mutation changes an arginine amino acid in position 358 of the EDAR protein into a stop codon (p.Arg358X, thereby truncating the protein. In addition to the causative mutation two polymorphisms, not associated with the HED disorder, were also found in the EDAR gene. Conclusion The finding of the p.Arg358X mutation in the Swedish families is the first corroboration of a previously described observation in an American family. Thus, our study strengthens the role of this particular mutation in the aetiology of autosomal dominant HED and confirms the importance of EDAR for the development of HED.

  6. Further evidence for P59L mutation in GJA3 associated with autosomal dominant congenital cataract

    Directory of Open Access Journals (Sweden)

    Li Wang

    2016-01-01

    Full Text Available Context: Congenital cataracts are one of the common eye disorders leading to visual impairment or blindness in children worldwide. We found a Chinese family with autosomal dominant pulverulent cataract. Aims: To identify the pathogenic gene mutation in a Chinese family with autosomal dominant inherited pulverulent cataract. Subjects and Methods: After obtained informed consent, detailed ophthalmic examinations were carried out; genomic DNAs were obtained from seven family members in a three-generation Chinese family with three affected. All exons of candidate genes were amplified by polymerase chain reaction and were sequenced performed by bidirectional sequencing. Results: By sequencing the encoding regions of the candidate genes, a missense mutation (c. 176C>T was detected in gap junction protein alpha 3 genes (GJA3, which resulted in the substitution of highly conserved proline by leucine at codon 59 (p.P59L. The mutation co-segregated with all patients and was absent in 100 normal Chinese controls. Conclusions: The study identified a missense mutation (c. 176C>T in GJA3 gene associated with autosomal dominant congenital pulverulent cataract in a Chinese family. It gave further evidence of phenotype heterogeneity for P59L mutation in GJA3 associated with congenital cataract.

  7. Autosomal dominant hypercalciuria in a mouse model due to a mutation of the epithelial calcium channel, TRPV5.

    Directory of Open Access Journals (Sweden)

    Nellie Y Loh

    Full Text Available Hypercalciuria is a major cause of nephrolithiasis, and is a common and complex disorder involving genetic and environmental factors. Identification of genetic factors for monogenic forms of hypercalciuria is hampered by the limited availability of large families, and to facilitate such studies, we screened for hypercalciuria in mice from an N-ethyl-N-nitrosourea mutagenesis programme. We identified a mouse with autosomal dominant hypercalciuria (HCALC1. Linkage studies mapped the Hcalc1 locus to a 11.94 Mb region on chromosome 6 containing the transient receptor potential cation channel, subfamily V, members 5 (Trpv5 and 6 (Trpv6 genes. DNA sequence analysis of coding regions, intron-exon boundaries and promoters of Trpv5 and Trpv6 identified a novel T to C transition in codon 682 of TRPV5, mutating a conserved serine to a proline (S682P. Compared to wild-type littermates, heterozygous (Trpv5(682P/+ and homozygous (Trpv5(682P/682P mutant mice had hypercalciuria, polyuria, hyperphosphaturia and a more acidic urine, and ∼10% of males developed tubulointerstitial nephritis. Trpv5(682P/682P mice also had normal plasma parathyroid hormone but increased 1,25-dihydroxyvitamin D(3 concentrations without increased bone resorption, consistent with a renal defect for the hypercalciuria. Expression of the S682P mutation in human embryonic kidney cells revealed that TRPV5-S682P-expressing cells had a lower baseline intracellular calcium concentration than wild-type TRPV5-expressing cells, suggesting an altered calcium permeability. Immunohistological studies revealed a selective decrease in TRPV5-expression from the renal distal convoluted tubules of Trpv5(682P/+ and Trpv5(682P/682P mice consistent with a trafficking defect. In addition, Trpv5(682P/682P mice had a reduction in renal expression of the intracellular calcium-binding protein, calbindin-D(28K, consistent with a specific defect in TRPV5-mediated renal calcium reabsorption. Thus, our findings

  8. Diverging longitudinal changes in astrocytosis and amyloid PET in autosomal dominant Alzheimer's disease.

    Science.gov (United States)

    Rodriguez-Vieitez, Elena; Saint-Aubert, Laure; Carter, Stephen F; Almkvist, Ove; Farid, Karim; Schöll, Michael; Chiotis, Konstantinos; Thordardottir, Steinunn; Graff, Caroline; Wall, Anders; Långström, Bengt; Nordberg, Agneta

    2016-03-01

    Alzheimer's disease is a multifactorial dementia disorder characterized by early amyloid-β, tau deposition, glial activation and neurodegeneration, where the interrelationships between the different pathophysiological events are not yet well characterized. In this study, longitudinal multitracer positron emission tomography imaging of individuals with autosomal dominant or sporadic Alzheimer's disease was used to quantify the changes in regional distribution of brain astrocytosis (tracer (11)C-deuterium-L-deprenyl), fibrillar amyloid-β plaque deposition ((11)C-Pittsburgh compound B), and glucose metabolism ((18)F-fluorodeoxyglucose) from early presymptomatic stages over an extended period to clinical symptoms. The 52 baseline participants comprised autosomal dominant Alzheimer's disease mutation carriers (n = 11; 49.6 ± 10.3 years old) and non-carriers (n = 16; 51.1 ± 14.2 years old; 10 male), and patients with sporadic mild cognitive impairment (n = 17; 61.9 ± 6.4 years old; nine male) and sporadic Alzheimer's disease (n = 8; 63.0 ± 6.5 years old; five male); for confidentiality reasons, the gender of mutation carriers is not revealed. The autosomal dominant Alzheimer's disease participants belonged to families with known mutations in either presenilin 1 (PSEN1) or amyloid precursor protein (APPswe or APParc) genes. Sporadic mild cognitive impairment patients were further divided into (11)C-Pittsburgh compound B-positive (n = 13; 62.0 ± 6.4; seven male) and (11)C-Pittsburgh compound B-negative (n = 4; 61.8 ± 7.5 years old; two male) groups using a neocortical standardized uptake value ratio cut-off value of 1.41, which was calculated with respect to the cerebellar grey matter. All baseline participants underwent multitracer positron emission tomography scans, cerebrospinal fluid biomarker analysis and neuropsychological assessment. Twenty-six of the participants underwent clinical and imaging follow-up examinations after 2.8 ± 0.6 years. By using linear

  9. C-terminal truncations in human 3 '-5 ' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

    NARCIS (Netherlands)

    Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schaefer, Ruth; Stam, Anine H.; Haan, Joost; Paulus, T. V. M. de Jong; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

    Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle- age onset. In nine families, we identified heterozygous C- terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

  10. Vasopressin, Copeptin, and Renal Concentrating Capacity in Patients with Autosomal Dominant Polycystic Kidney Disease without Renal Impairment

    NARCIS (Netherlands)

    Zittema, Debbie; Boertien, Wendy E.; van Beek, Andre P.; Dullaart, Robin P. F.; Franssen, Casper F. M.; de Jong, Paul E.; Meijer, Esther; Gansevoort, Ron T.

    Background and objectives Autosomal dominant polycystic kidney disease (ADPKD) is the most prevalent hereditary renal disease, characterized by cyst formation in the kidneys leading to end stage kidney failure. It is clinically acknowledged that ADPKD patients have impaired urine concentrating

  11. Kidney Function and Plasma Copeptin Levels in Healthy Kidney Donors and Autosomal Dominant Polycystic Kidney Disease Patients

    NARCIS (Netherlands)

    Zittema, Debbie; van den Berg, Else; Meijer, Esther; Boertien, Wendy E.; Muller Kobold, Anneke C.; Franssen, Casper F. M.; de Jong, Paul E.; Bakker, Stephan J. L.; Navis, Gerjan; Gansevoort, Ron T.

    Background and objectives Plasma copeptin, a marker of arginine vasopressin, is elevated in patients with autosomal dominant polycystic kidney disease and predicts disease progression. It is unknown whether elevated copeptin levels result from decreased kidney clearance or as compensation for

  12. Mutations in DNMT1 cause autosomal dominant cerebellar ataxia, deafness and narcolepsy

    DEFF Research Database (Denmark)

    Winkelmann, Juliane; Lin, Ling; Schormair, Barbara

    2012-01-01

    to HDAC2. It is also highly expressed in immune cells and required for the differentiation of CD4+ into T regulatory cells. Mutations in exon 20 of this gene were recently reported to cause hereditary sensory neuropathy with dementia and hearing loss (HSAN1). Our mutations are all located in exon 21......Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN) is characterized by late onset (30-40 years old) cerebellar ataxia, sensory neuronal deafness, narcolepsy-cataplexy and dementia. We performed exome sequencing in five individuals from three ADCA-DN kindreds and identified DNMT...

  13. Acute abdomen and ascites as presenting features of autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Chaudhary, Sanjay; Qian, Qi

    2012-12-27

    We describe a patient with sudden onset of abdominal pain and ascites, leading to the diagnosis of autosomal dominant polycystic kidney disease (ADPKD). Her presentation was consistent with acute liver cyst rupture as the cause of her acute illness. A review of literature on polycystic liver disease in patients with ADPKD and current management strategies are presented. This case alerts physicians that ADPKD could occasionally present as an acute abdomen; cyst rupture related to ADPKD may be considered in the differential diagnoses of acute abdomen.

  14. The role of noise and positive feedback in the onset of autosomal dominant diseases

    Directory of Open Access Journals (Sweden)

    Bosl William J

    2010-06-01

    Full Text Available Abstract Background Autosomal dominant (AD diseases result when a single mutant or non-functioning gene is present on an autosomal chromosome. These diseases often do not emerge at birth. There are presently two prevailing theories explaining the expression of AD diseases. One explanation originates from the Knudson two-hit theory of hereditary cancers, where loss of heterozygosity or occurrence of somatic mutations impairs the function of the wild-type copy. While these somatic second hits may be sufficient for stable disease states, it is often difficult to determine if their occurrence necessarily marks the initiation of disease progression. A more direct consequence of a heterozygous genetic background is haploinsufficiency, referring to a lack of sufficient gene function due to reduced wild-type gene copy number; however, haploinsufficiency can involve a variety of additional mechanisms, such as noise in gene expression or protein levels, injury and second hit mutations in other genes. In this study, we explore the possible contribution to the onset of autosomal dominant diseases from intrinsic factors, such as those determined by the structure of the molecular networks governing normal cellular physiology. Results First, simple models of single gene insufficiency using the positive feedback loops that may be derived from a three-component network were studied by computer simulation using Bionet software. The network structure is shown to affect the dynamics considerably; some networks are relatively stable even when large stochastic variations in are present, while others exhibit switch-like dynamics. In the latter cases, once the network switches over to the disease state it remains in that state permanently. Model pathways for two autosomal dominant diseases, AD polycystic kidney disease and mature onset diabetes of youth (MODY were simulated and the results are compared to known disease characteristics. Conclusions By identifying the

  15. A rare cardiac manifestation in autosomal-dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Meriam Hajji

    2017-01-01

    Full Text Available Autosomal-dominant polycystic kidney disease (ADPKD is a systemic disorder associated with various extrarenal complications. There is little information regarding the occurrence and distribution of cardiovascular abnormalities during the course of ADPKD. The major cardiovascular complications of ADPKD include valvulopathies and vascular ectasia. Aneurysm of the atrial septum (ASA is a very rare manifestation in ADPKD. A 37-year-old woman who was diagnosed with ADPKD was admitted to our hospital for advanced renal failure. Pelvic computed tomography revealed multiple variable-sized cysts in both kidneys. Trans-thoracic echocardiography showed ASA while the patient was completely asymptomatic.

  16. Health-related quality of life across all stages of autosomal dominant polycystic kidney disease

    DEFF Research Database (Denmark)

    Eriksson, Daniel; Karlsson, Linda; Eklund, Oskar

    2017-01-01

    BACKGROUND: A limited number of studies have assessed health-related quality of life (HRQoL) in autosomal dominant polycystic kidney disease (ADPKD). Results to date have been conflicting and studies have generally focused on patients with later stages of the disease. This study aimed to assess...... stages 4-5 and patients on dialysis. Progressive disease predominately had an impact on physical health, whereas mental health showed less variation between stages of the disease. A substantial loss in quality of life was observed as patients progressed to CKD stages 4-5. CONCLUSIONS: Later stages...

  17. Autosomal dominant polycystic kidney disease: recent advances in clinical management [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Zhiguo Mao

    2016-08-01

    Full Text Available The first clinical descriptions of autosomal dominant polycystic kidney disease (ADPKD go back at least 500 years to the late 16th century. Advances in understanding disease presentation and pathophysiology have mirrored the progress of clinical medicine in anatomy, pathology, physiology, cell biology, and genetics. The identification of PKD1 and PKD2, the major genes mutated in ADPKD, has stimulated major advances, which in turn have led to the first approved drug for this disorder and a fresh reassessment of patient management in the 21st century. In this commentary, we consider how clinical management is likely to change in the coming decade.

  18. New autosomal dominant syndrome reminiscent of Coffin-Siris syndrome and Brachymorphism-Onychodysplasia-Dysphalangism syndrome.

    Science.gov (United States)

    Elliott, A M; Teebi, A S

    2000-01-01

    We report a man and his two daughters (one stillborn) with an apparently unique constellation of anomalies including fifth finger/toe terminal phalanx and nail hypoplasia. The craniofacial manifestations include large boxy head, round face, hypertelorism with downslanting palpebral fissures and wide mouth. Other manifestations include brachydactyly, fifth finger clinodactyly and ventricular septal defect. Intelligence is normal. The resemblance to Coffin-Siris, Brachymorphism-Onychodysplasia-Dysphalangism and DOOR syndromes is discussed and we concluded that this family probably represents a new autosomal dominant syndrome.

  19. A nonsense mutation in CRYGC associated with autosomal dominant congenital nuclear cataract in a Chinese family.

    Science.gov (United States)

    Yao, Ke; Jin, Chongfei; Zhu, Ning; Wang, Wei; Wu, Renyi; Jiang, Jin; Shentu, Xingchao

    2008-07-09

    To identify the genetic defect associated with autosomal dominant congenital nuclear cataract in a Chinese family. Family history and phenotypic data were recorded, and the phenotypes were documented by slit lamp photography. The genomic DNA was extracted from peripheral blood leukocytes. All the exons and flanking intronic sequences of CRYGC and CRYGD were amplified by polymerase chain reaction (PCR) and screened for mutation by direct DNA sequencing. Structural models of the wild type and mutant gammaC-crystallin were generated and analyzed by SWISS-MODEL. Sequencing of the coding regions of CRYGC and CRYGD showed the presence of a heterozygous C>A transversion at c.327 of the coding sequence in exon 3 of CRYGC (c.327C>A), which results in the substitution of a wild type cysteine to a nonsense codon (C109X). One and a half Greek key motifs at the COOH-terminus were found to be absent in the structural model of the mutant truncated gammaC-crystallin. A novel nonsense mutation in CRYGC was detected in a Chinese family with consistent autosomal dominant congenital nuclear cataract, providing clear evidence of a relationship between the genotype and the corresponding cataract phenotype.

  20. A novel mutation in CRYAB associated with autosomal dominant congenital nuclear cataract in a Chinese family.

    Science.gov (United States)

    Chen, Qiang; Ma, Junjie; Yan, Ming; Mothobi, Maneo Emily; Liu, Yuanyuan; Zheng, Fang

    2009-07-10

    To identify the genetic defects associated with autosomal dominant congenital nuclear cataract in a Chinese family. Clinical data were collected, and the phenotypes of the affected members in this family were recorded by slit-lamp photography. Genomic DNA was isolated from peripheral blood. Mutations were screened in cataract-associated candidate genes through polymerase chain reaction (PCR) analyses and sequencing. Structural models of the wild-type and mutant alphaB-crystallin were generated and analyzed by SWISS-MODEL. Mutation screening identified only one heterozygous G-->A transition at nucleotide 32 in the first exon of alphaB-crystallin (CRYAB), resulting in an amino acid change from arginine to histidine at codon 11 (R11H). This mutation segregated in all available affected family members but was not observed in any of the unaffected persons of the family. The putative mutation disrupted a restriction site for the enzyme, Fnu4HI, in the affected family members. The disruption, however, was not found in any of the randomly selected ophthalmologically normal individuals or in 40 unrelated senile cataract patients. Computer-assisted prediction suggested that this mutation affected the biochemical properties as well as the structure of alphaB-crystallin. These results supported the idea that the novel R11H mutation was responsible for the autosomal dominant nuclear congenital cataract in this pedigree.

  1. Mutation in CPT1C Associated With Pure Autosomal Dominant Spastic Paraplegia.

    Science.gov (United States)

    Rinaldi, Carlo; Schmidt, Thomas; Situ, Alan J; Johnson, Janel O; Lee, Philip R; Chen, Ke-Lian; Bott, Laura C; Fadó, Rut; Harmison, George H; Parodi, Sara; Grunseich, Christopher; Renvoisé, Benoît; Biesecker, Leslie G; De Michele, Giuseppe; Santorelli, Filippo M; Filla, Alessandro; Stevanin, Giovanni; Dürr, Alexandra; Brice, Alexis; Casals, Núria; Traynor, Bryan J; Blackstone, Craig; Ulmer, Tobias S; Fischbeck, Kenneth H

    2015-05-01

    The family of genes implicated in hereditary spastic paraplegias (HSPs) is quickly expanding, mostly owing to the widespread availability of next-generation DNA sequencing methods. Nevertheless, a genetic diagnosis remains unavailable for many patients. To identify the genetic cause for a novel form of pure autosomal dominant HSP. We examined and followed up with a family presenting to a tertiary referral center for evaluation of HSP for a decade until August 2014. Whole-exome sequencing was performed in 4 patients from the same family and was integrated with linkage analysis. Sanger sequencing was used to confirm the presence of the candidate variant in the remaining affected and unaffected members of the family and screen the additional patients with HSP. Five affected and 6 unaffected participants from a 3-generation family with pure adult-onset autosomal dominant HSP of unknown genetic origin were included. Additionally, 163 unrelated participants with pure HSP of unknown genetic cause were screened. Mutation in the neuronal isoform of carnitine palmitoyl-transferase (CPT1C) gene. We identified the nucleotide substitution c.109C>T in exon 3 of CPT1C, which determined the base substitution of an evolutionarily conserved Cys residue for an Arg in the gene product. This variant strictly cosegregated with the disease phenotype and was absent in online single-nucleotide polymorphism databases and in 712 additional exomes of control participants. We showed that CPT1C, which localizes to the endoplasmic reticulum, is expressed in motor neurons and interacts with atlastin-1, an endoplasmic reticulum protein encoded by the ATL1 gene known to be mutated in pure HSPs. The mutation, as indicated by nuclear magnetic resonance spectroscopy studies, alters the protein conformation and reduces the mean (SD) number (213.0 [46.99] vs 81.9 [14.2]; P lipid droplets on overexpression in cells. We also observed a reduction of mean (SD) lipid droplets in primary cortical neurons

  2. Fibroblast Growth Factor 23 and Kidney Disease Progression in Autosomal Dominant Polycystic Kidney Disease.

    Science.gov (United States)

    Chonchol, Michel; Gitomer, Berenice; Isakova, Tamara; Cai, Xuan; Salusky, Isidro; Pereira, Renata; Abebe, Kaleab; Torres, Vicente; Steinman, Theodor I; Grantham, Jared J; Chapman, Arlene B; Schrier, Robert W; Wolf, Myles

    2017-09-07

    Increases in fibroblast growth factor 23 precede kidney function decline in autosomal dominant polycystic kidney disease; however, the role of fibroblast growth factor 23 in autosomal dominant polycystic kidney disease has not been well characterized. We measured intact fibroblast growth factor 23 levels in baseline serum samples from 1002 participants in the HALT-PKD Study A ( n =540; mean eGFR =91±17 ml/min per 1.73 m 2 ) and B ( n =462; mean eGFR =48±12 ml/min per 1.73 m 2 ). We used linear mixed and Cox proportional hazards models to test associations between fibroblast growth factor 23 and eGFR decline, percentage change in height-adjusted total kidney volume, and composite of time to 50% reduction in eGFR, onset of ESRD, or death. Median (interquartile range) intact fibroblast growth factor 23 was 44 (33-56) pg/ml in HALT-PKD Study A and 69 (50-93) pg/ml in Study B. In adjusted models, annualized eGFR decline was significantly faster in the upper fibroblast growth factor 23 quartile (Study A: quartile 4, -3.62; 95% confidence interval, -4.12 to -3.12 versus quartile 1, -2.51; 95% confidence interval, -2.71 to -2.30 ml/min per 1.73 m 2 ; P for trend kidney volume in adjusted models (quartile 4, 6.76; 95% confidence interval, 5.57 to 7.96 versus quartile 1, 6.04; 95% confidence interval, 5.55 to 6.54; P for trend =0.03). In Study B, compared with the lowest quartile, the highest fibroblast growth factor 23 quartile was associated with elevated risk for the composite outcome (hazard ratio, 3.11; 95% confidence interval, 1.84 to 5.25). Addition of fibroblast growth factor 23 to a model of annualized decline in eGFR≥3.0 ml/min per 1.73 m 2 did not improve risk prediction. Higher serum fibroblast growth factor 23 concentration was associated with kidney function decline, height-adjusted total kidney volume percentage increase, and death in patients with autosomal dominant polycystic kidney disease. However, fibroblast growth factor 23 did not substantially

  3. Novel BICD2 mutation in a Japanese family with autosomal dominant lower extremity-predominant spinal muscular atrophy-2.

    Science.gov (United States)

    Yoshioka, Mieko; Morisada, Naoya; Toyoshima, Daisaku; Yoshimura, Hajime; Nishio, Hisahide; Iijima, Kazumoto; Takeshima, Yasuhiro; Uehara, Tomoko; Kosaki, Kenjiro

    2018-04-01

    The most common form of spinal muscular atrophy (SMA) is a recessive disorder caused by SMN1 mutations in 5q13, whereas the genetic etiologies of non-5q SMA are very heterogenous and largely remain to be elucidated. We present a father and son with atrophy and weakness of the lower leg muscles since infancy. Genetic studies in this family revealed a novel BICD2 mutation causing autosomal dominant lower extremity-predominant SMA type 2. The proband was the father, aged 30, and the son was aged 3. Both of them were born uneventfully to nonconsanguineous parents. While the father first walked at the age of 19 months, the son was unable to walk at age 3 years. In both, knee and ankle reflexes were absent and sensation was intact. Serum creatine kinase levels were normal. The son showed congenital arthrogryposis and underwent orthopedic corrections for talipes calcaneovalgus. Investigation of the father at the age of 5 years revealed normal results on nerve conduction studies and sural nerve biopsy. Electromyography showed chronic neurogenic change, and muscle biopsy showed features suggestive of denervation. The father was diagnosed clinically with a sporadic distal SMA. Follow-up studies showed very slow progression. Next-generation and Sanger sequencing revealed a deleterious mutation in BICD2: c.1667A>G, p.Tyr556Cys, in this family. BICD2 is a cytoplasmic conserved motor-adaptor protein involved in anterograde and retrograde transport along the microtubules. Next-generation sequencing will further clarify the genetic basis of non-5q SMA. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  4. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Directory of Open Access Journals (Sweden)

    Alessandra Ruggieri

    2016-09-01

    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  5. A curious fact: Photic sneeze reflex. Autosomical dominant compelling helio-ophthalmic outburst syndrome.

    Science.gov (United States)

    Sevillano, C; Parafita-Fernández, A; Rodriguez-Lopez, V; Sampil, M; Moraña, N; Viso, E; Cores, F J

    2016-07-01

    To assess ocular involvement in the pathophysiology of autosomal dominant compelling helio-ophthalmic outburst syndrome (ACHOOs). An interview was conducted with a Caucasian family that showed clinical features of ACHOOs. Twelve of them had photic reflex and were recruited. A complete eye evaluation was made. A dominant autosomal inheritance with mild penetrance was demonstrated, with 67% of the studied subjects showing some degree of prominent corneal nerves. No other eye changes were found. Prominent corneal nerves may be associated with ACHOOs. The other eye structures studied do not seem to play a role in ACHOOs. Further studies are needed to understand the physiology of the ACHOOs. Copyright © 2016 Sociedad Española de Oftalmología. Published by Elsevier España, S.L.U. All rights reserved.

  6. [Cardiac tamponade as first manifestation in Mediterranean fever with autosomal dominant form].

    Science.gov (United States)

    Sánchez Ferrer, F; Martinez Villar, M; Fernández Bernal, A; Martín de Lara, I; Paya Elorza, I

    2015-01-01

    Familial Mediterranean fever (FMF) is a hereditary disease characterized by brief, recurring and self-limited episodes of fever and pain with inflammation, of one or several serous (peritoneum, pleura, pericardium, synovial or vaginal tunic of the testicle). Amyloidosis is its more important complication and the principal reason of death in the cases in which it appears. Diagnosis is based on the clinic and is confirmed by genetic tests. The treatment with Colchicine (0,02-0,03 mg/kg/day) prevents the recurrence of FMF attacks and the development of secondary (AA) amyloidosis. We report a case of a 13-year-old child in which FMF was diagnosed after several coincidental episodes with fever, pericarditis and cardiac tamponade. The genetic confirmation showed an autosomal dominant inheritance that is less frecuent than the recesive form, in this disease. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

  7. Recurrent acute pancreatitis and cholangitis in a patient with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Kambiz Yazdanpanah

    2013-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is an inherited disorder associated with multiple cyst formation in the different organs. Development of pancreatic cyst in ADPKD is often asymptomatic and is associated with no complication. A 38-year-old man with ADPKD was presented with six episodes of acute pancreatitis and two episodes of cholangitis in a period of 12 months. Various imaging studies revealed multiple renal, hepatic and pancreatic cysts, mild ectasia of pancreatic duct, dilation of biliary system and absence of biliary stone. He was managed with conservative treatment for each attack. ADPKD should be considered as a potential risk factor for recurrent acute and/or chronic pancreatitis and cholangitis.

  8. Autosomal dominant type of endosteal hyperostosis with unusual manifestations of sclerosis of the jaw bones

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Takashi; Yamada, Naoyuki; Nonaka, Ryosuke; Sasaki, Motomasa

    1987-01-01

    We report three cases of autosomal dominant type endosteal hyperostosis which occurred in one Japanese family. A new pattern of sclerotic changes in the jaw bones is evident. In all members of the family there was a symmetrical thickening of the diaphyseal cortices of the long bones. The affected bones were only minimally widened and the epiphyses and metaphyses were spared. Endosteal sclerosis of the neurocranium was present with loss of the diploe. The sclerotic changes included enlargement and mottled sclerosis of both the maxilla and mandible, with multiple embedded teeth and odontomas. The ramus of the mandible was spared. Severe sclerosis of the jaw bones was present only in a 28-year-old women. The 2-year-son showed only focal sclerosis in the mandible, and his grandmother had minimal changes in the skeleton.

  9. Novel LMNA Mutation in a Taiwanese Family with Autosomal Dominant Emery-Dreifuss Muscular Dystrophy

    Directory of Open Access Journals (Sweden)

    Wen-Chen Liang

    2007-01-01

    Full Text Available Emery-Dreifuss muscular dystrophy (EDMD is characterized by early-onset contractures, slowly progressive weakness, and muscle wasting in humeroperoneal muscles, and adult-onset cardiomyopathy with conduction block. We analyzed blood samples from an EDMD family, including a mother and two daughters, and found a novel mutation in codon 520 in exon 9 of the lamin A/C (LMNA gene, resulting in a substitution of tryptophan (W by glycine (G in all three patients. The mother died after a stroke-like episode at the age of 43. The elder sister received pacemaker implantation, which improved symptoms of exercise intolerance and dizziness. These cases illustrate the necessity of correct diagnosis, evaluation, and follow-up of cardiac problems due to the wide clinical spectrum and high prevalence of cardiac conduction block in patients with autosomal dominant EDMD. [J Formos Med Assoc 2007;106(2 Suppl:S27-S31

  10. Autosomal-dominant non-autoimmune hyperthyroidism presenting with neuromuscular symptoms.

    Science.gov (United States)

    Elgadi, Aziz; Arvidsson, C-G; Janson, Annika; Marcus, Claude; Costagliola, Sabine; Norgren, Svante

    2005-08-01

    Neuromuscular presentations are common in thyroid disease, although the mechanism is unclear. In the present study, we investigated the pathogenesis in a boy with autosomal-dominant hyperthyroidism presenting with neuromuscular symptoms. The TSHr gene was investigated by direct sequencing. Functional properties of the mutant TSHr were investigated during transient expression in COS-7 cells. Family members were investigated by clinical and biochemical examinations. Sequence analysis revealed a previously reported heterozygous missense mutation Glycine 431 for Serine in the first transmembrane segment, leading to an increased specific constitutive activity. Three additional affected family members carried the same mutation. There was no indication of autoimmune disorder. All symptoms disappeared upon treatment with thacapzol and L-thyroxine and subsequent subtotal thyroidectomy. The data imply that neuromuscular symptoms can be caused by excessive thyroid hormone levels rather than by autoimmunity.

  11. Rare co-occurrence of osteogenesis imperfecta type I and autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Hoefele, Julia; Mayer, Karin; Marschall, Christoph; Alberer, Martin; Klein, Hanns-Georg; Kirschstein, Martin

    2016-11-01

    There are several clinical reports about the co-occurrence of autosomal dominant polycystic kidney disease (ADPKD) and connective tissue disorders. A simultaneous occurrence of osteogenesis imperfecta (OI) type I and ADPKD has not been observed so far. This report presents the first patient with OI type I and ADPKD. Mutational analysis of PKD1 and COL1A1 in the index patient revealed a heterozygous mutation in each of the two genes. Mutational analysis of the parents indicated the mother as a carrier of the PKD1 mutation and the father as a carrier of the COL1A1 mutation. The simultaneous occurrence of both disorders has an estimated frequency of 3.5:100 000 000. In singular cases, ADPKD can occur in combination with other rare disorders, e.g. connective tissue disorders.

  12. Prenatal diagnosis of autosomal dominant hereditary spastic paraplegia (SPG4) using direct mutation detection

    DEFF Research Database (Denmark)

    Nielsen, Jørgen E; Koefoed, Pernille; Kjaergaard, Susanne

    2004-01-01

    OBJECTIVE: To present a report on prenatal diagnosis using direct SPG4 gene analysis in a family with autosomal dominant hereditary spastic paraplegia (AD-HSP). METHODS: Genetic linkage and haplotype analysis were previously carried out with chromosome 2p markers. DNA was obtained from affected...... individuals, the affected father, the mother, and fetal DNA from an ongoing pregnancy by chorionic villus sampling (CVS) in the first trimester. The spastin gene (SPG4) was completely sequenced. RESULTS: A novel 832insGdelAA frameshift mutation, predicted to cause loss of functional protein, was identified...... in the affected father and in the fetal DNA. CONCLUSIONS: This is the first report on direct prenatal diagnosis of chromosome 2p-linked AD-HSP (SPG4). In addition, we report a novel SPG4-combined small insertion/deletion mutation in exon 5, which may be the first SPG4 mutational hot spot....

  13. A stepwise approach for effective management of chronic pain in autosomal-dominant polycystic kidney disease.

    Science.gov (United States)

    Casteleijn, Niek F; Visser, Folkert W; Drenth, Joost P H; Gevers, Tom J G; Groen, Gerbrand J; Hogan, Marie C; Gansevoort, Ron T

    2014-09-01

    Chronic pain, defined as pain existing for >4-6 weeks, affects >60% of patients with autosomal-dominant polycystic disease (ADPKD). It can have various causes, indirectly or directly related to the increase in kidney and liver volume in these patients. Chronic pain in ADPKD patients is often severe, impacting physical activity and social relationships, and frequently difficult to manage. This review provides an overview of pathophysiological mechanisms that can lead to pain and discusses the sensory innervation of the kidneys and the upper abdominal organs, including the liver. In addition, the results of a systematic literature search of ADPKD-specific treatment options are presented. Based on pathophysiological knowledge and evidence derived from the literature an argumentative stepwise approach for effective management of chronic pain in ADPKD is proposed. © The Author 2014. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  14. Late onset autosomal dominant cerebellar ataxia a family description and linkage analysis with the hla system

    Directory of Open Access Journals (Sweden)

    Walter O. Arruda

    1991-09-01

    Full Text Available A family suffering an autosomal dominant form of late onset hereditary cerebellar ataxia is described. Eight affected family members were personally studied, and data from another four were obtained through anamnesis. The mean age of onset was 37.1±5.4 years (27-47 years. The clinical picture consisted basically of a pure ataxic cerebellar syndrome. CT-scan disclosed diffuse cerebellar atrophy with relative sparing of the brainstem (and no involvement of supratentorial structures. Neurophysiological studies (nerve conduction, VEP and BAEP were normal. Twenty-six individuals were typed for HLA histocompatibility antigens. Lod scores were calculated with the computer program LINKMAP. Close linkage of the ataxia gene with the HLA system in this family could be excluded - 0==0,02, z=(-2,17 - and the overall analysis of the lod scores suggest another chromossomal location than chromosome 6.

  15. Quantitative Amyloid Imaging in Autosomal Dominant Alzheimer's Disease: Results from the DIAN Study Group.

    Directory of Open Access Journals (Sweden)

    Yi Su

    Full Text Available Amyloid imaging plays an important role in the research and diagnosis of dementing disorders. Substantial variation in quantitative methods to measure brain amyloid burden exists in the field. The aim of this work is to investigate the impact of methodological variations to the quantification of amyloid burden using data from the Dominantly Inherited Alzheimer's Network (DIAN, an autosomal dominant Alzheimer's disease population. Cross-sectional and longitudinal [11C]-Pittsburgh Compound B (PiB PET imaging data from the DIAN study were analyzed. Four candidate reference regions were investigated for estimation of brain amyloid burden. A regional spread function based technique was also investigated for the correction of partial volume effects. Cerebellar cortex, brain-stem, and white matter regions all had stable tracer retention during the course of disease. Partial volume correction consistently improves sensitivity to group differences and longitudinal changes over time. White matter referencing improved statistical power in the detecting longitudinal changes in relative tracer retention; however, the reason for this improvement is unclear and requires further investigation. Full dynamic acquisition and kinetic modeling improved statistical power although it may add cost and time. Several technical variations to amyloid burden quantification were examined in this study. Partial volume correction emerged as the strategy that most consistently improved statistical power for the detection of both longitudinal changes and across-group differences. For the autosomal dominant Alzheimer's disease population with PiB imaging, utilizing brainstem as a reference region with partial volume correction may be optimal for current interventional trials. Further investigation of technical issues in quantitative amyloid imaging in different study populations using different amyloid imaging tracers is warranted.

  16. Longitudinal Assessment of Left Ventricular Mass in Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Taimur Dad

    2018-05-01

    Full Text Available Introduction: The high burden of cardiovascular morbidity and mortality in autosomal dominant polycystic kidney disease (ADPKD is related to development of hypertension and left ventricular hypertrophy. Blood pressure reduction has been shown to reduce left ventricular mass in ADPKD; however, moderators and predictors of response to lower blood pressure are unknown. Methods: This was a post hoc cohort analysis of HALT PKD study A, a randomized placebo controlled trial examining the effect of low blood pressure and single versus dual renin−angiotensin blockade in early ADPKD. Participants were hypertensive ADPKD patients 15 to 49 years of age with estimated glomerular filtration rate (eGFR > 60 ml/min per 1.73 m2 across 7 centers in the United States. Predictors included age, sex, baseline eGFR, systolic blood pressure, total kidney volume, serum potassium, and urine sodium, potassium, albumin, and aldosterone. Outcome was left ventricular mass index (LVMI measured using 1.5-T magnetic resonance imaging at months 0, 24, 48, and 60. Results: Reduction in LVMI was associated with higher baseline systolic blood pressure and larger kidney volume regardless of blood pressure control group assignment (P < 0.001 for both. Male sex and baseline eGFR were associated with a positive annual slope in LVMI (P < 0.001 and P = 0.07, respectively. Conclusion: Characteristics associated with higher risk of progression in ADPKD, including higher systolic blood pressure, larger kidney volume, and lower eGFR are associated with improvement in LVMI with intensive blood pressure control, whereas male sex is associated with a smaller slope of reduction in LVMI. Keywords: autosomal dominant polycystic kidney disease, hypertension, left ventricular hypertrophy, left ventricular mass index

  17. Quantitative Amyloid Imaging in Autosomal Dominant Alzheimer’s Disease: Results from the DIAN Study Group

    Science.gov (United States)

    Su, Yi; Blazey, Tyler M.; Owen, Christopher J.; Christensen, Jon J.; Friedrichsen, Karl; Joseph-Mathurin, Nelly; Wang, Qing; Hornbeck, Russ C.; Ances, Beau M.; Snyder, Abraham Z.; Cash, Lisa A.; Koeppe, Robert A.; Klunk, William E.; Galasko, Douglas; Brickman, Adam M.; McDade, Eric; Ringman, John M.; Thompson, Paul M.; Saykin, Andrew J.; Ghetti, Bernardino; Sperling, Reisa A.; Johnson, Keith A.; Salloway, Stephen P.; Schofield, Peter R.; Masters, Colin L.; Villemagne, Victor L.; Fox, Nick C.; Förster, Stefan; Chen, Kewei; Reiman, Eric M.; Xiong, Chengjie; Marcus, Daniel S.; Weiner, Michael W.; Morris, John C.; Bateman, Randall J.; Benzinger, Tammie L. S.

    2016-01-01

    Amyloid imaging plays an important role in the research and diagnosis of dementing disorders. Substantial variation in quantitative methods to measure brain amyloid burden exists in the field. The aim of this work is to investigate the impact of methodological variations to the quantification of amyloid burden using data from the Dominantly Inherited Alzheimer’s Network (DIAN), an autosomal dominant Alzheimer’s disease population. Cross-sectional and longitudinal [11C]-Pittsburgh Compound B (PiB) PET imaging data from the DIAN study were analyzed. Four candidate reference regions were investigated for estimation of brain amyloid burden. A regional spread function based technique was also investigated for the correction of partial volume effects. Cerebellar cortex, brain-stem, and white matter regions all had stable tracer retention during the course of disease. Partial volume correction consistently improves sensitivity to group differences and longitudinal changes over time. White matter referencing improved statistical power in the detecting longitudinal changes in relative tracer retention; however, the reason for this improvement is unclear and requires further investigation. Full dynamic acquisition and kinetic modeling improved statistical power although it may add cost and time. Several technical variations to amyloid burden quantification were examined in this study. Partial volume correction emerged as the strategy that most consistently improved statistical power for the detection of both longitudinal changes and across-group differences. For the autosomal dominant Alzheimer’s disease population with PiB imaging, utilizing brainstem as a reference region with partial volume correction may be optimal for current interventional trials. Further investigation of technical issues in quantitative amyloid imaging in different study populations using different amyloid imaging tracers is warranted. PMID:27010959

  18. Missense mutations in ITPR1 cause autosomal dominant congenital nonprogressive spinocerebellar ataxia

    Directory of Open Access Journals (Sweden)

    Huang Lijia

    2012-09-01

    Full Text Available Abstract Background Congenital nonprogressive spinocerebellar ataxia is characterized by early gross motor delay, hypotonia, gait ataxia, mild dysarthria and dysmetria. The clinical presentation remains fairly stable and may be associated with cerebellar atrophy. To date, only a few families with autosomal dominant congenital nonprogressive spinocerebellar ataxia have been reported. Linkage to 3pter was demonstrated in one large Australian family and this locus was designated spinocerebellar ataxia type 29. The objective of this study is to describe an unreported Canadian family with autosomal dominant congenital nonprogressive spinocerebellar ataxia and to identify the underlying genetic causes in this family and the original Australian family. Methods and Results Exome sequencing was performed for the Australian family, resulting in the identification of a heterozygous mutation in the ITPR1 gene. For the Canadian family, genotyping with microsatellite markers and Sanger sequencing of ITPR1 gene were performed; a heterozygous missense mutation in ITPR1 was identified. Conclusions ITPR1 encodes inositol 1,4,5-trisphosphate receptor, type 1, a ligand-gated ion channel that mediates calcium release from the endoplasmic reticulum. Deletions of ITPR1 are known to cause spinocerebellar ataxia type 15, a distinct and very slowly progressive form of cerebellar ataxia with onset in adulthood. Our study demonstrates for the first time that, in addition to spinocerebellar ataxia type 15, alteration of ITPR1 function can cause a distinct congenital nonprogressive ataxia; highlighting important clinical heterogeneity associated with the ITPR1 gene and a significant role of the ITPR1-related pathway in the development and maintenance of the normal functions of the cerebellum.

  19. Autosomal dominant hereditary sensory neuropathy with chronic cough and gastro-oesophageal reflux: clinical features in two families linked to chromosome 3p22-p24.

    Science.gov (United States)

    Spring, Penelope J; Kok, Cindy; Nicholson, Garth A; Ing, Alvin J; Spies, Judith M; Bassett, Mark L; Cameron, John; Kerlin, Paul; Bowler, Simon; Tuck, Roger; Pollard, John D

    2005-12-01

    Autosomal dominant hereditary sensory neuropathy (HSN I) is a clinically and genetically heterogeneous group of disorders, and in some families it is due to mutations in the serine palmitoyltransferase (SPTLC1) gene. We have characterized two families with HSN I associated with cough and gastro-oesophageal reflux (GOR). From a large Australian family, 27 individuals and from a smaller family, 11 individuals provided clinical information and blood for genetic analysis. Affected individuals had an adult onset of paroxysmal cough, GOR and distal sensory loss. Cough could be triggered by noxious odours or by pressure in the external auditory canal (Arnold's ear-cough reflex). Other features included throat clearing, hoarse voice, cough syncope and sensorineural hearing loss. Neurophysiological and pathological studies demonstrated a sensory axonal neuropathy. Gastric emptying studies were normal, and autonomic function and sweat tests were either normal or showed distal hypohidrosis. Cough was likely to be due to a combination of denervation hypersensitivity of the upper airways and oesophagus, and prominent GOR. Most affected individuals were shown on 24 h ambulatory oesophageal pH monitoring to have multiple episodes of GOR, closely temporally associated with coughing. Hoarse voice was probably attributable to acid-induced laryngeal damage, and there was no evidence of vocal cord palsy. No other cause for cough was found on most respiratory or otorhinological studies. Linkage to chromosome 3p22-p24 has been found in both families, with no evidence of linkage to loci for known HSN I, autosomal dominant hereditary motor and sensory neuropathy, hereditary GOR or triple A syndrome. These families represent a genetically novel variant of HSN I, with a distinctive cough owing to involvement of the upper aerodigestive tract.

  20. A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8.

    Science.gov (United States)

    Bouhy, Delphine; Juneja, Manisha; Katona, Istvan; Holmgren, Anne; Asselbergh, Bob; De Winter, Vicky; Hochepied, Tino; Goossens, Steven; Haigh, Jody J; Libert, Claude; Ceuterick-de Groote, Chantal; Irobi, Joy; Weis, Joachim; Timmerman, Vincent

    2018-01-01

    Mutations in the small heat shock protein B8 gene (HSPB8/HSP22) have been associated with distal hereditary motor neuropathy, Charcot-Marie-Tooth disease, and recently distal myopathy. It is so far not clear how mutant HSPB8 induces the neuronal and muscular phenotypes and if a common pathogenesis lies behind these diseases. Growing evidence points towards a role of HSPB8 in chaperone-associated autophagy, which has been shown to be a determinant for the clearance of poly-glutamine aggregates in neurodegenerative diseases but also for the maintenance of skeletal muscle myofibrils. To test this hypothesis and better dissect the pathomechanism of mutant HSPB8, we generated a new transgenic mouse model leading to the expression of the mutant protein (knock-in lines) or the loss-of-function (functional knock-out lines) of the endogenous protein Hspb8. While the homozygous knock-in mice developed motor deficits associated with degeneration of peripheral nerves and severe muscle atrophy corroborating patient data, homozygous knock-out mice had locomotor performances equivalent to those of wild-type animals. The distal skeletal muscles of the post-symptomatic homozygous knock-in displayed Z-disk disorganisation, granulofilamentous material accumulation along with Hspb8, αB-crystallin (HSPB5/CRYAB), and desmin aggregates. The presence of the aggregates correlated with reduced markers of effective autophagy. The sciatic nerve of the homozygous knock-in mice was characterized by low autophagy potential in pre-symptomatic and Hspb8 aggregates in post-symptomatic animals. On the other hand, the sciatic nerve of the homozygous knock-out mice presented a normal morphology and their distal muscle displayed accumulation of abnormal mitochondria but intact myofiber and Z-line organisation. Our data, therefore, suggest that toxic gain-of-function of mutant Hspb8 aggregates is a major contributor to the peripheral neuropathy and the myopathy. In addition, mutant Hspb8 induces

  1. Autosomal dominant cerebellar ataxia type I: A review of the phenotypic and genotypic characteristics

    Directory of Open Access Journals (Sweden)

    Fujioka Shinsuke

    2011-05-01

    Full Text Available Abstract Type I autosomal dominant cerebellar ataxia (ADCA is a type of spinocerebellar ataxia (SCA characterized by ataxia with other neurological signs, including oculomotor disturbances, cognitive deficits, pyramidal and extrapyramidal dysfunction, bulbar, spinal and peripheral nervous system involvement. The global prevalence of this disease is not known. The most common type I ADCA is SCA3 followed by SCA2, SCA1, and SCA8, in descending order. Founder effects no doubt contribute to the variable prevalence between populations. Onset is usually in adulthood but cases of presentation in childhood have been reported. Clinical features vary depending on the SCA subtype but by definition include ataxia associated with other neurological manifestations. The clinical spectrum ranges from pure cerebellar signs to constellations including spinal cord and peripheral nerve disease, cognitive impairment, cerebellar or supranuclear ophthalmologic signs, psychiatric problems, and seizures. Cerebellar ataxia can affect virtually any body part causing movement abnormalities. Gait, truncal, and limb ataxia are often the most obvious cerebellar findings though nystagmus, saccadic abnormalities, and dysarthria are usually associated. To date, 21 subtypes have been identified: SCA1-SCA4, SCA8, SCA10, SCA12-SCA14, SCA15/16, SCA17-SCA23, SCA25, SCA27, SCA28 and dentatorubral pallidoluysian atrophy (DRPLA. Type I ADCA can be further divided based on the proposed pathogenetic mechanism into 3 subclasses: subclass 1 includes type I ADCA caused by CAG repeat expansions such as SCA1-SCA3, SCA17, and DRPLA, subclass 2 includes trinucleotide repeat expansions that fall outside of the protein-coding regions of the disease gene including SCA8, SCA10 and SCA12. Subclass 3 contains disorders caused by specific gene deletions, missense mutation, and nonsense mutation and includes SCA13, SCA14, SCA15/16, SCA27 and SCA28. Diagnosis is based on clinical history, physical

  2. DVL1 frameshift mutations clustering in the penultimate exon cause autosomal-dominant Robinow syndrome

    DEFF Research Database (Denmark)

    White, Janson; Mazzeu, Juliana F; Hoischen, Alexander

    2015-01-01

    Robinow syndrome is a genetically heterogeneous disorder characterized by mesomelic limb shortening, genital hypoplasia, and distinctive facial features and for which both autosomal-recessive and autosomal-dominant inheritance patterns have been described. Causative variants in the non-canonical ...

  3. A novel syndrome of autosomal-dominant hyperinsulinemic hypoglycemia linked to a mutation in the human insulin receptor gene

    DEFF Research Database (Denmark)

    Højlund, Kurt; Hansen, Torben; Lajer, Maria

    2004-01-01

    a missense mutation (Arg1174Gln) in the tyrosine kinase domain of the insulin receptor gene that cosegregated with the disease phenotype (logarithm of odds [LOD] score 3.21). In conclusion, we report a novel syndrome of autosomal-dominant hyperinsulinemic hypoglycemia. The findings demonstrate...

  4. A three-generation family with idiopathic facial palsy suggesting an autosomal dominant inheritance with high penetrance

    DEFF Research Database (Denmark)

    Larsen, Christian Grønhøj; Gyldenløve, Mette; Jønch, Aia Elise

    2015-01-01

    Idiopathic facial palsy (IFP), also known as Bell's palsy, is a common neurologic disorder, but recurrent and familial forms are rare. This case series presents a three-generation family with idiopathic facial palsy. The mode of inheritance of IFP has previously been suggested as autosomal dominant...

  5. Autosomal-dominant polycystic kidney disease (ADPKD) : executive summary from a Kidney Disease: Improving Global Outcomes (KDIGO) Controversies Conference

    NARCIS (Netherlands)

    Chapman, Arlene B.; Devuyst, Olivier; Eckardt, Kai-Uwe; Gansevoort, Ron T.; Harris, Tess; Horie, Shigeo; Kasiske, Bertram L.; Odland, Dwight; Pei, York; Perrone, Ronald D.; Pirson, Yves; Schrier, Robert W.; Torra, Roser; Torres, Vicente E.; Watnick, Terry; Wheeler, David C.

    Autosomal-dominant polycystic kidney disease (ADPKD) affects up to 12 million individuals and is the fourth most common cause for renal replacement therapy worldwide. There have been many recent advances in the understanding of its molecular genetics and biology, and in the diagnosis and management

  6. Mutations in POGLUT1, Encoding Protein O-Glucosyltransferase 1, Cause Autosomal-Dominant Dowling-Degos Disease

    DEFF Research Database (Denmark)

    Basmanav, F Buket; Oprisoreanu, Ana-Maria; Pasternack, Sandra M

    2014-01-01

    Dowling-Degos disease (DDD) is an autosomal-dominant genodermatosis characterized by progressive and disfiguring reticulate hyperpigmentation. We previously identified loss-of-function mutations in KRT5 but were only able to detect pathogenic mutations in fewer than half of our subjects. To ident...

  7. Rationale and Design of a Clinical Trial Investigating Tolvaptan Safety and Efficacy in Autosomal Dominant Polycystic Kidney Disease

    NARCIS (Netherlands)

    Torres, Vicente E.; Devuyst, Olivier; Chapman, Arlene B.; Gansevoort, Ron T.; Perrone, Ronald D.; Ouyang, John; Blais, Jaime D.; Czerwiec, Frank S.; Sergeyeva, Olga

    Background: In TEMPO 3: 4, the vasopressin V2-receptor antagonist tolvaptan slowed kidney growth and function decline in autosomal dominant polycystic kidney disease (ADPKD) patients with relatively preserved kidney function. Methods: Prospective, phase 3b, multi-center, randomized-withdrawal,

  8. A peculiar autosomal dominant macular dystrophy caused by an asparagine deletion at codon 169 in the peripherin/RDS gene

    NARCIS (Netherlands)

    van Lith-Verhoeven, Janneke J. C.; van den Helm, Bellinda; Deutman, August F.; Bergen, Arthur A. B.; Cremers, Frans P. M.; Hoyng, Carel B.; de Jong, Paulus T. V. M.

    2003-01-01

    Objective: To describe the clinical and genetic findings in a family with a peculiar autosomal dominant macular dystrophy with peripheral deposits. Methods: All family members underwent an ophthalmic examination, and their genomic DNA was screened for mutations in the human retinal degeneration slow

  9. Tolvaptan and Kidney Pain in Patients With Autosomal Dominant Polycystic Kidney Disease : Secondary Analysis From a Randomized Controlled Trial

    NARCIS (Netherlands)

    Casteleijn, Niek F.; Blais, Jaime D.; Chapman, Arlene B.; Czerwiec, Frank S.; Devuyst, Olivier; Higashihara, Eiji; Leliveld, Anna M.; Ouyang, John; Perrone, Ronald D.; Torres, Vicente E.; Gansevoort, Ron T.

    Background: Kidney pain is a common complication in patients with autosomal dominant polycystic kidney disease (ADPKD), and data from the TEMPO 3: 4 trial suggested that tolvaptan, a vasopressin V2 receptor antagonist, may have a positive effect on kidney pain in this patient group. Because pain is

  10. Health-related quality of life across all stages of autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Eriksson, Daniel; Karlsson, Linda; Eklund, Oskar; Dieperink, Hans; Honkanen, Eero; Melin, Jan; Selvig, Kristian; Lundberg, Johan

    2017-12-01

    A limited number of studies have assessed health-related quality of life (HRQoL) in autosomal dominant polycystic kidney disease (ADPKD). Results to date have been conflicting and studies have generally focused on patients with later stages of the disease. This study aimed to assess HRQoL in ADPKD across all stages of the disease, from patients with early chronic kidney disease (CKD) to patients with end-stage renal disease. A study involving cross-sectional patient-reported outcomes and retrospective clinical data was undertaken April-December 2014 in Denmark, Finland, Norway and Sweden. Patients were enrolled into four mutually exclusive stages of the disease: CKD stages 1-3; CKD stages 4-5; transplant recipients; and dialysis patients. Overall HRQoL was generally highest in patients with CKD stages 1-3, followed by transplant recipients, patients with CKD stages 4-5 and patients on dialysis. Progressive disease predominately had an impact on physical health, whereas mental health showed less variation between stages of the disease. A substantial loss in quality of life was observed as patients progressed to CKD stages 4-5. Later stages of ADPKD are associated with reduced physical health. The value of early treatment interventions that can delay progression of the disease should be considered. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA.

  11. A novel GJA8 mutation (p.V44A causing autosomal dominant congenital cataract.

    Directory of Open Access Journals (Sweden)

    Yanan Zhu

    Full Text Available To examine the mechanism by which a novel connexin 50 (Cx50 mutation, Cx50 V44A, in a Chinese family causes suture-sparing autosomal dominant congenital nuclear cataracts.Family history and clinical data were recorded and direct gene sequencing was used to identify the disease-causing mutation. The Cx50 gene was cloned from a human lens cDNA library. Connexin protein distributions were assessed by fluorescence microscopy. Hemichannel functions were analyzed by dye uptake assay. Formation of functional channels was assessed by dye transfer experiments.Direct sequencing of the candidate GJA8 gene revealed a novel c.131T>C transition in exon 2, which cosegregated with the disease in the family and resulted in the substitution of a valine residue with alanine at codon 44 (p. V44A in the extracellular loop 1 of the Cx50 protein. Both Cx50 and Cx50V44A formed functional gap junctions, as shown by the neurobiotin transfer assay. However, unlike wild-type Cx50, Cx50V44A was unable to form open hemichannels in dye uptake experiments.This work identified a unique congenital cataract in the Chinese population, caused by the novel mutation Cx50V44A, and it showed that the V44A mutation specifically impairs the gating of the hemichannels but not the gap junction channels. The dysfunctional hemichannels resulted in the development of human congenital cataracts.

  12. Molecular Typing of Staphylococcus aureus Isolated from Patients with Autosomal Dominant Hyper IgE Syndrome

    Directory of Open Access Journals (Sweden)

    Inka Sastalla

    2017-06-01

    Full Text Available Autosomal dominant hyper IgE syndrome (AD-HIES is a primary immunodeficiency caused by a loss-of-function mutation in the Signal Transducer and Activator of Transcription 3 (STAT3. This immune disorder is clinically characterized by increased susceptibility to cutaneous and sinopulmonary infections, in particular with Candida and Staphylococcus aureus. It has recently been recognized that the skin microbiome of patients with AD-HIES is altered with an overrepresentation of certain Gram-negative bacteria and Gram-positive staphylococci. However, these alterations have not been characterized at the species- and strain-level. Since S. aureus infections are influenced by strain-specific expression of virulence factors, information on colonizing strain characteristics may provide insights into host-pathogen interactions and help guide management strategies for treatment and prophylaxis. The aim of this study was to determine whether the immunodeficiency of AD-HIES selects for unique strains of colonizing S. aureus. Using multi-locus sequence typing (MLST, protein A (spa typing, and PCR-based detection of toxin genes, we performed a detailed analysis of the S. aureus isolates (n = 13 found on the skin of twenty-one patients with AD-HIES. We found a low diversity of sequence types, and an abundance of strains that expressed methicillin resistance, Panton-Valentine leukocidin (PVL, and staphylococcal enterotoxins K and Q (SEK, SEQ. Our results indicate that patients with AD-HIES may often carry antibiotic-resistant strains that harbor key virulence factors.

  13. Blood Pressure and Intracranial Aneurysms in Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Mariusz Niemczyk

    2014-12-01

    Full Text Available Background/Aims: Autosomal dominant polycystic kidney disease (ADPKD is correlated with an increased frequency of both intracranial aneurysms (ICANs, and arterial hypertension (AH. The aim of our study was to search for the association between blood pressure (BP and ICANs in ADPKD patients. Methods: Sixty-eight adult, pre-dialysis phase ADPKD patients underwent both screening for ICANs with magnetic resonance angiography of the brain, and ambulatory blood pressure monitoring (ABPM. Results: ICANs were diagnosed in 10 patients (ICAN(+ group, while in 58 were not (ICAN(- group. The nighttime maximum diastolic blood pressure (DBP, maximum increase in DBP from measurement to measurement (positive delta of DBP at night, and the standard deviation of the daytime mean arterial pressure were significantly higher in ICAN(+ compared to ICAN(- patients. Additionally, in a subgroup of patients after 45 years-of-age, ICAN(+ patients had significantly higher maximum 24-hour and daytime systolic blood pressure, maximum 24-hour, daytime, nighttime DBP, maximum daytime and nighttime positive delta of DBP compared to ICAN(- cases. Conclusions: Development of ICANs in hypertensive ADPKD patients is accompanied with higher values of some BP parameters measured by ABPM. Hypertensive ADPKD patients with substantial fluctuations in BP assessed by ABPM, especially those after 45 years-of-age, should become candidates for screening for ICANs.

  14. The value of intrarenal resistive index in autosomal dominant polycystic kidney disease

    International Nuclear Information System (INIS)

    Lee, Young Rae; Lee, Kyu Beck; Park, Hae Won

    1998-01-01

    The purpose of this study was to determine the value of the intrarenal resistive index(RI), measured by Doppler sonography, in order to assess intrarenal vascular resistance in autosomal dominant polycystic kidney disease (ADPKD) patients. In 26 patients with ADPKD, RI was measured by Doppler sonography and correlated with the presence of hypertension, renal function (creatinine clearance) and anatomical renal severity index (RSI), thus indicating renal morphologic abnormalities during Bmode sonography. RI was significantly higher in 18 hypertensive ADPKD patients (0.64±0.65) (Mean±1SD;range:0.52-0.74) than in eight normotensive patients (0.59± 0.50) (0.48-0.64) (p<0.05). Statistically significant inverse correlation was found between RI values and creatinine clearance (r=3D-0.45, p<0.05), and statistically significant correlation was found between RI values and RSI, indicating the degree of renal parenchymal involvement. RI correlates with the development of hypertension, renal function and renal morphologic abnormality scoring by RSI during B-mode Doppler sonography, and measured in this way may thus be used to assess renal vascular resistance in ADPKD patients.=20

  15. Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa

    International Nuclear Information System (INIS)

    Dryja, T.P.; Han, L.B.; Cowley, G.S.; McGee, T.L.; Berson, E.L.

    1991-01-01

    The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150 patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene

  16. "An evil heritage": interview study of pain and autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Heiwe, Susanne; Bjuke, Monica

    2009-09-01

    Pain is a common problem for patients with autosomal dominant polycystic kidney disease (ADPKD). Knowledge about patients' experience of the pain, pain management, and pain's effect on everyday life is, however, limited. In clinical practice there is a need to improve the care of these patients. To be able to do so, information about how the disease and its pain affect the patients is required. This study explores patients' experience of living with ADPKD and its pain. The findings are based on in-depth semistructured interviews. The participants were 22 patients with ADPKD. The data were transcribed and analyzed by using phenomenology. Findings showed that the patients experienced limitations in their everyday life due to inexplicable and unpredictable pain and fatigue. Also, pain management was experienced as suboptimal and pain was seldom discussed at health care appointments. Emotional distress concerning the hereditary nature of the disease was also present. Health care providers need to increase their focus on pain and pain management to reduce the disease's intrusion in patients' everyday life. Also, patients and people in the patients' immediate surroundings need to be given information and education about the disease and its pain as well as the opportunity to talk about their worries concerning heredity. By implementing the findings of the present study when meeting a patient with ADPKD, improved patient satisfaction and health-related quality of life could be accomplished.

  17. Treatment of Persistent Gross Hematuria with Tranexamic Acid in Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Qing Yao

    2017-04-01

    Full Text Available Background/Aims: In this retrospective study we aimed to compare the effect of tranexamic acid (TXA vs etamsylate, two hemostatic agents, on hematuria duration in autosomal dominant polycystic kidney disease (ADPKD patients with persistent gross hematuria. Methods: This is a retrospective study of 40 patients with ADPKD and macroscopic hematuria. 20 patients receiving TXA and snake venom blood clotting enzyme injection were compared with 20 matched patients receiving etamsylate and snake venom blood clotting enzyme injection. The primary outcome was hematuria duration and the secondary outcomes were blood transfusion requirements and adverse events. Results: The hematuria duration was shorter in the TXA group compared with the etamsylate group (4[3-5] d vs 7[6-10] d, P<0.001. The volume of blood transfusion tended to be less in the TXA group than in the etamsylate group (300±115 ml vs 486±195 ml, P=0.12, and the number of patients needing a blood transfusion also tended to be lower [20% (4/20 vs 35% (7/20, P=0.29]. TXA and etamsylate were equally well tolerated and no serious adverse events were observed in both groups. Conclusions: Our study indicates that TXA treatment was more effective than etamsylate in stopping bleeding in ADPKD patients with persistent gross hematuria.

  18. Overview of autosomal dominant polycystic kidney disease in the south of Spain

    Directory of Open Access Journals (Sweden)

    Ana Isabel Morales García

    2018-03-01

    Full Text Available Introduction: Although autosomal dominant polycystic kidney disease is the most common hereditary kidney disease, available data tend to be limited to after initiation of renal replacement therapy. Objective: To ascertain an overview of autosomal dominant polycystic kidney disease within the health area of Granada in southern Spain. Materials and methods: From January 2007 to December 2016, we collected clinical, family and demographic information about all patients with autosomal dominant polycystic kidney disease, irrespective of whether or not they were treated with RRT, in the Granada health area. The computer software SPSS 15.0 and GenoPro were used. Results: 50.6% of the 1107 diagnosed patients were men. 99.1% were Caucasian and 4–6 generations/family were studied. The geographical distribution was heterogeneous. There was no family history in 2.43%. The mean age of diagnosis was 34.0 ± 17.80 years and the diagnosis was made after having offspring in 57.7% of cases. The main reason for diagnosis was family history (46.4%. The mean age of initiation of renal replacement therapy was 54.2 ± 11.05 years. 96.3% of the deceased had some degree of renal failure at the time of death. The mean age of death was 60.9 ± 14.10 years, the main cause of death being unknown in 33.5% of cases, followed by cardiovascular (27.8%. Conclusions: Cases and families were concentrated in certain geographical areas and a significant number of individuals were undiagnosed prior to cardiovascular death or diagnosed late after reproduction. Given that there is currently no curative treatment, the primary prevention strategy of preimplantation genetic diagnosis should play a leading role. Resumen: Introducción: La poliquistosis renal autosómica dominante es la enfermedad renal hereditaria más frecuente aunque los datos disponibles generalmente son tras el inicio del tratamiento renal sustitutivo. Objetivo: Conocer la situaci

  19. High frequency of potentially pathogenic SORL1 mutations in autosomal dominant early-onset Alzheimer disease.

    Science.gov (United States)

    Pottier, C; Hannequin, D; Coutant, S; Rovelet-Lecrux, A; Wallon, D; Rousseau, S; Legallic, S; Paquet, C; Bombois, S; Pariente, J; Thomas-Anterion, C; Michon, A; Croisile, B; Etcharry-Bouyx, F; Berr, C; Dartigues, J-F; Amouyel, P; Dauchel, H; Boutoleau-Bretonnière, C; Thauvin, C; Frebourg, T; Lambert, J-C; Campion, D

    2012-09-01

    Performing exome sequencing in 14 autosomal dominant early-onset Alzheimer disease (ADEOAD) index cases without mutation on known genes (amyloid precursor protein (APP), presenilin1 (PSEN1) and presenilin2 (PSEN2)), we found that in five patients, the SORL1 gene harbored unknown nonsense (n=1) or missense (n=4) mutations. These mutations were not retrieved in 1500 controls of same ethnic origin. In a replication sample, including 15 ADEOAD cases, 2 unknown non-synonymous mutations (1 missense, 1 nonsense) were retrieved, thus yielding to a total of 7/29 unknown mutations in the combined sample. Using in silico predictions, we conclude that these seven private mutations are likely to have a pathogenic effect. SORL1 encodes the Sortilin-related receptor LR11/SorLA, a protein involved in the control of amyloid beta peptide production. Our results suggest that besides the involvement of the APP and PSEN genes, further genetic heterogeneity, involving another gene of the same pathway is present in ADEOAD.

  20. Genetic linkage of autosomal dominant progressive supranuclear palsy to 1q31.1.

    Science.gov (United States)

    Ros, Raquel; Gómez Garre, Pilar; Hirano, Michio; Tai, Yen F; Ampuero, Israel; Vidal, Lídice; Rojo, Ana; Fontan, Aurora; Vazquez, Ana; Fanjul, Samira; Hernandez, Jaime; Cantarero, Susana; Hoenicka, Janet; Jones, Alison; Ahsan, R Laila; Pavese, Nicola; Piccini, Paola; Brooks, David J; Perez-Tur, Jordi; Nyggard, Torbjorn; de Yébenes, Justo G

    2005-05-01

    Progressive supranuclear palsy (PSP) is a disorder of unknown pathogenesis. Familial clusters of PSP have been reported related to mutations of protein tau. We report the linkage of a large Spanish family with typical autosomal dominant PSP to a new locus in chromosome 1. Four members of this family had typical PSP, confirmed by neuropathology in one case. At least five ancestors had similar disease. Other members of the family have incomplete phenotypes. The power of the linkage analysis was increased by detecting presymptomatic individuals with 18F-fluoro-dopa and 18F-deoxyglucose positron emission tomography. We screened the human genome with 340 polymorphic markers and we enriched the areas of interest with additional markers. The disease status was defined according to the clinical and positron emission tomography data. We excluded linkage to the tau gene in chromosome 17. PSP was linked, in this family, to one area of 3.4 cM in chromosome 1q31.1, with a maximal multipoint < OD score of +3.53. This area contains at least three genes, whose relevance in PSP is unknown. We expect to further define the gene responsible for PSP, which could help to understand the pathogenesis of this disease and to design effective treatment.

  1. Epidemiologic analysis of families with isolated anorectal malformations suggests high prevalence of autosomal dominant inheritance.

    Science.gov (United States)

    Dworschak, Gabriel C; Zwink, Nadine; Schmiedeke, Eberhard; Mortazawi, Kiarasch; Märzheuser, Stefanie; Reinshagen, Konrad; Leonhardt, Johannes; Gómez, Barbara; Volk, Patrick; Rißmann, Anke; Jenetzky, Ekkehart; Reutter, Heiko

    2017-12-13

    Anorectal malformations (ARM) are rare abnormalities that occur in approximately 1 in 3000 live births with around 40% of patients presenting with isolated forms. Multiple familial cases reported, suggest underlying genetic factors that remain largely unknown. The recurrence in relatives is considered rare, however transmission rates of ARM by affected parents have never been determined before. The inheritance pattern of ARM was investigated in our database of patients with isolated ARM. Within our cohort of 327 patients with isolated ARM we identified eight adult patients from eight families who had in total 16 children with their healthy spouse. Of these ten had ARM, resulting in a recurrence risk of approximately one in two live births (10 of 16; 62%). From 226 families with 459 siblings we found two affected siblings in five families. Hence, the recurrence risk of ARM among siblings is approximately one in 92 live births (5 of 459; 1.0%). Comparing the observed recurrence risk in our cohort with the prevalence in the general population, we see a 1500-fold increase in recurrence risk for offspring and a 32-fold increase if a sibling is affected. The recurrence risk of approximately 62% indicates an autosomal dominant mode of inheritance. Reliable figures on recurrence of ARM are becoming increasingly important since improved surgical techniques are able to maintain sexual function resulting in more offspring of patients with ARM. These data allow more precise counseling of families with ARM and support the need for genetic studies.

  2. Novel Presenting Phenotype in a Child With Autosomal Dominant Best's Vitelliform Macular Dystrophy.

    Science.gov (United States)

    Abdalla, Yasmine F; De Salvo, Gabriella; Elsahn, Ahmad; Self, James E

    2017-07-01

    Best's macular dystrophy (BMD) usually manifests with visual failure in the first or second decade of life; however, there is a large variability in expressivity of the disease, and some patients have no manifestation other than a pathological electro-oculogram (EOG). Autosomal dominant Best's vitelliform macular dystrophy (AD-BVMD) has a very specific phenotype that varies with the stage of the disease. In recent years, the authors have seen description of another clinical entity known as autosomal recessive BMD. Herein, the authors describe a 5-year-old girl referred from a peripheral hospital for investigation with a positive family history of BMD. Clinical findings included best-corrected visual acuity of 0.325 and 0.300 in the right and left eyes, respectively, by Sonksen logMar test, full color vision, normal orthoptic examination, and a small degree of hyperopia consistent with age. Macular optical coherence tomography (OCT) showed intraretinal fluid cysts and EOG showed reduced Arden ratio. Genetic testing was done for the proband and her father, who were found to be heterozygous for c.37C>T p. (Arg13Cys). The proband's younger sister will be reviewed and followed up once of age. The authors identified a new phenotype of AD-BVMD; although this is a single patient, more young children with BMD can now be scanned with the availability of hand-held OCT with better knowledge of the phenotype. [Ophthalmic Surg Lasers Imaging Retina. 2017;48:580-585.]. Copyright 2017, SLACK Incorporated.

  3. Autosomal dominant polycystic kidney disease caused by somatic and germline mosaicism.

    Science.gov (United States)

    Tan, A Y; Blumenfeld, J; Michaeel, A; Donahue, S; Bobb, W; Parker, T; Levine, D; Rennert, H

    2015-04-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a heterogeneous genetic disorder caused by loss of function mutations of PKD1 or PKD2 genes. Although PKD1 is highly polymorphic and the new mutation rate is relatively high, the role of mosaicism is incompletely defined. Herein, we describe the molecular analysis of ADPKD in a 19-year-old female proband and her father. The proband had a PKD1 truncation mutation c.10745dupC (p.Val3584ArgfsX43), which was absent in paternal peripheral blood lymphocytes (PBL). However, very low quantities of this mutation were detected in the father's sperm DNA, but not in DNA from his buccal cells or urine sediment. Next generation sequencing (NGS) analysis determined the level of this mutation in the father's PBL, buccal cells and sperm to be ∼3%, 4.5% and 10%, respectively, consistent with somatic and germline mosaicism. The PKD1 mutation in ∼10% of her father's sperm indicates that it probably occurred early in embryogenesis. In ADPKD cases where a de novo mutation is suspected because of negative PKD gene testing of PBL, additional evaluation with more sensitive methods (e.g. NGS) of the proband PBL and paternal sperm can enhance detection of mosaicism and facilitate genetic counseling. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Autosomal dominant tubulointerstitial kidney disease caused by uromodulin mutations: seek and you will find.

    Science.gov (United States)

    Raffler, Gabriele; Zitt, Emanuel; Sprenger-Mähr, Hannelore; Nagel, Mato; Lhotta, Karl

    2016-04-01

    Uromodulin (UMOD)-associated kidney disease belongs to the group of autosomal dominant interstitial kidney diseases and is caused by mutations in the UMOD gene. Affected patients present with hyperuricemia, gout, and progressive renal failure. The disease is thought to be very rare but is probably underdiagnosed. Two index patients from two families with tubulointerstitial nephropathy and hyperuricemia were examined, including blood and urine chemistry, ultrasound, and mutation analysis of the UMOD gene. In addition, other available family members were studied. In a 46-year-old female patient with a fractional excretion of uric acid of 3 %, analysis of the UMOD gene revealed a p.W202S missense mutation. The same mutation was found in her 72-year-old father, who suffers from gout and end-stage renal disease. The second index patient was a 47-year-old female with chronic kidney disease and gout for more than 10 years. Her fractional uric acid excretion was 3.5 %. Genetic analysis identified a novel p.H250Q UMOD mutation that was also present in her 12-year-old son, who had normal renal function and uric acid levels. In patients suffering from chronic tubulointerstitial nephropathy, hyperuricemia, and a low fractional excretion of uric acid mutation, analysis of the UMOD gene should be performed to diagnose UMOD-associated kidney disease.

  5. Isolated autosomal dominant growth hormone deficiency: an evolving pituitary deficit? A multicenter follow-up study.

    Science.gov (United States)

    Mullis, Primus E; Robinson, Iain C A F; Salemi, Souzan; Eblé, Andrée; Besson, Amélie; Vuissoz, Jean-Marc; Deladoey, Johnny; Simon, Dominique; Czernichow, Paul; Binder, Gerhard

    2005-04-01

    Four distinct familial types of isolated GH deficiency have been described so far, of which type II is the autosomal dominant inherited form. It is mainly caused by mutations within the first 6 bp of intervening sequence 3. However, other splice site and missense mutations have been reported. Based on in vitro experiments and transgenic animal data, there is strong evidence that there is a wide variability in phenotype in terms of the severity of GH deficiency. Therefore, we studied a total of 57 subjects belonging to 19 families suffering from different splice site as well as missense mutations within the GH-1 gene. The subjects presenting with a splice site mutation within the first 2 bp of intervening sequence 3 (5'IVS +1/+2 bp) leading to a skipping of exon 3 were found to be more likely to present in the follow-up with other pituitary hormone deficiencies. In addition, although the patients with missense mutations have previously been reported to be less affected, a number of patients presenting with the P89L missense GH form, showed some pituitary hormone impairment. The development of multiple hormonal deficiencies is not age dependent, and there is a clear variability in onset, severity, and progression, even within the same families. The message of clinical importance from these studies is that the pituitary endocrine status of all such patients should continue to be monitored closely over the years because further hormonal deficiencies may evolve with time.

  6. A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

    Science.gov (United States)

    Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-11-01

    Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

  7. Branched-chain amino acids enhance cyst development in autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Yamamoto, Junya; Nishio, Saori; Hattanda, Fumihiko; Nakazawa, Daigo; Kimura, Toru; Sata, Michio; Makita, Minoru; Ishikawa, Yasunobu; Atsumi, Tatsuya

    2017-08-01

    Autosomal dominant polycystic kidney disease (ADPKD) is characterized by the progressive development of kidney and liver cysts. The mammalian target of rapamycin (mTOR) cascade is one of the important pathways regulating cyst growth in ADPKD. Branched-chain amino acids (BCAAs), including leucine, play a crucial role to activate mTOR pathway. Therefore, we administered BCAA dissolved in the drinking water to Pkd1 flox/flox :Mx1-Cre (cystic) mice from four to 22 weeks of age after polyinosinic-polycytidylic acid-induced conditional Pkd1 knockout at two weeks of age. The BCAA group showed significantly greater kidney/body weight ratio and higher cystic index in both the kidney and liver compared to the placebo-treated mice. We found that the L-type amino acid transporter 1 that facilitates BCAA entry into cells is strongly expressed in cells lining the cysts. We also found increased cyst-lining cell proliferation and upregulation of mTOR and mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) pathways in the BCAA group. In vitro, we cultured renal epithelial cell lines from Pkd1 null mice with or without leucine. Leucine was found to stimulate cell proliferation, as well as activate mTOR and MAPK/ERK pathways in these cells. Thus, BCAA accelerated disease progression by mTOR and MAPK/ERK pathways. Hence, BCAA may be harmful to patients with ADPKD. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  8. The role of nicotinic acetylcholine receptors in autosomal dominant nocturnal frontal lobe epilepsy.

    Directory of Open Access Journals (Sweden)

    Andrea eBecchetti

    2015-02-01

    Full Text Available Autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE is a focal epilepsy with attacks typically arising in the frontal lobe during non rapid eye movement (NREM sleep. It is characterized by clusters of complex and stereotyped hypermotor seizures, frequently accompanied by sudden arousals. Cognitive and psychiatric symptoms may be also observed. Approximately 12% of the ADNFLE families carry mutations on genes coding for subunits of the heteromeric neuronal nicotinic receptors (nAChRs. This is consistent with the widespread expression of these receptors, particularly the α4β2* subtype, in the neocortex and thalamus. However, understanding how mutant nAChRs lead to partial frontal epilepsy is far from being straightforward because of the complexity of the cholinergic regulation in both developing and mature brains. The relation with the sleep-waking cycle must be also explained. We discuss some possible pathogenetic mechanisms in the light of recent advances about the nAChR role in prefrontal regions as well as the studies carried out in murine models of ADNFLE. Functional evidence points to alterations in prefrontal GABA release, and the synaptic unbalance probably arises during the cortical circuit maturation. Although most of the available functional evidence concerns mutations on nAChR subunit genes, other genes have been recently implicated in the disease, such as KCNT1 (coding for a Na+-dependent K+ channel, DEPD5 (Dishevelled, Egl-10 and Pleckstrin Domain-containing protein 5, and CRH (Corticotropin-Releasing Hormone. Overall, the uncertainties about both the etiology and the pathogenesis of ADNFLE point to the current gaps in our knowledge the regulation of neuronal networks in the cerebral cortex.

  9. Screening for Unruptured Intracranial Aneurysms in Autosomal Dominant Polycystic Kidney Disease: A Survey of 420 Nephrologists.

    Directory of Open Access Journals (Sweden)

    Adrien Flahault

    Full Text Available Despite a high prevalence of intracranial aneurysm (ICA in autosomal dominant polycystic kidney disease (ADPKD, rupture events are rare. The current recommendations for ICA screening are based on expert opinions and studies with low levels of evidence.The aim of our study was to describe the attitudes of practicing nephrologists in Europe towards screening for ICA using magnetic resonance angiography (MRA.We conducted a web-based survey among 1315 European French-speaking nephrologists and nephrology residents. An anonymous, electronic questionnaire including 24 independent questions related to ICA screening modalities, indications and participant profiles was sent by email between September and December 2014. Four hundred and twenty nephrologists (mostly from France participated, including 31 nephrology residents; the response rate was 32%.Systematic screening for ICA was advocated by 28% of the nephrologists. A family history of ICA rupture, sudden death, stroke and migraine were consensual indications for screening (> 90% of the panel. In other clinical situations largely not covered by the recommendations (pregnancy, nephrectomy, kidney transplantation, cardiac or hepatic surgery, uncontrolled hypertension, lack of familial ADPKD history, at-risk activity, tobacco use, the attitudes towards screening were highly divergent. ICA screening was influenced by nephrologists experience with ADPKD and by their practice setting. The majority of participants (57% would not repeat a normal ICA screening. Only a few participants (22% knew that non-contrast MRA was the reference diagnostic tool for ICA screening, whereas most participants thought that contrast enhancement was necessary to screen for ICA. The results from the nephrology residents were analyzed separately and yielded similar results.This practice survey revealed that most nephrologists follow the current recommendations for the initial screening of ICAs. However, more than a quarter of the

  10. Prevalence of autosomal dominant polycystic kidney disease in the European Union.

    Science.gov (United States)

    Willey, Cynthia J; Blais, Jaime D; Hall, Anthony K; Krasa, Holly B; Makin, Andrew J; Czerwiec, Frank S

    2017-08-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a leading cause of end-stage renal disease, but estimates of its prevalence vary by >10-fold. The objective of this study was to examine the public health impact of ADPKD in the European Union (EU) by estimating minimum prevalence (point prevalence of known cases) and screening prevalence (minimum prevalence plus cases expected after population-based screening). A review of the epidemiology literature from January 1980 to February 2015 identified population-based studies that met criteria for methodological quality. These examined large German and British populations, providing direct estimates of minimum prevalence and screening prevalence. In a second approach, patients from the 2012 European Renal Association‒European Dialysis and Transplant Association (ERA-EDTA) Registry and literature-based inflation factors that adjust for disease severity and screening yield were used to estimate prevalence across 19 EU countries (N = 407 million). Population-based studies yielded minimum prevalences of 2.41 and 3.89/10 000, respectively, and corresponding estimates of screening prevalences of 3.3 and 4.6/10 000. A close correspondence existed between estimates in countries where both direct and registry-derived methods were compared, which supports the validity of the registry-based approach. Using the registry-derived method, the minimum prevalence was 3.29/10 000 (95% confidence interval 3.27-3.30), and if ADPKD screening was implemented in all countries, the expected prevalence was 3.96/10 000 (3.94-3.98). ERA-EDTA-based prevalence estimates and application of a uniform definition of prevalence to population-based studies consistently indicate that the ADPKD point prevalence is <5/10 000, the threshold for rare disease in the EU. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA.

  11. Identification of novel mutations in Chinese Hans with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Yu Chaowen

    2011-12-01

    Full Text Available Abstract Background Autosomal dominant polycystic kidney disease (ADPKD is the most common inherited renal disease with an incidence of 1 in 400 to 1000. The disease is genetically heterogeneous, with two genes identified: PKD1 (16p13.3 and PKD2 (4q21. Molecular diagnosis of the disease in at-risk individuals is complicated due to the structural complexity of PKD1 gene and the high diversity of the mutations. This study is the first systematic ADPKD mutation analysis of both PKD1 and PKD2 genes in Chinese patients using denaturing high-performance liquid chromatography (DHPLC. Methods Both PKD1 and PKD2 genes were mutation screened in each proband from 65 families using DHPLC followed by DNA sequencing. Novel variations found in the probands were checked in their family members available and 100 unrelated normal controls. Then the pathogenic potential of the variations of unknown significance was examined by evolutionary comparison, effects of amino acid substitutions on protein structure, and effects of splice site alterations using online mutation prediction resources. Results A total of 92 variations were identified, including 27 reported previously. Definitely pathogenic mutations (ten frameshift, ten nonsense, two splicing defects and one duplication were identified in 28 families, and probably pathogenic mutations were found in an additional six families, giving a total detection level of 52.3% (34/65. About 69% (20/29 of the mutations are first reported with a recurrent mutation rate of 31%. Conclusions Mutation study of PKD1 and PKD2 genes in Chinese Hans with ADPKD may contribute to a better understanding of the genetic diversity between different ethnic groups and enrich the mutation database. Besides, evaluating the pathogenic potential of novel variations should also facilitate the clinical diagnosis and genetic counseling of the disease.

  12. De Novo GMNN Mutations Cause Autosomal-Dominant Primordial Dwarfism Associated with Meier-Gorlin Syndrome.

    Science.gov (United States)

    Burrage, Lindsay C; Charng, Wu-Lin; Eldomery, Mohammad K; Willer, Jason R; Davis, Erica E; Lugtenberg, Dorien; Zhu, Wenmiao; Leduc, Magalie S; Akdemir, Zeynep C; Azamian, Mahshid; Zapata, Gladys; Hernandez, Patricia P; Schoots, Jeroen; de Munnik, Sonja A; Roepman, Ronald; Pearring, Jillian N; Jhangiani, Shalini; Katsanis, Nicholas; Vissers, Lisenka E L M; Brunner, Han G; Beaudet, Arthur L; Rosenfeld, Jill A; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Xia, Fan; Lalani, Seema R; Lupski, James R; Bongers, Ernie M H F; Yang, Yaping

    2015-12-03

    Meier-Gorlin syndrome (MGS) is a genetically heterogeneous primordial dwarfism syndrome known to be caused by biallelic loss-of-function mutations in one of five genes encoding pre-replication complex proteins: ORC1, ORC4, ORC6, CDT1, and CDC6. Mutations in these genes cause disruption of the origin of DNA replication initiation. To date, only an autosomal-recessive inheritance pattern has been described in individuals with this disorder, with a molecular etiology established in about three-fourths of cases. Here, we report three subjects with MGS and de novo heterozygous mutations in the 5' end of GMNN, encoding the DNA replication inhibitor geminin. We identified two truncating mutations in exon 2 (the 1(st) coding exon), c.16A>T (p.Lys6(∗)) and c.35_38delTCAA (p.Ile12Lysfs(∗)4), and one missense mutation, c.50A>G (p.Lys17Arg), affecting the second-to-last nucleotide of exon 2 and possibly RNA splicing. Geminin is present during the S, G2, and M phases of the cell cycle and is degraded during the metaphase-anaphase transition by the anaphase-promoting complex (APC), which recognizes the destruction box sequence near the 5' end of the geminin protein. All three GMNN mutations identified alter sites 5' to residue Met28 of the protein, which is located within the destruction box. We present data supporting a gain-of-function mechanism, in which the GMNN mutations result in proteins lacking the destruction box and hence increased protein stability and prolonged inhibition of replication leading to autosomal-dominant MGS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  13. Psychiatric comorbidities in patients from seven families with autosomal dominant cortical tremor, myoclonus, and epilepsy.

    Science.gov (United States)

    Coppola, Antonietta; Caccavale, Carmela; Santulli, Lia; Balestrini, Simona; Cagnetti, Claudia; Licchetta, Laura; Esposito, Marcello; Bisulli, Francesca; Tinuper, Paolo; Provinciali, Leandro; Minetti, Carlo; Zara, Federico; Striano, Pasquale; Striano, Salvatore

    2016-03-01

    The objective of this report was to assess the psychiatric comorbidity in a group of patients affected by autosomal dominant cortical tremor, myoclonus, and epilepsy (ADCME). Reliable and validated psychodiagnostic scales including the BDI (Beck Depression Inventory), STAI-Y1 and 2 (State-Trait Anxiety Inventory - Y; 1 and 2), MMPI-2 (Minnesota Multiphasic Personality Inventory - 2), and QoLIE-31 (Quality of Life in Epilepsy Inventory - 31) were administered to 20 patients with ADCME, 20 patients with juvenile myoclonic epilepsy (JME), and 20 healthy controls. There was a higher prevalence of mood disorders in patients with ADCME compared to patients with JME and healthy controls, particularly depression (p=0.035 and p=0.017, respectively) and state anxiety (p=0.024 and p=0.019, respectively). Trait anxiety was not different from JME (p=0.102) but higher than healthy controls (p=0.017). The myoclonus score positively correlated with both state (rho: 0.58, p=0.042) and trait anxiety (rho: 0.65, p=0.011). These psychiatric features were also often associated with pathological traits of personality: paranoid (OR: 25.7, p=0.003), psychasthenia (OR: 7.0, p=0.023), schizophrenia (OR: 8.5, p=0.011), and hypomania (OR: 5.5, p=0.022). Finally, in patients with ADCME, decreased quality of life correlated with these psychiatric symptoms. Patients with ADCME show a significant psychiatric burden that impairs their quality of life. A comprehensive psychiatric evaluation should be offered at the time of diagnosis to detect these comorbidities and to treat them. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Impaired growth and intracranial calcifications in autosomal dominant hypocalcemia caused by a GNA11 mutation.

    Science.gov (United States)

    Tenhola, Sirpa; Voutilainen, Raimo; Reyes, Monica; Toiviainen-Salo, Sanna; Jüppner, Harald; Mäkitie, Outi

    2016-09-01

    Autosomal dominant hypocalcemia (ADH) is characterized by hypocalcemia and inappropriately low PTH concentrations. ADH type 1 is caused by activating mutations in the calcium-sensing receptor (CASR), a G-protein-coupled receptor signaling through α11 (Gα11) and αq (Gαq) subunits. Heterozygous activating mutations in GNA11, the gene encoding Gα11, underlie ADH type 2. This study describes disease characteristics in a family with ADH caused by a gain-of-function mutation in GNA11. A three-generation family with seven members (3 adults, 4 children) presenting with ADH. Biochemical parameters of calcium metabolism, clinical, genetic and brain imaging findings were analyzed. Sanger sequencing revealed a heterozygous GNA11 missense mutation (c.1018G>A, p.V340M) in all seven hypocalcemic subjects, but not in the healthy family members (n=4). The adult patients showed clinical symptoms of hypocalcemia, while the children were asymptomatic. Plasma ionized calcium ranged from 0.95 to 1.14mmol/L, yet plasma PTH was inappropriately low for the degree of hypocalcemia. Serum 25OHD was normal. Despite hypocalcemia 1,25(OH)2D and urinary calcium excretion were inappropriately in the reference range. None of the patients had nephrocalcinosis. Two adults and one child (of the two MRI scanned children) had distinct intracranial calcifications. All affected subjects had short stature (height s.d. scores ranging from -3.4 to -2.3 vs -0.5 in the unaffected children). The identified GNA11 mutation results in biochemical abnormalities typical for ADH. Additional features, including short stature and early intracranial calcifications, cosegregated with the mutation. These findings may indicate a wider role for Gα11 signaling besides calcium regulation. © 2016 European Society of Endocrinology.

  15. Phenotypic diversity in autosomal-dominant cone-rod dystrophy elucidated by adaptive optics retinal imaging.

    Science.gov (United States)

    Song, Hongxin; Rossi, Ethan A; Stone, Edwin; Latchney, Lisa; Williams, David; Dubra, Alfredo; Chung, Mina

    2018-01-01

    Several genes causing autosomal-dominant cone-rod dystrophy (AD-CRD) have been identified. However, the mechanisms by which genetic mutations lead to cellular loss in human disease remain poorly understood. Here we combine genotyping with high-resolution adaptive optics retinal imaging to elucidate the retinal phenotype at a cellular level in patients with AD-CRD harbouring a defect in the GUCA1A gene. Nine affected members of a four-generation AD-CRD pedigree and three unaffected first-degree relatives underwent clinical examinations including visual acuity, fundus examination, Goldmann perimetry, spectral domain optical coherence tomography and electroretinography. Genome-wide scan followed by bidirectional sequencing was performed on all affected participants. High-resolution imaging using a custom adaptive optics scanning light ophthalmoscope (AOSLO) was performed for selected participants. Clinical evaluations showed a range of disease severity from normal fundus appearance in teenaged patients to pronounced macular atrophy in older patients. Molecular genetic testing showed a mutation in in GUCA1A segregating with disease. AOSLO imaging revealed that of the two teenage patients with mild disease, one had severe disruption of the photoreceptor mosaic while the other had a normal cone mosaic. AOSLO imaging demonstrated variability in the pattern of cone and rod cell loss between two teenage cousins with early AD-CRD, who had similar clinical features and had the identical disease-causing mutation in GUCA1A . This finding suggests that a mutation in GUCA1A does not lead to the same degree of AD-CRD in all patients. Modifying factors may mitigate or augment disease severity, leading to different retinal cellular phenotypes. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  16. Effec Of Low Protein Diet On Chronic Renal Failure Due To Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Terukuni Ideura

    2012-06-01

    Full Text Available There are few reports about therapeutic effects of low protein diet on the progression of chronic renal failure due to autosomal dominant polycystic kidney disease (ADPKD, although the disease is common.The annual incidence rate for end-stage renal disease caused by ADPKD is around 6 per million.In this retrospective study in one center, ten chronic renal failure patients due to ADPKD with creatinine clearnce of 17.0±3.3 mL/min /1.73 m2 and serum creatinine (Cr level of 4.4±0.7 mg/dL were studied for 40 months after the introduction of severe low protein diet (SLPD (0.48±0.03 g/kgBW/day without supplementation of essential amino acids or keto-analogues. Dietary protein intake was estimated by urea appearance rate from 24hr urine sample according to Mitch-Maroni's formula. The results clearly showed that ▵1/Cr/month(×10−3 was significantly suppressed from 5.8±0.9 to 2.0±0.6 following the introduction of SLPD (p<0.02. Furthermore, BUN/Cr ratio decreased from 10.4±0.02 to 7.3±0.02 (p<0.01. Mean blood pressure (mmHg remained unchanged; 92±3 vs 89±3 (ns, and urinary protein excretion (g/day did not change; 0.6±0.2 vs 0.6±0.1 (ns. There were no significant differences between body mass index, serum albumin, transferrin and hemoglobin levels as the indices of nutritional state before and after the introduction of SLPD.In conclusion, SLPD was effective in suppressing the progression of further decline in renal function due to ADPKD under nutritionally safety condition in this cohort.

  17. Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Li, Linda Xiaoyan; Fan, Lucy X; Zhou, Julie Xia; Grantham, Jared J; Calvet, James P; Sage, Julien; Li, Xiaogang

    2017-06-30

    Autosomal dominant polycystic kidney disease (ADPKD) is driven by mutations in PKD1 and PKD2 genes. Recent work suggests that epigenetic modulation of gene expression and protein function may play a role in ADPKD pathogenesis. In this study, we identified SMYD2, a SET and MYND domain protein with lysine methyltransferase activity, as a regulator of renal cyst growth. SMYD2 was upregulated in renal epithelial cells and tissues from Pkd1-knockout mice as well as in ADPKD patients. SMYD2 deficiency delayed renal cyst growth in postnatal kidneys from Pkd1 mutant mice. Pkd1 and Smyd2 double-knockout mice lived longer than Pkd1-knockout mice. Targeting SMYD2 with its specific inhibitor, AZ505, delayed cyst growth in both early- and later-stage Pkd1 conditional knockout mouse models. SMYD2 carried out its function via methylation and activation of STAT3 and the p65 subunit of NF-κB, leading to increased cystic renal epithelial cell proliferation and survival. We further identified two positive feedback loops that integrate epigenetic regulation and renal inflammation in cyst development: SMYD2/IL-6/STAT3/SMYD2 and SMYD2/TNF-α/NF-κB/SMYD2. These pathways provide mechanisms by which SMYD2 might be induced by cyst fluid IL-6 and TNF-α in ADPKD kidneys. The SMYD2 transcriptional target gene Ptpn13 also linked SMYD2 to other PKD-associated signaling pathways, including ERK, mTOR, and Akt signaling, via PTPN13-mediated phosphorylation.

  18. Radiologic and clinical bronchiectasis associated with autosomal dominant polycystic kidney disease.

    Directory of Open Access Journals (Sweden)

    Teng Moua

    Full Text Available BACKGROUND: Polycystin 1 and 2, the protein abnormalities associated with autosomal dominant polycystic kidney disease (ADPKD, are also found in airway cilia and smooth muscle cells. There is evidence of increased radiologic bronchiectasis associated with ADPKD, though the clinical and functional implications of this association are unknown. We hypothesized an increased prevalence of both radiologic and clinical bronchiectasis is associated with APDKD as compared to non-ADPKD chronic kidney disease (CKD controls. MATERIALS AND METHODS: A retrospective case-control study was performed at our institution involving consecutive ADPKD and non-ADPKD chronic kidney disease (CKD patients seen over a 13 year period with both chest CT and PFT. CTs were independently reviewed by two blinded thoracic radiologists. Manually collected clinical data included symptoms, smoker status, transplant history, and PFT findings. RESULTS: Ninety-two ADPKD and 95 non-ADPKD CKD control patients were compared. Increased prevalence of radiologic bronchiectasis, predominantly mild lower lobe disease, was found in ADPKD patients compared to CKD control (19 vs. 9%, P = 0.032, OR 2.49 (CI 1.1-5.8. After adjustment for covariates, ADPKD was associated with increased risk of radiologic bronchiectasis (OR 2.78 (CI 1.16-7.12. Symptomatic bronchiectasis occurred in approximately a third of ADPKD patients with radiologic disease. Smoking was associated with increased radiologic bronchiectasis in ADPKD patients (OR 3.59, CI 1.23-12.1. CONCLUSIONS: Radiological bronchiectasis is increased in patients with ADPKD particularly those with smoking history as compared to non-ADPKD CKD controls. A third of such patients have symptomatic disease. Bronchiectasis should be considered in the differential in ADPKD patients with respiratory symptoms and smoking history.

  19. Attitudes in Patients with Autosomal Dominant Polycystic Kidney Disease Toward Prenatal Diagnosis and Preimplantation Genetic Diagnosis.

    Science.gov (United States)

    Swift, Oscar; Vilar, Enric; Rahman, Belinda; Side, Lucy; Gale, Daniel P

    2016-12-01

    No recommendations currently exist regarding implementation of both prenatal diagnosis and preimplantation genetic diagnosis (PGD) for autosomal dominant polycystic kidney disease (ADPKD). This study evaluated attitudes in ADPKD patients with either chronic kidney disease (CKD) stages I-IV or end-stage renal failure (ESRF) toward prenatal diagnosis and PGD. Ninety-six ADPKD patients were recruited from an outpatient clinic, wards, and dialysis units. Thirty-eight patients had ESRF and 58 had CKD stages I-IV. Participants were given an information sheet on prenatal diagnosis and PGD and subsequently completed a questionnaire. The median age of participants was 51.5 years. Seventeen percent of ADPKD patients with CKD and 18% of ADPKD patients with ESRF would consider prenatal diagnosis and termination of pregnancy for ADPKD. Fifty percent with CKD would have opted for PGD (or might consider it in the future) were it available and funded by the UK National Health Service, compared to 63% in the ESRF group (p = 0.33). Sixty-nine percent in the CKD group and 68% in the ESRF group believed that PGD should be offered to other patients. There was a spectrum of attitudes among this cohort. A proportion of patients believe that PGD should be made available to prospective parents with this disease. The discrepancy between the low proportion (17% CKD, 18% ESRF) who would consider prenatal diagnosis and termination of pregnancy and the higher number who hypothetically express an intention or wish to access PGD (50% CKD and 63% ESRF) indicates far greater acceptability for diagnostic methods that occur before embryo implantation. It is not known how the development of methods to identify patients whose renal function is likely to decline rapidly and treatments altering the natural history of ADPKD will affect these attitudes.

  20. Nephrotic Syndrome and Idiopathic Membranous Nephropathy Associated with Autosomal-Dominant Polycystic Kidney Disease

    Science.gov (United States)

    Peces, Ramón; Martínez-Ara, Jorge; Peces, Carlos; Picazo, Mariluz; Cuesta-López, Emilio; Vega, Cristina; Azorín, Sebastián; Selgas, Rafael

    2011-01-01

    We report the case of a 38-year-old male with autosomal-dominant polycystic kidney disease (ADPKD) and concomitant nephrotic syndrome secondary to membranous nephropathy (MN). A 3-month course of prednisone 60 mg daily and losartan 100 mg daily resulted in resistance. Treatment with chlorambucil 0.2 mg/kg daily, low-dose prednisone, plus an angiotensin-converting enzyme inhibitor (ACEI) and an angiotensin II receptor blocker (ARB) for 6 weeks resulted in partial remission of his nephrotic syndrome for a duration of 10 months. After relapse of the nephrotic syndrome, a 13-month course of mycophenolate mofetil (MFM) 2 g daily and low-dose prednisone produced complete remission for 44 months. After a new relapse, a second 24-month course of MFM and low-dose prednisone produced partial to complete remission of proteinuria with preservation of renal function. Thirty-six months after MFM withdrawal, complete remission of nephrotic-range proteinuria was maintained and renal function was preserved. This case supports the idea that renal biopsy is needed for ADPKD patients with nephrotic-range proteinuria in order to exclude coexisting glomerular disease and for appropriate treatment/prevention of renal function deterioration. To the best of our knowledge, this is the first reported case of nephrotic syndrome due to MN in a patient with ADPKD treated with MFM, with remission of proteinuria and preservation of renal function after more than 10 years. Findings in this patient also suggest that MFM might reduce cystic cell proliferation and fibrosis, preventing progressive renal scarring with preservation of renal function. PMID:21552769

  1. Nephrotic Syndrome and Idiopathic Membranous Nephropathy Associated with Autosomal-Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Ramón Peces

    2011-01-01

    Full Text Available We report the case of a 38-year-old male with autosomal-dominant polycystic kidney disease (ADPKD and concomitant nephrotic syndrome secondary to membranous nephropathy (MN. A 3-month course of prednisone 60 mg daily and losartan 100 mg daily resulted in resistance. Treatment with chlorambucil 0.2 mg/kg daily, low-dose prednisone, plus an angiotensin-converting enzyme inhibitor (ACEI and an angiotensin II receptor blocker (ARB for 6 weeks resulted in partial remission of his nephrotic syndrome for a duration of 10 months. After relapse of the nephrotic syndrome, a 13-month course of mycophenolate mofetil (MFM 2 g daily and low-dose prednisone produced complete remission for 44 months. After a new relapse, a second 24-month course of MFM and low-dose prednisone produced partial to complete remission of proteinuria with preservation of renal function. Thirty-six months after MFM withdrawal, complete remission of nephrotic-range proteinuria was maintained and renal function was preserved. This case supports the idea that renal biopsy is needed for ADPKD patients with nephrotic-range proteinuria in order to exclude coexisting glomerular disease and for appropriate treatment/prevention of renal function deterioration. To the best of our knowledge, this is the first reported case of nephrotic syndrome due to MN in a patient with ADPKD treated with MFM, with remission of proteinuria and preservation of renal function after more than 10 years. Findings in this patient also suggest that MFM might reduce cystic cell proliferation and fibrosis, preventing progressive renal scarring with preservation of renal function.

  2. Autosomal dominant hypoparathyroidism caused by germline mutation in GNA11: phenotypic and molecular characterization.

    Science.gov (United States)

    Li, Dong; Opas, Evan E; Tuluc, Florin; Metzger, Daniel L; Hou, Cuiping; Hakonarson, Hakon; Levine, Michael A

    2014-09-01

    Most cases of autosomal dominant hypoparathyroidism (ADH) are caused by gain-of-function mutations in CASR or dominant inhibitor mutations in GCM2 or PTH. Our objectives were to identify the genetic basis for ADH in a multigenerational family and define the underlying disease mechanism. Here we evaluated a multigenerational family with ADH in which affected subjects had normal sequences in these genes and were shorter than unaffected family members. We collected clinical and biochemical data from 6 of 11 affected subjects and performed whole-exome sequence analysis on DNA from two affected sisters and their affected father. Functional studies were performed after expression of wild-type and mutant Gα11 proteins in human embryonic kidney-293-CaR cells that stably express calcium-sensing receptors. Whole-exome-sequencing followed by Sanger sequencing revealed a heterozygous mutation, c.179G>T; p.R60L, in GNA11, which encodes the α-subunit of G11, the principal heterotrimeric G protein that couples calcium-sensing receptors to signal activation in parathyroid cells. Functional studies of Gα11 R60L showed increased accumulation of intracellular concentration of free calcium in response to extracellular concentration of free calcium with a significantly decreased EC50 compared with wild-type Gα11. By contrast, R60L was significantly less effective than the oncogenic Q209L form of Gα11 as an activator of the MAPK pathway. Compared to subjects with CASR mutations, patients with GNA11 mutations lacked hypercalciuria and had normal serum magnesium levels. Our findings indicate that the germline gain-of-function mutation of GNA11 is a cause of ADH and implicate a novel role for GNA11 in skeletal growth.

  3. Affected parent sex and severity of autosomal dominant polycystic kidney disease: a retrospective cohort study
.

    Science.gov (United States)

    Nowak, Kristen L; Chonchol, Michel; You, Zhiying; Gupta, Malika; Gitomer, Berenice

    2018-03-01

    Parental inheritance may differentially affect autosomal dominant polycystic kidney disease (-ADPKD) severity via genetic imprinting or in utero epigenetic modifications; however, evidence is inconsistent. We conducted a longitudinal retrospective cohort study to assess the association between sex of the affected parent and time to hypertension diagnosis, end-stage renal disease (ESRD), and death in patients with the PKD1 genotype. 814 individuals who participated in research at the University of Colorado were studied. Kaplan-Meier survival analysis was performed. The predictor was parental sex, and outcomes were diagnosis of hypertension, progression to ESRD, and death. We also examined associations in four strata according to affected parent and participant sex, as previous studies have reported earlier onset of ESRD in males compared to females. The median follow-up for each outcome was as follows: hypertension, 30 (interquartile range (IQR): 18, 37); ESRD, 43 (IQR: 31, 52), death 39 (IQR: 25, 52) years of age. Among affected offspring in the entire cohort, there was no difference in hypertension diagnosis (p = 0.97) or progression to ESRD (p = 0.79) according to affected parent sex; however, participants with an affected mother were more likely to die than participants with an affected father (p father (p < 0.01) but not when the affected parent was the mother (p ≥ 0.11). Our results are largely in contrast to the hypothesis that severity of ADPKD is worse with maternal inheritance of disease.
.

  4. Iron Supplementation Associated With Loss of Phenotype in Autosomal Dominant Hypophosphatemic Rickets.

    Science.gov (United States)

    Kapelari, Klaus; Köhle, Julia; Kotzot, Dieter; Högler, Wolfgang

    2015-09-01

    Autosomal dominant hypophosphatemic rickets (ADHR) is the only hereditary disorder of renal phosphate wasting in which patients may regain the ability to conserve phosphate. Low iron status plays a role in the pathophysiology of ADHR. This study reports of a girl with ADHR, iron deficiency, and a paternal history of hypophosphatemic rickets that resolved without treatment. The girl's biochemical phenotype resolved with iron supplementation. A 26-month-old girl presented with typical features of hypophosphatemic rickets, short stature (79 cm; -2.82 SDS), and iron deficiency. Treatment with elemental phosphorus and calcitriol improved her biochemical profile and resolved the rickets. The girl's father had presented with rickets at age 11 months but never received medication. His final height was reduced (154.3 cm; -3.51 SDS), he had undergone corrective leg surgery and had an adult normal phosphate, fibroblast growth factor 23, and iron status. Father and daughter were found to have a heterozygous mutation in exon 3 of the FGF23 gene (c.536G>A, p.Arg179Gln), confirming ADHR. Withdrawal of rickets medication was attempted off and on iron supplementation. Withdrawal of rickets medication in the girl was unsuccessful in the presence of low-normal serum iron levels at age 5.6 years but was later successful in the presence of high-normal serum iron levels following high-dose iron supplementation. We report an association between iron supplementation and a complete loss of biochemical ADHR phenotype, allowing withdrawal of rickets medication. Experience from this case suggests that reduction and withdrawal of rickets medication should be attempted only after iron status has been optimized.

  5. Three novel GJB2 (connexin 26) variants associated with autosomal dominant syndromic and nonsyndromic hearing loss.

    Science.gov (United States)

    DeMille, Desiree; Carlston, Colleen M; Tam, Oliver H; Palumbos, Janice C; Stalker, Heather J; Mao, Rong; Zori, Roberto T; Viskochil, David H; Park, Albert H; Carey, John C

    2018-04-01

    Connexin 26 (Cx26), encoded by the GJB2 gene, is a key protein involved in the formation of gap junctions in epithelial organs including the inner ear and palmoplantar epidermis. Pathogenic variants in GJB2 are responsible for approximately 50% of inherited sensorineural deafness. The majority of these variants are associated with autosomal recessive inheritance; however, rare reports of dominantly co-segregating variants have been published. Since we began offering GJB2 testing in 2003, only about 2% of detected GJB2 variants from our laboratory have been classified as dominant. Here we report three novel dominant GJB2 variants (p.Thr55Ala, p.Gln57_Pro58delinsHisSer, and p.Trp44Gly); two associated with syndromic sensorineural hearing loss and one with nonsyndromic hearing loss. In the kindred with the p.Thr55Ala variant, the proband and his father present with only leukonychia as a cutaneous finding of their syndromic hearing loss. This phenotype has been previously documented in conjunction with palmoplantar hyperkeratosis, but isolated leukonychia is a novel finding likely associated with the unique threonine to alanine change at codon 55 (other variants at this codon have been reported in cases of nonsyndromic hearing loss). This report contributes to the short list of GJB2 variants associated with autosomal dominant hearing loss, highlights the variability of skin and nail findings associated with such cases, and illustrates the occurrence of both syndromic and nonsyndromic presentations with changes in the same gene. © 2018 Wiley Periodicals, Inc.

  6. Autosomal dominant polycystic kidney disease in a family with mosaicism and hypomorphic allele.

    Science.gov (United States)

    Reiterová, Jana; Štekrová, Jitka; Merta, Miroslav; Kotlas, Jaroslav; Elišáková, Veronika; Lněnička, Petr; Korabečná, Marie; Kohoutová, Milada; Tesař, Vladimír

    2013-03-15

    Autosomal dominant polycystic kidney disease (ADPKD) is the most common form of inherited kidney disease that results in renal failure. ADPKD is a systemic disorder with cysts and connective tissue abnormalities involving many organs. ADPKD caused by mutations in PKD1 gene is significantly more severe than the cases caused by PKD2 gene mutations. The large intra-familial variability of ADPKD highlights a role for genetic background. Here we report a case of ADPKD family initially appearing unlinked to the PKD1 or PKD2 loci and the influence of mosaicism and hypomorphic allele on the variability of the clinical course of the disease. A grandmother with the PKD1 gene mutation in mosaicism (p.Val1105ArgfsX4) and with mild clinical course of ADPKD (end stage renal failure at the age of 77) seemed to have ADPKD because of PKD2 gene mutation. On the other hand, her grandson had a severe clinical course (end stage renal disease at the age of 45) in spite of the early treatment of mild hypertension. There was found by mutational analysis of PKD genes that the severe clinical course was caused by PKD1 gene frameshifting mutation inherited from his father and mildly affected grandmother in combination with inherited hypomorphic PKD1 allele with described missense mutation (p.Thr2250Met) from his clinically healthy mother. The sister with two cysts and with PKD1 hypomorphic allele became the kidney donor to her severely affected brother. We present the first case of ADPKD with the influence of mosaicism and hypomorphic allele of the PKD1 gene on clinical course of ADPKD in one family. Moreover, this report illustrates the role of molecular genetic testing in assessing young related kidney donors for patients with ADPKD.

  7. Autosomal dominant pseudohypoaldosteronism type 1 with a novel splice site mutation in MR gene

    Directory of Open Access Journals (Sweden)

    Kaito Hiroshi

    2009-11-01

    Full Text Available Abstract Background Autosomal dominant pseudohypoaldosteronism type 1 (PHA1 is a rare inherited condition that is characterized by renal resistance to aldosterone as well as salt wasting, hyperkalemia, and metabolic acidosis. Renal PHA1 is caused by mutations of the human mineralcorticoid receptor gene (MR, but it is a matter of debate whether MR mutations cause mineralcorticoid resistance via haploinsufficiency or dominant negative mechanism. It was previously reported that in a case with nonsense mutation the mutant mRNA was absent in lymphocytes because of nonsense mediated mRNA decay (NMD and therefore postulated that haploinsufficiency alone can give rise to the PHA1 phenotype in patients with truncated mutations. Methods and Results We conducted genomic DNA analysis and mRNA analysis for familial PHA1 patients extracted from lymphocytes and urinary sediments and could detect one novel splice site mutation which leads to exon skipping and frame shift result in premature termination at the transcript level. The mRNA analysis showed evidence of wild type and exon-skipped RT-PCR products. Conclusion mRNA analysis have been rarely conducted for PHA1 because kidney tissues are unavailable for this disease. However, we conducted RT-PCR analysis using mRNA extracted from urinary sediments. We could demonstrate that NMD does not fully function in kidney cells and that haploinsufficiency due to NMD with premature termination is not sufficient to give rise to the PHA1 phenotype at least in this mutation of our patient. Additional studies including mRNA analysis will be needed to identify the exact mechanism of the phenotype of PHA.

  8. Cerebral amyloidosis associated with cognitive decline in autosomal dominant Alzheimer disease.

    Science.gov (United States)

    Wang, Fen; Gordon, Brian A; Ryman, Davis C; Ma, Shengmei; Xiong, Chengjie; Hassenstab, Jason; Goate, Alison; Fagan, Anne M; Cairns, Nigel J; Marcus, Daniel S; McDade, Eric; Ringman, John M; Graff-Radford, Neill R; Ghetti, Bernardino; Farlow, Martin R; Sperling, Reisa; Salloway, Steve; Schofield, Peter R; Masters, Colin L; Martins, Ralph N; Rossor, Martin N; Jucker, Mathias; Danek, Adrian; Förster, Stefan; Lane, Christopher A S; Morris, John C; Benzinger, Tammie L S; Bateman, Randall J

    2015-09-01

    To investigate the associations of cerebral amyloidosis with concurrent cognitive performance and with longitudinal cognitive decline in asymptomatic and symptomatic stages of autosomal dominant Alzheimer disease (ADAD). Two hundred sixty-three participants enrolled in the Dominantly Inherited Alzheimer Network observational study underwent neuropsychological evaluation as well as PET scans with Pittsburgh compound B. One hundred twenty-one participants completed at least 1 follow-up neuropsychological evaluation. Four composite cognitive measures representing global cognition, episodic memory, language, and working memory were generated using z scores from a battery of 13 standard neuropsychological tests. General linear mixed-effects models were used to investigate the relationship between baseline cerebral amyloidosis and baseline cognitive performance and whether baseline cerebral amyloidosis predicts cognitive change over time (mean follow-up 2.32 years ± 0.92, range 0.89-4.19) after controlling for estimated years from expected symptom onset, APOE ε4 allelic status, and education. In asymptomatic mutation carriers, amyloid burden was not associated with baseline cognitive functioning but was significantly predictive of longitudinal decline in episodic memory. In symptomatic mutation carriers, cerebral amyloidosis was correlated with worse baseline performance in multiple cognitive composites and predicted greater decline over time in global cognition, working memory, and Mini-Mental State Examination. Cerebral amyloidosis predicts longitudinal episodic memory decline in presymptomatic ADAD and multidomain cognitive decline in symptomatic ADAD. These findings imply that amyloidosis in the brain is an indicator of early cognitive decline and provides a useful outcome measure for early assessment and prevention treatment trials. © 2015 American Academy of Neurology.

  9. Relationship between intracranial aneurysms and the severity of autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Yoshida, Hiroki; Higashihara, Eiji; Maruyama, Keisuke; Nutahara, Kikuo; Nitatori, Toshiaki; Miyazaki, Isao; Shiokawa, Yoshiaki

    2017-12-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary kidney disease characterized by the progressive enlargement of innumerable renal cysts. Although the association of intracranial aneurysms (ICANs) with ADPKD is well known, the relationship between the ICAN and the disease severity including total kidney volume (TKV) and estimated glomerular filtration rate (eGFR) is poorly understood. We screened 265 patients with ADPKD (mean age, 48.8 years; range, 14.9-88.3 years) with MR angiography. The patients with a past history related to ICANs were excluded from the study. The incidence and characteristics of ICAN in patients with ADPKD were evaluated. TKV was measured by volumetric analyses of MR imaging. We detected 65 ICANs in 49 patients (37 women and 12 men, mean age, 52.7 years; range, 20.4-86 years). The incidence of ICANs was 18.5% and female patients had was higher incidence (23.1%) than male patients (11.4%) (p = 0.02). An age of those with ICANs was significantly higher than those without (p = 0.006), and the cumulative risk of diagnosis of ICANs increased with age. TKV was significantly larger in those with ICANs than those without (p = 0.001), but eGFR was not different between two groups (p = 0.07). By multivariate analyses, only TKV was significantly related to the development of ICANs (p = 0.02). The incidence of ICANs increased with age, was higher in females, and correlated with kidney enlargement in patients with ADPKD. Necessity of screening ICANs would be particularly high in elderly women with large kidneys.

  10. A novel OPA1 mutation in a Chinese family with autosomal dominant optic atrophy

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Juanjuan; Yuan, Yimin; Lin, Bing; Feng, Hao; Li, Yan [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou 325027, Zhejiang (China); Dai, Xianning; Zhou, Huihui [Attardi Institute of Mitochondrial Biomedicine and Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou 325035, Zhejiang (China); Dong, Xujie [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou 325027, Zhejiang (China); Liu, Xiao-Ling, E-mail: lxl@mail.eye.ac.cn [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou 325027, Zhejiang (China); Guan, Min-Xin, E-mail: min-xin.guan@cchmc.org [Attardi Institute of Mitochondrial Biomedicine and Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou 325035, Zhejiang (China); Institute of Genetics, Zhejiang University, Hangzhou, Zhejiang 310012 (China); Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, OH 45229 (United States)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer We report the characterization of a four-generation large Chinese family with ADOA. Black-Right-Pointing-Pointer We find a new heterozygous mutation c.C1198G in OPA1 gene which may be a novel pathogenic mutation in this pedigree. Black-Right-Pointing-Pointer We do not find any mitochondrial DNA mutations associated with optic atrophy. Black-Right-Pointing-Pointer Other factors may also contribute to the phenotypic variability of ADOA in this pedigree. -- Abstract: A large four-generation Chinese family with autosomal dominant optic atrophy (ADOA) was investigated in the present study. Eight of the family members were affected in this pedigree. The affected family members exhibited early-onset and progressive visual impairment, resulting in mild to profound loss of visual acuity. The average age-at-onset was 15.9 years. A new heterozygous mutation c.C1198G was identified by sequence analysis of the 12th exon of the OPA1 gene. This mutation resulted in a proline to alanine substitution at codon 400, which was located in an evolutionarily conserved region. This missense mutation in the GTPase domain was supposed to result in a loss of function for the encoded protein and act through a dominant negative effect. No other mutations associated with optic atrophy were found in our present study. The c.C1198G heterozygous mutation in the OPA1 gene may be a novel key pathogenic mutation in this pedigree with ADOA. Furthermore, additional nuclear modifier genes, environmental factors, and psychological factors may also contribute to the phenotypic variability of ADOA in this pedigree.

  11. A novel OPA1 mutation in a Chinese family with autosomal dominant optic atrophy

    International Nuclear Information System (INIS)

    Zhang, Juanjuan; Yuan, Yimin; Lin, Bing; Feng, Hao; Li, Yan; Dai, Xianning; Zhou, Huihui; Dong, Xujie; Liu, Xiao-Ling; Guan, Min-Xin

    2012-01-01

    Highlights: ► We report the characterization of a four-generation large Chinese family with ADOA. ► We find a new heterozygous mutation c.C1198G in OPA1 gene which may be a novel pathogenic mutation in this pedigree. ► We do not find any mitochondrial DNA mutations associated with optic atrophy. ► Other factors may also contribute to the phenotypic variability of ADOA in this pedigree. -- Abstract: A large four-generation Chinese family with autosomal dominant optic atrophy (ADOA) was investigated in the present study. Eight of the family members were affected in this pedigree. The affected family members exhibited early-onset and progressive visual impairment, resulting in mild to profound loss of visual acuity. The average age-at-onset was 15.9 years. A new heterozygous mutation c.C1198G was identified by sequence analysis of the 12th exon of the OPA1 gene. This mutation resulted in a proline to alanine substitution at codon 400, which was located in an evolutionarily conserved region. This missense mutation in the GTPase domain was supposed to result in a loss of function for the encoded protein and act through a dominant negative effect. No other mutations associated with optic atrophy were found in our present study. The c.C1198G heterozygous mutation in the OPA1 gene may be a novel key pathogenic mutation in this pedigree with ADOA. Furthermore, additional nuclear modifier genes, environmental factors, and psychological factors may also contribute to the phenotypic variability of ADOA in this pedigree.

  12. Autosomal dominant polycystic kidney disease: Study of clinical characteristics in an Indian population

    Directory of Open Access Journals (Sweden)

    Sanjay Vikrant

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common hereditary form of kidney disease. Clinical data on this multisystem disorder are scarce from developing countries. We conducted a prospective observational study of the clinical profile of ADPKD patients at a single center over a period of six years. A total of 208 patients were studied. Majority were male (60.6% and the mean age was 45.8 ± 14.5 years. About 61.5% had early stage (Stages 1-3 of chronic kidney disease (CKD and 38.5% had advanced CKD (Stages 4 and 5. Clinical features observed included pain abdomen (46.2%, nocturia (65.9%, hematuria (21.6%, nephrolithiasis (38.9%, urinary tract infection (UTI (38.9%, hypertension (69.5%, and raised serum creatinine (54.3%. The prevalence of nocturia, hypertension, and renal dysfunction showed a significant increase with age (P = 0.001. Extrarenal manifestations were polycystic liver disease in 77 patients (37%, cysts in pancreas in two (1%, and stroke in three (1.5% (hemorrhage in 2 and infarct in 1. There was significantly higher prevalence of hypertension (P = 0.027 and nephrolithiasis (P = 0.044 in males compared to females. Ninety-two patients (44.2% had a positive family history for ADPKD. Fifteen (7.2% had kidney failure at the diagnosis of ADPKD, were hospitalized, and underwent emergency dialysis. A total of 20 patients (9.6% developed end-stage kidney disease during the study period. The age at diagnosis was higher, and there was a high prevalence of hypertension, nocturia, abdominal pain, nephrolithiasis, UTI, and renal dysfunction in Indian ADPKD patients.

  13. Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11)

    NARCIS (Netherlands)

    Luijendijk, M.W.J.; Wijk, E. van; Bischoff, A.M.L.C.; Krieger, E.; Huygen, P.L.M.; Pennings, R.J.E.; Brunner, H.G.; Cremers, C.W.R.J.; Cremers, F.P.M.; Kremer, J.M.J.

    2004-01-01

    Myosin VIIA is an unconventional myosin that has been implicated in Usher syndrome type 1B, atypical Usher syndrome, non-syndromic autosomal recessive hearing impairment (DFNB2) and autosomal dominant hearing impairment (DFNA11). Here, we present a family with non-syndromic autosomal dominant

  14. Identification and molecular modelling of a mutation in the motor head domain of myosin VIIA in a family with autosomal dominant hearing impairment (DFNA11).

    NARCIS (Netherlands)

    Luijendijk, M.W.J.; Wijk, E. van; Bischoff, A.M.L.C.; Krieger, E.; Huygen, P.L.M.; Pennings, R.J.E.; Brunner, H.G.; Cremers, C.W.R.J.; Cremers, F.P.M.; Kremer, J.M.J.

    2004-01-01

    Myosin VIIA is an unconventional myosin that has been implicated in Usher syndrome type 1B, atypical Usher syndrome, non-syndromic autosomal recessive hearing impairment (DFNB2) and autosomal dominant hearing impairment (DFNA11). Here, we present a family with non-syndromic autosomal dominant

  15. Autosomal-dominant Leber Congenital Amaurosis Caused by a Heterozygous CRX Mutation in a Father and Son.

    Science.gov (United States)

    Arcot Sadagopan, Karthikeyan; Battista, Robert; Keep, Rosanne B; Capasso, Jenina E; Levin, Alex V

    2015-06-01

    Leber congenital amaurosis (LCA) is most often an autosomal recessive disorder. We report a father and son with autosomal dominant LCA due to a mutation in the CRX gene. DNA screening using an allele specific assay of 90 of the most common LCA-causing variations in the coding sequences of AIPL1, CEP290, CRB1, CRX, GUCY2D, RDH12 and RPE65 was performed on the father. Automated DNA sequencing of his son examining exon 3 of the CRX gene was subsequently performed. Both father and son have a heterozygous single base pair deletion of an adenine at codon 153 in the coding sequence of the CRX gene resulting in a frameshift mutation. Mutations involving the CRX gene may demonstrate an autosomal dominant inheritance pattern for LCA.

  16. Autosomal dominant cutis laxa with progeroid features due to a novel, de novo mutation in ALDH18A1.

    Science.gov (United States)

    Bhola, Priya T; Hartley, Taila; Bareke, Eric; Boycott, Kym M; Nikkel, Sarah M; Dyment, David A

    2017-06-01

    De novo dominant mutations in the aldehyde dehydrogenase 18 family member A1 (ALDH18A1) gene have recently been shown to cause autosomal dominant cutis laxa with progeroid features (MIM 616603). To date, all de novo dominant mutations have been found in a single highly conserved amino acid residue at position p.Arg138. We report an 8-year-old male with a clinical diagnosis of autosomal dominant cutis laxa (ADCL) with progeroid features and a novel de novo missense mutation in ALDH18A1 (NM_002860.3: c.377G>A (p.Arg126His)). This is the first report of an individual with ALDH18A1-ADCL due to a substitution at a residue other than p.Arg138. Knowledge of the complete spectrum of dominant-acting mutations that cause this rare syndrome will have implications for molecular diagnosis and genetic counselling of these families.

  17. Autosomal-dominant GTPCH1-deficient DRD: clinical characteristics and long-term outcome of 34 patients

    OpenAIRE

    Trender-Gerhard , Iris; Sweeney , Mary G; Schwingenschuh , Petra; Mir , Pablo; Edwards , Mark J; Gerhard , Alexander; Polke , James M; Hanna , Mike G; Davis , Mary B; Wood , Nick W; Bhatia , Kailash P

    2009-01-01

    Abstract An autosomal dominantly inherited defect in the GCH1 gene that encodes guanosine triphosphate cyclohydrolase 1 (GTPCH1) is the most common cause of dopa-responsive dystonia (DRD). A classic phenotype of young-onset lower limb dystonia, diurnal fluctuations, and excellent response to levodopa has been well recognized in association with GCH1 mutations, and rare atypical presentations have been reported. However, a number of clinical issues remain unresolved including phenot...

  18. Progression of autosomal dominant kidney disease: measurement of the stage transitions of chronic kidney disease

    Directory of Open Access Journals (Sweden)

    Christopher M Blanchette

    2015-04-01

    Full Text Available Background: Autosomal dominant polycystic kidney disease (ADPKD is a progressive genetic disorder characterized by the development of numerous kidney cysts that result in kidney failure. Little is known regarding the key patient characteristics and utilization of healthcare resources for ADPKD patients along the continuum of disease progression. This observational study was designed to describe the characteristics of ADPKD patients and compare them with those of patients with other chronic kidney diseases. Methods: This retrospective cohort study involved patients with a claim for ADPKD or PKD unspecified from 1/1/2000–2/28/2013 and ≥6 months of previous continuous enrollment (baseline within a large database of administrative claims in the USA. A random sample of chronic kidney disease (CKD patients served as comparators. For a subset of ADPKD patients who had only a diagnosis code of unspecified PKD, abstraction of medical records was undertaken to estimate the proportion of patients who had medical chart-confirmed ADPKD. In patients with linked electronic laboratory data, the estimated glomerular filtration rate was calculated via serum creatinine values to determine CKD stage at baseline and during follow-up. Proportions of patients transitioning to another stage and the mean age at transition were calculated. Results: ADPKD patients were, in general, younger and had fewer physician visits, but had more specific comorbidities at observation start compared with CKD patients. ADPKD patients had a longer time in the milder stages and longer duration before recorded transition to a more severe stage compared with CKD patients. Patients with ADPKD at risk of rapid progression had a shorter time-to-end-stage renal disease than patients with CKD and ADPKD patients not at risk, but stage duration was similar between ADPKD patients at risk and those not at risk. Conclusions: These results suggest that distribution of patients by age at transition

  19. Iron Modifies Plasma FGF23 Differently in Autosomal Dominant Hypophosphatemic Rickets and Healthy Humans

    Science.gov (United States)

    Peacock, Munro; Gray, Amie K.; Padgett, Leah R.; Hui, Siu L.; Econs, Michael J.

    2011-01-01

    Context: In autosomal dominant hypophosphatemic rickets (ADHR), fibroblast growth factor 23 (FGF23) resists cleavage, causing increased plasma FGF23 levels. The clinical phenotype includes variable onset during childhood or adulthood and waxing/waning of hypophosphatemia. Delayed onset after puberty in females suggests iron status may be important. Objective: Studies were performed to test the hypothesis that plasma C-terminal and intact FGF23 concentrations are related to serum iron concentrations in ADHR. Design and Setting: Cross-sectional and longitudinal studies of ADHR and a cross-sectional study in healthy subjects were conducted at an academic medical center. Participants: Participants included 37 subjects with ADHR mutations from four kindreds and 158 healthy adult controls. Main Outcome Measure: The relationships of serum iron concentrations with plasma C-terminal and intact FGF23 concentrations were evaluated. Results: Serum phosphate and 1,25-dihydroxyvitamin D correlated negatively with C-terminal FGF23 and intact FGF23 in ADHR but not in controls. Serum iron was negatively correlated to both C-terminal FGF23 (r = −0.386; P < 0.05) and intact FGF23 (r = −0.602; P < 0.0001) in ADHR. However, control subjects also demonstrated a negative relationship of serum iron with C-terminal FGF23 (r = −0.276; P < 0.001) but no relationship with intact FGF23. Longitudinally in ADHR subjects, C-terminal FGF23 and intact FGF23 concentrations changed negatively with iron concentrations (P < 0.001 and P = 0.055, respectively), serum phosphate changed negatively with C-terminal FGF23 and intact FGF23 (P < 0.001), and there was a positive relationship between serum iron and phosphate (P < 0.001). Conclusions: Low serum iron is associated with elevated FGF23 in ADHR. However, in controls, low serum iron was also associated with elevated C-terminal FGF23, but not intact FGF23, suggesting cleavage maintains homeostasis despite increased FGF23 expression. PMID:21880793

  20. Berberine slows cell growth in autosomal dominant polycystic kidney disease cells

    International Nuclear Information System (INIS)

    Bonon, Anna; Mangolini, Alessandra; Pinton, Paolo; Senno, Laura del; Aguiari, Gianluca

    2013-01-01

    Highlights: •Berberine at appropriate doses slows cell proliferation in ADPKD cystic cells. •Reduction of cell growth by berberine occurs by inhibition of ERK and p70-S6 kinase. •Higher doses of berberine cause an overall cytotoxic effect. •Berberine overdose induces apoptotic bodies formation and DNA fragmentation. •Antiproliferative properties of this drug make it a new candidate for ADPKD therapy. -- Abstract: Autosomal dominant polycystic kidney disease (ADPKD) is the most common hereditary monogenic disorder characterized by development and enlargement of kidney cysts that lead to loss of renal function. It is caused by mutations in two genes (PKD1 and PKD2) encoding for polycystin-1 and polycystin-2 proteins which regulate different signals including cAMP, mTOR and EGFR pathways. Abnormal activation of these signals following PC1 or PC2 loss of function causes an increased cell proliferation which is a typical hallmark of this disease. Despite the promising findings obtained in animal models with targeted inhibitors able to reduce cystic cell growth, currently, no specific approved therapy for ADPKD is available. Therefore, the research of new more effective molecules could be crucial for the treatment of this severe pathology. In this regard, we have studied the effect of berberine, an isoquinoline quaternary alkaloid, on cell proliferation and apoptosis in human and mouse ADPKD cystic cell lines. Berberine treatment slows cell proliferation of ADPKD cystic cells in a dose-dependent manner and at high doses (100 μg/mL) it induces cell death in cystic cells as well as in normal kidney tubule cells. However, at 10 μg/mL, berberine reduces cell growth in ADPKD cystic cells only enhancing G 0 /G 1 phase of cell cycle and inhibiting ERK and p70-S6 kinases. Our results indicate that berberine shows a selected antiproliferative activity in cellular models for ADPKD, suggesting that this molecule and similar natural compounds could open new opportunities

  1. FDG-PET/CT in autosomal dominant polycystic kidney disease patients with suspected cyst infection.

    Science.gov (United States)

    Pijl, Jordy Pieter; Glaudemans, Andor W J M; Slart, Riemer H J A; Kwee, Thomas Christian

    2018-04-13

    Purpose: To determine the value of 18 F-fluoro-2-deoxy-D-glucose (FDG) positron emission tomography (PET)/computed tomography (CT) for diagnosing renal or hepatic cyst infection in patients with autosomal dominant polycystic kidney disease (ADPKD). Methods: This retrospective single-center study included all patients with ADPKD who underwent FDG-PET/CT because of suspected cyst infection between 2010 and 2017. Results: Thirty FDG-PET/CT scans of thirty individual patients were included, of which 19 were positive for cyst infection. According to a previously established clinical and biochemical reference standard, FDG-PET/CT achieved sensitivity of 88.9%, specificity of 75.0%, positive predictive value of 84.2%, and negative predictive value of 81.8% for the diagnosis of cyst infection. In 5 cases, FDG-PET/CT suggested a different pathologic process that explained the symptoms, including pneumonia ( n = 1), generalized peritonitis ( n = 1), pancreatitis ( n = 1), colitis ( n = 1), and cholangitis ( n = 1). Total duration of hospital stay and duration between FDG-PET/CT scan and hospital discharge of patients with an FDG-PET/CT scan positive for cyst infection were significantly longer than those with a negative scan ( P = 0.005 and P = 0.009, respectively). Creatinine levels were significantly higher in patients with an FDG-PET/CT scan positive for cyst infection than in patients with a negative scan ( P = 0.015). Other comparisons of clinical parameters (age, gender, presence of fever (>38.5°C) for more than 3 days, abdominal pain, history of solid organ transplantation and nephrectomy, immune status), laboratory values (C-reactive protein level (CRP), leukocyte count, estimated glomerular filtration rate), and microbiologic results (blood and urine cultures) were not significantly different ( P = 0.13-1.00) between FDG-PET/CT-positive and -negative patients. Conclusion: FDG-PET/CT is a useful and recommendable (upfront) imaging modality for the evaluation of

  2. Two novel mutations of CLCN7 gene in Chinese families with autosomal dominant osteopetrosis (type II).

    Science.gov (United States)

    Zheng, Hui; Shao, Chong; Zheng, Yan; He, Jin-Wei; Fu, Wen-Zhen; Wang, Chun; Zhang, Zhen-Lin

    2016-07-01

    Autosomal dominant osteopetrosis type II (ADO-II) is a heritable bone disorder characterized by osteosclerosis, predominantly involving the spine (vertebral end-plate thickening, or rugger-jersey spine), the pelvis ("bone-within-bone" structures) and the skull base. Chloride channel 7 (CLCN7) has been reported to be the causative gene. In this study, we aimed to identify the pathogenic mutation in four Chinese families with ADO-II. All 25 exons of the CLCN7 gene, including the exon-intron boundaries, were amplified and sequenced directly in four probands from the Chinese families with ADO-II. The mutation site was then identified in other family members and 250 healthy controls. In family 1, a known missense mutation c.296A>G in exon 4 of CLCN7 was identified in the proband, resulting in a tyrosine (UAU) to cysteine (UGU) substitution at p.99 (Y99C); the mutation was also identified in his affected father. In family 2, a novel missense mutation c.865G>C in exon 10 was identified in the proband, resulting in a valine (GUC) to leucine (CUC) substitution at p.289 (V289L); the mutation was also identified in her healthy mother and sister. In family 3, a novel missense mutation c.1625C>T in exon 17 of CLCN7 was identified in the proband, resulting in an alanine (GCG) to valine (GUG) substitution at p.542 (A542V); the mutation was also identified in her father. In family 4, a hot spot, R767W (c.2299C>T, CGG>TGG), in exon 24 was found in the proband which once again proved the susceptibility of the site or the similar genetic background in different races. Moreover, two novel mutations, V289L and A542V, occurred at a highly conserved position, found by a comparison of the protein sequences from eight vertebrates, and were predicted to have a pathogenic effect by PolyPhen-2 software, which showed "probably damaging" with a score of approximately 1. These mutation sites were not identified in 250 healthy controls. Our present findings suggest that the novel missense

  3. Berberine slows cell growth in autosomal dominant polycystic kidney disease cells

    Energy Technology Data Exchange (ETDEWEB)

    Bonon, Anna; Mangolini, Alessandra [Department of Biomedical and Specialty Surgical Sciences, University of Ferrara, 44121 Ferrara (Italy); Pinton, Paolo [Department of Morphology, Surgery and Experimental Medicine, Section of General Pathology, University of Ferrara, 44121 Ferrara (Italy); Senno, Laura del [Department of Biomedical and Specialty Surgical Sciences, University of Ferrara, 44121 Ferrara (Italy); Aguiari, Gianluca, E-mail: dsn@unife.it [Department of Biomedical and Specialty Surgical Sciences, University of Ferrara, 44121 Ferrara (Italy)

    2013-11-22

    Highlights: •Berberine at appropriate doses slows cell proliferation in ADPKD cystic cells. •Reduction of cell growth by berberine occurs by inhibition of ERK and p70-S6 kinase. •Higher doses of berberine cause an overall cytotoxic effect. •Berberine overdose induces apoptotic bodies formation and DNA fragmentation. •Antiproliferative properties of this drug make it a new candidate for ADPKD therapy. -- Abstract: Autosomal dominant polycystic kidney disease (ADPKD) is the most common hereditary monogenic disorder characterized by development and enlargement of kidney cysts that lead to loss of renal function. It is caused by mutations in two genes (PKD1 and PKD2) encoding for polycystin-1 and polycystin-2 proteins which regulate different signals including cAMP, mTOR and EGFR pathways. Abnormal activation of these signals following PC1 or PC2 loss of function causes an increased cell proliferation which is a typical hallmark of this disease. Despite the promising findings obtained in animal models with targeted inhibitors able to reduce cystic cell growth, currently, no specific approved therapy for ADPKD is available. Therefore, the research of new more effective molecules could be crucial for the treatment of this severe pathology. In this regard, we have studied the effect of berberine, an isoquinoline quaternary alkaloid, on cell proliferation and apoptosis in human and mouse ADPKD cystic cell lines. Berberine treatment slows cell proliferation of ADPKD cystic cells in a dose-dependent manner and at high doses (100 μg/mL) it induces cell death in cystic cells as well as in normal kidney tubule cells. However, at 10 μg/mL, berberine reduces cell growth in ADPKD cystic cells only enhancing G{sub 0}/G{sub 1} phase of cell cycle and inhibiting ERK and p70-S6 kinases. Our results indicate that berberine shows a selected antiproliferative activity in cellular models for ADPKD, suggesting that this molecule and similar natural compounds could open new

  4. Autosomal dominant hereditary spastic paraplegia with axonal sensory motor polyneuropathy maps to chromosome 21q 22.3.

    Science.gov (United States)

    Peddareddygari, Leema Reddy; Hanna, Philip A; Igo, Robert P; Luo, Yuqun A; Won, Sungho; Hirano, Michio; Grewal, Raji P

    2016-01-01

    Hereditary spastic paraplegia (HSP) are a genetically and clinically heterogeneous group of disorders. At present, 19 autosomal dominant loci for HSP have been mapped. We ascertained an American family of European descent segregating an autosomal dominant HSP associated with peripheral neuropathy. A genome wide scan was performed with 410 microsatellite repeat marker (Weber lab screening set 16) and following linkage and haplotype analysis, fine mapping was performed. Established genes or loci for HSP were excluded by direct sequencing or haplotype analysis. All established loci for HSP were excluded. Fine mapping suggested a locus on chromosome 21q22.3 flanked by markers D21S1411 and D21S1446 with a maximum logarithm of odds score of 2.05 and was supported by haplotype analysis. A number of candidate genes in this region were analyzed and no disease-producing mutations were detected. We present the clinical and genetic analysis of an American family with autosomal dominant HSP with axonal sensory motor polyneuropathy mapping to a novel locus on chromosome 21q22.3 designated SPG56.

  5. Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy resulting in stroke in an 11-year-old male

    DEFF Research Database (Denmark)

    Granild-Jensen, Jakob Bie; Jensen, Uffe Birk; Schwartz, Marianne

    2009-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is caused by mutations in the Notch3 gene on chromosome 19. The condition manifests itself clinically typically in the third to fifth decade with migraine and recurrent episodes of stroke or trans......Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is caused by mutations in the Notch3 gene on chromosome 19. The condition manifests itself clinically typically in the third to fifth decade with migraine and recurrent episodes of stroke...... or transient ischaemic attacks. We report the case of an 11-year-old male with CADASIL resulting in stroke with right hemiparesis and dysphasia. Acute magnetic resonance imaging suggested infarction in the left hemisphere; magnetic resonance angiography revealed calibre variation of the intracerebral arteries...... of CADASIL, with an autosomal dominant pattern. The diagnosis of CADASIL was confirmed by the finding of the known mutation of the Notch3 gene running in the family. With treatment in a neurorehabilitation centre the patient recovered most of his functions with only discrete fine-motor and cognitive sequelae...

  6. A novel IMPDH1 mutation (Arg231Pro) in a family with a severe form of autosomal dominant retinitis pigmentosa.

    Science.gov (United States)

    Grover, Sandeep; Fishman, Gerald A; Stone, Edwin M

    2004-10-01

    To define ophthalmic findings in a family with autosomal dominant retinitis pigmentosa and a novel IMPDH1 gene mutation. Genetic and observational family study. Sixteen affected members of a family with autosomal dominant retinitis pigmentosa. Ophthalmic examination, including best-corrected visual acuity (VA), slit-lamp biomicroscopy, direct and indirect ophthalmoscopy, Goldmann kinetic perimetry, and electroretinography were performed. Deoxyribonucleic acid single-strand conformation polymorphism (SSCP) analysis was done. Abnormal polymerase chain reaction products identified by SSCP analysis were sequenced bidirectionally. All affected patients had the onset of night blindness within the first decade of life. Ocular findings were characterized by diffuse retinal pigmentary degenerative changes, marked restriction of peripheral visual fields, severe loss of VA, nondetectable electroretinography amplitudes, and a high frequency of posterior subcapsular lens opacities. Affected members were observed to harbor a novel IMPDH1 gene mutation. A novel IMPDH1 gene mutation (Arg231Pro) was associated with a severe form of autosomal dominant retinitis pigmentosa. Families affected with a severe form of this genetic subtype should be investigated for a mutation in the IMPDH1 gene.

  7. Magnetic resonance imaging of posterior pituitary for evaluation of the neurohypophyseal function in idiopathic and autosomal dominant neurohypophyseal diabetes insipidus

    International Nuclear Information System (INIS)

    Ozata, M.; Tayfun, C.; Kurtaran, K.; Yetkin, I.; Beyhan, Z.; Corakci, A.; Caglayan, S.; Alemdaroglu, A.; Guendogan, M.A.

    1997-01-01

    We investigated the role of MR imaging for evaluation of the functional status of the neurohypophyseal system in both idiopathic central diabetes insipidus (DI) and familial autosomal dominant neurohypophyseal DI. The patients and family with DI were analyzed retrospectively for the presence or absence of posterior pituitary gland hyperintense signal on MR images. A total of 19 adult patients with idiopathic central DI, 7 members of a family with autosomal dominant DI and 20 control subjects were included in the study. Diagnosis of idiopathic DI was based on the presence of central DI in the absence of any alteration that is known to be responsible for DI. The patients were studied retrospectively and the morphology and intensity of the posterior lobe by MR imaging was assessed by blinded reading. In all patients with idiopathic central DI and the affected members of the family, the posterior bright signal was absent while the stalk was normal on MR images. In contrast, normal posterior pituitary bright signal and stalk were found in unaffected members of the family and all control subjects. We conclude that MR imaging of the posterior pituitary lobe can be used to evaluate the functional status of the neurohypophyseal system in idiopathic central DI and familial autosomal dominant DI. (orig.). With 3 figs., 1 tab

  8. Characterization of Autosomal Dominant Hypercholesterolemia Caused by PCSK9 Gain of Function Mutations and Its Specific Treatment With Alirocumab, a PCSK9 Monoclonal Antibody

    NARCIS (Netherlands)

    Hopkins, Paul N.; Defesche, Joep; Fouchier, Sigrid W.; Bruckert, Eric; Luc, Gérald; Cariou, Bertrand; Sjouke, Barbara; Leren, Trond P.; Harada-Shiba, Mariko; Mabuchi, Hiroshi; Rabès, Jean-Pierre; Carrié, Alain; van Heyningen, Charles; Carreau, Valérie; Farnier, Michel; Teoh, Yee P.; Bourbon, Mafalda; Kawashiri, Masa-Aki; Nohara, Atsushi; Soran, Handrean; Marais, A. David; Tada, Hayato; Abifadel, Marianne; Boileau, Catherine; Chanu, Bernard; Katsuda, Shoji; Kishimoto, Ichiro; Lambert, Gilles; Makino, Hisashi; Miyamoto, Yoshihiro; Pichelin, Matthieu; Yagi, Kunimasa; Yamagishi, Masakazu; Zair, Yassine; Mellis, Scott; Yancopoulos, George D.; Stahl, Neil; Mendoza, Johanna; Du, Yunling; Hamon, Sara; Krempf, Michel; Swergold, Gary D.

    2015-01-01

    Background Patients with PCSK9 gene gain of function (GOF) mutations have a rare form of autosomal dominant hypercholesterolemia. However, data examining their clinical characteristics and geographic distribution are lacking. Furthermore, no randomized treatment study in this population has been

  9. Rationale and design of the RESOLVE trial: lanreotide as a volume reducing treatment for polycystic livers in patients with autosomal dominant polycystic kidney disease.

    NARCIS (Netherlands)

    Gevers, T.J.G.; Chrispijn, M.; Wetzels, J.F.M.; Drenth, J.P.H.

    2012-01-01

    BACKGROUND: A large proportion of patients with autosomal dominant polycystic kidney disease (ADPKD) suffers from polycystic liver disease. Symptoms arise when liver volume increases. The somatostatin analogue lanreotide has proven to reduce liver volume in patients with polycystic liver disease.

  10. Left frontal hub connectivity delays cognitive impairment in autosomal-dominant and sporadic Alzheimer’s disease

    Science.gov (United States)

    Franzmeier, Nicolai; Düzel, Emrah; Jessen, Frank; Buerger, Katharina; Levin, Johannes; Duering, Marco; Dichgans, Martin; Haass, Christian; Suárez-Calvet, Marc; Fagan, Anne M; Paumier, Katrina; Benzinger, Tammie; Masters, Colin L; Morris, John C; Perneczky, Robert; Janowitz, Daniel; Catak, Cihan; Wolfsgruber, Steffen; Wagner, Michael; Teipel, Stefan; Kilimann, Ingo; Ramirez, Alfredo; Rossor, Martin; Jucker, Mathias; Chhatwal, Jasmeer; Spottke, Annika; Boecker, Henning; Brosseron, Frederic; Falkai, Peter; Fliessbach, Klaus; Heneka, Michael T; Laske, Christoph; Nestor, Peter; Peters, Oliver; Fuentes, Manuel; Menne, Felix; Priller, Josef; Spruth, Eike J; Franke, Christiana; Schneider, Anja; Kofler, Barbara; Westerteicher, Christine; Speck, Oliver; Wiltfang, Jens; Bartels, Claudia; Araque Caballero, Miguel Ángel; Metzger, Coraline; Bittner, Daniel; Weiner, Michael; Lee, Jae-Hong; Salloway, Stephen; Danek, Adrian; Goate, Alison; Schofield, Peter R; Bateman, Randall J; Ewers, Michael

    2018-01-01

    Abstract Patients with Alzheimer’s disease vary in their ability to sustain cognitive abilities in the presence of brain pathology. A major open question is which brain mechanisms may support higher reserve capacity, i.e. relatively high cognitive performance at a given level of Alzheimer’s pathology. Higher functional MRI-assessed functional connectivity of a hub in the left frontal cortex is a core candidate brain mechanism underlying reserve as it is associated with education (i.e. a protective factor often associated with higher reserve) and attenuated cognitive impairment in prodromal Alzheimer’s disease. However, no study has yet assessed whether such hub connectivity of the left frontal cortex supports reserve throughout the evolution of pathological brain changes in Alzheimer’s disease, including the presymptomatic stage when cognitive decline is subtle. To address this research gap, we obtained cross-sectional resting state functional MRI in 74 participants with autosomal dominant Alzheimer’s disease, 55 controls from the Dominantly Inherited Alzheimer’s Network and 75 amyloid-positive elderly participants, as well as 41 amyloid-negative cognitively normal elderly subjects from the German Center of Neurodegenerative Diseases multicentre study on biomarkers in sporadic Alzheimer’s disease. For each participant, global left frontal cortex connectivity was computed as the average resting state functional connectivity between the left frontal cortex (seed) and each voxel in the grey matter. As a marker of disease stage, we applied estimated years from symptom onset in autosomal dominantly inherited Alzheimer’s disease and cerebrospinal fluid tau levels in sporadic Alzheimer’s disease cases. In both autosomal dominant and sporadic Alzheimer’s disease patients, higher levels of left frontal cortex connectivity were correlated with greater education. For autosomal dominant Alzheimer’s disease, a significant left frontal cortex connectivity

  11. External Ocular Manifestations in Autosomal Dominant Dystrophic Epidermolysis Bullosa; a Case Report

    Directory of Open Access Journals (Sweden)

    Manizheh Mahdavi

    2008-11-01

    Full Text Available

    PURPOSE: To present a case of autosomal dominant dystrophic epidermolysis bullosa with symblepharon formation due to eye rubbing. CASE REPORT: A 10-year-old girl suffering from blistering and ulcerative lesions of the trunk and palms and dystrophic nails since childhood was referred to our clinic with a symblepharon connecting the medial portion of the right upper lid to the superonasal quadrant of the cornea. The central cornea in both eyes exhibited mild subepithelial opacification. She had history of eye rubbing due to foreign body sensation in the right eye, resulting in red eye and blister-like conjunctival lesions since three years ago. She had previously undergone surgical symblepharon removal leading to more severe recurrence of the condition. CONCLUSION: Dominant dystrophic epidermolysis bullosa may be accompanied by external ocular manifestations. Protection of the eye from minor trauma such as rubbing may help prevent ocular complications.

  1. A paradoxical presentation of rickets and secondary osteomyelitis of the jaw in Type II autosomal dominant osteopetrosis: Rare case reports.

    Science.gov (United States)

    Jayachandran, S; Kumar, M Suresh

    2016-01-01

    Osteopetrosis is a rare genetic bone disorder arising due to a defect in the differentiation or function of osteoclast which results in a generalized increase in bone mass. Osteomyelitis is one of the most common complications because of decreased bone marrow function and compromised blood supply. Radiologist plays a vital role in diagnosing osteopetrosis. Here, we present two cases of autosomal dominant osteopetrosis Type II (ADO II) with secondary osteomyelitis changes which were reported to our department. One of these two cases presented with secondary osteomyelitis in both maxilla and mandible and features of rickets, which is very rarely seen in ADO II. To the best of our knowledge, the presentation of rickets with ADO is the first of its kind to be reported. In this paper, we describe the clinical and radiological features leading to the diagnosis of ADO in these two patients. Further, a review of the literature regarding ADO is discussed.

  2. Dystrophic Epidermolysis Bullosa in Pregnancy: A Case Report of the Autosomal Dominant Subtype and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Nicole Colgrove

    2014-01-01

    Full Text Available Epidermolysis bullosa (EB is a group of inherited blistering skin diseases that vary widely in their pathogenesis and severity. There are three main categories of EB: simplex, junctional, and dystrophic. This classification is based on the level of tissue separation within the basement membrane zone and this is attributed to abnormalities of individual or several anchoring proteins that form the interlocking network spanning from the epidermis to the dermis underneath. Dystrophic EB results from mutations in COL7A1 gene coding for type VII collagen leading to blister formation within the dermis. Diagnosis ultimately depends on the patient’s specific genetic mutation, but initial diagnosis can be made from careful examination and history taking. We present a pregnant patient known to have autosomal dominant dystrophic EB and discuss the obstetrical and neonatal outcome. The paper also reviews the current English literature on this rare skin disorder.

  3. The French series of autosomal dominant early onset Alzheimer's disease cases: mutation spectrum and cerebrospinal fluid biomarkers.

    Science.gov (United States)

    Wallon, David; Rousseau, Stéphane; Rovelet-Lecrux, Anne; Quillard-Muraine, Muriel; Guyant-Maréchal, Lucie; Martinaud, Olivier; Pariente, Jérémie; Puel, Michèle; Rollin-Sillaire, Adeline; Pasquier, Florence; Le Ber, Isabelle; Sarazin, Marie; Croisile, Bernard; Boutoleau-Bretonnière, Claire; Thomas-Antérion, Catherine; Paquet, Claire; Moreaud, Olivier; Gabelle, Audrey; Sellal, François; Sauvée, Mathilde; Laquerrière, Annie; Duyckaerts, Charles; Delisle, Marie-Bernadette; Streichenberger, Nathalie; Lannes, Béatrice; Frebourg, Thierry; Hannequin, Didier; Campion, Dominique

    2012-01-01

    We describe 56 novel autosomal dominant early-onset Alzheimer disease (ADEOAD) families with PSEN1, PSEN2, and AβPP mutations or duplications, raising the total of families with mutations on known genes to 111 (74 PSEN1, 8 PSEN2, 16 AβPP, and 13 AβPP duplications) in the French series. In 33 additional families (23% of the series), the genetic determinism remained uncharacterized after this screening. Cerebrospinal fluid (CSF) biomarker levels were obtained for patients of 58 families (42 with known mutations and 16 without genetic characterization). CSF biomarkers profile was consistent with an AD diagnosis in 90% of families carrying mutations on known genes. In families without mutation, CSF biomarkers were consistent with AD diagnosis in 14/16 cases. Overall, these results support further genetic heterogeneity in the determinism of ADEOAD and suggest that other major genes remain to be characterized.

  4. Autosomal dominant mesomandibular fibro-osseous dysplasia: a self-resolving inherited fibro-osseous lesion of the jaws

    Directory of Open Access Journals (Sweden)

    Ioannis eKoutlas

    2012-12-01

    Full Text Available A hereditary congenital condition characterized by a fibro-osseous lesion sharing some features with fibrous dysplasia and affecting the middle aspect of the mandible is presented. The condition was initially described as congenital monostotic fibrous dysplasia in two siblings, a male and a female. However, there is sufficient evidence that the disorder is autosomal dominant since it has been encountered in two of four children, both males, of the female propositus and one child, a boy, of the male propositus. All patients presented at birth or right after birth with enlargement of the middle part of the mandible. Radiographs from affected individuals have shown mesomandibular enlargement with irregular trabeculation akin of ground-glass appearance. Histologically, samples from all patients revealed woven bone proliferation in a cellular fibroblastic stroma. Interestingly, the originally described siblings, now in their 30s, have no evidence of jaw lesions either radiographically or clinically, thus indicating that the condition is self-limiting or self-resolving. An autosomal dominant mode of inheritance with apparent male predilection is favored. The molecular basis of this condition is currently unknown. However, the location of the lesions in the middle aspect of the mandible suggests dysregulation of Bone Morphogenetic Protein signaling since BMPs regulate mandibular morphogenesis in utero, particularly in the medial region as well as postnatal bone remodeling. Immunohistochemical evaluation for a BMP-binding protein Twisted Gastrulation revealed mosaic pattern of staining, with some cells, including osteoclasts, strongly stained and others exhibiting faint or no staining, thus supporting active regulation of BMP signaling within the lesion. Future investigations will determine if dysregulation of BMP signaling plays a causative role or rather reflects secondary activation of repair mechanisms and/or bone remodeling.

  5. Characterization of macular structure and function in two Swedish families with genetically identified autosomal dominant retinitis pigmentosa

    Science.gov (United States)

    Abdulridha-Aboud, Wissam; Kjellström, Ulrika; Andréasson, Sten

    2016-01-01

    Purpose To study the phenotype in two families with genetically identified autosomal dominant retinitis pigmentosa (adRP) focusing on macular structure and function. Methods Clinical data were collected at the Department of Ophthalmology, Lund University, Sweden, for affected and unaffected family members from two pedigrees with adRP. Examinations included optical coherence tomography (OCT), full-field electroretinography (ffERG), and multifocal electroretinography (mfERG). Molecular genetic screening was performed for known mutations associated with adRP. Results The mode of inheritance was autosomal dominant in both families. The members of the family with a mutation in the PRPF31 (p.IVS6+1G>T) gene had clinical features characteristic of RP, with severely reduced retinal rod and cone function. The degree of deterioration correlated well with increasing age. The mfERG showed only centrally preserved macular function that correlated well with retinal thinning on OCT. The family with a mutation in the RHO (p.R135W) gene had an extreme intrafamilial variability of the phenotype, with more severe disease in the younger generations. OCT showed pathology, but the degree of morphological changes was not correlated with age or with the mfERG results. The mother, with a de novo mutation in the RHO (p.R135W) gene, had a normal ffERG, and her retinal degeneration was detected merely with the reduced mfERG. Conclusions These two families demonstrate the extreme inter- and intrafamilial variability in the clinical phenotype of adRP. This is the first Swedish report of the clinical phenotype associated with a mutation in the PRPF31 (p.IVS6+1G>T) gene. Our results indicate that methods for assessment of the central retinal structure and function may improve the detection and characterization of the RP phenotype. PMID:27212874

  6. Clinical results from low-level laser therapy in patients with autosomal dominant cone-rod dystrophy

    Science.gov (United States)

    Koev, K.; Avramov, L.; Borissova, E.

    2018-03-01

    The objective of this study is to examine long-term effects of low-level laser therapy (LLLT) in patients with autosomal dominant cone-rod dystrophy (CRDs). A He-Ne Laser with continuous emission at 633 nm (01 mW/cm2) was used on five patients with autosomal dominant pedigree of Romani origin with non-syndromic CRDs. The laser radiation was applied transpupillary to the macula six times for three minutes every other day. The experiment was conducted for a period of three years. The clinical evaluation included best corrected visual acuity determination, funduscopy, Humphrey perimetry, Farnsworth Hue-28 color testing, fluorescein angiography, and full-field electroretinogram (ERG). All affected individuals presented reduced visual acuity (0.01 – 0.4) and photophobia. The funduscopic examination and fluorescein angiography revealed advanced changes including bone spicule-like pigment deposits in the midperiphery and the macular area, along with retinal atrophy, narrowing of the vessels, and waxy optic discs. The visual fields demonstrated central scotoma. The electrophysiologic examination of the patients detected an abnormal cone-rod ERG (20 – 30 μV) with photopic amplitudes more markedly reduced than the scotopic. Flicker responses were missing and Farnsworth Hue-28 test found protanopia. There was a statistically significant increase in the visual acuity (p<0.001, end of study versus baseline) for CRDs patients for the period of three years after the treatment with LLLT. Following the LLLT, the central absolute scotoma in CRDs was reduced, as was the prevalence of metamorphopsia in CRDs. This study shows that LLLT may prove be a novel long-lasting therapeutic option for both forms of CRDs. It is a highly effective treatment resulting in a long-term improvement of the visual acuity.

  7. A case report: a heterozygous deletion (2791_2805 del) in exon 18 of the filamin C gene causing filamin C-related myofibrillar myopathies in a Chinese family.

    Science.gov (United States)

    Miao, Jing; Su, Fei-Fei; Liu, Xue-Mei; Wei, Xiao-Jing; Yuan, Yun; Yu, Xue-Fan

    2018-06-04

    Filamin C-related myofibrillar myopathies (MFM) are progressive skeletal myopathies with an autosomal dominant inheritance pattern. The conditions are caused by mutations of the filamin C gene (FLNC) located in the chromosome 7q32-q35 region. Genetic variations in the FLNC gene result in various clinical phenotypes. We describe a 43-year-old woman who suffered filamin C-related MFM, with symptoms first presenting in the proximal muscles of the lower limbs and eventually spreading to the upper limbs and distal muscles. The patient's serum level of creatine kinase was mildly increased. Mildy myopathic changes in the electromyographic exam and moderate lipomatous alterations in lower limb MRI were found. Histopathological examination revealed increased muscle fiber size variability, disturbances in oxidative enzyme activity, and the presence of abnormal protein aggregates and vacuoles in some muscle fibers. Ultrastructural analysis showed inclusions composed of thin filaments and interspersed granular densities. DNA sequencing analysis detected a novel 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the FLNC gene. The patient's father, sister, brother, three paternal aunts, one paternal uncle, and the uncle's son also had slowly progressive muscle weakness, and thus, we detected an autosomal dominant inheritance pattern of the disorder. A novel heterogeneous 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the Ig-like domain 7 of the FLNC gene was found to cause filamin C-related MFM. This deletion in the FLNC gene causes protein aggregation, abnormalities in muscle structure, and impairment in muscle fiber function, which leads to muscle weakness.

  8. Metabolic Myopathies.

    Science.gov (United States)

    Tarnopolsky, Mark A

    2016-12-01

    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  9. Spectrum of sonographic changes in hereditary motor and sensory neuropathy with autosomal dominant and X-linked inheritance

    Directory of Open Access Journals (Sweden)

    E. S. Naumova

    2016-01-01

    Full Text Available Background. In the recent years interest towards nerve sonography has largely increased, specifically in terms of differentiating types of hereditary motor and sensory neuropathy (HMSN. The diagnostic possibilities of high-resolution ultrasound (HRUS compared to standard neurophysiological tools in the peripheral nerve disorders is still a matter of debate.Objectives. Analysis of quantitative and qualitative ultrasound changes of limb nerves in patients with HMSN type 1 and its comparison with anthropometric and nerve conduction study data.Materials and methods. 44 HMSN patients were analyzed: 16 men, mean age 35,9 ± 6,8 years; 16 (37 % with autosomal dominant type 1А, 11 (25 % – with 1В type and 17 (38 % with Х-linked inheritance. Control group included 44 subjects, 16 male; mean age 35,9 ± 6,8 years. HRUS parameters were analyzed bilaterally on the selected levels: cross-sectional area (CSA, visual cross sectional and longitudinal patterns of the median and ulnar nerves, C5, C6, C7 spinal nerves, tibial, peroneal and sciatic nerves. HRUS parameters were compared to standard anthropometric data, nerve conduction velocity and CMAP amplitude.Results. In all HMSN cases CSA was enlarged compared to healthy controls. Greater changes were found in patients with autosomal dominant inheritance. CSA enlargement in С5, С6, С7 spinal nerves was found in patients with HMSN 1A, С6, С7 – in HMSN 1В, С6 – in HMSN 1X, confirming the necessity to include those nerves in the sonographic protocol in patients with HMSN. Three qualitative cross sectional and longitudinal patterns of the investigated arm nerves were identified, distinct for each of the HMSN type. Absence of significant differences in CSA of the upper limb nerves among analyzed types of HMSN makes it unreliable as the differential parameter, opposite to the defined sonographic patterns. Methodological issues and absence of significant quantitative and qualitative data

  10. Feasibility of measuring renal blood flow by phase-contrast magnetic resonance imaging in patients with autosomal dominant polycystic kidney disease

    NARCIS (Netherlands)

    Spithoven, E. M.; Meijer, E.; Borns, C.; Boertien, W. E.; Gaillard, C. A. J. M.; Kappert, P.; Greuter, M. J. W.; van der Jagt, E.; Vart, P.; de Jong, P. E.; Gansevoort, R. T.

    Renal blood flow (RBF) has been shown to predict disease progression in autosomal dominant polycystic kidney disease (ADPKD). We investigated the feasibility and accuracy of phase-contrast RBF by MRI (RBFMRI) in ADPKD patients with a wide range of estimated glomerular filtration rate (eGFR) values.

  11. C-terminal truncations in human 3'-5' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

    NARCIS (Netherlands)

    Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schäfer, Ruth; Stam, Anine H.; Haan, Joost; de Jong, Paulus T. V. M.; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

    2007-01-01

    Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle-age onset. In nine families, we identified heterozygous C-terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

  12. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    DEFF Research Database (Denmark)

    Toustrup, Lise Bols; Zhou, Yan; Kvistgaard, Helene

    2017-01-01

    Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI) is caused by variants in the arginine vasopressin (AVP) gene. Here we report the generation of induced pluripotent stem cells (iPSCs) from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using...

  13. Feasibility of measuring renal blood flow by phase-contrast magnetic resonance imaging in patients with autosomal dominant polycystic kidney disease

    NARCIS (Netherlands)

    Spithoven, Edwin M.; Meijer, E.; Borns, C.; Boertien, W. E.; Gaillard, C. A. J. M.; Kappert, P.; Greuter, Marcel J W; van der Jagt, E.; Vart, P.; de Jong, P. E.; Gansevoort, Ron T.

    Renal blood flow (RBF) has been shown to predict disease progression in autosomal dominant polycystic kidney disease (ADPKD). We investigated the feasibility and accuracy of phase-contrast RBF by MRI (RBFMRI) in ADPKD patients with a wide range of estimated glomerular filtration rate (eGFR)

  14. Chronic Kidney Pain in Autosomal Dominant Polycystic Kidney Disease : A Case Report of Successful Treatment by Catheter-Based Renal Denervation

    NARCIS (Netherlands)

    Casteleijn, Niek F.; de Jager, Rosa L.; Neeleman, M. Peer; Blankestijn, Peter J.; Gansevoort, Ron T.

    Chronic pain is a common concern in patients with autosomal dominant polycystic kidney disease (ADPKD). We report what to our knowledge is the first catheter-based renal denervation procedure in a patient with ADPKD resulting in successful management of chronic pain. The patient was a 43-year-old

  15. White matter pathology and disconnection in the frontal lobe in cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL).

    Science.gov (United States)

    Craggs, Lucinda J L; Yamamoto, Yumi; Ihara, Masafumi; Fenwick, Richard; Burke, Matthew; Oakley, Arthur E; Roeber, Sigrun; Duering, Marco; Kretzschmar, Hans; Kalaria, Raj N

    2014-08-01

    Magnetic resonance imaging indicates diffuse white matter (WM) changes are associated with cognitive impairment in cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). We examined whether the distribution of axonal abnormalities is related to microvascular pathology in the underlying WM. We used post-mortem brains from CADASIL subjects and similar age cognitively normal controls to examine WM axonal changes, microvascular pathology, and glial reaction in up to 16 different regions extending rostro-caudally through the cerebrum. Using unbiased stereological methods, we estimated length densities of affected axons immunostained with neurofilament antibody SMI32. Standard immunohistochemistry was used to assess amyloid precursor protein immunoreactivity per WM area. To relate WM changes to microvascular pathology, we also determined the sclerotic index (SI) in WM arterioles. The degree of WM pathology consistently scored higher across all brain regions in CADASIL subjects (Pneurones connecting to targets in the subcortical structures. © 2013 The Authors. Neuropathology and Applied Neurobiology published by John Wiley & Sons Ltd on behalf of British Neuropathological Society.

  16. Germline mutations in ABL1 cause an autosomal dominant syndrome characterized by congenital heart defects and skeletal malformations.

    Science.gov (United States)

    Wang, Xia; Charng, Wu-Lin; Chen, Chun-An; Rosenfeld, Jill A; Al Shamsi, Aisha; Al-Gazali, Lihadh; McGuire, Marianne; Mew, Nicholas Ah; Arnold, Georgianne L; Qu, Chunjing; Ding, Yan; Muzny, Donna M; Gibbs, Richard A; Eng, Christine M; Walkiewicz, Magdalena; Xia, Fan; Plon, Sharon E; Lupski, James R; Schaaf, Christian P; Yang, Yaping

    2017-04-01

    ABL1 is a proto-oncogene well known as part of the fusion gene BCR-ABL1 in the Philadelphia chromosome of leukemia cancer cells. Inherited germline ABL1 changes have not been associated with genetic disorders. Here we report ABL1 germline variants cosegregating with an autosomal dominant disorder characterized by congenital heart disease, skeletal abnormalities, and failure to thrive. The variant c.734A>G (p.Tyr245Cys) was found to occur de novo or cosegregate with disease in five individuals (families 1-3). Additionally, a de novo c.1066G>A (p.Ala356Thr) variant was identified in a sixth individual (family 4). We overexpressed the mutant constructs in HEK 293T cells and observed increased tyrosine phosphorylation, suggesting increased ABL1 kinase activities associated with both the p.Tyr245Cys and p.Ala356Thr substitutions. Our clinical and experimental findings, together with previously reported teratogenic effects of selective BCR-ABL inhibitors in humans and developmental defects in Abl1 knockout mice, suggest that ABL1 has an important role during organismal development.

  17. Germline mutations in ABL1 cause an autosomal dominant syndrome characterized by congenital heart defects and skeletal malformations

    Science.gov (United States)

    Wang, Xia; Charng, Wu-Lin; Chen, Chun-An; Rosenfeld, Jill A.; Shamsi, Aisha Al; Al-Gazali, Lihadh; McGuire, Marianne; Mew, Nicholas Ah; Arnold, Georgianne L.; Qu, Chunjing; Ding, Yan; Muzny, Donna M.; Gibbs, Richard A.; Eng, Christine M.; Walkiewicz, Magdalena; Xia, Fan; Plon, Sharon E.; Lupski, James R.; Schaaf, Christian P.; Yang, Yaping

    2017-01-01

    ABL1 is a proto-oncogene well known as part of the fusion gene BCR-ABL in the Philadelphia chromosome of leukemia cancer cells1. Inherited germline ABL1 changes have not been associated with genetic disorders. Here we report ABL1 germline variants co-segregating with an autosomal dominant disorder characterized by congenital heart disease, skeletal abnormalities, and failure to thrive. The variant c.734A>G (p.Tyr245Cys) was found as de novo or co-segregating with disease in five individuals (families 1-3). Additionally, a de novo c.1066G>A (p.Ala356Thr) variant was identified in the sixth individual (family 4). We overexpressed the mutant constructs in HEK 293T cells and observed increased tyrosine phosphorylation, suggesting increased ABL1 kinase activities associated with both p.Tyr245Cys and p.Ala356Thr substitutions. Our clinical and laboratory findings, together with previously reported teratogenic effects of selective BCR-ABL inhibitors in humans2-5 and developmental defects in Abl1 knock-out mice6,7, suggest ABL1 plays an important role during organismal development. PMID:28288113

  18. High prevalence of mutations affecting the splicing process in a Spanish cohort with autosomal dominant retinitis pigmentosa

    Science.gov (United States)

    Ezquerra-Inchausti, Maitane; Barandika, Olatz; Anasagasti, Ander; Irigoyen, Cristina; López de Munain, Adolfo; Ruiz-Ederra, Javier

    2017-01-01

    Retinitis pigmentosa is the most frequent group of inherited retinal dystrophies. It is highly heterogeneous, with more than 80 disease-causing genes 27 of which are known to cause autosomal dominant RP (adRP), having been identified. In this study a total of 29 index cases were ascertained based on a family tree compatible with adRP. A custom panel of 31 adRP genes was analysed by targeted next-generation sequencing using the Ion PGM platform in combination with Sanger sequencing. This allowed us to detect putative disease-causing mutations in 14 out of the 29 (48.28%) families analysed. Remarkably, around 38% of all adRP cases analysed showed mutations affecting the splicing process, mainly due to mutations in genes coding for spliceosome factors (SNRNP200 and PRPF8) but also due to splice-site mutations in RHO. Twelve of the 14 mutations found had been reported previously and two were novel mutations found in PRPF8 in two unrelated patients. In conclusion, our results will lead to more accurate genetic counselling and will contribute to a better characterisation of the disease. In addition, they may have a therapeutic impact in the future given the large number of studies currently underway based on targeted RNA splicing for therapeutic purposes. PMID:28045043

  19. Clinical characterization of a novel calcium sensing receptor genetic alteration in a Greek patient with autosomal dominant hypocalcemia type 1.

    Science.gov (United States)

    Papadopoulou, Anna; Gole, Evangelia; Melachroinou, Katerina; Trangas, Theoni; Bountouvi, Evaggelia; Papadimitriou, Anastasios

    2017-04-01

    Autosomal dominant hypocalcemia (ADH) is a rare familial or sporadic syndrome associated with activating mutations in the calcium sensing receptor (CaSR) gene. The aim of this study was to assess the functional significance of a novel CaSR mutation and, moreover, to present the clinical characteristics and the bone mineral density (BMD) progression from early childhood to late puberty in a patient with ADH. Genetic analysis of the CaSR gene was performed in a patient who presented in the neonatal period with hypocalcemic seizures and biochemical features of ADH. The functional impact of the novel mutation identified was assessed in cultured HEK 293T cells, transfected with either the wild type (WT) or mutant CaSR, by evaluating intracellular calcium ([Ca2+]i) influx after stimulation with extracellular calcium (Ca2+). Several BMD measurements were performed during the patient's follow-up until late puberty. A novel CaSR mutation (p.L123S) was identified, which, as demonstrated by functional analysis, renders CaSR more sensitive to extracellular changes of Ca2+ compared with the WT, although the difference is not statistically significant. BMD measurements, from early childhood to late puberty, revealed high normal to elevated BMD. We present the first Greek patient, to our knowledge, with sporadic ADH due to a novel gain-of-function mutation of the CaSR gene.

  20. Recurrent Skin and Lung Infections in Autosomal Dominant Hyper IgE Syndrome with Transactivation Domain STAT3 Mutation

    Directory of Open Access Journals (Sweden)

    Chad J. Cooper

    2014-01-01

    Full Text Available Background. Hyper IgE is a rare systemic disease characterized by the clinical triad of high serum levels of IgE (>2000 IU/mL, eczema, and recurrent staphylococcal skin and lung infections. The presentation of hyper IgE syndrome is highly variable, which makes it easy to confuse the diagnosis with that of severe atopy or other rare immunodeficiency disorders. Case Report. A 23-year-old Hispanic presented with history of frequent respiratory and gastrointestinal infections as a child and multiple episodes of skin and lung infections (abscess with Staphylococcus aureus throughout his adult life. He had multiple eczematous lesions and folliculitis over his entire body, oral/esophageal candidiasis, and retention of his primary teeth. The IgE was elevated (>5000 IU/mL. Genetic mutation analysis revealed a mutation affecting the transactivation domain of the STAT3 gene. Conclusion. The hallmark of hyper IgE syndrome is serum IgE of >2000 IU/mL. Hyper IgE syndrome is a genetic disorder that is either autosomal dominant or recessive. A definite diagnosis can be made with genetic mutation analysis, and in this case, it revealed a very rare finding of the transactivation domain STAT3 mutation. Hyper IgE syndrome is a challenge for clinicians in establishing a diagnosis in suspected cases.

  1. Percutaneous Nephrolithotomy in Autosomal Dominant Polycystic Kidney Disease: Is it Different from Percutaneous Nephrolithotomy in Normal Kidney?

    Science.gov (United States)

    Singh, Vishwajeet; Sinha, Rahul Janak; Gupta, Dheeraj Kumar

    2013-08-01

    Nephrolithiasis has been reported in 20-28% of patients, of whom 50% are symptomatic for stone disease and 20% require definite urologic intervention. The management of nephrolithiasis includes oral alkali dissolution therapy, extracorporeal shock wave lithotripsy and surgical treatment. In such patients, percutaneous nephrolithotomy (PNL) as a method of stone treatment has been reported in few cases with limited experience. The aim of this study is to present our experience of PNL in autosomal dominant polycystic kidney disease (ADPKD) and assessing the outcome results. From 2002 to 2011, 22 patients (26 renal units) suffering from ADPKD with stone were managed by PNL. Demographic characteristics, operative parameters and postoperative complications were recorded and analysed. The overall success rate of PNL was 82.1% and PNL with extracorporeal shock wave lithotripsy for clinically significant residual fragments was 92.85% respectively. The hematuria required blood transfusion (n = 9), postoperative fever due to cyst infection (n = 4) and paralytic ileus (n = 3) were recorded. The PNL in ADPKD PNL is safe and effective but have more postoperative complications such as bleeding requiring transfusions, fever due to cyst infection and paralytic ileus.

  2. Type II autosomal dominant osteopetrosis: radiological features in two families containing five members with asymptomatic and uncomplicated disease

    Energy Technology Data Exchange (ETDEWEB)

    Fotiadou, Anastasia; Kiriakou, Vera; Tsitouridis, Ioannis [Papageorgiou Hospital, Radiology Department, Thessaloniki (Greece); Arvaniti, Maria [Genimatas Hospital, Radiology Department, Thessaloniki (Greece)

    2009-10-15

    In this study we analysed the imaging patterns in two families containing five members with asymptomatic and uncomplicated autosomal dominant osteopetrosis (ADO II), and we report new and uncommon radiological manifestations. These findings might be useful in the context of reducing the incidence of fractures and other orthopaedic complications. Diffuse pelvic sclerosis on radiographs was observed incidentally in two patients. Both cases were asymptomatic, and the patients had never suffered a fracture. The suggestion of ADO II was raised. A detailed medical history, an imaging survey, and a haematological study were obtained so that other rare causes of osteosclerosis could be ruled out. No genetic study was conducted. All their first-degree relatives were also examined. Bony sclerosis was observed in five patients, and the radiological findings were analysed. A not previously reported thickening of the skull base without cranial nerve palsy or optic nerve atrophy was revealed in all patients. Scoliosis was present in three of them. This has been reported previously only once in ADO II. No lower limb deformity was detected. This study provided information on the pattern of radiological features in familial asymptomatic ADO II. These data on new and rare imaging findings will increase the diagnostic awareness of physicians and will guide a thorough investigation of the entire family. This might result in a consequent decrease in the incidence of fractures and other orthopaedic complications. (orig.)

  3. Type II autosomal dominant osteopetrosis: radiological features in two families containing five members with asymptomatic and uncomplicated disease

    International Nuclear Information System (INIS)

    Fotiadou, Anastasia; Kiriakou, Vera; Tsitouridis, Ioannis; Arvaniti, Maria

    2009-01-01

    In this study we analysed the imaging patterns in two families containing five members with asymptomatic and uncomplicated autosomal dominant osteopetrosis (ADO II), and we report new and uncommon radiological manifestations. These findings might be useful in the context of reducing the incidence of fractures and other orthopaedic complications. Diffuse pelvic sclerosis on radiographs was observed incidentally in two patients. Both cases were asymptomatic, and the patients had never suffered a fracture. The suggestion of ADO II was raised. A detailed medical history, an imaging survey, and a haematological study were obtained so that other rare causes of osteosclerosis could be ruled out. No genetic study was conducted. All their first-degree relatives were also examined. Bony sclerosis was observed in five patients, and the radiological findings were analysed. A not previously reported thickening of the skull base without cranial nerve palsy or optic nerve atrophy was revealed in all patients. Scoliosis was present in three of them. This has been reported previously only once in ADO II. No lower limb deformity was detected. This study provided information on the pattern of radiological features in familial asymptomatic ADO II. These data on new and rare imaging findings will increase the diagnostic awareness of physicians and will guide a thorough investigation of the entire family. This might result in a consequent decrease in the incidence of fractures and other orthopaedic complications. (orig.)

  4. Effects of Lacunar Infarctions on Cognitive Impairment in Patients with Cerebral Autosomal-Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy

    Science.gov (United States)

    Choi, Jay Chol; Kang, Sa-Yoon; Kang, Ji-Hoon; Na, Hae Ri; Park, Ji-Kang

    2011-01-01

    Background and Purpose Cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is an inherited microangiopathy caused by mutations in the Notch3 gene. Although previous studies have shown an association between lacunar infarction and cognitive impairment, the relationship between MRI parameters and cognition remains unclear. In this study we investigated the influence of MRI parameters on cognitive impairment in CADASIL. Methods We applied a prospective protocol to 40 patients. MRI analysis included the normalized volume of white-matter hyperintensities (nWMHs), number of lacunes, and number of cerebral microbleeds. Cognition was assessed with the aid of psychometric tests [Mini-Mental State Examination (MMSE), Alzheimer's Disease Assessment Scale-cognition (ADAS-cog), Trail-Making Test, and Stroop interference (Stroop IF)]. Results A multivariate regression analysis revealed that the total number of lacunes influenced the performance in the MMSE, ADAS-cog, and Stroop IF, while nWMHs had a strong univariate association with ADAS-cog and Stroop IF scores. However, this association disappeared in the multivariate analysis. Conclusions These findings demonstrate that the number of lacunes is the main predictive factor of cognitive impairment in CADASIL. PMID:22259617

  5. Hydrops fetalis and pulmonary lymphangiectasia due to FOXC2 mutation: an autosomal dominant hereditary lymphedema syndrome with variable expression.

    Science.gov (United States)

    de Bruyn, Gwendolyn; Casaer, Alexandra; Devolder, Katrien; Van Acker, Geert; Logghe, Hilde; Devriendt, Koen; Cornette, Luc

    2012-03-01

    Non-immune hydrops fetalis may find its origin within genetically determined lymphedema syndromes, caused by mutations in FOXC2 and SOX-18. We describe a newborn girl, diagnosed with non-immune hydrops fetalis at a gestational age of 30 weeks. Family history revealed the presence of an autosomal dominant late-onset form of lymphedema of the lower limbs in her father, associated with an aberrant implantation of the eyelashes in some individuals. The newborn, hydropic girl suffered from severe pulmonary lymphangiectasia, resulting in terminal respiratory failure at the age of 3 months. Genetic analysis in both the father and the newborn girl demonstrated a heterozygous FOXC2 mutation, i.e., c.939C>A, p.Tyr313X. Her two older sisters are currently asymptomatic and the parents decided not to test them for the FOXC2 mutation. Patients with a mutation in the FOXC2 transcription factor usually show lower limb lymphedema with onset at or after puberty, together with distichiasis. However, the eye manifestations can be very mild and easily overlooked. The association between FOXC2 mutation and neonatal hydrops resulting in terminal respiratory failure is not reported so far. Therefore, in sporadic patients diagnosed with non-immune hydrops fetalis, lymphangiogenic genes should be systematically screened for mutations. In addition, all cases of fetal edema must prompt a thorough analysis of the familial pedigree, in order to detect familial patterns and to facilitate adequate antenatal counseling.

  6. A de novo mutation in KCNN3 associated with autosomal dominant idiopathic non-cirrhotic portal hypertension.

    Science.gov (United States)

    Koot, Bart G P; Alders, Marielle; Verheij, Joanne; Beuers, Ulrich; Cobben, Jan M

    2016-04-01

    Non-cirrhotic portal hypertension is characterized by histopathological abnormalities in the liver, mostly affecting small intrahepatic portal veins that cause portal hypertension in the absence of cirrhosis. It can be secondary to coagulation disorders or toxic agents. However, most cases are idiopathic non-cirrhotic portal hypertension (INCPH) and familial cases are rare. We report a family in which a father and three of his four children conceived with three different mothers are affected by INCPH. Whole exome and Sanger sequencing showed the father to have a de novo single nucleotide substitution c.1348G>C in the KCNN3 gene that was transmitted to all three of his affected offspring. The KCNN3 gene encodes small conductance calcium-activated potassium (SK) channel 3. SK channels are involved in the regulation of arterial and venous vascular tone by causing smooth muscle relaxation on activation. No data exist on the expression and function of SK channels in portal veins. The autosomal dominant inheritance in this unique pedigree and the single de novo mutation identified, strongly suggests that KCNN3 mutations have a pathogenetic role in INCPH. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  7. A Case of New Familiar Genetic Variant of Autosomal Dominant Polycystic Kidney Disease-2: A Case Study.

    Science.gov (United States)

    Litvinchuk, Tetiana; Tao, Yunxia; Singh, Ruchi; Vasylyeva, Tetyana L

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is characterized by renal cyst formation due to mutations in genes coding for polycystin-1 [PKD1 (85-90% of cases), on ch 16p13.3] and polycystin-2 [PKD2 (10-15% of cases), on ch 4q13-23] and PKD3 gene (gene unmapped). It is also associated with TSC2/PKD1 contiguous gene syndrome. ADPKD is usually inherited, but new mutations without a family history occur in approximately 10% of the cases. A 17-year-old boy was followed up for bilateral cystic kidney disease, hypertension, and obesity since he was 13 years old. The diagnosis was an accidental finding during abdominal CT at age 13 to rule out appendicitis. A renal ultrasonogram also demonstrated a multiple bilateral cysts. Because of parental history of bilateral renal cysts, PKD1 and PKD2, genetic testing was ordered. Results showed, PKD2 variant 1:3 bp deletion of TGT; nucleotide position: 1602-1604; codon position: 512-513; mRNA reading frame maintained. The same mutation was later identified in his father. A smaller number of patients have a defect in the PKD2 locus on chromosome 4 (resulting in PKD2 disease). There are no known published cases on this familiar genetic variant of ADPKD-2 cystic kidney disease. In this case, the disease is present unusually early in life.

  8. A R54L mutation of CRYAA associated with autosomal dominant nuclear cataracts in a Chinese family.

    Science.gov (United States)

    Yang, Zhenfei; Su, Dongmei; Li, Qian; Ma, Zicheng; Yang, Fan; Zhu, Siquan; Ma, Xu

    2013-12-01

    To identify the genetic defect in a three-generation Chinese family with congenital cataracts. The phenotype of a three-generation Chinese family with congenital cataract was recruited. Detailed family history and clinical data of the family were recorded. Candidate genes sequencing was performed to screen out the disease-causing mutation. Bioinformatics analysis was performed to predict the function of mutant gene. The phenotype of the family was identified as nuclear cataract. Direct sequencing revealed a c.161 G > T transversion in exon 1 of crystallin alpha-A (CRYAA). This mutation co-segregated with all affected individuals in the family and was not found in unaffected family members nor in the 100 unrelated controls. Bioinformatics analysis indicated that the 54th amino acid position was highly conserved and the mutation R54L caused an increase of local hydrophobicity around the substitution site. This study identified a novel disease-causing mutation c.161 G > T (p.R54L) in CRYAA in a Chinese family with autosomal dominant nuclear cataracts, this is the first report relating a G > T mutation in CRYAA leading to congenital nuclear cataract.

  9. Clinical and ERG data in a family with autosomal dominant RP and Pro-347-Arg mutation in the rhodopsin gene.

    Science.gov (United States)

    Niemeyer, G; Trüb, P; Schinzel, A; Gal, A

    1992-01-01

    In a family with autosomal dominant retinitis pigmentosa, documented over six generations, a previously undescribed point mutation in the rhodopsin gene could be identified. The mutation found in the six affected members examined but in none of the controls, including healthy members of the family, was a point mutation in codon 347 predicting a substitution of the amino acid arginine for proline, designated Pro-347-Arg. Six affected members from two generations were examined clinically and with ganzfeld rod and cone electroretinography. The cone and, more dramatically, the rod electroretinograms were reduced to residual b-wave amplitudes or were non-detectable as early as ages 18 to 22 years. The Pro-347-Arg mutation resulted in a subjectively and clinically homogeneous phenotype: early onset of night blindness before age 11, relatively preserved usable visual fields until about age 30, blindness at ages 40 to 60, and change from an initial apparently sine pigmento to a hyperpigmented and atrophic fundus picture between 30 and 50 years of age.

  10. Insights into cellular and molecular basis for urinary tract infection in autosomal-dominant polycystic kidney disease.

    Science.gov (United States)

    Gao, Chao; Zhang, Long; Zhang, Ye; Wallace, Darren P; Lopez-Soler, Reynold I; Higgins, Paul J; Zhang, Wenzheng

    2017-11-01

    Urinary tract infection (UTI) is a broad term referring to an infection of the kidneys, ureters, bladder, and/or urethra. Because of its prevalence, frequent recurrence, and rising resistance to antibiotics, UTI has become a challenge in clinical practice. Autosomal-dominant polycystic kidney disease (ADPKD) is the most common monogenic disorder of the kidney and is characterized by the growth of fluid-filled cysts in both kidneys. Progressive cystic enlargement, inflammation, and interstitial fibrosis result in nephron loss with subsequent decline in kidney function. ADPKD patients frequently develop UTI; however, the cellular and molecular mechanisms responsible for the high UTI incidence in ADPKD patients remain virtually unaddressed. Emerging evidence suggests that α-intercalated cells (α-ICs) of the collecting ducts function in the innate immune defense against UTI. α-ICs inhibit bacterial growth by acidifying urine and secreting neutrophil gelatinase-associated lipocalin (NGAL) that chelates siderophore-containing iron. It is necessary to determine, therefore, if ADPKD patients with recurrent UTI have a reduced number and/or impaired function of α-ICs. Identification of the underlying cellular and molecular mechanisms may lead to the development of novel strategies to reduce UTI in ADPKD. Copyright © 2017 the American Physiological Society.

  11. The Value of Pre-Screening in the Alzheimer's Prevention Initiative (API) Autosomal Dominant Alzheimer's Disease Trial.

    Science.gov (United States)

    Rios-Romenets, S; Giraldo-Chica, M; López, H; Piedrahita, F; Ramos, C; Acosta-Baena, N; Muñoz, C; Ospina, P; Tobón, C; Cho, W; Ward, M; Langbaum, J B; Tariot, P N; Reiman, E M; Lopera, F

    2018-01-01

    The Alzheimer's Prevention Initiative (API) Autosomal Dominant Alzheimer's Disease (ADAD) trial evaluates the anti-amyloid-β antibody crenezumab in cognitively unimpaired persons who, based on genetic background and age, are at high imminent risk of clinical progression, and provides a powerful test of the amyloid hypothesis. The Neurosciences Group of Antioquia implemented a pre-screening process with the goals of decreasing screen failures and identifying participants most likely to adhere to trial requirements of the API ADAD trial in cognitively unimpaired members of Presenilin1 E280A mutation kindreds. The pre-screening failure rate was 48.2%: the primary reason was expected inability to comply with the protocol, chiefly due to work requirements. More carriers compared to non-carriers, and more males compared to females, failed pre-screening. Carriers with illiteracy or learning/comprehension difficulties failed pre-screening more than non-carriers. With the Colombian API Registry and our prescreening efforts, we randomized 169 30-60 year-old cognitively unimpaired carriers and 83 non-carriers who agreed to participate in the trial for at least 60 months. Our findings suggest multiple benefits of implementing a pre-screening process for enrolling prevention trials in ADAD.

  12. Type III Bartter-like syndrome in an infant boy with Gitelman syndrome and autosomal dominant familial neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Brugnara, Milena; Gaudino, Rossella; Tedeschi, Silvana; Syrèn, Marie-Louise; Perrotta, Silverio; Maines, Evelina; Zaffanello, Marco

    2014-09-01

    We report the case of an infant boy with polyuria and a familial history of central diabetes insipidus. Laboratory blood tests disclosed hypokalemia, metabolic alkalosis, hyperreninemia, and hyperaldosteronism. Plasma magnesium concentration was slightly low. Urine analysis showed hypercalciuria, hyposthenuria, and high excretion of potassium. Such findings oriented toward type III Bartter syndrome (BSIII). Direct sequencing of the CLCNKB gene revealed no disease-causing mutations. The water deprivation test was positive. Magnetic resonance imaging showed a lack of posterior pituitary hyperintensity. Finally, direct sequencing of the AVP-NPII gene showed a point mutation (c.1884G>A) in a heterozygous state, confirming an autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI). This condition did not explain the patient's phenotype; thus, we investigated for Gitelman syndrome (GS). A direct sequencing of the SLC12A3 gene showed c.269A>C and c.1205C>A new mutations. In conclusion, the patient had a genetic combination of GS and adFNDI with a BSIII-like phenotype.

  13. Clinical and molecular analysis of the enamelin gene ENAM in Colombian families with autosomal dominant amelogenesis imperfecta

    Directory of Open Access Journals (Sweden)

    Sandra Gutiérrez

    2012-01-01

    Full Text Available In this study, we analyzed the phenotype, clinical characteristics and presence of mutations in the enamelin gene ENAM in five Colombian families with autosomal dominant amelogenesis imperfecta (ADAI. 22 individuals (15 affected and seven unaffected belonging to five Colombian families with ADAI and eight individuals (three affected and five unaffected belonging to three Colombian families with autosomal recessive amelogenesis imperfecta (ARAI that served as controls for molecular alterations and inheritance patterns were studied. Clinical, radiographic and genetic evaluations were done in all individuals. Eight exons and three intron-exon boundaries were sequenced for mutation analysis. Two of the five families with ADAI had the hypoplasic phenotype, two had the hypocalcified phenotype and one had the hypomaturative phenotype. Anterior open bite and mandibular retrognathism were the most frequent skeletal abnormalities in the families with ADAI. No mutations were found. These findings suggest that ADAI in these Colombian families was unrelated to previously described mutations in the ENAM gene. These results also indicate that other regions not included in this investigation, such as the promoter region, introns and other genes should be considered as potential ADAI candidates.

  14. High-Resolution En Face Images of Microcystic Macular Edema in Patients with Autosomal Dominant Optic Atrophy

    Directory of Open Access Journals (Sweden)

    Kiyoko Gocho

    2013-01-01

    Full Text Available The purpose of this study was to investigate the characteristics of microcystic macular edema (MME determined from the en face images obtained by an adaptive optics (AO fundus camera in patients with autosomal dominant optic atrophy (ADOA and to try to determine the mechanisms underlying the degeneration of the inner retinal cells and RNFL by using the advantage of AO. Six patients from 4 families with ADOA underwent detailed ophthalmic examinations including spectral domain optical coherence tomography (SD-OCT. Mutational screening of all coding and flanking intron sequences of the OPA1 gene was performed by DNA sequencing. SD-OCT showed a severe reduction in the retinal nerve fiber layer (RNFL thickness in all patients. A new splicing defect and two new frameshift mutations with premature termination of the Opa1 protein were identified in three families. A reported nonsense mutation was identified in one family. SD-OCT of one patient showed MME in the inner nuclear layer (INL of the retina. AO images showed microcysts in the en face images of the INL. Our data indicate that AO is a useful method to identify MME in neurodegenerative diseases and may also help determine the mechanisms underlying the degeneration of the inner retinal cells and RNFL.

  15. Somatic and germline mosaicism for a mutation of the PHEX gene can lead to genetic transmission of X-linked hypophosphatemic rickets that mimics an autosomal dominant trait.

    Science.gov (United States)

    Goji, Katsumi; Ozaki, Kayo; Sadewa, Ahmad H; Nishio, Hisahide; Matsuo, Masafumi

    2006-02-01

    Familial hypophosphatemic rickets is usually transmitted as an X-linked dominant disorder (XLH), although autosomal dominant forms have also been observed. Genetic studies of these disorders have identified mutations in PHEX and FGF23 as the causes of X-linked dominant disorder and autosomal dominant forms, respectively. The objective of the study was to describe the molecular genetic findings in a family affected by hypophosphatemic rickets with presumed autosomal dominant inheritance. We studied a family in which the father and the elder of his two daughters, but not the second daughter, were affected by hypophosphatemic rickets. The pedigree interpretation of the family suggested that genetic transmission of the disorder occurred as an autosomal dominant trait. Direct nucleotide sequencing of FGF23 and PHEX revealed that the elder daughter was heterozygous for an R567X mutation in PHEX, rather than FGF23, suggesting that the genetic transmission occurred as an X-linked dominant trait. Unexpectedly, the father was heterozygous for this mutation. Single-nucleotide primer extension and denaturing HPLC analysis of the father using DNA from single hair roots revealed that he was a somatic mosaic for the mutation. Haplotype analysis confirmed that the father transmitted the genotypes for 18 markers on the X chromosome equally to his two daughters. The fact that the father transmitted the mutation to only one of his two daughters indicated that he was a germline mosaic for the mutation. Somatic and germline mosaicism for an X-linked dominant mutation in PHEX may mimic autosomal dominant inheritance.

  16. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    Science.gov (United States)

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  17. Malformations among 289,365 Births Attributed to Mutations with Autosomal Dominant and Recessive and X-Linked Inheritance.

    Science.gov (United States)

    Toufaily, M Hassan; Westgate, Marie-Noel; Nasri, Hanah; Holmes, Lewis B

    2018-01-01

    The number of malformations attributed to mutations with autosomal or X-linked patterns of inheritance has increased steadily since the cataloging began in the 1960s. These diagnoses have been based primarily on the pattern of phenotypic features among close relatives. A malformations surveillance program conducted in consecutive pregnancies can identify both known and "new" hereditary disorders. The Active Malformations Surveillance Program was carried out among 289,365 births over 41 years (1972-2012) at Brigham and Women's Hospital in Boston. The findings recorded by examining pediatricians and all consultants were reviewed by study clinicians to establish the most likely diagnoses. The findings in laboratory testing in the newborn period were reviewed, as well. One hundred ninety-six (0.06%) infants among 289,365 births had a malformation or malformation syndrome that was attributed to Mendelian inheritance. A total of 133 (68%) of the hereditary malformations were attributed to autosomal dominant inheritance, with 94 (71%) attributed to apparent spontaneous mutations. Forty-six (23%) were attributed to mutations with autosomal recessive inheritance, 17 associated with consanguinity. Seventeen (9%) were attributed to X-linked inheritance. Fifteen novel familial phenotypes were identified. The family histories showed that most (53 to 71%) of the affected infants were born, as a surprise, to healthy, unaffected parents. It is important for clinicians to discuss with surprised healthy parents how they can have an infant with an hereditary condition. Future studies, using DNA samples from consecutive populations of infants with malformations and whole genome sequencing, will identify many more mutations in loci associated with mendelizing phenotypes. Birth Defects Research 110:92-97, 2018.© 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  18. Mutations in POGLUT1, Encoding Protein O-Glucosyltransferase 1, Cause Autosomal-Dominant Dowling-Degos Disease

    Science.gov (United States)

    Basmanav, F. Buket; Oprisoreanu, Ana-Maria; Pasternack, Sandra M.; Thiele, Holger; Fritz, Günter; Wenzel, Jörg; Größer, Leopold; Wehner, Maria; Wolf, Sabrina; Fagerberg, Christina; Bygum, Anette; Altmüller, Janine; Rütten, Arno; Parmentier, Laurent; El Shabrawi-Caelen, Laila; Hafner, Christian; Nürnberg, Peter; Kruse, Roland; Schoch, Susanne; Hanneken, Sandra; Betz, Regina C.

    2014-01-01

    Dowling-Degos disease (DDD) is an autosomal-dominant genodermatosis characterized by progressive and disfiguring reticulate hyperpigmentation. We previously identified loss-of-function mutations in KRT5 but were only able to detect pathogenic mutations in fewer than half of our subjects. To identify additional causes of DDD, we performed exome sequencing in five unrelated affected individuals without mutations in KRT5. Data analysis identified three heterozygous mutations from these individuals, all within the same gene. These mutations, namely c.11G>A (p.Trp4∗), c.652C>T (p.Arg218∗), and c.798-2A>C, are within POGLUT1, which encodes protein O-glucosyltransferase 1. Further screening of unexplained cases for POGLUT1 identified six additional mutations, as well as two of the above described mutations. Immunohistochemistry of skin biopsies of affected individuals with POGLUT1 mutations showed significantly weaker POGLUT1 staining in comparison to healthy controls with strong localization of POGLUT1 in the upper parts of the epidermis. Immunoblot analysis revealed that translation of either wild-type (WT) POGLUT1 or of the protein carrying the p.Arg279Trp substitution led to the expected size of about 50 kDa, whereas the c.652C>T (p.Arg218∗) mutation led to translation of a truncated protein of about 30 kDa. Immunofluorescence analysis identified a colocalization of the WT protein with the endoplasmic reticulum and a notable aggregating pattern for the truncated protein. Recently, mutations in POFUT1, which encodes protein O-fucosyltransferase 1, were also reported to be responsible for DDD. Interestingly, both POGLUT1 and POFUT1 are essential regulators of Notch activity. Our results furthermore emphasize the important role of the Notch pathway in pigmentation and keratinocyte morphology. PMID:24387993

  19. European ADPKD Forum multidisciplinary position statement on autosomal dominant polycystic kidney disease care: European ADPKD Forum and Multispecialist Roundtable participants.

    Science.gov (United States)

    Harris, Tess; Sandford, Richard; de Coninck, Brenda; Devuyst, Olivier; Drenth, Joost P H; Ecder, Tevfik; Kent, Alastair; Gansevoort, Ron T; Górriz, José Luis; Ong, Albert C M; Pirson, Yves; Torres, Vicente E; Budde, Klemens; Clément, Denis; Derchi, Lorenzo E; Eleftheroudi, Marianna; Levtchenko, Elena; Peters, Dorien; Van Poppel, Hendrik; Vanholder, Raymond

    2017-12-22

    Autosomal dominant polycystic kidney disease (ADPKD) is a chronic, progressive condition characterized by the development and growth of cysts in the kidneys and other organs and by additional systemic manifestations. Individuals with ADPKD should have access to lifelong, multidisciplinary, specialist and patient-centred care involving: (i) a holistic and comprehensive assessment of the manifestations, complications, prognosis and impact of the disease (in physical, psychological and social terms) on the patient and their family; (ii) access to treatment to relieve symptoms, manage complications, preserve kidney function, lower the risk of cardiovascular disease and maintain quality of life; and (iii) information and support to help patients and their families act as fully informed and active partners in care, i.e. to maintain self-management approaches, deal with the impact of the condition and participate in decision-making regarding healthcare policies, services and research. Building on discussions at an international roundtable of specialists and patient advocates involved in ADPKD care, this article sets out (i) the principles for a patient-centred, holistic approach to the organization and delivery of ADPKD care in practice, with a focus on multispecialist collaboration and shared-decision making, and (ii) the rationale and knowledge base for a route map for ADPKD care intended to help patients navigate the services available to them and to help stakeholders and decision-makers take practical steps to ensure that all patients with ADPKD can access the comprehensive multispecialist care to which they are entitled. Further multispecialty collaboration is encouraged to design and implement these services, and to work with patient organizations to promote awareness building, education and research. © The Author 2017. Published by Oxford University Press on behalf of ERA-EDTA.

  20. EFFICACY AND SAFETY OF SIROLIMUS IN REDUCING CYST VOLUME IN PATIENTS WITH AUTOSOMAL DOMINANT POLYCYSTIC KIDNEY DISEASE

    Directory of Open Access Journals (Sweden)

    Sreelatha Melemadathil

    2016-11-01

    Full Text Available BACKGROUND Autosomal-Dominant Polycystic Kidney Disease is by far the most frequent inherited kidney disease. In White populations, its prevalence ranges from one in 400 to one in 1000 (Gabow 1993. Though the corresponding figure in Blacks is not yet available, the incidence of ESRD due to ADPKD is similar in American Blacks and Whites (Yium et al, 1994. Renoprotective interventions in ADPKD are maximal reduction of blood pressure and proteinuria and limit the effects of additional potential promoters of disease progression such as dyslipidaemia, chronic hyperglycaemia or smoking. At present, there is no definitive treatment for reducing cyst volume and hence disease progression. Sirolimus (Rapamycin is an immunosuppressant mostly used for the management of kidney transplant recipients. This drug by specifically and effectively inhibiting mTOR, exerts antiproliferative and growth inhibiting effects and could be important for the inhibition of cyst progression in ADPKD. MATERIALS AND METHODS It is an interventional randomised open label, active control study for six months. ADPKD type 1 patients between the age of 18 to 60 years with a GFR > 40 mL/min/1.73 m2 were included in the study. RESULTS Total number of subjects enrolled – 60. Patients enrolled in sirolimus arm – 40. Patients enrolled in conventional treatment arm - 20. Patients dropped out due to sirolimus side effects - 5. Patients lost to followup - 1. Patients completed treatment in conventional treatment arm - 20. CONCLUSION Treatment with mTOR inhibitor sirolimus for 6 months was effective in reducing total kidney volume, total renal cyst volume and volume of the largest cyst in patients with ADPKD. There was a small, but significant increase in renal parenchymal volume on treatment with sirolimus. Extending the duration of treatment to one year caused further significant reduction in total kidney volume and cyst volume. Major side effect of sirolimus in our patients was

  1. Urinary proteomic biomarkers for diagnosis and risk stratification of autosomal dominant polycystic kidney disease: a multicentric study.

    Directory of Open Access Journals (Sweden)

    Andreas D Kistler

    Full Text Available Treatment options for autosomal dominant polycystic kidney disease (ADPKD will likely become available in the near future, hence reliable diagnostic and prognostic biomarkers for the disease are strongly needed. Here, we aimed to define urinary proteomic patterns in ADPKD patients, which aid diagnosis and risk stratification. By capillary electrophoresis online coupled to mass spectrometry (CE-MS, we compared the urinary peptidome of 41 ADPKD patients to 189 healthy controls and identified 657 peptides with significantly altered excretion, of which 209 could be sequenced using tandem mass spectrometry. A support-vector-machine based diagnostic biomarker model based on the 142 most consistent peptide markers achieved a diagnostic sensitivity of 84.5% and specificity of 94.2% in an independent validation cohort, consisting of 251 ADPKD patients from five different centers and 86 healthy controls. The proteomic alterations in ADPKD included, but were not limited to markers previously associated with acute kidney injury (AKI. The diagnostic biomarker model was highly specific for ADPKD when tested in a cohort consisting of 481 patients with a variety of renal and extrarenal diseases, including AKI. Similar to ultrasound, sensitivity and specificity of the diagnostic score depended on patient age and genotype. We were furthermore able to identify biomarkers for disease severity and progression. A proteomic severity score was developed to predict height adjusted total kidney volume (htTKV based on proteomic analysis of 134 ADPKD patients and showed a correlation of r = 0.415 (p<0.0001 with htTKV in an independent validation cohort consisting of 158 ADPKD patients. In conclusion, the performance of peptidomic biomarker scores is superior to any other biochemical markers of ADPKD and the proteomic biomarker patterns are a promising tool for prognostic evaluation of ADPKD.

  2. Non-image-forming light driven functions are preserved in a mouse model of autosomal dominant optic atrophy.

    Directory of Open Access Journals (Sweden)

    Georgia Perganta

    Full Text Available Autosomal dominant optic atrophy (ADOA is a slowly progressive optic neuropathy that has been associated with mutations of the OPA1 gene. In patients, the disease primarily affects the retinal ganglion cells (RGCs and causes optic nerve atrophy and visual loss. A subset of RGCs are intrinsically photosensitive, express the photopigment melanopsin and drive non-image-forming (NIF visual functions including light driven circadian and sleep behaviours and the pupil light reflex. Given the RGC pathology in ADOA, disruption of NIF functions might be predicted. Interestingly in ADOA patients the pupil light reflex was preserved, although NIF behavioural outputs were not examined. The B6; C3-Opa1(Q285STOP mouse model of ADOA displays optic nerve abnormalities, RGC dendropathy and functional visual disruption. We performed a comprehensive assessment of light driven NIF functions in this mouse model using wheel running activity monitoring, videotracking and pupillometry. Opa1 mutant mice entrained their activity rhythm to the external light/dark cycle, suppressed their activity in response to acute light exposure at night, generated circadian phase shift responses to 480 nm and 525 nm pulses, demonstrated immobility-defined sleep induction following exposure to a brief light pulse at night and exhibited an intensity dependent pupil light reflex. There were no significant differences in any parameter tested relative to wildtype littermate controls. Furthermore, there was no significant difference in the number of melanopsin-expressing RGCs, cell morphology or melanopsin transcript levels between genotypes. Taken together, these findings suggest the preservation of NIF functions in Opa1 mutants. The results provide support to growing evidence that the melanopsin-expressing RGCs are protected in mitochondrial optic neuropathies.

  3. Cerebral Microbleeds and the Risk of Incident Ischemic Stroke in CADASIL (Cerebral Autosomal Dominant Arteriopathy With Subcortical Infarcts and Leukoencephalopathy).

    Science.gov (United States)

    Puy, Laurent; De Guio, François; Godin, Ophélia; Duering, Marco; Dichgans, Martin; Chabriat, Hugues; Jouvent, Eric

    2017-10-01

    Cerebral microbleeds are associated with an increased risk of intracerebral hemorrhage. Recent data suggest that microbleeds may also predict the risk of incident ischemic stroke. However, these results were observed in elderly individuals undertaking various medications and for whom causes of microbleeds and ischemic stroke may differ. We aimed to test the relationship between the presence of microbleeds and incident stroke in CADASIL (Cerebral Autosomal Dominant Arteriopathy With Subcortical Infarcts and Leukoencephalopathy)-a severe monogenic small vessel disease known to be responsible for both highly prevalent microbleeds and a high incidence of ischemic stroke in young patients. We assessed microbleeds on baseline MRI in all 378 patients from the Paris-Munich cohort study. Incident ischemic strokes were recorded during 54 months. Survival analyses were used to test the relationship between microbleeds and incident ischemic stroke. Three hundred sixty-nine patients (mean age, 51.4±11.4 years) were followed-up during a median time of 39 months (interquartile range, 19 months). The risk of incident ischemic stroke was higher in patients with microbleeds than in patients without (35.8% versus 19.6%, hazard ratio, 1.87; 95% confidence interval, 1.16-3.01; P =0.009). These results persisted after adjustment for history of ischemic stroke, age, sex, vascular risk factors, and antiplatelet agents use (hazard ratio, 1.89; 95% confidence interval, 1.10-3.26; P =0.02). The presence of microbleeds is an independent risk marker of incident ischemic stroke in CADASIL, emphasizing the need to carefully interpret MRI data. © 2017 American Heart Association, Inc.

  4. Type II autosomal dominant osteopetrosis (Albers-Schönberg disease): clinical and radiological manifestations in 42 patients.

    Science.gov (United States)

    Bénichou, O D; Laredo, J D; de Vernejoul, M C

    2000-01-01

    Type II autosomal dominant osteopetrosis (ADO II, Albers-Schonberg disease) is a genetic condition characterized by generalized osteosclerosis predominating in some skeletal sites such as the spine and pelvis. ADO II is rare, and most available clinical descriptions are based on small numbers of patients. We report the clinical and radiological manifestations in 42 ADO II patients. To our knowledge, this is the largest series reported so far. Our inclusion criterion was presence on radiographs of the spine of vertebral endplate thickening, producing the classic sandwich vertebra appearance. We found various patterns of sandwich vertebra, of which we provide a description to assist physicians in diagnosing ADO II. The classic bone-within-bone appearance was present in most but not all skeletal sites. The radiological penetrance of the disease was high (90%) and increased after 20 years of age. As many as 81% of our patients experienced clinical manifestations. Fractures were common (78% of patients) and healed slowly. Hip osteoarthritis developed in 27% of patients and required arthroplasty in 9 of the 16 affected hips. Nonmandibular osteomyelitis occurred in 4 cases (11%). Twenty-four percent of patients had thoracic or lumbar scoliosis. Orthopedic surgery was performed in 52.8% of patients, of whom half had at least three surgical procedures for internal fracture fixation, arthroplasty, limb deformity correction, or treatment of surgical complications. There was a high rate of surgical complications including nonunion, infection, prosthesis loosening, and intraoperative fractures. Nearly two-thirds of patients (64%) had stomatologic manifestations, including mandibular osteomyelitis in 4 patients (11%). Cranial nerve involvement responsible for hearing loss, bilateral optic atrophy, and/or facial palsy was present in 14 patients but was clearly attributable to ADO II in only 6 cases (16%). This large series sheds new light on several aspects of ADO II, most

  5. Laparoscopic Nephrectomy versus Open Nephrectomy for Patients with Autosomal Dominant Polycystic Kidney Disease: A Systematic Review and Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Pengyu Guo

    Full Text Available To compare efficacy and safety of laparoscopicnephrectomy (LN versus open nephrectomy (ON in the management of autosomal dominant polycystic kidney disease (ADPKD, we conducted a systematic review and meta-analysis.A systematic search of the electronic databases PubMed, Scopus, and the Cochrane Library was performed up to October 2014. This systematic review was performed based on observational comparative studies that assessed the two techniques. The weighted mean difference (WMD and risk ratio (RR, with their corresponding 95% confidence interval (CI, were calculated to compare continuous and dichotomous variables, respectively.Seven studies were identified, including 195 cases (118 LN/77 ON. Although LN was associated with longer operative time (WMD 30.236, 95%CI 14.541 -45.932, P<0.001 and the specimen might not have been resected as heavy as the ON group (WMD -986.516, 95%CI -1883.24--89.795, P = 0.031, patients in this group might benefit from a shorter length of hospital stay (WMD -3.576, 95%CI 4.976--2.176, P <0.001, less estimated blood loss (WMD -180.245, 95%CI -317.939--42.556, P = 0.010, and lower need of transfusion (RR 0.345, 95%CI 0.183-0.650, P = 0.001. The LN group also had less overall complications (RR 0.545, 95%CI 0.329-0.903, P = 0.018. The need of narcotic analgesics between the two groups might have no significant difference (WMD -54.66, 95%CI -129.76-20.44, P = 0.154.LN for giant symptomatic ADPKD was feasible, safe and efficacious. Morbidity was significantly reduced compared with the open approach. For an experienced laparoscopist, LN might be a better alternative.

  6. Positron-emission computed tomography in cyst infection diagnosis in patients with autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Jouret, François; Lhommel, Renaud; Beguin, Claire; Devuyst, Olivier; Pirson, Yves; Hassoun, Ziad; Kanaan, Nada

    2011-07-01

    Cyst infection remains a challenging issue in patients with autosomal dominant polycystic kidney disease (ADPKD). In most patients, conventional imaging techniques are inconclusive. Isolated observations suggest that (18)fluorodeoxyglucose (¹⁸FDG) positron-emission computed tomography (PET/CT) might help detect cyst infection in ADPKD patients. Comparative assessment of administrative databases from January 2005 to December 2009 identified 27 PET/CT scans performed in 24 ADPKD patients for suspicion of abdominal infection. Cyst infection was definite if confirmed by cyst fluid analysis. Cyst infection was probable if all four of the following criteria were met: temperature of >38°C for >3 days, loin or liver tenderness, C-reactive protein plasma level of >5 mg/dl, and no CT evidence for intracystic bleeding. Episodes with only two or three criteria were grouped as "fever of unknown origin". Thirteen infectious events in 11 patients met all criteria for kidney (n = 3) or liver (n = 10) cyst infection. CT was contributive in only one patient, whereas PET/CT proved cyst infection in 11 patients (84.6%). In addition, 14 episodes of "fever of unknown origin" in 13 patients were recorded. PET/CT identified the source of infection in nine patients (64.3%), including 2 renal cyst infections. Conversely, PET/CT showed no abnormal ¹⁸FDG uptake in 5 patients, including 2 intracystic bleeding. The median delay between the onset of symptoms and PET/CT procedure was 9 days. This retrospective series underscores the usefulness of PET/CT to confirm and locate cyst infection and identify alternative sources of abdominal infection in ADPKD patients.

  7. A novel mutation in PRPF31, causative of autosomal dominant retinitis pigmentosa, using the BGISEQ-500 sequencer

    Directory of Open Access Journals (Sweden)

    Yu Zheng

    2018-01-01

    Full Text Available AIM: To study the genes responsible for retinitis pigmentosa. METHODS: A total of 15 Chinese families with retinitis pigmentosa, containing 94 sporadically afflicted cases, were recruited. The targeted sequences were captured using the Target_Eye_365_V3 chip and sequenced using the BGISEQ-500 sequencer, according to the manufacturer’s instructions. Data were aligned to UCSC Genome Browser build hg19, using the Burroughs Wheeler Aligner MEM algorithm. Local realignment was performed with the Genome Analysis Toolkit (GATK v.3.3.0 IndelRealigner, and variants were called with the Genome Analysis Toolkit Haplotypecaller, without any use of imputation. Variants were filtered against a panel derived from 1000 Genomes Project, 1000G_ASN, ESP6500, ExAC and dbSNP138. In all members of Family ONE and Family TWO with available DNA samples, the genetic variant was validated using Sanger sequencing. RESULTS: A novel, pathogenic variant of retinitis pigmentosa, c.357_358delAA (p.Ser119SerfsX5 was identified in PRPF31 in 2 of 15 autosomal-dominant retinitis pigmentosa (ADRP families, as well as in one, sporadic case. Sanger sequencing was performed upon probands, as well as upon other family members. This novel, pathogenic genotype co-segregated with retinitis pigmentosa phenotype in these two families. CONCLUSION: ADRP is a subtype of retinitis pigmentosa, defined by its genotype, which accounts for 20%-40% of the retinitis pigmentosa patients. Our study thus expands the spectrum of PRPF31 mutations known to occur in ADRP, and provides further demonstration of the applicability of the BGISEQ500 sequencer for genomics research.

  8. A novel mutation in PRPF31, causative of autosomal dominant retinitis pigmentosa, using the BGISEQ-500 sequencer

    Science.gov (United States)

    Zheng, Yu; Wang, Hai-Lin; Li, Jian-Kang; Xu, Li; Tellier, Laurent; Li, Xiao-Lin; Huang, Xiao-Yan; Li, Wei; Niu, Tong-Tong; Yang, Huan-Ming; Zhang, Jian-Guo; Liu, Dong-Ning

    2018-01-01

    AIM To study the genes responsible for retinitis pigmentosa. METHODS A total of 15 Chinese families with retinitis pigmentosa, containing 94 sporadically afflicted cases, were recruited. The targeted sequences were captured using the Target_Eye_365_V3 chip and sequenced using the BGISEQ-500 sequencer, according to the manufacturer's instructions. Data were aligned to UCSC Genome Browser build hg19, using the Burroughs Wheeler Aligner MEM algorithm. Local realignment was performed with the Genome Analysis Toolkit (GATK v.3.3.0) IndelRealigner, and variants were called with the Genome Analysis Toolkit Haplotypecaller, without any use of imputation. Variants were filtered against a panel derived from 1000 Genomes Project, 1000G_ASN, ESP6500, ExAC and dbSNP138. In all members of Family ONE and Family TWO with available DNA samples, the genetic variant was validated using Sanger sequencing. RESULTS A novel, pathogenic variant of retinitis pigmentosa, c.357_358delAA (p.Ser119SerfsX5) was identified in PRPF31 in 2 of 15 autosomal-dominant retinitis pigmentosa (ADRP) families, as well as in one, sporadic case. Sanger sequencing was performed upon probands, as well as upon other family members. This novel, pathogenic genotype co-segregated with retinitis pigmentosa phenotype in these two families. CONCLUSION ADRP is a subtype of retinitis pigmentosa, defined by its genotype, which accounts for 20%-40% of the retinitis pigmentosa patients. Our study thus expands the spectrum of PRPF31 mutations known to occur in ADRP, and provides further demonstration of the applicability of the BGISEQ500 sequencer for genomics research. PMID:29375987

  9. Autosomal-dominant chronic mucocutaneous candidiasis with STAT1-mutation can be complicated with chronic active hepatitis and hypothyroidism.

    Science.gov (United States)

    Hori, Tomohiro; Ohnishi, Hidenori; Teramoto, Takahide; Tsubouchi, Kohji; Naiki, Takafumi; Hirose, Yoshinobu; Ohara, Osamu; Seishima, Mariko; Kaneko, Hideo; Fukao, Toshiyuki; Kondo, Naomi

    2012-12-01

    To describe a case of autosomal-dominant (AD)-chronic mucocutaneous candidiasis (CMC) with a signal transducer and activator of transcription (STAT) 1 gene mutation, and some of the important complications of this disease such as chronic hepatitis. We present a 23-year-old woman with CMC, chronic active hepatitis, and hypothyroidism. Her father also had CMC. We performed several immunological analyses of blood and liver samples, and searched for gene mutations for CMC in the patient and her father. We identified the heterozygous substitution c.821 G > A (p.Arg274Gln) in the STAT1 gene of both the patient and her father. The level of β-glucan induced interferon (IFN)-γ in her blood cells was significantly low. Immunoblot analysis detected serum anti-interleukin (IL)-17 F autoantibody. She was found to have increased (low-titer) antibodies related to her hypothyroidism and hepatitis. Her serum IL-18 levels fluctuated with her AST and ALT levels. Liver biopsy revealed CD68-positive cell infiltration and IL-18 expression in the sinusoidal regions. These results suggest that the chronic active hepatitis in this patient may be exacerbated by the excessive IL-18 accumulation caused by recurrent mucocutaneous fungal infection, and decreased IFN-γ production. AD-CMC is known to be caused by a gain-of-function mutation of the STAT1 gene. Chronic active hepatitis is a rare complication of AD-CMC, with currently unknown pathogenesis. It seems that the clinical phenotype in this patient is modified by autoimmune mechanisms and cytokine dysregulation. AD-CMC can be complicated by various immune disorders including autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy.

  10. Exon sequencing of PKD1 gene in an Iranian patient with autosomal-dominant polycystic kidney disease.

    Science.gov (United States)

    Hafizi, Atousa; Khatami, Saeid Reza; Galehdari, Hamid; Shariati, Gholamreza; Saberi, Ali Hossein; Hamid, Mohammad

    2014-07-01

    Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common genetic kidney disorders with the incidence of 1 in 1,000 births. ADPKD is genetically heterogeneous with two genes identified: PKD1 (16p13.3, 46 exons) and PKD2 (4q21, 15 exons). Eighty five percent of the patients with ADPKD have at least one mutation in the PKD1 gene. Genetic studies have demonstrated an important allelic variability among patients, but very few data are known about the genetic variation among Iranian populations. In this study, exon direct sequencing of PKD1 was performed in a seven-year old boy with ADPKD and in his parents. The patient's father was ADPKD who was affected without any kidney dysfunction, and the patient's mother was congenitally missing one kidney. Molecular genetic testing found a mutation in all three members of this family. It was a missense mutation GTG>ATG at position 3057 in exon 25 of PKD1. On the other hand, two novel missense mutations were reported just in the 7-year-old boy: ACA>GCA found in exon 15 at codon 2241 and CAC>AAC found in exon 38 at codon 3710. For checking the pathogenicity of these mutations, exons 15, 25, and 38 of 50 unrelated normal cases were sequenced. our findings suggested that GTG>ATG is a polymorphism with high frequency (60%) as well as ACA>GCA and CAC>AAC are polymorphisms with frequencies of 14% and 22%, respectively in the population of Southwest Iran.

  11. Novel calcium-sensing receptor cytoplasmic tail deletion mutation causing autosomal dominant hypocalcemia: molecular and clinical study.

    Science.gov (United States)

    Obermannova, Barbora; Sumnik, Zdenek; Dusatkova, Petra; Cinek, Ondrej; Grant, Michael; Lebl, Jan; Hendy, Geoffrey N

    2016-04-01

    Autosomal dominant hypocalcemia (ADH) is a rare disorder caused by activating mutations of the calcium-sensing receptor (CASR). The treatment of ADH patients with 1α-hydroxylated vitamin D derivatives can cause hypercalciuria leading to nephrocalcinosis. We studied a girl who presented with hypoparathyroidism and asymptomatic hypocalcemia at age 2.5 years. Mutations of CASR were investigated by DNA sequencing. Functional analyses of mutant and WT CASRs were done in transiently transfected human embryonic kidney (HEK293) cells. The proband and her father are heterozygous for an eight-nucleotide deletion c.2703_2710delCCTTGGAG in the CASR encoding the intracellular domain of the protein. Transient expression of CASR constructs in kidney cells in vitro suggested greater cell surface expression of the mutant receptor with a left-shifted extracellular calcium dose-response curve relative to that of the WT receptor consistent with gain of function. Initial treatment of the patient with calcitriol led to increased urinary calcium excretion. Evaluation for mosaicism in the paternal grandparents of the proband was negative. We describe a novel naturally occurring deletion mutation within the CASR that apparently arose de novo in the father of the ADH proband. Functional analysis suggests that the cytoplasmic tail of the CASR contains determinants that regulate the attenuation of signal transduction. Early molecular analysis of the CASR gene in patients with isolated idiopathic hypoparathyroidism is recommended because of its relevance to clinical outcome and treatment choice. In ADH patients, calcium supplementation and low-dose cholecalciferol avoids hypocalcemic symptoms without compromising renal function. © 2016 European Society of Endocrinology.

  12. Variability in clinical phenotypes of PRPF8-linked autosomal dominant retinitis pigmentosa correlates with differential PRPF8/SNRNP200 interactions.

    Science.gov (United States)

    Escher, Pascal; Passarin, Olga; Munier, Francis L; Tran, Viet H; Vaclavik, Veronika

    2018-01-01

    To expand the genotype/phenotype correlations in patients with autosomal dominant retinitis pigmentosa (adRP) harboring PRPF8 variants. Two patients, a father and his daughter, harboring a novel p.PRPF8-Glu2331* variant, underwent ophthalmic examination at 3-year-interval, including fundus photography, fundus autofluorescence, optical coherence tomography, and ISCEV standard full field ERGs. All reported disease-causing PRPF8 variants were collected and localized in the PRPF8 and PRPF8/SNRNP200 protein structures. The p.PRPF8-Glu2331* variant results in a truncated PRPF8 protein lacking the last five C-terminal amino acids and caused in the two patients a severe clinical phenotype, with the macula being affected from the second decade on. All but two adRP-linked variants are located in the last exon 43 encoding the C-terminal tail of the C-terminal PRPF8 Jab1 domain. The p.PRPF8-Ser2118Phe and -Asn2280Lys variants encoded by exons 39 and 42, respectively, are located at the basis of the C-terminal tail. Frame-shift mutations and nonconservative amino acid changes in PRPF8 typically cause severe clinical phenotypes. The conservative missense variant p.PRPF8-Arg2310Lys that is not altering the global charge of the C-terminal tail, and variants located at the basis of the C-terminal tail show milder clinical phenotypes, in accordance with functional data on PRPF8/SNRNP200 interactions in yeast.

  13. Novel three-dimensional imaging volumetry in autosomal dominant polycystic kidney disease: comparison with 2D volumetry.

    Science.gov (United States)

    Shin, Dongsuk; Lee, Kyu-Beck; Hyun, Young Youl; Lee, Young Rae; Hwang, Young-Hwan; Park, Hayne Cho; Ahn, Curie

    2014-08-01

    Autosomal dominant polycystic kidney disease (ADPKD) volumetry is an important marker for evaluating the progression of disease. Three-dimensional (3D) volumetry is generally more timesaving than 2D volumetry, but its reliability and accuracy are uncertain. Small and large phantoms simulating polycystic kidneys and 20 patients with ADPKD underwent magnetic resonance imaging (MRI) volumetry. We evaluated the total kidney volume (TKV) and total cyst volume (TCV) using a novel 3D volumetry program (XelisTM) and compared 3D volumetry data with the conventional 2D method (the reference volume values). After upload and threshold setting, the other organs surrounding the kidney were removed by picking and sculpting. The novel method involves drawing of the kidney or cyst and automatic measurement of kidney volume and cyst volume in 3D images. The 3D volume estimation of the small and large phantoms differed from the actual values by 6.9% and -8.2%, respectively, for TKV and by 2.1% and 1.4% for TCV. In ADPKD patients, the intra-reader reliability of 3D volumetry was 30 ± 180 mL (1.3 ± 10.3%) and 25 ± 113 mL (1.2 ± 9.4%), respectively, for TKV and TCV. Correlation between 3D volumetry and 2D volumetry of TKV and TCV resulted in a high correlation coefficient and a regression slope approaching 1.00 (r = 0.97 - 0.98). The mean of the volume percentage differences for 3D vs. 2D for TKV : TCV were -6.0 ± 8.9% : 2.0 ± 11.8% in large ADPKD and -16.1 ± 10.4% : 13.2 ± 21.9% in small ADPKD. Our study showed that 3D volumetry has reliability and accuracy compared with 2D volumetry in ADPKD. 3D volumetry is more accurate for TCV and large ADPKD.

  14. Autosomal-dominant GTPCH1-deficient DRD: clinical characteristics and long-term outcome of 34 patients.

    Science.gov (United States)

    Trender-Gerhard, I; Sweeney, M G; Schwingenschuh, P; Mir, P; Edwards, M J; Gerhard, A; Polke, J M; Hanna, M G; Davis, M B; Wood, N W; Bhatia, K P

    2009-08-01

    An autosomal dominantly inherited defect in the GCH1 gene that encodes guanosine triphosphate cyclohydrolase 1 (GTPCH1) is the most common cause of dopa-responsive dystonia (DRD). A classic phenotype of young-onset lower-limb dystonia, diurnal fluctuations and excellent response to levodopa has been well recognised in association with GCH1 mutations, and rare atypical presentations have been reported. However, a number of clinical issues remain unresolved including phenotypic variability, long-term response to levodopa and associated non-motor symptoms, and there are limited data on long-term follow-up of genetically proven cases. A detailed clinical evaluation of 34 patients (19 women, 15 men), with confirmed mutations in the GCH1 gene, is presented. The classic phenotype was most frequent (n = 23), with female predominance (F:M = 16:7), and early onset (mean 4.5 years) with involvement of legs. However, a surprisingly large number of patients developed craniocervical dystonia, with spasmodic dysphonia being the predominant symptom in two subjects. A subset of patients, mainly men, presented with either a young-onset (mean 6.8 years) mild DRD variant not requiring treatment (n = 4), or with an adult-onset (mean 37 years) Parkinson disease-like phenotype (n = 4). Two siblings were severely affected with early hypotonia and delay in motor development, associated with compound heterozygous GCH1 gene mutations. The study also describes a number of supplementary features including restless-legs-like symptoms, influence of female sex hormones, predominance of tremor or parkinsonism in adult-onset cases, initial reverse reaction to levodopa, recurrent episodes of depressive disorder and specific levodopa-resistant symptoms (writer's cramp, dysphonia, truncal dystonia). Levodopa was used effectively and safely in 20 pregnancies, and did not cause any fetal abnormalities.

  15. Clinical characteristics and disease predictors of a large Chinese cohort of patients with autosomal dominant polycystic kidney disease.

    Directory of Open Access Journals (Sweden)

    Dongping Chen

    Full Text Available OBJECTIVE: Autosomal dominant polycystic kidney disease (ADPKD is a relentlessly progressing form of chronic kidney disease for which there is no cure. The aim of this study was to characterize Chinese patients with ADPKD and to identify the factors which predict cyst growth and renal functional deterioration. METHODS: To analyze disease predicting factors we performed a prospective longitudinal observational study in a cohort of 541 Chinese patients with ADPKD and an eGFR ≥ 30 ml/min/1.73 m(2. Patients were followed clinically and radiologically with sequential abdominal magnetic resonance imaging (MRI. Clinical characteristics and laboratory data were related to changes in estimated glomerular filtration rate (eGFR and total kidney volume (TKV. A linear regression model was developed to analyze the factors which determine eGFR and TKV changes. RESULTS: The age range of this unselected cohort ranged from 4 to 77 years. Median follow-up time was 14.3 ± 10.6 months. Although inter-individual differences in eGFR and TKV were large, there was a consistent link between these two parameters. Baseline log10-transformed TKV and urinary protein/creatinine ratio were identified as the major predictors for a faster eGFR decline and were associated with a higher TKV growth rate. Interestingly, a lower thrombocyte count correlated significantly with lower eGFR (r = 0.222 and higher TKV (r = 0.134. CONCLUSIONS: This large cohort of Chinese patients with ADPKD provides unique epidemiological data for comparison with other cohorts of different ethnicity. In Chinese patients we identified a lower thrombocyte count as a significant predictor of disease progression. These results are important for the design of future clinical trials to retard polycystic kidney disease progression.

  16. Identification of IFRD1 variant in a Han Chinese family with autosomal dominant hereditary spastic paraplegia associated with peripheral neuropathy and ataxia.

    Science.gov (United States)

    Lin, Pengfei; Zhang, Dong; Xu, Guangrun; Yan, Chuanzhu

    2018-04-01

    Spinocerebellar ataxias (SCAs) are a group of autosomal dominant, clinically heterogeneous neurodegenerative disorders. SCA18 is a rare autosomal dominant sensory/motor neuropathy with ataxia (OMIM#607458) associated with a single missense variant c.514 A>G in the interferon related developmental regulator 1 (IFRD1) gene previously reported in a five-generation American family of Irish origin. However, to date, there have been no other reports of the IFRD1 mutation to confirm its role in SCA. Here, we report a Han Chinese family with SCA18; the family members presented with a slowly progressing gait ataxia, pyramidal tract signs, and peripheral neuropathy. We identified a missense variant (c.514 A>G, p.I172V) in IFRD1 gene in the family using targeted next-generation sequencing and Sanger direct sequencing with specific primers. Our results suggest that the IFRD1 gene may be the causative allele for SCA18.

  17. Genetic heterogeneity in familial exudative vitreoretinopathy; exclusion of the EVR1 locus on chromosome 11q in a large autosomal dominant pedigree.

    Science.gov (United States)

    Bamashmus, M A; Downey, L M; Inglehearn, C F; Gupta, S R; Mansfield, D C

    2000-04-01

    Familial exudative vitreoretinopathy (FEVR) is associated with mutations in the Norrie disease gene in X linked pedigrees and with linkage to the EVR1 locus at 11q13 in autosomal dominant cases. A large autosomal dominant FEVR family was studied, both clinically and by linkage analysis, to determine whether it differed from the known forms of FEVR. Affected members and obligate gene carriers from this family were examined by slit lamp biomicroscopy, indirect ophthalmoscopy, and in some cases fluorescein angiography. Patient DNAs were genotyped for markers at the EVR1 locus on chromosome 11q13. The clinical evaluation in this family is consistent with previous descriptions of FEVR pedigrees, but linkage analysis proves that it has a form of FEVR genetically distinct from the EVR1 locus on 11q. This proves that there are at least three different loci associated with comparable FEVR phenotypes, a situation similar to that existing for many forms of retinal degeneration.

  18. Diagnostic Algorithm in the Management of Acute Febrile Abdomen in Patients with Autosomal Dominant Polycystic Kidney Disease.

    Directory of Open Access Journals (Sweden)

    Marie Neuville

    Full Text Available Acute febrile abdomen represents a diagnostic challenge in patients with autosomal dominant polycystic kidney disease (ADPKD. Although criteria have been proposed for cyst infection (CyI and hemorrhage (CyH, there is a lack of comparative assessments. Furthermore, distinguishing cystic from non-cystic complications remains problematic.ADPKD patients presenting with abdominal pain and/or fever between 01/2005 and 06/2015 were retrospectively identified in a systematic computerized billing database. CyH was defined as spontaneous intracystic density above 50 Hounsfield units on computed tomography (CT. CyI was definite if confirmed by cyst puncture, and probable if 4 criteria were met: 3-day fever, loin/liver tenderness, C-reactive protein (CRP plasma levels >50mg/L and no CT evidence for CyH. Other episodes were grouped as inflammation of unknown origin (IUO.Among a cohort of 173 ADPKD patients, 101 presented with 205 episodes of abdominal pain (n = 172 and/or fever (n = 33. 20 patients experienced 30 CyH, whereas 16 presented 23 episodes of definite (n = 11 or probable (n = 12 CyI. 35 IUO were observed in 31 patients. Clinically, fever was observed in 7% vs. 100% vs. 66% of CyH, CyI and IUO, respectively. Biologically, CRP cut-off at 70 mg/dl showed 92% sensitivity and 81% specificity in CyI diagnosis. Urine or blood cultures remained sterile in >90% of CyH, but were contributive in 53.4% of CyI and IUO, with a 74.2% prevalence for E. coli. Radiologically, ultrasounds, CT and magnetic resonance diagnosed CyI in 2.6%, 20% and 16.7% of cases, respectively. 18F-FDG positron-emission tomography (PET/CT was done within a median period of 7 days post antibiotics, and significantly changed patient management in 71.4%.This retrospective single-center series underscores the usefulness of clinical-fever-and biological-CRP-parameters, but emphasizes the limitations of bacteriological and radiological investigations in cases of acute febrile abdomen in

  19. Characteristics of intracranial aneurysms in the else kröner-fresenius registry of autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Neumann, Hartmut P H; Malinoc, Angelica; Bacher, Janina; Nabulsi, Zinaida; Ivanovas, Vera; Bruechle, Nadine Ortiz; Mader, Irina; Hoffmann, Michael M; Riegler, Peter; Kraemer-Guth, Annette; Burchardi, Christian; Schaeffner, Elke; Martin, Rodolfo S; Azurmendi, Pablo J; Zerres, Klaus; Jilg, Cordula; Eng, Charis; Gläsker, Sven

    2012-01-01

    Patients who harbor intracranial aneurysms (IAs) run a risk for aneurysm rupture and subsequent subarachnoid hemorrhage which frequently results in permanent deficits or death. Prophylactic treatment of unruptured aneurysms is possible and recommended depending on the size and location of the aneurysm as well as patient age and condition. IAs are major manifestations of autosomal dominant polycystic kidney disease (ADPKD). Current guidelines do not suggest surveillance of IAs in ADPKD except in the setting of family history if IA was known in any relative with ADPKD. Management of IAs in ADPKD is problematic because limited data exist from large studies. We established the Else Kröner-Fresenius Registry for ADPKD in Germany. Clinical data were assessed for age at diagnosis of IAs, stage of renal insufficiency, and number, location and size of IAs as well as family history of cerebral events. Patients with symptomatic or asymptomatic IAs were included. All patients with ADPKD-related IAs were offered mutation scanning of the susceptibility genes for ADPKD, the PKD1 and PKD2 genes. Of 463 eligible ADPKD patients from the population base of Germany, 32 (7%) were found to have IAs, diagnosed at the age of 2-71 years, 19 females and 13 males. Twenty (63%) of these 32 patients were symptomatic, whereas IAs were detected in an asymptomatic stage in 12 patients. IAs were multifocal in 12 and unifocal in 20 patients. In 26 patients (81%), IAs were diagnosed before end-stage renal failure. Twenty-five out of 27 unrelated index cases (93%) had no IAs or cerebral events documented in their relatives with ADPKD. In 16 unrelated index patients and 3 relatives, we detected germline mutations. The mutations were randomly distributed across the PKD1 gene in 14 and the PKD2 gene in 2 index cases. Questionnaires answered for 320/441 ADPKD patients without IAs revealed that only 45/320 (14%) had MR angiography. In ADPKD, rupture of IAs occurs frequently before the start of dialysis

  20. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

    Science.gov (United States)

    Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

    2017-01-01

    Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

  1. Autosomal Dominant Tubulointerstitial Kidney Disease: Clinical Presentation of Patients With ADTKD-UMOD and ADTKD-MUC1.

    Science.gov (United States)

    Ayasreh, Nadia; Bullich, Gemma; Miquel, Rosa; Furlano, Mónica; Ruiz, Patricia; Lorente, Laura; Valero, Oliver; García-González, Miguel Angel; Arhda, Nisrine; Garin, Intza; Martínez, Víctor; Pérez-Gómez, Vanessa; Fulladosa, Xavier; Arroyo, David; Martínez-Vea, Alberto; Espinosa, Mario; Ballarín, Jose; Ars, Elisabet; Torra, Roser

    2018-05-18

    Autosomal dominant tubulointerstitial kidney disease (ADTKD) is a rare underdiagnosed cause of end-stage renal disease (ESRD). ADTKD is caused by mutations in at least 4 different genes: MUC1, UMOD, HNF1B, and REN. Retrospective cohort study. 56 families (131 affected individuals) with ADTKD referred from different Spanish hospitals. Clinical, laboratory, radiologic, and pathologic data were collected, and genetic testing for UMOD, MUC1, REN, and HNF1B was performed. Hyperuricemia, ultrasound findings, renal histology, genetic mutations. Age at ESRD, rate of decline in estimated glomerular filtration rate. ADTKD was diagnosed in 25 families (45%), 9 carried UMOD pathogenic variants (41 affected members), and 16 carried the MUC1 pathogenic mutation c.(428)dupC (90 affected members). No pathogenic variants were identified in REN or HNF1B. Among the 77 individuals who developed ESRD, median age at onset of ESRD was 51 years for those with ADTKD-MUC1 versus 56 years (P=0.1) for those with ADTKD-UMOD. Individuals with the MUC1 duplication presented higher risk for developing ESRD (HR, 2.24; P=0.03). The slope of decline in estimated glomerular filtration rate showed no significant difference between groups (-3.0mL/min/1.73m 2 per year in the ADTKD-UMOD group versus -3.9mL/min/1.73m 2 per year in the ADTKD-MUC1 group; P=0.2). The prevalence of hyperuricemia was significantly higher in individuals with ADTKD-UMOD (87% vs 54%; P=0.006). Although gout occurred more frequently in this group, the difference was not statistically significant (24% vs 7%; P=0.07). Relatively small Spanish cohort. MUC1 analysis limited to cytosine duplication. The main genetic cause of ADTKD in our Spanish cohort is the MUC1 pathogenic mutation c.(428)dupC. Renal survival may be worse in individuals with the MUC1 mutation than in those with UMOD mutations. Clinical presentation does not permit distinguishing between these variants. However, hyperuricemia and gout are more frequent in individuals

  2. Characteristics of Intracranial Aneurysms in the Else Kröner-Fresenius Registry of Autosomal Dominant Polycystic Kidney Disease

    Science.gov (United States)

    Neumann, Hartmut P.H.; Malinoc, Angelica; Bacher, Janina; Nabulsi, Zinaida; Ivanovas, Vera; Bruechle, Nadine Ortiz; Mader, Irina; Hoffmann, Michael M.; Riegler, Peter; Kraemer-Guth, Annette; Burchardi, Christian; Schaeffner, Elke; Martin, Rodolfo S.; Azurmendi, Pablo J.; Zerres, Klaus; Jilg, Cordula; Eng, Charis; Gläsker, Sven

    2012-01-01

    Background Patients who harbor intracranial aneurysms (IAs) run a risk for aneurysm rupture and subsequent subarachnoid hemorrhage which frequently results in permanent deficits or death. Prophylactic treatment of unruptured aneurysms is possible and recommended depending on the size and location of the aneurysm as well as patient age and condition. IAs are major manifestations of autosomal dominant polycystic kidney disease (ADPKD). Current guidelines do not suggest surveillance of IAs in ADPKD except in the setting of family history if IA was known in any relative with ADPKD. Management of IAs in ADPKD is problematic because limited data exist from large studies. Methods We established the Else Kröner-Fresenius Registry for ADPKD in Germany. Clinical data were assessed for age at diagnosis of IAs, stage of renal insufficiency, and number, location and size of IAs as well as family history of cerebral events. Patients with symptomatic or asymptomatic IAs were included. All patients with ADPKD-related IAs were offered mutation scanning of the susceptibility genes for ADPKD, the PKD1 and PKD2 genes. Results Of 463 eligible ADPKD patients from the population base of Germany, 32 (7%) were found to have IAs, diagnosed at the age of 2–71 years, 19 females and 13 males. Twenty (63%) of these 32 patients were symptomatic, whereas IAs were detected in an asymptomatic stage in 12 patients. IAs were multifocal in 12 and unifocal in 20 patients. In 26 patients (81%), IAs were diagnosed before end-stage renal failure. Twenty-five out of 27 unrelated index cases (93%) had no IAs or cerebral events documented in their relatives with ADPKD. In 16 unrelated index patients and 3 relatives, we detected germline mutations. The mutations were randomly distributed across the PKD1 gene in 14 and the PKD2 gene in 2 index cases. Questionnaires answered for 320/441 ADPKD patients without IAs revealed that only 45/320 (14%) had MR angiography. Conclusion In ADPKD, rupture of IAs occurs

  3. Characteristics of Intracranial Aneurysms in the Else Kröner-Fresenius Registry of Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Hartmut P.H. Neumann

    2012-10-01

    Full Text Available Background: Patients who harbor intracranial aneurysms (IAs run a risk for aneurysm rupture and subsequent subarachnoid hemorrhage which frequently results in permanent deficits or death. Prophylactic treatment of unruptured aneurysms is possible and recommended depending on the size and location of the aneurysm as well as patient age and condition. IAs are major manifestations of autosomal dominant polycystic kidney disease (ADPKD. Current guidelines do not suggest surveillance of IAs in ADPKD except in the setting of family history if IA was known in any relative with ADPKD. Management of IAs in ADPKD is problematic because limited data exist from large studies. Methods: We established the Else Kröner-Fresenius Registry for ADPKD in Germany. Clinical data were assessed for age at diagnosis of IAs, stage of renal insufficiency, and number, location and size of IAs as well as family history of cerebral events. Patients with symptomatic or asymptomatic IAs were included. All patients with ADPKD-related IAs were offered mutation scanning of the susceptibility genes for ADPKD, the PKD1 and PKD2 genes. Results: Of 463 eligible ADPKD patients from the population base of Germany, 32 (7% were found to have IAs, diagnosed at the age of 2–71 years, 19 females and 13 males. Twenty (63% of these 32 patients were symptomatic, whereas IAs were detected in an asymptomatic stage in 12 patients. IAs were multifocal in 12 and unifocal in 20 patients. In 26 patients (81%, IAs were diagnosed before end-stage renal failure. Twenty-five out of 27 unrelated index cases (93% had no IAs or cerebral events documented in their relatives with ADPKD. In 16 unrelated index patients and 3 relatives, we detected germline mutations. The mutations were randomly distributed across the PKD1 gene in 14 and the PKD2 gene in 2 index cases. Questionnaires answered for 320/441 ADPKD patients without IAs revealed that only 45/320 (14% had MR angiography. Conclusion: In ADPKD

  4. Diagnostic Algorithm in the Management of Acute Febrile Abdomen in Patients with Autosomal Dominant Polycystic Kidney Disease.

    Science.gov (United States)

    Neuville, Marie; Hustinx, Roland; Jacques, Jessica; Krzesinski, Jean-Marie; Jouret, François

    2016-01-01

    Acute febrile abdomen represents a diagnostic challenge in patients with autosomal dominant polycystic kidney disease (ADPKD). Although criteria have been proposed for cyst infection (CyI) and hemorrhage (CyH), there is a lack of comparative assessments. Furthermore, distinguishing cystic from non-cystic complications remains problematic. ADPKD patients presenting with abdominal pain and/or fever between 01/2005 and 06/2015 were retrospectively identified in a systematic computerized billing database. CyH was defined as spontaneous intracystic density above 50 Hounsfield units on computed tomography (CT). CyI was definite if confirmed by cyst puncture, and probable if 4 criteria were met: 3-day fever, loin/liver tenderness, C-reactive protein (CRP) plasma levels >50mg/L and no CT evidence for CyH. Other episodes were grouped as inflammation of unknown origin (IUO). Among a cohort of 173 ADPKD patients, 101 presented with 205 episodes of abdominal pain (n = 172) and/or fever (n = 33). 20 patients experienced 30 CyH, whereas 16 presented 23 episodes of definite (n = 11) or probable (n = 12) CyI. 35 IUO were observed in 31 patients. Clinically, fever was observed in 7% vs. 100% vs. 66% of CyH, CyI and IUO, respectively. Biologically, CRP cut-off at 70 mg/dl showed 92% sensitivity and 81% specificity in CyI diagnosis. Urine or blood cultures remained sterile in >90% of CyH, but were contributive in 53.4% of CyI and IUO, with a 74.2% prevalence for E. coli. Radiologically, ultrasounds, CT and magnetic resonance diagnosed CyI in 2.6%, 20% and 16.7% of cases, respectively. 18F-FDG positron-emission tomography (PET)/CT was done within a median period of 7 days post antibiotics, and significantly changed patient management in 71.4%. This retrospective single-center series underscores the usefulness of clinical-fever-and biological-CRP-parameters, but emphasizes the limitations of bacteriological and radiological investigations in cases of acute febrile abdomen in ADPKD

  5. Functional characteristics of three new germline mutations of the thyrotropin receptor gene causing autosomal dominant toxic thyroid hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Tonacchera, M.; Van Sande, J.; Cetani, F. [Universite Libre de Bruxelles, Brussels (Belgium)] [and others

    1996-02-01

    We report three unrelated families in which hyperthyroidism associated with thyroid hyperplasia was transmitted in an autosomal dominant fashion, in the absence of signs of autoimmunity. Exon 10 of the TSH receptor gene was directly sequenced after PCR amplification from DNA of peripheral leukocytes. In one family, a C to A transversion resulted in an S505R substitution in the third transmembrane segment; in the second, an A to T transversion caused an N650Y substitution in the sixth transmembrane segment; and in the third family, an A to G transition resulted in an N670S substitution in the seventh transmembrane segment. When expressed by transfection in COS-7 cells, each mutated receptor displayed an increase in constitutive stimulation of cAMP production; no effect on basal accumulation of inositol phosphates (IP) could be detected. In binding studies, cells transfected with wild-type of mutated receptors showed similar levels of expression, with the mutated receptors displaying similar or slightly increased affinity for bovine TSH (bTSH) binding. Cells transfected with S505R and N650Y mutants showed a similar cAMP maximal TSH-stimulated accumulation over the cells transfected with the wild type, whereas N670S transfectants showed a blunted response with an increase in EC{sub 50}. A higher IP response to 100 mU/mL bTSH over that obtained with the wild-type receptor was obtained in cells transfected with N650Y; in contrast, cells transfected with S505R showed a blunted IP production (50% less), and the N670S mutant completely lost the ability to stimulate IP accumulation in response to bTSH. The differential effects of individual mutations on stimulation by bTSH of cAMP or IP accumulation suggest that individual mutant receptors may achieve different active conformations with selective abilities to couple to G{sub s}{alpha} and to G{sub q}{alpha}. 17 refs., 8 figs.

  6. Mitochondrial myopathies.

    Science.gov (United States)

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  7. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    African Journals Online (AJOL)

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  8. A novel missense variant (Gln220Arg) of GNB4 encoding guanine nucleotide-binding protein, subunit beta-4 in a Japanese family with autosomal dominant motor and sensory neuropathy.

    Science.gov (United States)

    Miura, Shiroh; Morikawa, Takuya; Fujioka, Ryuta; Noda, Kazuhito; Kosaka, Kengo; Taniwaki, Takayuki; Shibata, Hiroki

    2017-09-01

    Dominant intermediate Charcot-Marie-Tooth disease F (CMTDIF) is an autosomal dominant hereditary form of Charcot-Marie-Tooth disease (CMT) caused by variations in the guanine nucleotide-binding protein, subunit beta-4 gene (GNB4). We examined two Japanese familial cases with CMT. Case 1 was a 49-year-old male whose chief complaint was slowly progressive gait disturbance and limb dysesthesia that appeared at the age of 47. On neurological examination, he showed hyporeflexia or areflexia, distal limb muscle weakness, and distal sensory impairment with lower dominancy. Nerve conduction studies demonstrated demyelinating sensorimotor neuropathy with reduced action potentials in the lower limbs. Case 2 was an 80-year-old man, Case 1's father, who reported difficulty in riding a bicycle at the age of 76. On neurological examination, he showed areflexia in the upper and lower limbs. Distal sensory impairment in the lower limbs was also observed. Nerve conduction studies revealed mainly axonal involvement. Exome sequencing identified a novel heterozygous nonsynonymous variant (NM_021629.3:c.659T > C [p.Gln220Arg]) in GNB4 exon 8, which is known to be responsible for CMT. Sanger sequencing confirmed that both patients are heterozygous for the variation, which causes an amino acid substitution, Gln220Arg, in the highly conserved region of the WD40 domain of GNB4. The frequency of this variant in the Exome Aggregation Consortium Database was 0.000008247, and we confirmed its absence in 502 Japanese control subjects. We conclude that this novel GNB4 variant is causative for CMTDIF in these patients, who represent the first record of the disease in the Japanese population. Copyright © 2017. Published by Elsevier Masson SAS.

  9. Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

    International Nuclear Information System (INIS)

    Back, Susan J.; Andronikou, Savvas; Kilborn, Tracy; Kaplan, Bernard S.; Darge, Kassa

    2015-01-01

    Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

  10. Imaging features of tuberous sclerosis complex with autosomal-dominant polycystic kidney disease: a contiguous gene syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Back, Susan J. [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); Andronikou, Savvas [University of the Witwatersrand, Radiology Department, Faculty of Health Sciences, Johannesburg (South Africa); Kilborn, Tracy [University of Cape Town, Red Cross War Memorial Children' s Hospital, Cape Town (South Africa); Kaplan, Bernard S. [The Children' s Hospital of Philadelphia, Division of Nephrology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States); Darge, Kassa [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States); University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA (United States)

    2015-03-01

    Genes for tuberous sclerosis complex (TSC) type 2 and autosomal-dominant polycystic kidney disease (ADPKD) type 1 are both encoded over a short segment of chromosome 16. When deletions involve both genes, an entity known as the TSC2/ADPKD1 contiguous gene syndrome, variable phenotypes of TSC and ADPKD are exhibited. This syndrome has not been reviewed in the radiology literature. Unlike renal cysts in TSC, cystic disease in TSC2/ADPKD1 contiguous gene syndrome results in hypertension and renal failure. A radiologist might demonstrate polycystic kidney disease before the patient develops other stigmata of TSC. Conversely, in patients with known TSC, enlarged and polycystic kidneys should signal the possibility of the TSC2/ADPKD1 contiguous gene syndrome and not simply TSC. Distinguishing these diagnoses has implications in prognosis, treatment and genetic counseling. To describe the clinical and imaging findings of tuberous sclerosis complex and polycystic kidney disease in seven pediatric patients. We retrospectively reviewed renal and brain imaging of children and young adults with genetically proven or high clinical suspicion for TSC2/ADPKD1 contiguous gene syndrome. We included seven pediatric patients from two referral institutions. Ages ranged from birth to 21 years over the course of imaging. The mean follow-up period was 9 years 8 months (4 years 6 months to 20 years 6 months). No child progressed to end-stage renal disease during this period. Three patients were initially imaged for stigmata of TSC, three for abdominal distension and one for elevated serum creatinine concentration. All patients developed enlarged, polycystic kidneys. The latest available imaging studies demonstrated that in 12 of the 14 kidneys 50% or more of the parenchyma was ultimately replaced by >15 cysts, resulting in significant cortical thinning. The largest cysts in each kidney ranged from 2.4 cm to 9.3 cm. Echogenic lesions were present in 13 of the 14 kidneys, in keeping with

  11. [Metabolic myopathies].

    Science.gov (United States)

    Papazian, Óscar; Rivas-Chacón, Rafael

    2013-09-06

    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  12. POU4F3 mutation screening in Japanese hearing loss patients: Massively parallel DNA sequencing-based analysis identified novel variants associated with autosomal dominant hearing loss.

    Directory of Open Access Journals (Sweden)

    Tomohiro Kitano

    Full Text Available A variant in a transcription factor gene, POU4F3, is responsible for autosomal dominant nonsyndromic hereditary hearing loss, DFNA15. To date, 14 variants, including a whole deletion of POU4F3, have been reported to cause HL in various ethnic groups. In the present study, genetic screening for POU4F3 variants was carried out for a large series of Japanese hearing loss (HL patients to clarify the prevalence and clinical characteristics of DFNA15 in the Japanese population. Massively parallel DNA sequencing of 68 target candidate genes was utilized in 2,549 unrelated Japanese HL patients (probands to identify genomic variations responsible for HL. The detailed clinical features in patients with POU4F3 variants were collected from medical charts and analyzed. Novel 12 POU4F3 likely pathogenic variants (six missense variants, three frameshift variants, and three nonsense variants were successfully identified in 15 probands (2.5% among 602 families exhibiting autosomal dominant HL, whereas no variants were detected in the other 1,947 probands with autosomal recessive or inheritance pattern unknown HL. To obtain the audiovestibular configuration of the patients harboring POU4F3 variants, we collected audiograms and vestibular symptoms of the probands and their affected family members. Audiovestibular phenotypes in a total of 24 individuals from the 15 families possessing variants were characterized by progressive HL, with a large variation in the onset age and severity with or without vestibular symptoms observed. Pure-tone audiograms indicated the most prevalent configuration as mid-frequency HL type followed by high-frequency HL type, with asymmetry observed in approximately 20% of affected individuals. Analysis of the relationship between age and pure-tone average suggested that individuals with truncating variants showed earlier onset and slower progression of HL than did those with non-truncating variants. The present study showed that variants

  13. Autosomal dominant familial neurohypophyseal diabetes insipidus caused by a mutation in the arginine-vasopressin II gene in four generations of a Korean family

    Directory of Open Access Journals (Sweden)

    Myo-Jing Kim

    2014-12-01

    Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.

  14. Genotype-phenotype correlation for DFNA22: characterization of non-syndromic, autosomal dominant, progressive sensorineural hearing loss due to MYO6 mutations

    DEFF Research Database (Denmark)

    Topsakal, Vedat; Hilgert, Nele; van Dinther, Joost

    2010-01-01

    Clinical and audiological examination was done in 2 Belgian families with autosomal dominant sensorineural hearing loss (SNHL) linked to DFNA22. Nineteen subjects in family 1 had mild to moderate SNHL starting in the third decade. The hearing loss was characterized by a flat audiogram affecting all......Hz. For all hitherto known DFNA22 families the audiological and clinical characteristics were correlated with the molecular data. This study describes the phenotype of 2 Belgian families with SNHL linked to DFNA22, both with a pathogenic change in the deafness gene MYO6. The phenotypes of all hitherto...

  15. Post transplant urinary tract infection in Autosomal dominant polycystic kidney disease a perpetual diagnostic dilema - 18-fluorodeoxyglucose - Positron emission computerized tomography - A valuable tool

    International Nuclear Information System (INIS)

    Sainaresh, VV; Jain, SH; Patel, HV; Shah, PR; Vanikar, AV; Trivedi, HL

    2011-01-01

    Urinary tract infection (UTI) is the most common infection contracted by renal allograft recipients. In patients of autosomal dominant polycystic kidney disease (ADPKD), cyst infection presents a complex diagnostic and therapeutic challenge especially in the post transplant period. Accurate diagnosis forms the cornerstone in salvaging the graft from potentially catastrophic outcome. We describe a case of xanthogranulomatous pyelonephritis (XPN) in the native kidney in a patient of post transplant ADPKD which presented as frequently relapsing UTI with graft dysfunction where in accurate diagnosis was made possible with the aid of 18-fluorodeoxyglucose (FDG) - Positron emission computerized tomography (PET/CT)

  16. Clinical proof-of-concept trial to assess the therapeutic effect of sirolimus in patients with autosomal dominant polycystic kidney disease: SUISSE ADPKD study

    Directory of Open Access Journals (Sweden)

    Wüthrich Rudolf P

    2007-09-01

    Full Text Available Abstract Background Currently there is no effective treatment available to retard cyst growth and to prevent the progression to end-stage renal failure in patients with autosomal dominant polycystic kidney disease (ADPKD. Evidence has recently been obtained from animal experiments that activation of the mammalian target of rapamycin (mTOR signaling pathway plays a crucial role in cyst growth and renal volume expansion, and that the inhibition of mTOR with rapamycin (sirolimus markedly slows cyst development and renal functional deterioration. Based on these promising results in animals we have designed and initiated the first randomized controlled trial (RCT to examine the effectiveness, safety and tolerability of sirolimus to retard disease progression in ADPKD. Method/design This single center, randomised controlled, open label trial assesses the therapeutic effect, safety and tolerability of the mTOR inhibitor sirolimus (Rapamune® in patients with autosomal dominant polycystic kidney disease and preserved renal function. The primary outcome will be the inhibition of kidney volume growth measured by magnetic resonance imaging (MRI volumetry. Secondary outcome parameters will be preservation of renal function, safety and tolerability of sirolimus. Discussion The results from this proof-of-concept RCT will for the first time show whether treatment with sirolimus effectively retards cyst growth in patients with ADPKD. Trial registration NCT00346918

  17. Mapping of the locus for autosomal dominant amelogenesis imperfecta (AIH2) to a 4-Mb YAC contig on chromosome 4q11-q21

    Energy Technology Data Exchange (ETDEWEB)

    Kaerrman, C.; Holmgren, G.; Forsman, K. [Univ. Hospital, Umea (Sweden)]|[Univ. of Umea (Sweden)] [and others

    1997-01-15

    Amelogenesis imperfecta (Al) is a clinically and genetically heterogeneous group of inherited enamel defects. We recently mapped a locus for autosomal dominant local hypoplastic amelogenesis imperfecta (AIH2) to the long arm of chromosome 4. The disease gene was localized to a 17.6-cM region between the markers D4S392 and D4S395. The albumin gene (ALB), located in the same interval, was a candidate gene for autosomal dominant AI (ADAI) since albumin has a potential role in enamel maturation. Here we describe refined mapping of the AIH2 locus and the construction of marker maps by radiation hybrid mapping and yeast artificial chromosome (YAC)-based sequence tagged site-content mapping. A radiation hybrid map consisting of 11 microsatellite markers in the 5-cM interval between D4S409 and D4S1558 was constructed. Recombinant haplotypes in six Swedish ADAI families suggest that the disease gene is located in the interval between D4S2421 and ALB. ALB is therefore not likely to be the disease-causing gene. Affected members in all six families share the same allele haplotypes, indicating a common ancestral mutation in all families. The AIH2 critical region is less than 4 cM and spans a physical distance of approximately 4 Mb as judged from radiation hybrid maps. A YAC contig over the AIH2 critical region including several potential candidate genes was constructed. 35 refs., 4 figs., 1 tab.

  18. Molecular and Genetic Studies of Congenital Myopathies

    Science.gov (United States)

    2018-03-21

    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  19. Examination of the presynaptic dopaminergic system using positron emission tomography in a family with autosomal dominant parkinsonism and dementia due to pallido-ponto-nigral degeneration (PPNO)

    International Nuclear Information System (INIS)

    Cordes, M.; Wszolek, Z.K.; Pfeiffer, R.F.; Calne, D.B.

    1993-01-01

    We report positron emission tomography (PET) examinations of presynaptic nigrostriatal dopaminergic function in a large family with an autosomal dominant neuro-degenerative disorder characterized pathologically by pallido-ponto-nigral degeneration, and clinically by parkinsonism, dystonia, paresis of conjugate gaze, apraxia of eyelid opening and closing, pyramidal tract dysfunction, and urinary incontinence. Dopaminergic function was studied and quantified with [ 18 F[-L-6-fluorodopa (6 FD) and PET in five affected patients, 13 individuals at-risk, and 15 similarly aged controls. The rate constant K i (mL/striatum/min) for 6 FD was decreased in all patients. None of the individuals at risk had reduced 6 FD uptake. In fact, three of them had increased values. Repeat scans have revealed a fall in 6 FD uptake in two out of the three with initially high constants. This may reflect a preclinical stage of involvement, but longer observation is necessary. (orig.) [de

  20. Changes in causes of death and risk of cancer in Danish patients with autosomal dominant polycystic kidney didease and end-stage renal disease

    DEFF Research Database (Denmark)

    Ørskov, Bjarne; Feldt-Rasmussen, Bo Friis; Strandgaard, Svend Valdemar

    2012-01-01

    Abstract Background. With the improved prognosis in patients with autosomal dominant polycystic kidney disease (ADPKD), causes of death and the risk of cancer might have changed. This was investigated in a Danish population with ADPKD and end-stage renal disease (ESRD) between 1 January 1993 and 31...... December 2008. Methods. Data were retrieved from three Danish national registries and a total of 823 patients were identified of which 431 had died during the study period. The 16 years were divided into two 8-year periods and the causes of death were divided into six categories: cancer, cardiovascular......, cerebrovascular, infection, other and unknown. Results. Cardiovascular disease was the major cause of death. A multivariate competing risk model comparing the two 8-year periods, adjusted for age at ESRD, gender and treatment modality, showed that deaths from cardiovascular disease decreased by 35% [hazard ratios...

  1. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    Directory of Open Access Journals (Sweden)

    Lise Bols Toustrup

    2017-03-01

    Full Text Available Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI is caused by variants in the arginine vasopressin (AVP gene. Here we report the generation of induced pluripotent stem cells (iPSCs from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using lentivirus-mediated nuclear reprogramming. The iPSCs carried the expected variant in the AVP gene. Furthermore, the iPSCs expressed pluripotency markers; displayed in vitro differentiation potential to the three germ layers and had a normal karyotype consistent with the original fibroblasts. This iPSC line is useful in future studies focusing on the pathogenesis of adFNDI.

  2. Changes in causes of death and risk of cancer in Danish patients with autosomal dominant polycystic kidney didease and end-stage renal disease

    DEFF Research Database (Denmark)

    Ørskov, Bjarne; Sørensen, Vibeke Rømming; Feldt-Rasmussen, Bo Friis

    2012-01-01

    Abstract Background. With the improved prognosis in patients with autosomal dominant polycystic kidney disease (ADPKD), causes of death and the risk of cancer might have changed. This was investigated in a Danish population with ADPKD and end-stage renal disease (ESRD) between 1 January 1993 and 31...... December 2008. Methods. Data were retrieved from three Danish national registries and a total of 823 patients were identified of which 431 had died during the study period. The 16 years were divided into two 8-year periods and the causes of death were divided into six categories: cancer, cardiovascular...... (HR) 0.65, P = 0.008] and deaths from cerebrovascular disease decreased by 69% (HR 0.31, P = 0.0003) from the first to the second time period. There were no significant changes between the time periods in death from cancer, infection, other or unknown. From the first to the second 8-year interval...

  3. Simultaneous Occurence of an Autosomal Dominant Inherited MSX1 Mutation and an X-linked Recessive Inherited EDA Mutation in One Chinese Family with Non-syndromic Oligodontia.

    Science.gov (United States)

    Zhang, Xiao Xia; Wong, Sing Wai; Han, Dong; Feng, Hai Lan

    2015-01-01

    To describe the simultaneous occurence of an autosomal dominant inherited MSX1 mutation and an X-linked recessive inherited EDA mutation in one Chinese family with nonsyndromic oligodontia. Clinical data of characteristics of tooth agenesis were collected. MSX1 and EDA gene mutations were detected in a Chinese family of non-syndromic oligodontia. Mild hypodontia in the parents and severe oligodontia in the son was recorded. A novel missense heterozygous mutation c.517C>A (p.Arg173Ser) was detected in the MSX1 gene in the boy and the father. A homozygous missense mutation c.1001G>A (p.Arg334His) was detected in the EDA gene in the boy and the same mutant occurred heterozygously in the mother. Simultaneous occurence of two different gene mutations with different inheritence patterns, which both caused oligodontia, which occurred in one subject and in one family, was reported.

  4. Autosomal dominant polycystic kidney disease and pain - a review of the disease from aetiology, evaluation, past surgical treatment options to current practice.

    Science.gov (United States)

    Badani, K K; Hemal, A K; Menon, M

    2004-01-01

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), often referred to as "adult" polycystic kidney disease, is one of the commonest hereditary disorders. It affects approximately 4 to 6 million individuals worldwide. The disease progresses to end-stage renal disease and it accounts for 10-15% of patients requiring dialysis in the United States. A comprehensive Medline search for aetiology, evaluation, screening, cellular biology, and treatment was utilized to locate, extract, and synthesize relevant data with respect to this topic. Special attention was focused on urologic literature and surgical textbooks regarding operative treatment of pain associated with ADPKD. Now, patients with ADPKD have more treatment options. More specifically, several therapeutic alternatives are now available for the management of pain in these patients. A recent review of literature supports the performance of open or laparoscopic cyst decortication procedures for control of pain and infection without the worry of causing further renal impairment in those with preserved renal function.

  5. Autosomal dominant precocious osteoarthropathy due to a mutation of the cartilage oligomeric matrix protein (COMP) gene: further expansion of the phenotypic variations of COMP defects

    Energy Technology Data Exchange (ETDEWEB)

    Kawaji, Hiroyuki [Department of Orthopaedic Surgery, Sanyudo Hospital, 6-1-219 Chuou, Yonezawa, Yamagata 992-0045 (Japan); Nishimura, Gen [Department of Radiology, Nasu Chuou Hospital, Tochigi (Japan); Watanabe, Sobei; Sasaki, Akira; Sano, Tokuhisa [Department of Orthopaedic Surgery, Tohoku Kohsei-Nenkin Hospital, Miyagi (Japan); Mabuchi, Akihiko; Ikeda, Toshiyuki; Ikegawa, Shiro [Laboratory for Bone and Joint Diseases, SNP Research Center, Tokyo (Japan); Ohashi, Hirofumi [Division of Medical Genetics, Saitama Children' s Medical Center, Saitama (Japan)

    2002-12-01

    We report on a Japanese family of four generations with an autosomal dominant precocious osteoarthropathy. The cardinal clinical manifestations of affected individuals were painful weight-bearing large joints, which started in late childhood or adolescence. The radiological hallmarks included coxa plana, mild epiphyseal dysplasia of the knee, and round talar domes with tibiotalar slant in childhood, which evolved into degenerative joint diseases in adulthood. The disease phenotype was cosegregated with a mutation of the cartilage oligomeric matrix protein (COMP) gene in the family members, who underwent molecular evaluation. COMP mutations have been reported in a mild form of multiple epiphyseal dysplasia (MED), Ribbing type, as well as allied disorders with more severe manifestations, such as MED Fairbank type and pseudoachondroplasia. Unlike previously reported cases with the Ribbing type, the present patients did not have short stature or brachydactyly. This report expands further the phenotypic variations of COMP defects. (orig.)

  6. Examination of the presynaptic dopaminergic system using positron emission tomography in a family with autosomal dominant parkinsonism and dementia due to pallido-ponto-nigral degeneration (PPNO)

    Energy Technology Data Exchange (ETDEWEB)

    Cordes, M. [Neurodegenerative Disorders Centre, Univ. of British Columbia, Vancouver, BC (Canada)]|[Strahlenklinik und Poliklinik, Universitaetsklinikum Rudolf Virchow, Freie Univ. Berlin (Germany); Wszolek, Z.K. [Neurodegenerative Disorders Centre, Univ. of British Columbia, Vancouver, BC (Canada)]|[Section of Neurology, Univ. of Nebraska Medical Center, Omaha, NE (United States); Pfeiffer, R.F. [Section of Neurology, Univ. of Nebraska Medical Center, Omaha, NE (United States); Calne, D.B. [Neurodegenerative Disorders Centre, Univ. of British Columbia, Vancouver, BC (Canada)

    1993-12-31

    We report positron emission tomography (PET) examinations of presynaptic nigrostriatal dopaminergic function in a large family with an autosomal dominant neuro-degenerative disorder characterized pathologically by pallido-ponto-nigral degeneration, and clinically by parkinsonism, dystonia, paresis of conjugate gaze, apraxia of eyelid opening and closing, pyramidal tract dysfunction, and urinary incontinence. Dopaminergic function was studied and quantified with [{sup 18}F]-L-6-fluorodopa (6 FD) and PET in five affected patients, 13 individuals at-risk, and 15 similarly aged controls. The rate constant K{sub i} (mL/striatum/min) for 6 FD was decreased in all patients. None of the individuals at risk had reduced 6 FD uptake. In fact, three of them had increased values. Repeat scans have revealed a fall in 6 FD uptake in two out of the three with initially high constants. This may reflect a preclinical stage of involvement, but longer observation is necessary. (orig.) [Deutsch] Wir berichten ueber Untersuchungen der praesynaptischen dopaminergen Funktion mit der Positronenemissionstomographie bei einer grossen Familie mit autosomal-dominant vererbtem Parkinsonismus und Demenz. Die Erkrankung ist pathologisch-anatomisch gekennzeichnet durch eine pallido-ponto-nigrale Degeneration. Klinisch bestehen ein Parkinsonismus, Dystonien, eine Apraxie der Augenoeffnung und -schliessung, pyramidale Dysfunktionen und eine Harninkontinenz. Die praesynaptische dopaminerge Funktion wurde untersucht und quantifiziert mittels [{sup 18}F]-L-6-Fluorodopa (6FD) PET bei fuenf erkrankten Patienten, 13 Risikopatienten und 15 Kontrollpersonen vergleichbaren Alters. Die Transportkonstante K{sub i} (ml/Striatum/min) fuer die striatale Aufnahme des Radiotracers war bei allen erkrankten Patienten erniedrigt. Von den 13 Risikopatienten hatte keiner eine reduzierte Aufnahme von 6FD. Drei Risikopatienten zeigten sogar Werte fuer K{sub i}, die oberhalb des Referenzbereiches der Kontrollpersonen lagen

  7. Autosomal dominant HMSN with proximal involvement: new Brazilian cases HMSN autossômica dominante com envolvimento proximal: novos casos brasileiros

    Directory of Open Access Journals (Sweden)

    Cristiane Borges Patroclo

    2009-09-01

    Full Text Available We report four Brazilian siblings with Autosomal Dominant Hereditary Motor Sensory Neuropathy with Proximal Dominant Involvement (HMSN-P, a rare form of HMSN, that was characterized by proximal dominant muscle weakness and atrophy onset after the age of 30 years, fasciculation, arreflexia and sensory disturbances with autosomal dominant inheritance. Electrophysiological study and sural nerve biopsy were in the accordance with axonal sensory motor polyneuropathy and laboratorial analysis disclosed serum lipids and muscle enzymes abnormalities. Our report is the first done by a group outside Japan, where the disease initially seemed to be restricted and stressed the phenotypic variability from the original report.Relatamos os casos de quatro irmãos brasileiros com Neuropatia Sensitivo Motora Hereditária com Envolvimento Proximal Dominante (HMSN-P, uma forma rara de HMSN caracterizada por fraqueza muscular de predomínio proximal e atrofia de instalação após os 30 anos, fasciculações, arreflexia, distúrbios sensitivos e padrão de herança autossômica dominante. Os estudos eletrofisiológicos e de biópsia do nervo sural confirmaram o diagnóstico de polineuropatia sensitivo-motora com padrão lesional axonal. Laboratorialmente foram constatadas anormalidades séricas no metabolismo lipídico e enzimas musculares. Nosso relato é o primeiro feito por um grupo fora do Japão, onde a doença parecia restrita até então e ressalta a variabilidade fenotípica apresentada nos casos Brasileiros.

  8. Targeted deletion of the Nesp55 DMR defines another Gnas imprinting control region and provides a mouse model of autosomal dominant PHP-Ib.

    Science.gov (United States)

    Fröhlich, Leopold F; Mrakovcic, Maria; Steinborn, Ralf; Chung, Ung-Il; Bastepe, Murat; Jüppner, Harald

    2010-05-18

    Approximately 100 genes undergo genomic imprinting. Mutations in fewer than 10 imprinted genetic loci, including GNAS, are associated with complex human diseases that differ phenotypically based on the parent transmitting the mutation. Besides the ubiquitously expressed Gsalpha, which is of broad biological importance, GNAS gives rise to an antisense transcript and to several Gsalpha variants that are transcribed from the nonmethylated parental allele. We previously identified two almost identical GNAS microdeletions extending from exon NESP55 to antisense (AS) exon 3 (delNESP55/delAS3-4). When inherited maternally, both deletions are associated with erasure of all maternal GNAS methylation imprints and autosomal-dominant pseudohypoparathyroidism type Ib, a disorder characterized by parathyroid hormone-resistant hypocalcemia and hyperphosphatemia. As for other imprinting disorders, the mechanisms resulting in abnormal GNAS methylation are largely unknown, in part because of a paucity of suitable animal models. We now showed in mice that deletion of the region equivalent to delNESP55/delAS3-4 on the paternal allele (DeltaNesp55(p)) leads to healthy animals without Gnas methylation changes. In contrast, mice carrying the deletion on the maternal allele (DeltaNesp55(m)) showed loss of all maternal Gnas methylation imprints, leading in kidney to increased 1A transcription and decreased Gsalpha mRNA levels, and to associated hypocalcemia, hyperphosphatemia, and secondary hyperparathyroidism. Besides representing a murine autosomal-dominant pseudohypoparathyroidism type Ib model and one of only few animal models for imprinted human disorders, our findings suggest that the Nesp55 differentially methylated region is an additional principal imprinting control region, which directs Gnas methylation and thereby affects expression of all maternal Gnas-derived transcripts.

  9. Autosomal dominant inheritance of brain cardiolipin fatty acid abnormality in VM/DK mice: association with hypoxic-induced cognitive insensitivity.

    Science.gov (United States)

    Ta, Nathan L; Jia, Xibei; Kiebish, Michael; Seyfried, Thomas N

    2014-01-01

    Cardiolipin is a complex polyglycerol phospholipid found almost exclusively in the inner mitochondrial membrane and regulates numerous enzyme activities especially those related to oxidative phosphorylation and coupled respiration. Abnormalities in cardiolipin can impair mitochondrial function and bioenergetics. We recently demonstrated that the ratio of shorter chain saturated and monounsaturated fatty acids (C16:0; C18:0; C18:1) to longer chain polyunsaturated fatty acids (C18:2; C20:4; C22:6) was significantly greater in the brains of adult VM/DK (VM) inbred mice than in the brains of C57BL/6 J (B6) mice. The cardiolipin fatty acid abnormalities in VM mice are also associated with alterations in the activity of mitochondrial respiratory complexes. In this study we found that the abnormal brain fatty acid ratio in the VM strain was inherited as an autosomal dominant trait in reciprocal B6 × VM F1 hybrids. To evaluate the potential influence of brain cardiolipin fatty acid composition on cognitive sensitivity, we placed the parental B6 and VM mice and their reciprocal male and female B6VMF1 hybrid mice (3-month-old) in a hypoxic chamber (5 % O2). Cognitive awareness (conscientiousness) under hypoxia was significantly lower in the VM parental mice and F1 hybrid mice (11.4 ± 0.4  and 11.0 ± 0.4 min, respectively) than in the parental B6 mice (15.3 ± 1.4 min), indicating an autosomal dominant inheritance like that of the brain cardiolipin abnormalities. These findings suggest that impaired cognitive awareness under hypoxia is associated with abnormalities in neural lipid composition.

  10. Dominant inherited distal spinal muscular atrophy with atrophic and hypertrophic calves

    NARCIS (Netherlands)

    Groen, R J; Sie, O G; van Weerden, T W

    The clinical, electrophysiological, radiological and morphological data of 3 members of a family with autosomal dominant distal spinal muscular atrophy (DSMA) are reported. One patient has the clinical picture of peroneal muscular atrophy with atrophic calves. His father and sister suffer from

  11. Atypical presentation of GNE myopathy with asymmetric hand weakness

    Science.gov (United States)

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

    2014-01-01

    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  12. Genetics Home Reference: distal myopathy 2

    Science.gov (United States)

    ... nasal. The weakness can also cause difficulty swallowing (dysphagia). Related Information What does it mean if a ... which is a chemical cousin of DNA. Some studies indicate that matrin 3 binds and stabilizes a ...

  13. Genetics Home Reference: Laing distal myopathy

    Science.gov (United States)

    ... resistant to fatigue. For example, muscles involved in posture, such as the neck muscles that hold the ... Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens ...

  14. Medical resource utilization and costs associated with autosomal dominant polycystic kidney disease in the USA: a retrospective matched cohort analysis of private insurer data

    Directory of Open Access Journals (Sweden)

    Knight T

    2015-02-01

    Full Text Available Tyler Knight,1 Caroline Schaefer,1 Holly Krasa,2 Dorothee Oberdhan,2 Arlene Chapman,3 Ronald D Perrone4 1Covance Market Access Services Inc., Gaithersburg, MD, 2Otsuka Pharmaceutical Development and Commercialization, Inc., Rockville, MD, 3Emory University, Atlanta, GA, 4Tufts Medical Center and Tufts University School of Medicine, Boston, MA, USA Background: Autosomal dominant polycystic kidney disease (ADPKD results in kidney cyst development and enlargement, resulting in chronic kidney disease (CKD leading to renal failure. This study sought to determine if ADPKD patients in the early stages of CKD contribute to a sizable economic burden for the US health care system. Methods: This was a retrospective, matched cohort study, reviewing medical resource utilization (MRU and costs for adults in a US private-payer claims database with a diagnosis code of ADPKD (ICD-9-CM 753.13. ADPKD patients were matched by age grouping (0–17, 18–34, 35–44, 45–54, 55–64, and 65+ years and sex to controls to understand the burden of ADPKD. Descriptive statistics on 6-month MRU and costs were assessed by CKD stages, dialysis use, or previous renal transplant. Results: The analysis included ADPKD patients in CKD stages 1–5 (n=316 to n=860, dialysis (n=586, and post-transplant (n=615. Mean ages did not differ across CKD stages (range 43–56 years. Men were the majority in the later stages but the minority in the early stages. The proportion of patients with at least one hospitalization increased with CKD stage, (12% to >40% CKD stage 2 to stage 5, dialysis or post-transplant. The majority had at least one hospital outpatient visit and at least one pharmacy claim. Total 6-month per-patient costs were greater among ADPKD patients than in age-matched and sex-matched healthy non-ADPKD controls (P<0.001 for all comparisons. Conclusion: ADPKD patients with normal kidney function are associated with a significant economic burden to the health care system

  15. Myopathy in acute hypothyroidism

    OpenAIRE

    Ma, JTC; Yu, YL; Kung, AWC

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  16. Myopathy in acute hypothyroidism.

    OpenAIRE

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  17. Genetics Home Reference: Miyoshi myopathy

    Science.gov (United States)

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  18. Recommendations for the use of tolvaptan in autosomal dominant polycystic kidney disease : a position statement on behalf of the ERA-EDTA Working Groups on Inherited Kidney Disorders and European Renal Best Practice

    NARCIS (Netherlands)

    Gansevoort, Ron T; Arici, Mustafa; Benzing, Thomas; Birn, Henrik; Capasso, Giovambattista; Covic, Adrian; Devuyst, Olivier; Drechsler, Christiane; Eckardt, Kai-Uwe; Emma, Francesco; Knebelmann, Bertrand; Le Meur, Yannick; Massy, Ziad A; Ong, Albert C M; Ortiz, Alberto; Schaefer, Franz; Torra, Roser; Vanholder, Raymond; Więcek, Andrzej; Zoccali, Carmine; Van Biesen, Wim

    Recently, the European Medicines Agency approved the use of the vasopressin V2 receptor antagonist tolvaptan to slow the progression of cyst development and renal insufficiency of autosomal dominant polycystic kidney disease (ADPKD) in adult patients with chronic kidney disease stages 1-3 at

  19. Hepatic Cyst Infection During Use of the Somatostatin Analog Lanreotide in Autosomal Dominant Polycystic Kidney Disease: An Interim Analysis of the Randomized Open-Label Multicenter DIPAK-1 Study

    NARCIS (Netherlands)

    Lantinga, M.A. (Marten A.); D’Agnolo, H.M.A. (Hedwig M. A.); E. Casteleijn (Eric); de Fijter, J.W. (Johan W.); E. Meijer (Esther); A.L. Messchendorp (A. Lianne); D. Peters (Dorien); M. Salih (Mahdi); E.M. Spithoven (Edwin); D. Soonawala (Darius); F.W. Visser (Folkert); Wetzels, J.F.M. (Jack F. M.); R. Zietse (Bob); J.P.H. Drenth (Joost); R.T. Gansevoort (Ron); Drenth, J.P.H.; J.W. de Fijter (Johan); Gansevoort, R.T.; D.J.M. Peters (Dorien J.M.); J.F.M. Wetzels (Jack); Zietse, R.

    2017-01-01

    textabstractIntroduction and Aims: The DIPAK-1 Study investigates the reno- and hepatoprotective efficacy of the somatostatin analog lanreotide compared with standard care in patients with later stage autosomal dominant polycystic kidney disease (ADPKD). During this trial, we witnessed several

  20. Changes in causes of death and risk of cancer in Danish patients with autosomal dominant polycystic kidney disease and end-stage renal disease.

    Science.gov (United States)

    Orskov, Bjarne; Sørensen, Vibeke Rømming; Feldt-Rasmussen, Bo; Strandgaard, Svend

    2012-04-01

    With the improved prognosis in patients with autosomal dominant polycystic kidney disease (ADPKD), causes of death and the risk of cancer might have changed. This was investigated in a Danish population with ADPKD and end-stage renal disease (ESRD) between 1 January 1993 and 31 December 2008. Data were retrieved from three Danish national registries and a total of 823 patients were identified of which 431 had died during the study period. The 16 years were divided into two 8-year periods and the causes of death were divided into six categories: cancer, cardiovascular, cerebrovascular, infection, other and unknown. Cardiovascular disease was the major cause of death. A multivariate competing risk model comparing the two 8-year periods, adjusted for age at ESRD, gender and treatment modality, showed that deaths from cardiovascular disease decreased by 35% [hazard ratios (HR) 0.65, P=0.008] and deaths from cerebrovascular disease decreased by 69% (HR 0.31, P=0.0003) from the first to the second time period. There were no significant changes between the time periods in death from cancer, infection, other or unknown. From the first to the second 8-year interval, the prevalence of cancer increased by 35% (P=0.0002) while the cancer incidence was stable. In Danish patients with ADPKD and ESRD, there was a significant reduction in cardiovascular and cerebrovascular deaths from 1993 to 2008. The prevalence of cancer increased without significant change in cancer incidence or deaths from cancer.

  1. RHO Mutations (p.W126L and p.A346P in Two Japanese Families with Autosomal Dominant Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Satoshi Katagiri

    2014-01-01

    Full Text Available Purpose. To investigate genetic and clinical features of patients with rhodopsin (RHO mutations in two Japanese families with autosomal dominant retinitis pigmentosa (adRP. Methods. Whole-exome sequence analysis was performed in ten adRP families. Identified RHO mutations for the cosegregation analysis were confirmed by Sanger sequencing. Ophthalmic examinations were performed to evaluate the RP phenotypes. The impact of the RHO mutation on the rhodopsin conformation was examined by molecular modeling analysis. Results. In two adRP families, we identified two RHO mutations (c.377G>T (p.W126L and c.1036G>C (p.A346P, one of which was novel. Complete cosegregation was confirmed for each mutation exhibiting the RP phenotype in both families. Molecular modeling predicted that the novel mutation (p.W126L might impair rhodopsin function by affecting its conformational transition in the light-adapted form. Clinical phenotypes showed that patients with p.W126L exhibited sector RP, whereas patients with p.A346P exhibited classic RP. Conclusions. Our findings demonstrated that the novel mutation (p.W126L may be associated with the phenotype of sector RP. Identification of RHO mutations is a very useful tool for predicting disease severity and providing precise genetic counseling.

  2. Rationale and design of the RESOLVE trial: lanreotide as a volume reducing treatment for polycystic livers in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gevers Tom JG

    2012-04-01

    Full Text Available Abstract Background A large proportion of patients with autosomal dominant polycystic kidney disease (ADPKD suffers from polycystic liver disease. Symptoms arise when liver volume increases. The somatostatin analogue lanreotide has proven to reduce liver volume in patients with polycystic liver disease. However, this study also included patients with isolated polycystic liver disease (PCLD. The RESOLVE trial aims to assess the efficacy of lanreotide treatment in ADPKD patients with symptomatic polycystic livers. In this study we present the design of the RESOLVE trial. Methods/design This open-label clinical trial evaluates the effect of 6 months of lanreotide in ADPKD patients with symptomatic polycystic livers. Primary outcome is change in liver volume determined by computerised tomography-volumetry. Secondary outcomes are changes in total kidney volume, kidney intermediate volume and renal function. Furthermore, urinary (NGAL, α1-microglobulin, KIM-1, H-FABP, MCP-1 and serum (fibroblast growth factor 23 biomarkers associated with ADPKD disease severity are assessed to investigate whether these biomarkers predict treatment responses to lanreotide. Moreover, safety and tolerability of the drug in ADPKD patients will be assessed. Discussion We anticipate that lanreotide is an effective therapeutic option for ADPKD patients with symptomatic polycystic livers and that this trial aids in the identification of patient related factors that predict treatment response. Trial registration number Clinical trials.gov NCT01354405

  3. Percutaneous Nephrolithotomy under Ultrasound Guidance in Patients with Renal Calculi and Autosomal Dominant Polycystic Kidney Disease: A Report of 11 Cases

    Directory of Open Access Journals (Sweden)

    Xiao Wang

    2017-01-01

    Full Text Available Nephrolithiasis accelerates the renal failure in the patients with ADPKD. In order to evaluate the role of percutaneous nephrolithotomy in management of calculus in these patients, 11 patients with autosomal dominant polycystic kidney disease and renal stones were included in the study. Two patients had bilateral renal stones. All patients were treated by percutaneous nephrolithotomy under ultrasound guidance. 13 percutaneous nephrolithotomy procedures were performed in 1 stage by the urology team under ultrasound guidance. 5 people received second operation with flexible nephroscopy in lateral position. The success rate and morbidity and mortality of the technique and hospital stay were recorded. Results. The puncture procedure was fully successful in all cases. The renal function improved in these patients. 5 patients had moderate fever after the surgery. 5 patients received flexible nephroscopy to take out the residual calculi. 2 persons had ESWL therapy after the surgery. Conclusion. PCNL is an ideal, safe, and effective method to remove the stones from those patients with no definite increase in the risk of complication. The outcome and stone-free rate are satisfactory comparable to the PCNL in the patients without ADPKD.

  4. Autosomal dominant Marfan-like connective-tissue disorder with aortic dilation and skeletal anomaslies not linked to the Fibrillin genes

    Energy Technology Data Exchange (ETDEWEB)

    Boileau, C.; Coulon, M.; Alexandre, J.-A.; Junien, C. (Laboratorie Central de Biochimie et de Genetique Moleculaire (France)); Jondeau, G.; Delorme, G.; Dubourg, O.; Bourdarias, J.-P. (CHU Ambroise Pare, Boulogne (France)); Babron, M.-C.; Bonaieti-Pellie, C. (INSERM, Chateau de Longchamp, Paris (France)); Sakai, L. (Shriners' Hospital for Crippled Children, Portland, OR (United States)); Melki, J. (Hopital Necker-Enfants Malades, Paris (France))

    1993-07-01

    The authors describe a large family with a connective-tissue disorder that exhibits some of the skeletal and cardiovascular features seen in Marfan syndrome. However, none of the 19 affected individuals displayed ocular abnormalities and therefore did not comply with recognized criteria for this disease. These patients could alternatively be diagnosed as MASS (mitral valve, aorta, skeleton, and skin) phenotype patients or represent a distinct clinical entity, i.e., a new autosomal dominant connective-tissue disorder. The fibrillin genes located on chromosomes 15 and 5 are clearly involved in the classic form of Marfan syndrome and a clinically related disorder (congenital contractural arachnodactyly), respectively. To test whether one of these genes was also implicated in this French family, the authors performed genetic analyses. Blood samples were obtained for 56 family members, and four polymorphic fibrillin gene markers, located on chromosomes 15 (Fib15) and 5 (Fib5), respectively, were tested. Linkage between the disease allele and the markers of these two genes was excluded with lod scores of [minus]11.39 (for Fib15) and [minus]13.34 (for Fib5), at 0 = .001, indicating that the mutation is at a different locus. This phenotype thus represents a new connective-tissue disorder, overlapping but different from classic Marfan syndrome. 33 refs., 1 fig. 2 tabs.

  5. Polysomnographic and neurometabolic features may mark preclinical autosomal dominant cerebellar ataxia, deafness, and narcolepsy due to a mutation in the DNA (cytosine-5-)-methyltransferase gene, DNMT1.

    Science.gov (United States)

    Moghadam, Keivan Kaveh; Pizza, Fabio; Tonon, Caterina; Lodi, Raffaele; Carelli, Valerio; Poli, Francesca; Franceschini, Christian; Barboni, Piero; Seri, Marco; Ferrari, Simona; La Morgia, Chiara; Testa, Claudia; Cornelio, Ferdinando; Liguori, Rocco; Winkelmann, Juliane; Lin, Ling; Mignot, Emmanuel; Plazzi, Giuseppe

    2014-05-01

    We aimed to report the clinical picture of two asymptomatic daughters of a patient with autosomal dominant cerebellar ataxia, deafness, and narcolepsy (ADCA-DN) due to a mutation in the DNA (cytosine-5-)-methyltransferase gene, DNMT1. Clinical assessment based on history, neurologic examination, sleep recordings, neurophysiologic neuroimaging, and genetic tests was performed. History and neurologic examination in both subjects were unremarkable. Genetic analysis disclosed in both the paternally-inherited heterozygous point mutation in the DNMT1 gene. Sleep recordings found sleep-onset rapid eye movement periods (SOREMPs) and proton magnetic resonance spectroscopy (MRS) revealed increased cerebellar myoinositol (mI) in both subjects. Auditory and ophthalmologic investigations as well as structural brain magnetic resonance imaging (MRI) scans revealed no abnormalities. The two asymptomatic carriers of the heterozygous DNMT1 mutation for ADCA-DN, a late-onset neurodegenerative disease, presented with SOREMPs associated with an increase of mI in the brain, a marker of glial cell activity and density characteristic of early stages of neurodegenerative diseases. Therefore, SOREMPs may precede the clinical picture of ADCA-DN as an early polysomnographic marker of central nervous system involvement detected by MRS. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Atypical Association of Ethmoidal Encephalocele and Hydrocephalus in an Adult Patient with Autosomal-Dominant Osteopetrosis Type I (ADO-I): A Case Report.

    Science.gov (United States)

    Rossini, Zefferino; Castellani, Carlotta; Borsa, Stefano; Carrabba, Giorgio; Locatelli, Marco; Di Cristofori, Andrea

    2016-05-01

    Osteopetroses are a heterogeneous group of heritable disorders characterized by increased bone density as the result of defective osteoclast-mediated bone resorption. The autosomal-dominant osteopetrosis type I (ADO-I) is defined by the presence of osteosclerosis involving mainly the skull bones, variably associated with compression of the foramina of cranial nerves and vascular structures, hypertelorism, exophthalmos, and less commonly with hydrocephalus, pseudotumor, and Chiari malformation type I. We describe an adult patient with ADO-I presenting with an atypical association of clinical manifestations that required a tailored management. On admission, the patient complained about chronic headache, recurrent sinusitis, and postnasal drip. Findings of the examination didn't show clear signs of increased intracranial pressure, whereas imaging studies revealed thickening of the skull bones and an unexpected fistula associated with anterior ethmoidal meningoencephalocele. Some days after endoscopic transnasal closure of the fistula, a severe hypertensive hydrocephalus developed, which required a prompt ventriculoperitoneal shunt placement, complicated by a diffuse subarachnoid hemorrhage. The 6-month follow-up showed complete recovery. After reviewing the literature, we can confirm that ours was the second case of an adult ADO-I patient associated with anterior ethmoidal meningoencephalocele, the first one needing a combined treatment of the encephalocele and hydrocephalus. Because ADO-I is a rare disease with a wide spectrum of clinical manifestations, our case can represent a prototype for the future management of similar cases. Copyright © 2016. Published by Elsevier Inc.

  7. Exome Sequencing Identifies a Missense Variant in EFEMP1 Co-Segregating in a Family with Autosomal Dominant Primary Open-Angle Glaucoma.

    Directory of Open Access Journals (Sweden)

    Donna S Mackay

    Full Text Available Primary open-angle glaucoma (POAG is a clinically important and genetically heterogeneous cause of progressive vision loss as a result of retinal ganglion cell death. Here we have utilized trio-based, whole-exome sequencing to identify the genetic defect underlying an autosomal dominant form of adult-onset POAG segregating in an African-American family. Exome sequencing identified a novel missense variant (c.418C>T, p.Arg140Trp in exon-5 of the gene coding for epidermal growth factor (EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1 that co-segregated with disease in the family. Linkage and haplotype analyses with microsatellite markers indicated that the disease interval overlapped a known POAG locus (GLC1H on chromosome 2p. The p.Arg140Trp substitution was predicted in silico to have damaging effects on protein function and transient expression studies in cultured cells revealed that the Trp140-mutant protein exhibited increased intracellular accumulation compared with wild-type EFEMP1. In situ hybridization of the mouse eye with oligonucleotide probes detected the highest levels of EFEMP1 transcripts in the ciliary body, cornea, inner nuclear layer of the retina, and the optic nerve head. The recent finding that a common variant near EFEMP1 was associated with optic nerve-head morphology supports the possibility that the EFEMP1 variant identified in this POAG family may be pathogenic.

  8. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  9. SPM analysis of brain perfusion SPECT and F-18 FDG PET in the Korean autosomal dominant nocturnal frontal lobe epilepsy family

    International Nuclear Information System (INIS)

    Won, Kyoung Sook; Zeon, Seok Kil

    2004-01-01

    This study attempted to investigate the specific pattern of brain perfusion and glucose metabolism in the Korean autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) family. Using Tc-99m ECD brain perfusion SPECT. we assessed brain perfusion in 6 patients at interictal period and 5 patients at ictal period. Interictal F-18 FDG PET was performed on 6 affected family members. The scans were statistically analyzed by using statistical parametric mapping (SPM99). The data of the affected family members were compared to those of the control subjects. Interictal F-18 FDG PET SPM group analysis showed decreased glucose metabolism over the left middle and superior frontal gyri and the left central regions including the anterior parietal lobe. There was a less pronounced decrease in glucose uptake in the right anterior superior frontal gyrus. Interictal brain perfusion SPECT SPM group analysis showed similar pattern of decreased perfusion compared to those of interictal F-18 FDG PET. Ictal brain perfusion SPECT SPM group analysis revealed increased perfusion over the left pre-and postcentral gyri and less pronounced increased perfusion in the right postcentral gyrus. lnterictal F -18 PET and brain perfusion SPECT SPM group analysis suggest that major abnormalities of ADNFLE family are in the left frontal lobe. These findings may be helpful to elucidate the pathophysiological mechanism of this rare disease entity

  10. A missense mutation in the alpha-actinin 1 gene (ACTN1 is the cause of autosomal dominant macrothrombocytopenia in a large French family.

    Directory of Open Access Journals (Sweden)

    Paul Guéguen

    Full Text Available Inherited thrombocytopenia is a heterogeneous group of disorders characterized by a reduced number of blood platelets. Despite the identification of nearly 20 causative genes in the past decade, approximately half of all subjects with inherited thrombocytopenia still remain unexplained in terms of the underlying pathogenic mechanisms. Here we report a six-generation French pedigree with an autosomal dominant mode of inheritance and the identification of its genetic basis. Of the 55 subjects available for analysis, 26 were diagnosed with isolated macrothrombocytopenia. Genome-wide linkage analysis mapped a 10.9 Mb locus to chromosome 14 (14q22 with a LOD score of 7.6. Candidate gene analysis complemented by targeted next-generation sequencing identified a missense mutation (c.137GA; p.Arg46Gln in the alpha-actinin 1 gene (ACTN1 that segregated with macrothrombocytopenia in this large pedigree. The missense mutation occurred within actin-binding domain of alpha-actinin 1, a functionally critical domain that crosslinks actin filaments into bundles. The evaluation of cultured mutation-harboring megakaryocytes by electron microscopy and the immunofluorescence examination of transfected COS-7 cells suggested that the mutation causes disorganization of the cellular cytoplasm. Our study concurred with a recently published whole-exome sequence analysis of six small Japanese families with congenital macrothrombocytopenia, adding ACTN1 to the growing list of thrombocytopenia genes.

  11. Autosomal dominant Carvajal plus syndrome due to the novel desmoplakin mutation c.1678A > T (p.Ile560Phe).

    Science.gov (United States)

    Finsterer, Josef; Stöllberger, Claudia; Wollmann, Eva; Dertinger, Susanne; Laccone, Franco

    2016-09-01

    Carvajal syndrome is an autosomal dominant or autosomal recessive disorder, manifesting with dilated cardiomyopathy, woolly hair, and palmoplantar keratoma. Additional manifestations can be occasionally found. Carvajal syndrome may be due to mutations in the desmocollin-2, desmoplakin, or plakophilin-2 gene. We report a family with Carvajal syndrome which additionally presented with hypoacusis, noncompaction, recurrent pharyngeal infections, oligodontia, and recurrent diarrhoea. Father and brother were also affected and had died suddenly, the father despite implantation of a cardioverter defibrillator (ICD). Genetic studies revealed the novel pathogenic mutation c.1678A > T in the desmoplakin gene resulting in the amino acid change Ile to Phe at position 560 in the index case and her brother. The index case underwent ICD implantation recently. Phenotypic manifestations of Carvajal syndrome are even broader than so far anticipated, the number of mutations in the desmoplakin gene responsible for Carvajal syndrome is still increasing, and these patients require implantation of an ICD as soon as their diagnosis is established.

  12. A novel T→G splice site mutation of CRYBA1/A3 associated with autosomal dominant nuclear cataracts in a Chinese family.

    Science.gov (United States)

    Yang, Zhenfei; Su, Dongmei; Li, Qian; Yang, Fan; Ma, Zicheng; Zhu, Siquan; Ma, Xu

    2012-01-01

    The purpose of this study was to identify the disease-causing mutation and the molecular phenotype that are responsible for the presence of an autosomal dominant congenital nuclear cataract disease in a Chinese family. The family history and clinical data were recorded. The patients were given a physical examination and their blood samples were collected for DNA extraction. Direct sequencing was used to detect the mutation. Transcription analysis of the mutant crystallin, beta A1 (CRYBA1/A3) gene was performed to verify whether the defective mutation had influenced the splice of the mature mRNA. The phenotype of the congenital cataract in the family was identified as a nuclear cataract type, by using slit-lamp photography. Direct sequencing revealed a novel mutation IVS3+2 T→G in CRYBA1/A3. This mutation co-segregated with all affected individuals in the family, but was not found in unaffected family members nor in the 100 unrelated controls. Transcription analysis of the mutant CRYBA1/A3 gene indicated that this mutation had influenced the splice of the mature mRNA. Our study identified a novel splice site mutation in CRYBA1/A3. This mutation was responsible for aberrant splicing of the mature mRNA and had caused the congenital nuclear cataracts in the family. This is the first report relating an IVS3+2 T→G mutation of CRYBA1/A3 to congenital cataracts.

  13. Feasibility of measuring renal blood flow by phase-contrast magnetic resonance imaging in patients with autosomal dominant polycystic kidney disease

    Energy Technology Data Exchange (ETDEWEB)

    Spithoven, E.M.; Meijer, E.; Boertien, W.E.; Gaillard, C.A.J.M.; Jong, P.E. de; Gansevoort, R.T. [University of Groningen, Department of Nephrology, Community and Occupational Medicine, University Medical Center Groningen, PO Box 30.001, RB Groningen (Netherlands); Borns, C.; Kappert, P.; Greuter, M.J.W.; Jagt, E. van der [University of Groningen, Department of Radiology, Community and Occupational Medicine, University Medical Center Groningen, Groningen (Netherlands); Vart, P. [University of Groningen, Department of Health Sciences, Community and Occupational Medicine, University Medical Center Groningen, Groningen (Netherlands)

    2016-03-15

    Renal blood flow (RBF) has been shown to predict disease progression in autosomal dominant polycystic kidney disease (ADPKD). We investigated the feasibility and accuracy of phase-contrast RBF by MRI (RBF{sub MRI}) in ADPKD patients with a wide range of estimated glomerular filtration rate (eGFR) values. First, we validated RBF{sub MRI} measurement using phantoms simulating renal artery hemodynamics. Thereafter, we investigated in a test-set of 21 patients intra- and inter-observer coefficient of variation of RBF{sub MRI}. After validation, we measured RBF{sub MRI} in a cohort of 91 patients and compared the variability explained by characteristics indicative for disease severity for RBF{sub MRI} and RBF measured by continuous hippuran infusion. The correlation in flow measurement using phantoms by phase-contrast MRI was high and fluid collection was high (CCC=0.969). Technical problems that precluded RBF{sub MRI} measurement occurred predominantly in patients with a lower eGFR (34% vs. 16%). In subjects with higher eGFRs, variability in RBF explained by disease characteristics was similar for RBF{sub MRI} compared to RBF{sub Hip,} whereas in subjects with lower eGFRs, this was significantly less for RBF{sub MRI}. Our study shows that RBF can be measured accurately in ADPKD patients by phase-contrast, but this technique may be less feasible in subjects with a lower eGFR. (orig.)

  14. Regional association of pCASL-MRI with FDG-PET and PiB-PET in people at risk for autosomal dominant Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Lirong Yan

    2018-01-01

    Full Text Available Autosomal dominant Alzheimer's disease (ADAD is a small subset of Alzheimer's disease that is genetically determined with 100% penetrance. It provides a valuable window into studying the course of pathologic processes that leads to dementia. Arterial spin labeling (ASL MRI is a potential AD imaging marker that non-invasively measures cerebral perfusion. In this study, we investigated the relationship of cerebral blood flow measured by pseudo-continuous ASL (pCASL MRI with measures of cerebral metabolism (FDG PET and amyloid deposition (Pittsburgh Compound B (PiB PET. Thirty-one participants at risk for ADAD (age 39±13 years, 19 females were recruited into this study, and 21 of them received both MRI and FDG and PiB PET scans. Considerable variability was observed in regional correlations between ASL-CBF and FDG across subjects. Both regional hypo-perfusion and hypo-metabolism were associated with amyloid deposition. Cross-sectional analyses of each biomarker as a function of the estimated years to expected dementia diagnosis indicated an inverse relationship of both perfusion and glucose metabolism with amyloid deposition during AD development. These findings indicate that neurovascular dysfunction is associated with amyloid pathology, and also indicate that ASL CBF may serve as a sensitive early biomarker for AD. The direct comparison among the three biomarkers provides complementary information for understanding the pathophysiological process of AD.

  15. SPM analysis of brain perfusion SPECT and F-18 FDG PET in the Korean autosomal dominant nocturnal frontal lobe epilepsy family

    Energy Technology Data Exchange (ETDEWEB)

    Won, Kyoung Sook; Zeon, Seok Kil [Keimyung University Dongsan Medical Center, Daegu (Korea, Republic of)

    2004-07-01

    This study attempted to investigate the specific pattern of brain perfusion and glucose metabolism in the Korean autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) family. Using Tc-99m ECD brain perfusion SPECT. we assessed brain perfusion in 6 patients at interictal period and 5 patients at ictal period. Interictal F-18 FDG PET was performed on 6 affected family members. The scans were statistically analyzed by using statistical parametric mapping (SPM99). The data of the affected family members were compared to those of the control subjects. Interictal F-18 FDG PET SPM group analysis showed decreased glucose metabolism over the left middle and superior frontal gyri and the left central regions including the anterior parietal lobe. There was a less pronounced decrease in glucose uptake in the right anterior superior frontal gyrus. Interictal brain perfusion SPECT SPM group analysis showed similar pattern of decreased perfusion compared to those of interictal F-18 FDG PET. Ictal brain perfusion SPECT SPM group analysis revealed increased perfusion over the left pre-and postcentral gyri and less pronounced increased perfusion in the right postcentral gyrus. lnterictal F -18 PET and brain perfusion SPECT SPM group analysis suggest that major abnormalities of ADNFLE family are in the left frontal lobe. These findings may be helpful to elucidate the pathophysiological mechanism of this rare disease entity.

  16. Autosomal Dominant Polycystic Kidney Disease

    Science.gov (United States)

    ... NIH Director Organization Budget History NIH Almanac Public Involvement Outreach & Education Visitor Information RePORT NIH Fact Sheets Home > Autosomal ... other than the observation that 50 percent of children born to an affected parent would develop the disease. Diagnosis of well-established ...

  17. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    NARCIS (Netherlands)

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

    2014-01-01

    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  18. [Descending ocular myopathy].

    Science.gov (United States)

    de Freitas, M R; Nascimento, O J

    1975-06-01

    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  19. Feasibility of measuring renal blood flow by phase-contrast magnetic resonance imaging in patients with autosomal dominant polycystic kidney disease.

    Science.gov (United States)

    Spithoven, E M; Meijer, E; Borns, C; Boertien, W E; Gaillard, C A J M; Kappert, P; Greuter, M J W; van der Jagt, E; Vart, P; de Jong, P E; Gansevoort, R T

    2016-03-01

    Renal blood flow (RBF) has been shown to predict disease progression in autosomal dominant polycystic kidney disease (ADPKD). We investigated the feasibility and accuracy of phase-contrast RBF by MRI (RBFMRI) in ADPKD patients with a wide range of estimated glomerular filtration rate (eGFR) values. First, we validated RBFMRI measurement using phantoms simulating renal artery hemodynamics. Thereafter, we investigated in a test-set of 21 patients intra- and inter-observer coefficient of variation of RBFMRI. After validation, we measured RBFMRI in a cohort of 91 patients and compared the variability explained by characteristics indicative for disease severity for RBFMRI and RBF measured by continuous hippuran infusion. The correlation in flow measurement using phantoms by phase-contrast MRI was high and fluid collection was high (CCC=0.969). Technical problems that precluded RBFMRI measurement occurred predominantly in patients with a lower eGFR (34% vs. 16%). In subjects with higher eGFRs, variability in RBF explained by disease characteristics was similar for RBFMRI compared to RBFHip, whereas in subjects with lower eGFRs, this was significantly less for RBFMRI. Our study shows that RBF can be measured accurately in ADPKD patients by phase-contrast, but this technique may be less feasible in subjects with a lower eGFR. Renal blood flow (RBF) can be accurately measured by phase-contrast MRI in ADPKD patients. RBF measured by phase-contrast is associated with ADPKD disease severity. RBF measurement by phase-contrast MRI may be less feasible in patients with an impaired eGFR.

  20. Identification of Two Disease-causing Genes TJP2 and GJB2 in a Chinese Family with Unconditional Autosomal Dominant Nonsyndromic Hereditary Hearing Impairment

    Directory of Open Access Journals (Sweden)

    Hong-Yang Wang

    2015-01-01

    Full Text Available Background: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI, including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI. Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI. Methods: To decipher the genetic code of a Chinese family (family 686 with ADNSHHI, different gene screening techniques have been performed, including linkage analysis, candidate genes screening, high-throughput sequencing and Sanger sequencing. These techniques were done on samples obtained from this family over a period of 10 years. Results: We identified a pathogenic missense mutation, c. 2081G>A (p.G694E, in TJP2, a gene that plays a crucial role in apoptosis and age-related hearing loss (ARHL. The mutation was co-segregated in this pedigree in all, but not in the two patients who presented with different phenotypes from the other affected family members. In one of the two patients, we confirmed that the compound heterozygosity for p.Y136FNx01 and p.G45E in the GJB2 gene may account for the phenotype shown in this patient. Conclusions: We identified the co-occurrence of two genetic causes in family 686. The possible disease-causing missense mutation of TJP2 in family 686 presents an opportunity for further investigation into ARHL. It is necessary to combine various genes screening methods, especially for some unconventional cases.

  1. Three novel and the common Arg677Ter RP1 protein truncating mutations causing autosomal dominant retinitis pigmentosa in a Spanish population

    Directory of Open Access Journals (Sweden)

    Antiñolo Guillermo

    2006-04-01

    Full Text Available Abstract Background Retinitis pigmentosa (RP, a clinically and genetically heterogeneous group of retinal degeneration disorders affecting the photoreceptor cells, is one of the leading causes of genetic blindness. Mutations in the photoreceptor-specific gene RP1 account for 3–10% of cases of autosomal dominant RP (adRP. Most of these mutations are clustered in a 500 bp region of exon 4 of RP1. Methods Denaturing gradient gel electrophoresis (DGGE analysis and direct genomic sequencing were used to evaluate the 5' coding region of exon 4 of the RP1 gene for mutations in 150 unrelated index adRP patients. Ophthalmic and electrophysiological examination of RP patients and relatives according to pre-existing protocols were carried out. Results Three novel disease-causing mutations in RP1 were detected: Q686X, K705fsX712 and K722fsX737, predicting truncated proteins. One novel missense mutation, Thr752Met, was detected in one family but the mutation does not co-segregate in the family, thereby excluding this amino acid variation in the protein as a cause of the disease. We found the Arg677Ter mutation, previously reported in other populations, in two independent families, confirming that this mutation is also present in a Spanish population. Conclusion Most of the mutations reported in the RP1 gene associated with adRP are expected to encode mutant truncated proteins that are approximately one third or half of the size of wild type protein. Patients with mutations in RP1 showed mild RP with variability in phenotype severity. We also observed several cases of non-penetrant mutations.

  2. Live Donor Renal Transplant With Simultaneous Bilateral Nephrectomy for Autosomal Dominant Polycystic Kidney Disease Is Feasible and Satisfactory at Long-term Follow-up.

    Science.gov (United States)

    Ahmad, Sarwat B; Inouye, Brian; Phelan, Michael S; Kramer, Andrew C; Sulek, Jay; Weir, Matthew R; Barth, Rolf N; LaMattina, John C; Schweitzer, Eugene J; Leeser, David B; Niederhaus, Silke V; Bartlett, Stephen T; Bromberg, Jonathan S

    2016-02-01

    Timing of bilateral nephrectomy (BN) is controversial in patients with refractory symptoms of autosomal dominant polycystic kidney disease (APKD) in need of a renal transplant. Adults who underwent live donor renal transplant (LRT) + simultaneous BN (SBN) from August 2003 to 2013 at a single transplant center (n = 66) were retrospectively compared to a matched group of APKD patients who underwent LRT alone (n = 52). All patients received general health and polycystic kidney symptom surveys. Simultaneous BN increased operative duration, estimated blood loss, transfusions, intravenous fluid, and hospital length of stay. Most common indications for BN were pain, loss of abdominal domain, and early satiety. There were more intraoperative complications for LRT + SBN (6 vs 0, P = 0.03; 2 vascular, 2 splenic, and 1 liver injury; 1 reexploration to adjust graft positioning). There were no differences in Clavien-Dindo grade I or II (39% vs 25%, P = 0.12) or grade III or IV (7.5% vs 5.7%, P = 1.0) complications during the hospital course. There were no surgery-related mortalities. There were no differences in readmission rates (68% vs 48%, P = 0.19) or readmissions requiring procedures (25% vs. 20%, P = 0.51) over 12 months. One hundred percent of LRT + SBN allografts functioned at longer than 1 year for those available for follow-up. Survey response rate was 40% for LRT-alone and 56% for LRT + SBN. One hundred percent of LRT + SBN survey responders were satisfied with their choice of having BN done simultaneously. Excellent outcomes for graft survival, satisfaction, and morbidity suggest that the combined operative approach be preferred for patients with symptomatic APKD to avoid multiple procedures, dialysis, and costs of staged operations.

  3. Profiling conserved biological pathways in Autosomal Dominant Polycystic Kidney Disorder (ADPKD) to elucidate key transcriptomic alterations regulating cystogenesis: A cross-species meta-analysis approach.

    Science.gov (United States)

    Chatterjee, Shatakshee; Verma, Srikant Prasad; Pandey, Priyanka

    2017-09-05

    Initiation and progression of fluid filled cysts mark Autosomal Dominant Polycystic Kidney Disease (ADPKD). Thus, improved therapeutics targeting cystogenesis remains a constant challenge. Microarray studies in single ADPKD animal models species with limited sample sizes tend to provide scattered views on underlying ADPKD pathogenesis. Thus we aim to perform a cross species meta-analysis to profile conserved biological pathways that might be key targets for therapy. Nine ADPKD microarray datasets on rat, mice and human fulfilled our study criteria and were chosen. Intra-species combined analysis was performed after considering removal of batch effect. Significantly enriched GO biological processes and KEGG pathways were computed and their overlap was observed. For the conserved pathways, biological modules and gene regulatory networks were observed. Additionally, Gene Set Enrichment Analysis (GSEA) using Molecular Signature Database (MSigDB) was performed for genes found in conserved pathways. We obtained 28 modules of significantly enriched GO processes and 5 major functional categories from significantly enriched KEGG pathways conserved in human, mice and rats that in turn suggest a global transcriptomic perturbation affecting cyst - formation, growth and progression. Significantly enriched pathways obtained from up-regulated genes such as Genomic instability, Protein localization in ER and Insulin Resistance were found to regulate cyst formation and growth whereas cyst progression due to increased cell adhesion and inflammation was suggested by perturbations in Angiogenesis, TGF-beta, CAMs, and Infection related pathways. Additionally, networks revealed shared genes among pathways e.g. SMAD2 and SMAD7 in Endocytosis and TGF-beta. Our study suggests cyst formation and progression to be an outcome of interplay between a set of several key deregulated pathways. Thus, further translational research is warranted focusing on developing a combinatorial therapeutic

  4. Medical resource utilization and costs associated with autosomal dominant polycystic kidney disease in the USA: a retrospective matched cohort analysis of private insurer data

    Science.gov (United States)

    Knight, Tyler; Schaefer, Caroline; Krasa, Holly; Oberdhan, Dorothee; Chapman, Arlene; Perrone, Ronald D

    2015-01-01

    Background Autosomal dominant polycystic kidney disease (ADPKD) results in kidney cyst development and enlargement, resulting in chronic kidney disease (CKD) leading to renal failure. This study sought to determine if ADPKD patients in the early stages of CKD contribute to a sizable economic burden for the US health care system. Methods This was a retrospective, matched cohort study, reviewing medical resource utilization (MRU) and costs for adults in a US private-payer claims database with a diagnosis code of ADPKD (ICD-9-CM 753.13). ADPKD patients were matched by age grouping (0–17, 18–34, 35–44, 45–54, 55–64, and 65+ years) and sex to controls to understand the burden of ADPKD. Descriptive statistics on 6-month MRU and costs were assessed by CKD stages, dialysis use, or previous renal transplant. Results The analysis included ADPKD patients in CKD stages 1–5 (n=316 to n=860), dialysis (n=586), and post-transplant (n=615). Mean ages did not differ across CKD stages (range 43–56 years). Men were the majority in the later stages but the minority in the early stages. The proportion of patients with at least one hospitalization increased with CKD stage, (12% to >40% CKD stage 2 to stage 5, dialysis or post-transplant). The majority had at least one hospital outpatient visit and at least one pharmacy claim. Total 6-month per-patient costs were greater among ADPKD patients than in age-matched and sex-matched healthy non-ADPKD controls (P<0.001 for all comparisons). Conclusion ADPKD patients with normal kidney function are associated with a significant economic burden to the health care system relative to the general population. Any treatments that delay progression to later stages of CKD may provide potential health care cost offsets. PMID:25759590

  5. Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

    Science.gov (United States)

    Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

    2016-06-01

    Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

  6. Cyst Ablation Using a Mixture of N-Butyl Cyanoacrylate and Iodized Oil in Patients with Autosomal Dominant Polycystic Kidney Disease: the Long-Term Results

    Energy Technology Data Exchange (ETDEWEB)

    Kim, See Hyung; Kim, Seung Hyup; Cho, Jeong Yeon [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2009-08-15

    We wanted to assess the long-term results of cyst ablation with using N-butyl cyanoacrylate (NBCA) and iodized oil in patients with autosomal dominant polycystic kidney disease (ADPKD) and symptomatic cysts. Cyst ablation using a mixture of NBCA and iodized oil was performed in 99 cysts from 21 patients who had such symptoms as abdominal distension and pain. The collapse or reaccumulation of the ablated cysts after the procedure was assessed during the follow-up period of 36 to 90 months. The treatment effects, including symptom relief, and the clinical data such as the blood pressure and serum creatinine levels were also assessed, together with the complications. The procedure was technically successful in all 99 cysts from the 21 patients. Any procedure-related significant complications were not detected. Seventy-seven of 99 cysts (78%) were successfully collapsed on the follow-up CT. Twenty-two cysts showed reaccumulation during long-term follow-up period. The clinical symptoms were relieved in 17 of the 21 patients (76%). Four of 12 patients (33%) with hypertension and two of six patients (33%) with azotemia were improved. End stage renal disease (ESRD) occurred in six of the 21 patients (28%) during the follow-up period. The mean age of ESRD in our patients was 57 years. The mean time interval for the development of ESRD was 19 months. Ablation using a mixture of NBCA and iodized oil may be an effective, safe method for obtaining symptom relief in patients with ADPKD.

  7. Endothelin 1 gene is not a major modifier of chronic kidney disease advancement among the autosomal dominant polycystic kidney disease patients

    Directory of Open Access Journals (Sweden)

    Annapareddy Shiva Nagendra Reddy

    2016-01-01

    Full Text Available Introduction: Autosomal dominant polycystic kidney disease (ADPKD is characterized by the presence of numerous cysts in the kidney and manifest with various renal and extra-renal complications leading to ESRD. Endothelin may contribute to various renal and extra-renal manifestations pointing to genetic and environmental modifying factors that alter the risk of developing chronic kidney disease (CKD in ADPKD. In the present study we investigated six genes coding for endothelin 1 (EDN1 tagging-single nucleotide polymorphisms (tag-SNPs to unravel the EDN1 gene modifier effect for renal disease progression in ADPKD. Materials and Methods: The tag-SNPs were genotyped using FRET-based KASPar method in 108 ADPKD patients and 119 healthy subjects. Cochran-Armitage trend test was used to determine the association between ADPKD and EDN1 tag-SNPs. Multivariate logistic regression analysis was performed to assess the effect of tag-SNPs on CKD progression. The relationship between different CKD stages and hypertension and their interaction Mantel-Haenszel stratified analysis was performed. Results: All loci are polymorphic and followed Hardy-Weinberg equilibrium. Distribution of EDN1 genotypes and haplotypes in control and ADPKD is not statistically significant. Five SNPs covering 3.4 kb forming single LD block, but the LD was not strong between SNPs. The EDN1 genotypes are not contributing to the CKD advancement among the ADPKD patients. Conclusion: These results suggest that the EDN1 gene is not a major modifier of CKD advancement among ADPKD patients.

  8. Autosomal Dominant STAT3 Deficiency and Hyper-IgE Syndrome Molecular, Cellular, and Clinical Features From a French National Survey

    Science.gov (United States)

    Chandesris, Marie-Olivia; Melki, Isabelle; Natividad, Angels; Puel, Anne; Fieschi, Claire; Yun, Ling; Thumerelle, Caroline; Oksenhendler, Eric; Boutboul, David; Thomas, Caroline; Hoarau, Cyrille; Lebranchu, Yvon; Stephan, Jean-Louis; Cazorla, Celine; Aladjidi, Nathalie; Micheau, Marguerite; Tron, Fran[cedil]cois; Baruchel, Andre; Barlogis, Vincent; Palenzuela, Gilles; Mathey, Catherine; Dominique, Stephane; Body, Gerard; Munzer, Martine; Fouyssac, Fanny; Jaussaud, Rolland; Bader-Meunier, Brigitte; Mahlaoui, Nizar; Blanche, Stephane; Debre, Marianne; Le Bourgeois, Muriel; Gandemer, Virginie; Lambert, Nathalie; Grandin, Virginie; Ndaga, Stephanie; Jacques, Corinne; Harre, Chantal; Forveille, Monique; Alyanakian, Marie-Alexandra; Durandy, Anne; Bodemer, Christine; Suarez, Felipe; Hermine, Olivier; Lortholary, Olivier; Casanova, Jean-Laurent; Fischer, Alain; Picard, Capucine

    2013-01-01

    Autosomal dominant deficiency of signal transducer and activator of transcription 3 (STAT3) is the main genetic etiology of hyper-immunoglobulin (Ig) E syndrome. We documented the molecular, cellular, and clinical features of 60 patients with heterozygous STAT3 mutations from 47 kindreds followed in France. We identified 11 known and 13 new mutations of STAT3. Low levels of interleukin (IL)-6-dependent phosphorylation and nuclear translocation (or accumulation) of STAT3 were observed in Epstein-Barr virus-transformed B lymphocytes (EBV-B cells) from all STAT3-deficient patients tested. The immunologic phenotype was characterized by high serum IgE levels (96% of the patients), memory B-cell lymphopenia (94.5%), and hypereosinophilia (80%). A low proportion of IL-17A-producing circulating T cells was found in 14 of the 15 patients tested. Mucocutaneous infections were the most frequent, typically caused by Staphylococcus aureus (all patients) and Candida albicans (85%). Up to 90% of the patients had pneumonia, mostly caused by Staph. aureus (31%) or Streptococcus pneumoniae (30%). Recurrent pneumonia was associated with secondary bronchiectasis and pneumatocele (67%), as well as secondary aspergillosis (22%). Up to 92% of the patients had dermatitis and connective tissue abnormalities, with facial dysmorphism (95%), retention of decidual teeth (65%), osteopenia (50%), and hyperextensibility (50%). Four patients developed non-Hodgkin lymphoma. The clinical outcome was favorable, with 56 patients, including 43 adults, still alive at the end of study (mean age, 21 yr; range, 1 mo to 46 yr). Only 4 patients died, 3 from severe bacterial infection (aged 1, 15, and 29 yr, respectively). Antibiotic prophylaxis (90% of patients), antifungal prophylaxis (50%), and IgG infusions (53%) improved patient health, as demonstrated by the large decrease in pneumonia recurrence. Overall, the prognosis of STAT3 deficiency may be considered good, provided that multiple prophylactic

  9. Long-term effect of coffee consumption on autosomal dominant polycystic kidneys disease progression: results from the Suisse ADPKD, a Prospective Longitudinal Cohort Study.

    Science.gov (United States)

    Girardat-Rotar, Laura; Puhan, Milo A; Braun, Julia; Serra, Andreas L

    2018-02-01

    Previous in vitro experiments of human polycystic kidney disease (PKD) cells reported that caffeine is a risk factor for the promotion of cyst enlargement in patients with autosomal dominant PKD (ADPKD). The relentless progression of ADPKD inclines the majority of physicians to advocate minimization of caffeine consumption despite the absence of clinical data supporting such a recommendation so far. This is the first clinical study to assess prospectively the association between coffee consumption and disease progression in a longitudinal ADPKD cohort. Information on coffee consumption and disease progression was collected at each follow-up visit using standardized measurement methods. The main model for the outcomes, kidney size (height-adjusted total kidney volume, htTKV) and kidney function (estimated glomerular filtration rate, eGFR), was a linear mixed model. Patients entered the on-going Swiss ADPKD study between 2006 and June 2014 and had at least 1 visit every year. The sample size of the study population was 151 with a median follow-up of 4 visits per patient and a median follow-up time of 4.38 years. After multivariate adjustment for age, smoking, hypertension, sex, body mass index and an interaction term (coffee*visit), coffee drinkers did not have a statistically significantly different kidney size compared to non-coffee drinkers (difference of -33.03 cm 3 height adjusted TKV, 95% confidence interval (CI) from -72.41 to 6.34, p = 0.10). After the same adjustment, there was no statistically significant difference in eGFR between coffee and non-coffee drinkers (2.03 ml/min/1.73 m 2 , 95% CI from -0.31 to 4.31, p = 0.089). Data derived from our prospective longitudinal study do not confirm that drinking coffee is a risk factor for ADPKD progression.

  10. Successful haploidentical donor hematopoietic stem cell transplant and restoration of STAT3 function in an adolescent with autosomal dominant hyper-IgE syndrome.

    Science.gov (United States)

    Patel, N C; Gallagher, J L; Torgerson, T R; Gilman, A L

    2015-07-01

    Autosomal dominant hyper-IgE syndrome (AD-HIES), caused by mutations in Signal Transducer and Activator of Transcription 3 (STAT3) is associated with defective STAT3 signaling and Th17 differentiation and recurrent bacterial and fungal infections. Most patients suffer significant morbidity and premature mortality. Hematopoietic stem cell transplantation (HSCT) has been reported in a small number of cases, with mixed outcomes. We report successful haploidentical donor HSCT in a patient with AD-HIES. Evaluation of lymphocyte subsets, STAT3 signaling, and Th17 cells was performed pre- and post-HSCT. A 14-year old female with AD-HIES developed recurrent methicillin-resistant Staphylococcus aureus (MRSA) abscesses. Immunologic analysis showed elevated IgE (4331 kU/L), absent Th17 cells, and markedly decreased STAT3 phosphorylation in cytokine stimulated peripheral blood mononuclear cells. She had breakthrough abscesses despite clindamycin and trimethoprim-sulfamethoxazole prophylaxis, and developed steroid refractory autoimmune hemolytic anemia. She underwent T-cell depleted haploidentical HSCT from her father following reduced intensity conditioning. She developed one MRSA hand abscess after transplant. Twenty-four months post transplant, she had complete donor chimerism (>95 % donor), normal absolute T cell numbers, and a normal percentage of Th17 cells. IgE was normal at 25 kU/L. She remains well 42 months after transplantation off all antibacterial prophylaxis. Haploidentical HSCT led to successful bone marrow engraftment, normalization of STAT3 signaling in hematopoietic cells, normalization of IgE, and restoration of immune function in this patient with AD-HIES.

  11. Recurrent De Novo Mutations Affecting Residue Arg138 of Pyrroline-5-Carboxylate Synthase Cause a Progeroid Form of Autosomal-Dominant Cutis Laxa.

    Science.gov (United States)

    Fischer-Zirnsak, Björn; Escande-Beillard, Nathalie; Ganesh, Jaya; Tan, Yu Xuan; Al Bughaili, Mohammed; Lin, Angela E; Sahai, Inderneel; Bahena, Paulina; Reichert, Sara L; Loh, Abigail; Wright, Graham D; Liu, Jaron; Rahikkala, Elisa; Pivnick, Eniko K; Choudhri, Asim F; Krüger, Ulrike; Zemojtel, Tomasz; van Ravenswaaij-Arts, Conny; Mostafavi, Roya; Stolte-Dijkstra, Irene; Symoens, Sofie; Pajunen, Leila; Al-Gazali, Lihadh; Meierhofer, David; Robinson, Peter N; Mundlos, Stefan; Villarroel, Camilo E; Byers, Peter; Masri, Amira; Robertson, Stephen P; Schwarze, Ulrike; Callewaert, Bert; Reversade, Bruno; Kornak, Uwe

    2015-09-03

    Progeroid disorders overlapping with De Barsy syndrome (DBS) are collectively denoted as autosomal-recessive cutis laxa type 3 (ARCL3). They are caused by biallelic mutations in PYCR1 or ALDH18A1, encoding pyrroline-5-carboxylate reductase 1 and pyrroline-5-carboxylate synthase (P5CS), respectively, which both operate in the mitochondrial proline cycle. We report here on eight unrelated individuals born to non-consanguineous families clinically diagnosed with DBS or wrinkly skin syndrome. We found three heterozygous mutations in ALDH18A1 leading to amino acid substitutions of the same highly conserved residue, Arg138 in P5CS. A de novo origin was confirmed in all six probands for whom parental DNA was available. Using fibroblasts from affected individuals and heterologous overexpression, we found that the P5CS-p.Arg138Trp protein was stable and able to interact with wild-type P5CS but showed an altered sub-mitochondrial distribution. A reduced size upon native gel electrophoresis indicated an alteration of the structure or composition of P5CS mutant complex. Furthermore, we found that the mutant cells had a reduced P5CS enzymatic activity leading to a delayed proline accumulation. In summary, recurrent de novo mutations, affecting the highly conserved residue Arg138 of P5CS, cause an autosomal-dominant form of cutis laxa with progeroid features. Our data provide insights into the etiology of cutis laxa diseases and will have immediate impact on diagnostics and genetic counseling. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  12. A Recurrent Mutation in CACNA1G Alters Cav3.1 T-Type Calcium-Channel Conduction and Causes Autosomal-Dominant Cerebellar Ataxia

    Science.gov (United States)

    Coutelier, Marie; Blesneac, Iulia; Monteil, Arnaud; Monin, Marie-Lorraine; Ando, Kunie; Mundwiller, Emeline; Brusco, Alfredo; Le Ber, Isabelle; Anheim, Mathieu; Castrioto, Anna; Duyckaerts, Charles; Brice, Alexis; Durr, Alexandra; Lory, Philippe; Stevanin, Giovanni

    2015-01-01

    Hereditary cerebellar ataxias (CAs) are neurodegenerative disorders clinically characterized by a cerebellar syndrome, often accompanied by other neurological or non-neurological signs. All transmission modes have been described. In autosomal-dominant CA (ADCA), mutations in more than 30 genes are implicated, but the molecular diagnosis remains unknown in about 40% of cases. Implication of ion channels has long been an ongoing topic in the genetics of CA, and mutations in several channel genes have been recently connected to ADCA. In a large family affected by ADCA and mild pyramidal signs, we searched for the causative variant by combining linkage analysis and whole-exome sequencing. In CACNA1G, we identified a c.5144G>A mutation, causing an arginine-to-histidine (p.Arg1715His) change in the voltage sensor S4 segment of the T-type channel protein Cav3.1. Two out of 479 index subjects screened subsequently harbored the same mutation. We performed electrophysiological experiments in HEK293T cells to compare the properties of the p.Arg1715His and wild-type Cav3.1 channels. The current-voltage and the steady-state activation curves of the p.Arg1715His channel were shifted positively, whereas the inactivation curve had a higher slope factor. Computer modeling in deep cerebellar nuclei (DCN) neurons suggested that the mutation results in decreased neuronal excitability. Taken together, these data establish CACNA1G, which is highly expressed in the cerebellum, as a gene whose mutations can cause ADCA. This is consistent with the neuropathological examination, which showed severe Purkinje cell loss. Our study further extends our knowledge of the link between calcium channelopathies and CAs. PMID:26456284

  13. Mitochondrial disorders in congenital myopathies

    Directory of Open Access Journals (Sweden)

    D. A. Kharlamov

    2014-01-01

    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.

  14. Acute steroid myopathy: a highly overlooked entity.

    Science.gov (United States)

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

    2018-02-15

    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  15. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Science.gov (United States)

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

    2016-02-01

    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  16. Automatic total kidney volume measurement on follow-up magnetic resonance images to facilitate monitoring of autosomal dominant polycystic kidney disease progression.

    Science.gov (United States)

    Kline, Timothy L; Korfiatis, Panagiotis; Edwards, Marie E; Warner, Joshua D; Irazabal, Maria V; King, Bernard F; Torres, Vicente E; Erickson, Bradley J

    2016-02-01

    Renal imaging examinations provide high-resolution information about the anatomic structure of the kidneys and are used to measure total kidney volume (TKV) in autosomal dominant polycystic kidney disease (ADPKD) patients. TKV has become the gold-standard image biomarker for ADPKD progression at early stages of the disease and is used in clinical trials to characterize treatment efficacy. Automated methods to segment the kidneys and measure TKV are desirable because of the long time requirement for manual approaches such as stereology or planimetry tracings. However, ADPKD kidney segmentation is complicated by a number of factors, including irregular kidney shapes and variable tissue signal at the kidney borders. We describe an image processing approach that overcomes these problems by using a baseline segmentation initialization to provide automatic segmentation of follow-up scans obtained years apart. We validated our approach using 20 patients with complete baseline and follow-up T1-weighted magnetic resonance images. Both manual tracing and stereology were used to calculate TKV, with two observers performing manual tracings and one observer performing repeat tracings. Linear correlation and Bland-Altman analysis were performed to compare the different approaches. Our automated approach measured TKV at a level of accuracy (mean difference ± standard error = 0.99 ± 0.79%) on par with both intraobserver (0.77 ± 0.46%) and interobserver variability (1.34 ± 0.70%) of manual tracings. All approaches had excellent agreement and compared favorably with ground-truth manual tracing with interobserver, stereological and automated approaches having 95% confidence intervals ∼ ± 100 mL. Our method enables fast, cost-effective and reproducible quantification of ADPKD progression that will facilitate and lower the costs of clinical trials in ADPKD and other disorders requiring accurate, longitudinal kidney quantification. In addition, it will hasten the routine use of

  17. Cyst infection in hospital-admitted autosomal dominant polycystic kidney disease patients is predominantly multifocal and associated with kidney and liver volume

    Energy Technology Data Exchange (ETDEWEB)

    Balbo, B.E.P. [Divisão de Nefrologia, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Sapienza, M.T.; Ono, C.R. [Divisão de Medicina Nuclear, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Jayanthi, S.K. [Divisão de Radiologia, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Dettoni, J.B. [Divisão de Patologia, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil); Castro, I.; Onuchic, L.F. [Divisão de Nefrologia, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP (Brazil)

    2014-06-13

    Positron-emission tomography/computed tomography (PET/CT) has improved cyst infection (CI) management in autosomal dominant polycystic kidney disease (ADPKD). The determinants of kidney and/or liver involvement, however, remain uncertain. In this study, we evaluated clinical and imaging factors associated with CI in kidney (KCI) and liver (LCI) in ADPKD. A retrospective cohort study was performed in hospital-admitted ADPKD patients with suspected CI. Clinical, imaging and surgical data were analyzed. Features of infected cysts were evaluated by PET/CT. Total kidney (TKV) and liver (TLV) volumes were measured by CT-derived multiplanar reconstruction. CI was detected in 18 patients who experienced 24 episodes during an interval of 30 months (LCI in 12, KCI in 10 and concomitant infection in 2). Sensitivities of CT, magnetic resonance imaging and PET/CT were 25.0, 71.4, and 95.0%. Dysuria (P<0.05), positive urine culture (P<0.01), and previous hematuria (P<0.05) were associated with KCI. Weight loss (P<0.01) and increased C-reactive protein levels (P<0.05) were associated with LCI. PET/CT revealed that three or more infected cysts were present in 70% of the episodes. TKV was higher in kidney-affected than in LCI patients (AUC=0.91, P<0.05), with a cut-off of 2502 mL (72.7% sensitivity, 100.0% specificity). TLV was higher in liver-affected than in KCI patients (AUC=0.89, P<0.01) with a cut-off of 2815 mL (80.0% sensitivity, 87.5% specificity). A greater need for invasive procedures was observed in LCI (P<0.01), and the overall mortality was 20.8%. This study supports PET/CT as the most sensitive imaging method for diagnosis of cyst infection, confirms the multifocal nature of most hospital-admitted episodes, and reveals an association of kidney and liver volumes with this complication.

  18. Identification and Functional Characterization of a Novel Mutation in the Human Calcium-Sensing Receptor That Co-Segregates With Autosomal-Dominant Hypocalcemia

    Directory of Open Access Journals (Sweden)

    Anne Qvist Rasmussen

    2018-04-01

    Full Text Available The human calcium-sensing receptor (CASR is the key controller of extracellular Cao2+ homeostasis, and different mutations in the CASR gene have been linked to different calcium diseases, such as familial hypocalciuric hypercalcemia, severe hyperparathyroidism, autosomal-dominant hypocalcemia (ADH, and Bartter’s syndrome type V. In this study, two generations of a family with biochemically and clinically confirmed ADH who suffered severe muscle pain, arthralgia, tetany, abdominal pain, and fatigue were evaluated for mutations in the CASR gene. The study comprises genotyping of all family members, functional characterization of a potential mutant receptor by in vitro analysis related to the wild-type receptor to reveal an association between the genotype and phenotype in the affected family members. The in vitro analysis of functional characteristics includes measurements of inositol trisphosphate accumulation, Ca2+ mobilization in response to [Ca2+]o-stimulation and receptor expression. The results reveal a significant leftward shift of inositol trisphosphate accumulation as a result of the “gain-of-function” mutant receptor and surprisingly a normalization of the response in (Ca2+i release in the downstream pathway and additionally the maximal response of (Ca2+i release was significantly decreased compared to the wild type. However, no gross differences were seen in D126V and the D126V/WT CASR dimeric >250 kDa band expression compared to the WT receptor, however, the D126V and D126V/WT CASR immature ~140 kDa species appear to have reduced expression compared to the WT receptor. In conclusion, in this study, a family with a clinical diagnosis of ADH in two generations was evaluated to identify a mutation in the CASR gene and reveal an association between genotype and phenotype in the affected family members. The clinical condition was caused by a novel, activating, missense mutation (D126V in the CASR gene and the in vitro functional

  19. Calcilytic Ameliorates Abnormalities of Mutant Calcium-Sensing Receptor (CaSR) Knock-In Mice Mimicking Autosomal Dominant Hypocalcemia (ADH).

    Science.gov (United States)

    Dong, Bingzi; Endo, Itsuro; Ohnishi, Yukiyo; Kondo, Takeshi; Hasegawa, Tomoka; Amizuka, Norio; Kiyonari, Hiroshi; Shioi, Go; Abe, Masahiro; Fukumoto, Seiji; Matsumoto, Toshio

    2015-11-01

    Activating mutations of calcium-sensing receptor (CaSR) cause autosomal dominant hypocalcemia (ADH). ADH patients develop hypocalcemia, hyperphosphatemia, and hypercalciuria, similar to the clinical features of hypoparathyroidism. The current treatment of ADH is similar to the other forms of hypoparathyroidism, using active vitamin D3 or parathyroid hormone (PTH). However, these treatments aggravate hypercalciuria and renal calcification. Thus, new therapeutic strategies for ADH are needed. Calcilytics are allosteric antagonists of CaSR, and may be effective for the treatment of ADH caused by activating mutations of CaSR. In order to examine the effect of calcilytic JTT-305/MK-5442 on CaSR harboring activating mutations in the extracellular and transmembrane domains in vitro, we first transfected a mutated CaSR gene into HEK cells. JTT-305/MK-5442 suppressed the hypersensitivity to extracellular Ca(2+) of HEK cells transfected with the CaSR gene with activating mutations in the extracellular and transmembrane domains. We then selected two activating mutations locating in the extracellular (C129S) and transmembrane (A843E) domains, and generated two strains of CaSR knock-in mice to build an ADH mouse model. Both mutant mice mimicked almost all the clinical features of human ADH. JTT-305/MK-5442 treatment in vivo increased urinary cAMP excretion, improved serum and urinary calcium and phosphate levels by stimulating endogenous PTH secretion, and prevented renal calcification. In contrast, PTH(1-34) treatment normalized serum calcium and phosphate but could not reduce hypercalciuria or renal calcification. CaSR knock-in mice exhibited low bone turnover due to the deficiency of PTH, and JTT-305/MK-5442 as well as PTH(1-34) increased bone turnover and bone mineral density (BMD) in these mice. These results demonstrate that calcilytics can reverse almost all the phenotypes of ADH including hypercalciuria and renal calcification, and suggest that calcilytics can become a

  20. Positive Predictive Values of International Classification of Diseases, 10th Revision Coding Algorithms to Identify Patients With Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Vinusha Kalatharan

    2016-12-01

    Full Text Available Background: International Classification of Diseases, 10th Revision codes (ICD-10 for autosomal dominant polycystic kidney disease (ADPKD is used within several administrative health care databases. It is unknown whether these codes identify patients who meet strict clinical criteria for ADPKD. Objective: The objective of this study is (1 to determine whether different ICD-10 coding algorithms identify adult patients who meet strict clinical criteria for ADPKD as assessed through medical chart review and (2 to assess the number of patients identified with different ADPKD coding algorithms in Ontario. Design: Validation study of health care database codes, and prevalence. Setting: Ontario, Canada. Patients: For the chart review, 201 adult patients with hospital encounters between April 1, 2002, and March 31, 2014, assigned either ICD-10 codes Q61.2 or Q61.3. Measurements: This study measured positive predictive value of the ICD-10 coding algorithms and the number of Ontarians identified with different coding algorithms. Methods: We manually reviewed a random sample of medical charts in London, Ontario, Canada, and determined whether or not ADPKD was present according to strict clinical criteria. Results: The presence of either ICD-10 code Q61.2 or Q61.3 in a hospital encounter had a positive predictive value of 85% (95% confidence interval [CI], 79%-89% and identified 2981 Ontarians (0.02% of the Ontario adult population. The presence of ICD-10 code Q61.2 in a hospital encounter had a positive predictive value of 97% (95% CI, 86%-100% and identified 394 adults in Ontario (0.003% of the Ontario adult population. Limitations: (1 We could not calculate other measures of validity; (2 the coding algorithms do not identify patients without hospital encounters; and (3 coding practices may differ between hospitals. Conclusions: Most patients with ICD-10 code Q61.2 or Q61.3 assigned during their hospital encounters have ADPKD according to the clinical

  1. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Science.gov (United States)

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

    2011-01-01

    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  2. STATINS AND MYOPATHY: MOLECULAR MECHANISMS

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2012-01-01

    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  3. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Directory of Open Access Journals (Sweden)

    Zhiyv Niu

    2018-03-01

    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  4. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Science.gov (United States)

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

    2018-01-01

    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  5. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Science.gov (United States)

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

    2018-02-15

    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  6. Myofibrillar myopathies: State of the art, present and future challenges.

    Science.gov (United States)

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

    2015-10-01

    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  7. Genuine myotubular myopathy

    International Nuclear Information System (INIS)

    Edstroem, L.; Wroblewski, R.; Mair, W.G.

    1982-01-01

    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  8. Cerebrovascular Accidents In Myopathies

    Directory of Open Access Journals (Sweden)

    Farzad Fatehi

    2017-02-01

    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  9. Muscle regeneration in mitochondrial myopathies

    DEFF Research Database (Denmark)

    Krag, T O; Hauerslev, S; Jeppesen, T D

    2013-01-01

    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  10. Spectrum of metabolic myopathies.

    Science.gov (United States)

    Angelini, Corrado

    2015-04-01

    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  11. Inherited myopathies and muscular dystrophies

    NARCIS (Netherlands)

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  12. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Science.gov (United States)

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

    1991-03-01

    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

  13. Generation of an induced pluripotent stem cell line, IBMS-iPSC-014-05, from a female autosomal dominant polycystic kidney disease patient carrying a common mutation of R803X in PKD2

    Directory of Open Access Journals (Sweden)

    Ming-Ching Ho

    2017-12-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is one of the most commonly inherited forms of polycystic kidney disease, and is characterized by the growth of numerous cysts in both kidneys. Here we generated an induced pluripotent stem cell (iPSC line from the peripheral blood mononuclear cells (PBMCs of a 63-year-old female ADPKD patient carrying an R803X mutation in the PKD2 gene using the Sendai-virus delivery system. Downstream characterization of these iPSCs showed that they possessed normal karyotyping, were free of genomic integration, retained the disease-causing PKD2 mutation, expressed pluripotency markers and could differentiate into three germ layers.

  14. Stepwise approach to myopathy in systemic disease.

    Science.gov (United States)

    Chawla, Jasvinder

    2011-01-01

    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  15. Exercise training in metabolic myopathies

    DEFF Research Database (Denmark)

    Vissing, J

    2016-01-01

    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  16. Genetics Home Reference: nemaline myopathy

    Science.gov (United States)

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  17. Recommendations for the use of tolvaptan in autosomal dominant polycystic kidney disease: a position statement on behalf of the ERA-EDTA Working Groups on Inherited Kidney Disorders and European Renal Best Practice.

    Science.gov (United States)

    Gansevoort, Ron T; Arici, Mustafa; Benzing, Thomas; Birn, Henrik; Capasso, Giovambattista; Covic, Adrian; Devuyst, Olivier; Drechsler, Christiane; Eckardt, Kai-Uwe; Emma, Francesco; Knebelmann, Bertrand; Le Meur, Yannick; Massy, Ziad A; Ong, Albert C M; Ortiz, Alberto; Schaefer, Franz; Torra, Roser; Vanholder, Raymond; Więcek, Andrzej; Zoccali, Carmine; Van Biesen, Wim

    2016-03-01

    Recently, the European Medicines Agency approved the use of the vasopressin V2 receptor antagonist tolvaptan to slow the progression of cyst development and renal insufficiency of autosomal dominant polycystic kidney disease (ADPKD) in adult patients with chronic kidney disease stages 1-3 at initiation of treatment with evidence of rapidly progressing disease. In this paper, on behalf of the ERA-EDTA Working Groups of Inherited Kidney Disorders and European Renal Best Practice, we aim to provide guidance for making the decision as to which ADPKD patients to treat with tolvaptan. The present position statement includes a series of recommendations resulting in a hierarchical decision algorithm that encompasses a sequence of risk-factor assessments in a descending order of reliability. By examining the best-validated markers first, we aim to identify ADPKD patients who have documented rapid disease progression or are likely to have rapid disease progression. We believe that this procedure offers the best opportunity to select patients who are most likely to benefit from tolvaptan, thus improving the benefit-to-risk ratio and cost-effectiveness of this treatment. It is important to emphasize that the decision to initiate treatment requires the consideration of many factors besides eligibility, such as contraindications, potential adverse events, as well as patient motivation and lifestyle factors, and requires shared decision-making with the patient. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA.

  18. Síndrome das pernas inquietas com herança autossômica dominante piorada pelo uso de mirtazapina: relato de caso Worsening of autosomal dominant restless legs syndrome after use of mirtazapine: case report

    Directory of Open Access Journals (Sweden)

    Hélio A.G. Teive

    2002-12-01

    Full Text Available Relatamos o caso de uma paciente de 78 anos, com diagnóstico estabelecido de síndrome das pernas inquietas (SPI, de etiologia primária com herança autossômica dominante. A paciente apresentava quadro depressivo associado. Enfatiza-se a piora do quadro clínico da SPI após o uso de anti-depressivo com ação inibidora seletiva da recaptação de serotonina (mirtazapina, com atenuação dos sintomas após a retirada da droga, e a excelente resposta terapêutica com o uso de agonista dopaminérgico (pramipexol em baixa dose.We report the case of a 78 years old female patient with primary restless legs syndrome (RLS with an autosomal dominant pattern of inheritance. In addition, the patient also had depression. We emphasize the worsening of symptoms of RLS after the use of a selective serotonin uptake inhibitor (mirtazapine, with improvement after the drug was discontinued, and an excellent recovery with the use of low dose dopaminergic agonist (pramipexol.

  19. The human dorsal spinocerebellar tract: myelinated fiber spectrum and fiber density in controls, autosomal dominant spinocerebellar atrophy, Huntington's chorea, radiation myelopathy, and diseases with peripheral sensory nerve involvement

    Energy Technology Data Exchange (ETDEWEB)

    Ringelstein, E.B.; Schroeder, J.M.

    1982-01-01

    The human dorsal spinocerebellar tract (DSCT) was evaluated morphometrically in 14 control cases of different age and sex using semithin sections of epon-embedded cross sections from the C3, T5, and T10 segments of the spinal cord. A bimodal fiber spectrum was revealed with one peak at 2-3 microns, and a second, broader peak at about 6-8 microns. Fiber density at C3 was 11,188 fibers/mm2 and at T5, 11,156 fibers/mm2. Regression analysis relating fiber density to age disclosed a highly significant loss of myelinated fibers at T5 amounting to about 2.5% per decade. A severe reduction of fiber density and a distinct change in the fiber spectrum with predominant loss of large myelinated fibers were noted in a case of autosomal dominant spinocerebellar atrophy with late onset, and, to a lesser degree, in a case of Huntington's chorea. A subtotal loss of fibers with a persistent normal distribution of fiber sizes was observed rostral to a focus of severe radiation myelopathy, indicating Wallerian degeneration of large numbers of fibers, and a reduction of fiber diameters caudal to the lesion, suggesting retrograde fiber change. By contrast, no primary or transneural changes in the DSCT were detected in six cases of long-term alcoholism, carcinomatous sensory neuropathy, and neurofibromatosis in spite of the involvement of numerous nerve roots.

  20. Complete Heart Block with Diastolic Heart Failure and Pulmonary Edema Secondary to Enlarging Previously Diagnosed Thrombosed Aneurysm of Sinus of Valsalva in a Patient with History of Autosomal Dominant Polycystic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Sherif Ali Eltawansy

    2015-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is associated with vascular aneurysms that can affect any part of the vascular tree, like ascending aorta or coronary arteries. Sinus of Valsalva is known as an anatomical dilation at the root of aorta above the aortic valve and very few cases show aneurysm at that site in patients with ADPKD. Sinus of Valsalva aneurysm (SVA can present with rupture and acute heart failure and infective endocarditis or could be asymptomatic accidentally discovered during cardiac catheterization. We report a case of a 76-year-old male with a unique constellation of cardiovascular anomalies associated with ADPKD. Patient was previously diagnosed with aneurysms affecting ascending aorta, sinus of Valsalva, and coronary arteries. Several years later, he came with complete heart block which was discovered later to be secondary to enlargement of his previously diagnosed thrombosed SVA. His case was complicated with acute heart failure and pulmonary edema. Conclusion. Patients with ADPKD can present with extrarenal manifestations. In our case, aneurysm at sinus of Valsalva was progressively enlarging and presented with complete heart block.

  1. Cerebral autosomal dominant arteriopathy with subcortical infarcts ...

    African Journals Online (AJOL)

    A new finding, to our knowledge, was the normality of visual, somatosensory and auditory evoked potentials. Conclusion. Our study confirms the existence of CADASIL in. South Africa, and also suggests that skin electron microscopy is useful, despite recent reports of its low sensitivity, and that evoked potentials in CADASIL ...

  2. Autosomal dominant non-epidermolytic palmoplantar hyperkeratosis ...

    African Journals Online (AJOL)

    PROF. EZECHUKWU

    2013-08-12

    epidermolytic and the isolated type (NEPPK). The non-volar skin, hair, teeth, nails and other organ systems were not involved. The presence of the disorder in the proband's father and its absence in her paternal grandfather and ...

  3. Cleidocranial Dysplasia with Autosomal Dominant Inheritance Pattern

    African Journals Online (AJOL)

    [3] These patients have the following triad of lesions, which is considered ... Brachycephalic skull with depression in the frontal bone of skull, depressed ... hyper mobility of both shoulders with associated radiographic features. Odontologist is ...

  4. Autosomal dominant transmission of GLUT1 deficiency.

    NARCIS (Netherlands)

    Klepper, J.; Willemsen, M.A.A.P.; Verrips, A.; Guertsen, E.; Herrmann, R.; Kutzick, C.; Florcken, A.; Voit, T.

    2001-01-01

    GLUT1 deficiency is caused by a defect in the facilitative glucose transporter GLUT1. Impaired glucose transport across brain tissue barriers is reflected by hypoglycorrhachia and results in an epileptic encephalopathy with developmental delay and motor disorders. Recently heterozygous mutations in

  5. Autosomal dominant craniosynostosis of the sutura metopica

    NARCIS (Netherlands)

    Hennekam, R. C.; van den Boogaard, M. J.

    1990-01-01

    Trigonocephaly due to craniosynostosis of the sutura metopica was found in two sibs with normal intelligence. Both were microcephalic. The father had a sloping forehead and possibly partial metopic craniosynostosis. The paternal grandfather had a bony ridge at the upper half of the metopic suture

  6. Genetics Home Reference: autosomal dominant vitreoretinochoroidopathy

    Science.gov (United States)

    ... Vitreoretinochoroidopathy Patient Support and Advocacy Resources (2 links) Foundation Fighting Blindness Prevent Blindness: Living Well with Low Vision Scientific Articles on PubMed (1 link) PubMed OMIM ( ...

  7. Autosomal Dominant Polycystic Kidney Disease, incidental finding ...

    African Journals Online (AJOL)

    N.J. Gildenhuys

    2016-06-30

    Jun 30, 2016 ... This case study serves as a learning opportunity and future reference in the cases and management of ... sentation, special investigations, and treatment. The table ... trauma to an abnormal kidney is still a controversial topic. .... running into fence. AP ... He does not have any prior medical or surgical history.

  8. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Science.gov (United States)

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  9. Endocrine myopathy: Case-based review

    Directory of Open Access Journals (Sweden)

    Babul Reddy Hanmayyagari

    2016-01-01

    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  10. Resveratrol and Myopathy

    Science.gov (United States)

    Bastin, Jean; Djouadi, Fatima

    2016-01-01

    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  11. Lipid storage myopathies.

    Science.gov (United States)

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  12. Desmin myopathy with severe cardiomyopathy in a Uruguayan family due to a codon deletion in a new location within the desmin 1A rod domain.

    Science.gov (United States)

    Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta

    2010-03-01

    Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.

  13. Amyloid myopathy: a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Heli Tuomaala

    2009-08-01

    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  14. Idiopathic Inflammatory Myopathies: An update

    Directory of Open Access Journals (Sweden)

    Bulent KURT

    2016-06-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  15. Autosomal dominant anhidrotic ectodermal dysplasia with immunodeficiency caused by a novel NFKBIA mutation, p.Ser36Tyr, presents with mild ectodermal dysplasia and non-infectious systemic inflammation.

    Science.gov (United States)

    Yoshioka, Takakazu; Nishikomori, Ryuta; Hara, Junichi; Okada, Keiko; Hashii, Yoshiko; Okafuji, Ikuo; Nodomi, Seishiro; Kawai, Tomoki; Izawa, Kazushi; Ohnishi, Hidenori; Yasumi, Takahiro; Nakahata, Tatsutoshi; Heike, Toshio

    2013-10-01

    Anhidrotic ectodermal dysplasia with immunodeficiency (EDA-ID) is characterized by hypohidrosis, dental abnormalities, sparse hair, and immunodeficiency. Autosomal dominant (AD)-EDA-ID, caused by a heterozygous mutation within NFKBIA, is very rare and its clinical features remain largely unknown. This study describes a patient with AD-EDA-ID harboring a novel NFKBIA mutation who presented with mild EDA and non-infectious systemic inflammation. The clinical presentation of an AD-EDA-ID patient was described and immunological, genetic, and biochemical analyses were performed, with a focus on nuclear factor kappa B (NF-κB) activation. The patient presented with symptoms of mild EDA-ID, namely sparse hair and hypohidrosis, although a skin biopsy confirmed the presence of sweat glands. There were no dental abnormalities. The patient also suffered from non-infectious inflammation, which responded to systemic corticosteroid therapy; however, the patient remained ill. Immunological analyses revealed reduced Toll-like receptor/IL-1 (TLR/IL-1) and tumor necrosis factor (TNF) receptor family responses to various stimuli. Genetic analysis identified a de novo heterozygous missense mutation, p.Ser36Tyr, in NFKBIA, resulting in defective NFKBIA degradation and impaired NF-κB activation. The patient was diagnosed with AD-EDA-ID and underwent hematopoietic stem cell transplantation. Engraftment was successful, with few signs of acute graft versus host disease. However, the patient suffered hemolytic anemia and thrombocytopenia, and died from a brain hemorrhage due to intractable thrombocytopenia. AD-EDA-ID patients can present with mild ectodermal dysplasia and non-infectious inflammation, rather than with recurrent infections. Also, hematopoietic stem cell transplantation for AD-EDA-ID is still a clinical challenge.

  16. Technical Evaluation: Identification of Pathogenic Mutations in PKD1 and PKD2 in Patients with Autosomal Dominant Polycystic Kidney Disease by Next-Generation Sequencing and Use of a Comprehensive New Classification System.

    Science.gov (United States)

    Kinoshita, Moritoshi; Higashihara, Eiji; Kawano, Haruna; Higashiyama, Ryo; Koga, Daisuke; Fukui, Takafumi; Gondo, Nobuhisa; Oka, Takehiko; Kawahara, Kozo; Rigo, Krisztina; Hague, Tim; Katsuragi, Kiyonori; Sudo, Kimiyoshi; Takeshi, Masahiko; Horie, Shigeo; Nutahara, Kikuo

    2016-01-01

    Genetic testing of PKD1 and PKD2 is expected to play an increasingly important role in determining allelic influences in autosomal dominant polycystic kidney disease (ADPKD) in the near future. However, to date, genetic testing is not commonly employed because it is expensive, complicated because of genetic heterogeneity, and does not easily identify pathogenic variants. In this study, we developed a genetic testing system based on next-generation sequencing (NGS), long-range polymerase chain reaction, and a new software package. The new software package integrated seven databases and provided access to five cloud-based computing systems. The database integrated 241 polymorphic nonpathogenic variants detected in 140 healthy Japanese volunteers aged >35 years, who were confirmed by ultrasonography as having no cysts in either kidney. Using this system, we identified 60 novel and 30 known pathogenic mutations in 101 Japanese patients with ADPKD, with an overall detection rate of 89.1% (90/101) [95% confidence interval (CI), 83.0%-95.2%]. The sensitivity of the system increased to 93.1% (94/101) (95% CI, 88.1%-98.0%) when combined with multiplex ligation-dependent probe amplification analysis, making it sufficient for use in a clinical setting. In 82 (87.2%) of the patients, pathogenic mutations were detected in PKD1 (95% CI, 79.0%-92.5%), whereas in 12 (12.8%) patients pathogenic mutations were detected in PKD2 (95% CI, 7.5%-21.0%); this is consistent with previously reported findings. In addition, we were able to reconfirm our pathogenic mutation identification results using Sanger sequencing. In conclusion, we developed a high-sensitivity NGS-based system and successfully employed it to identify pathogenic mutations in PKD1 and PKD2 in Japanese patients with ADPKD.

  17. Risk of Japanese carriers of hyperphosphorylated paratarg-7, the first autosomal-dominantly inherited risk factor for hematological neoplasms, to develop monoclonal gammopathy of undetermined significance and multiple myeloma.

    Science.gov (United States)

    Grass, Sandra; Iida, Shinsuke; Wikowicz, Aleksandra; Preuss, Klaus-Dieter; Inagaki, Atsushi; Shimizu, Kazuyuki; Ziepert, Marita; Ueda, Ryuzo; Pfreundschuh, Michael

    2011-03-01

    Hyperphosphorylated paratarg-7 (pP-7) is a frequent target of paraproteins in German patients with monoclonal gammopathy of undetermined significance (MGUS)/multiple myeloma (MM). The frequency of MGUS/MM is lower in Japan than in Europe. As pP-7, the first molecularly defined autosomal-dominant risk factor for any hematological neoplasm, is inherited in a dominant fashion, we determined the incidence of the pP-7 carrier state in a Japanese population, and compared the frequency of pP-7-specific paraproteins and the pP-7 carrier state in Japanese and German patients with MGUS/MM. Peripheral blood from 111 Japanese patients with MGUS/MM and 278 healthy blood donors was analyzed for the pP-7 carrier state by isoelectric focusing and for pP-7-specific antibodies by ELISA. The Japanese group was compared with 252 German MGUS/MM patients and 200 healthy controls. Five of 111 (4.5%) Japanese and 35/252 (13.9%) German IgA/IgG MGUS/MM patients had a pP-7-specific paraprotein (P=0.009). The prevalence of healthy pP-7 carriers in the Japanese study group was 1/278 (0.36%), whereas it was 4/200 in the German group (P=0.166). The relative risk for pP-7 carriers developing MGUS/MM had an odds ratio of 13.1 in the Japanese and 7.9 in the German group. In conclusion, the fraction of pP-7 carriers with a pP-7-specific paraprotein is lower among Japanese than in German patients with MGUS/MM, but pP-7 carriers in both ethnic groups have a high risk of developing MGUS/MM. © 2011 Japanese Cancer Association.

  18. A follow-up study of autosomal dominant polycystic kidney disease with intracranial aneurysms using 3.0 T three-dimensional time-of-flight magnetic resonance angiography

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Tao; Wang, Peng; Qian, Yi [Department of Radiology, Changzheng Hospital, Second Military Medical University, Shanghai (China); Zheng, Xuan [Clinical Nutrition Department of Changhai Hospital, Second Military Medical University, Shanghai (China); Xiao, Liaoyuan [Department of Nephrology, Changzheng Hospital, Second Military Medical University, Shanghai (China); Yu, Shengqiang, E-mail: yushengqiang_cz@163.com [Department of Nephrology, Changzheng Hospital, Second Military Medical University, Shanghai (China); Liu, Shiyuan, E-mail: laijiangtaotao@163.com [Department of Radiology, Changzheng Hospital, Second Military Medical University, Shanghai (China)

    2013-11-01

    Objective: Autosomal dominant polycystic kidney disease (ADPKD) patients have an increased risk for intracranial aneurysms (IAs). Our aim was to screen and follow up the unruptured intracranial aneurysms (UIAs) detected by 3.0 T three-dimensional time-of-flight magnetic resonance angiography (3D-TOF MRA) in patients with ADPKD in order to evaluate the growth of UIAs and the value of 3D-TOF MRA. Methods: From 2011 to 2012, we followed up UIAs detected in 40 ADPKD patients who had MRA examinations with an interval of at least 36 months. All MRA examinations were performed on a 3 T system (Achieva X-Series, Philips Medical Systems) with a Sense-Head-8 receiver head coil. The acquired data sets were transferred to a workstation (EWS, Philips Medical) to perform maximum intensity projection (MIP) and volume rendering (VR) with a specialized software package (Philips Medical). The size of UIAs was determined as the longest diameter in transverse or vertical measurement. UIAs that grew more than 20% were considered as enlarged. Results: Fifty UIAs were found in 40 previously examined ADPKD patients who underwent 3.0 T 3D-TOF MRA follow-ups. No patients ever had treatment before the second examination. The longest diameter of all follow-up UIAs was less than 10 mm and mean diameter was 3.64 ± 2.25 mm. UIAs in only 4 patients (10%) were considered as enlarged. None of the 50 IAs in the 40 ADPKD patients ruptured during the MRA follow-up period. Conclusion: 3.0 T 3D-TOF MRA was feasible for UIAs follow-up in ADPKD patients. The chance of enlargement and rupture of UIAs in ADPKD patients was not higher than in the general population.

  19. A follow-up study of autosomal dominant polycystic kidney disease with intracranial aneurysms using 3.0 T three-dimensional time-of-flight magnetic resonance angiography.

    Science.gov (United States)

    Jiang, Tao; Wang, Peng; Qian, Yi; Zheng, Xuan; Xiao, Liaoyuan; Yu, Shengqiang; Liu, Shiyuan

    2013-11-01

    Autosomal dominant polycystic kidney disease (ADPKD) patients have an increased risk for intracranial aneurysms (IAs). Our aim was to screen and follow up the unruptured intracranial aneurysms (UIAs) detected by 3.0 T three-dimensional time-of-flight magnetic resonance angiography (3D-TOF MRA) in patients with ADPKD in order to evaluate the growth of UIAs and the value of 3D-TOF MRA. From 2011 to 2012, we followed up UIAs detected in 40 ADPKD patients who had MRA examinations with an interval of at least 36 months. All MRA examinations were performed on a 3T system (Achieva X-Series, Philips Medical Systems) with a Sense-Head-8 receiver head coil. The acquired data sets were transferred to a workstation (EWS, Philips Medical) to perform maximum intensity projection (MIP) and volume rendering (VR) with a specialized software package (Philips Medical). The size of UIAs was determined as the longest diameter in transverse or vertical measurement. UIAs that grew more than 20% were considered as enlarged. Fifty UIAs were found in 40 previously examined ADPKD patients who underwent 3.0 T 3D-TOF MRA follow-ups. No patients ever had treatment before the second examination. The longest diameter of all follow-up UIAs was less than 10mm and mean diameter was 3.64 ± 2.25 mm. UIAs in only 4 patients (10%) were considered as enlarged. None of the 50 IAs in the 40 ADPKD patients ruptured during the MRA follow-up period. 3.0 T 3D-TOF MRA was feasible for UIAs follow-up in ADPKD patients. The chance of enlargement and rupture of UIAs in ADPKD patients was not higher than in the general population. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Amino alcohol- (NPS-2143 and quinazolinone-derived calcilytics (ATF936 and AXT914 differentially mitigate excessive signalling of calcium-sensing receptor mutants causing Bartter syndrome Type 5 and autosomal dominant hypocalcemia.

    Directory of Open Access Journals (Sweden)

    Saskia Letz

    Full Text Available Activating calcium sensing receptor (CaSR mutations cause autosomal dominant hypocalcemia (ADH characterized by low serum calcium, inappropriately low PTH and relative hypercalciuria. Four activating CaSR mutations cause additional renal wasting of sodium, chloride and other salts, a condition called Bartter syndrome (BS type 5. Until today there is no specific medical treatment for BS type 5 and ADH. We investigated the effects of different allosteric CaSR antagonists (calcilytics on activating CaSR mutants.All 4 known mutations causing BS type 5 and five ADH mutations were expressed in HEK 293T cells and receptor signalling was studied by measurement of intracellular free calcium in response to extracellular calcium ([Ca2+]o. To investigate the effect of calcilytics, cells were stimulated with 3 mM [Ca2+]o in the presence or absence of NPS-2143, ATF936 or AXT914.All BS type 5 and ADH mutants showed enhanced signalling activity to [Ca2+]o with left shifted dose response curves. In contrast to the amino alcohol NPS-2143, which was only partially effective, the quinazolinone calcilytics ATF936 and AXT914 significantly mitigated excessive cytosolic calcium signalling of all BS type 5 and ADH mutants studied. When these mutants were co-expressed with wild-type CaSR to approximate heterozygosity in patients, ATF936 and AXT914 were also effective on all mutants.The calcilytics ATF936 and AXT914 are capable of attenuating enhanced cytosolic calcium signalling activity of CaSR mutations causing BS type 5 and ADH. Quinazolinone calcilytics might therefore offer a novel treatment option for patients with activating CaSR mutations.

  1. Familial co-segregation of Coffin-Lowry syndrome inherited from the mother and autosomal dominant Waardenburg type IV syndrome due to deletion of EDNRB inherited from the father.

    Science.gov (United States)

    Loupe, Jacob; Sampath, Srirangan; Lacassie, Yves

    2014-10-01

    We report an African-American family that was identified after the proposita was referred for diagnostic evaluation at 4½ months with a history of Hirschsprung and dysmorphic features typical of Waardenburg syndrome (WS). Family evaluation revealed that the father had heterochromidia irides and hypertelorism supporting the clinical diagnosis of WS; however, examination of the mother revealed characteristic facial and digital features of Coffin-Lowry syndrome (CLS). Molecular testing of the mother identified a novel 2 bp deletion (c.865_866delCA) in codon 289 of RPS6KA3 leading to a frame-shift and premature termination of translation 5 codons downstream (NM_004586.2:p.Gln289ValfsX5). This deletion also was identified in the proposita and her three sisters with a clinical suspicion of CLS, all of whom as carriers for this X-linked disorder had very subtle manifestations. The molecular confirmation of WS type 4 (Shah-Waardenburg; WS4) was not as straightforward. To evaluate WS types 1-4, multiple sequential molecular tests were requested, including Sanger sequencing of all exons, and deletion/duplication analysis using MLPA for PAX3, MITF, SOX10, EDN3 and EDNRB. Although sequencing did not identify any disease causing variants, MLPA identified a heterozygous deletion of the entire EDNRB in the father. This deletion was also found in the proposita and the oldest child. Since the heterozygous deletion was the only change identified in EDNRB, this family represents one of the few cases of an autosomal dominant inheritance of WS4 involving the endothelin pathway. Altogether, clinical evaluation of the family revealed one child to be positive for WS4 and two positive for CLS, while two children were positive for both diseases simultaneously (including the proposita) while another pair test negative for either disease. This kinship is an example of the coincidence of two conditions co-segregating in one family, with variable phenotypes requiring molecular testing to

  2. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

    2015-05-01

    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Immune-mediated statin myopathy.

    Science.gov (United States)

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

    2016-01-01

    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  4. Localized scleroderma and regional inflammatory myopathy.

    Science.gov (United States)

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

    2014-05-01

    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  5. Agrin mutations lead to a congenital myasthenic syndrome with distal muscle weakness and atrophy.

    Science.gov (United States)

    Nicole, Sophie; Chaouch, Amina; Torbergsen, Torberg; Bauché, Stéphanie; de Bruyckere, Elodie; Fontenille, Marie-Joséphine; Horn, Morten A; van Ghelue, Marijke; Løseth, Sissel; Issop, Yasmin; Cox, Daniel; Müller, Juliane S; Evangelista, Teresinha; Stålberg, Erik; Ioos, Christine; Barois, Annie; Brochier, Guy; Sternberg, Damien; Fournier, Emmanuel; Hantaï, Daniel; Abicht, Angela; Dusl, Marina; Laval, Steven H; Griffin, Helen; Eymard, Bruno; Lochmüller, Hanns

    2014-09-01

    Congenital myasthenic syndromes are a clinically and genetically heterogeneous group of rare diseases resulting from impaired neuromuscular transmission. Their clinical hallmark is fatigable muscle weakness associated with a decremental muscle response to repetitive nerve stimulation and frequently related to postsynaptic defects. Distal myopathies form another clinically and genetically heterogeneous group of primary muscle disorders where weakness and atrophy are restricted to distal muscles, at least initially. In both congenital myasthenic syndromes and distal myopathies, a significant number of patients remain genetically undiagnosed. Here, we report five patients from three unrelated families with a strikingly homogenous clinical entity combining congenital myasthenia with distal muscle weakness and atrophy reminiscent of a distal myopathy. MRI and neurophysiological studies were compatible with mild myopathy restricted to distal limb muscles, but decrement (up to 72%) in response to 3 Hz repetitive nerve stimulation pointed towards a neuromuscular transmission defect. Post-exercise increment (up to 285%) was observed in the distal limb muscles in all cases suggesting presynaptic congenital myasthenic syndrome. Immunofluorescence and ultrastructural analyses of muscle end-plate regions showed synaptic remodelling with denervation-reinnervation events. We performed whole-exome sequencing in two kinships and Sanger sequencing in one isolated case and identified five new recessive mutations in the gene encoding agrin. This synaptic proteoglycan with critical function at the neuromuscular junction was previously found mutated in more typical forms of congenital myasthenic syndrome. In our patients, we found two missense mutations residing in the N-terminal agrin domain, which reduced acetylcholine receptors clustering activity of agrin in vitro. Our findings expand the spectrum of congenital myasthenic syndromes due to agrin mutations and show an unexpected

  6. Evidence-based treatment of metabolic myopathy

    Directory of Open Access Journals (Sweden)

    Yan LIN

    2014-05-01

    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  7. A diagnostic algorithm for metabolic myopathies.

    Science.gov (United States)

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  8. Genetics Home Reference: idiopathic inflammatory myopathy

    Science.gov (United States)

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  9. A family with autosomal dominant mutilating neuropathy not linked to either Charcot-Marie-Tooth disease type 2B (CMT2B) or hereditary sensory neuropathy type I (HSN I) loci.

    Science.gov (United States)

    Bellone, Emilia; Rodolico, Carmelo; Toscano, Antonio; Di Maria, Emilio; Cassandrini, Denise; Pizzuti, Antonio; Pigullo, Simona; Mazzeo, Anna; Macaione, Vincenzo; Girlanda, Paolo; Vita, Giuseppe; Ajmar, Franco; Mandich, Paola

    2002-03-01

    Sensory loss and ulcero-mutilating features have been observed in hereditary sensory neuropathy type I and in hereditary motor and sensory neuropathy type IIB, also referred as Charcot-Marie-Tooth disease type 2B. To date two loci associated with ulcero-mutilating neuropathy have been described: CMT2B at 3q13-q22 and HSN I at 9q22.1-q22.3. We performed linkage analysis with chromosomal markers representing the hereditary sensory neuropathy type I and Charcot-Marie-Tooth disease type 2B loci on an Italian family with a severe distal sensory loss leading to an ulcero-mutilating peripheral neuropathy. Negative likelihood-of-odds scores excluded any evidence of linkage to both chromosome 3q13 and chromosome 9q22 markers, confirming the genetic heterogeneity of this clinical entity and the presence of a third locus responsible for ulcero-mutilating neuropathies.

  10. The burden of gestational diabetes mellitus in Jamaican women with a family history of autosomal dominant type 2 diabetes La carga de la diabetes mellitus gestacional en mujeres de Jamaica con antecedentes familiares de diabetes autosómica dominante tipo 2

    Directory of Open Access Journals (Sweden)

    Rachael R. Irving

    2008-02-01

    Full Text Available OBJECTIVES: To determine if Jamaican women of African descent with a family history of early onset autosomal dominant type 2 diabetes have greater odds of developing gestational diabetes mellitus (GDM than those without a family history of the disease. METHODS: A comparative study was conducted of two groups of pregnant Jamaican women: the first with a family history of early onset autosomal dominant type 2 diabetes; the second with no history of the disease. Incidence, odds for developing GDM, and metabolic profiles in first and second trimesters were assessed using SPSS 11.5 (SPSS Inc., Chicago, Illinois, United States. RESULTS: The incidence of GDM was 12.0 % in women with a family history of early onset autosomal dominant type 2 diabetes and 1.5% in women without a family history of the disease (P OBJETIVOS: Determinar si las mujeres jamaicanas de ascendencia africana con antecedentes familiares de inicio temprano de diabetes autosómica dominante tipo 2 tienen mayor probabilidad de desarrollar diabetes mellitus gestacional (DMG que las que no tienen esos antecedentes familiares. MÉTODOS: Se realizó un estudio comparativo con dos grupos de mujeres jamaicanas embarazadas: el primero con mujeres que tenían antecedentes familiares de inicio temprano de diabetes autosómica dominante tipo 2 y el segundo con mujeres sin antecedentes familiares de esa enfermedad. Se empleó el programa SPSS v. 11.5 (SPSS Inc., Chicago, Illinois, Estados Unidos de América para analizar los resultados y calcular la incidencia, la probabilidad de desarrollar DMG y los perfiles metabólicos en el primer y el segundo trimestres de gestación. RESULTADOS: La incidencia de DMG fue de 12,0% en las mujeres con antecedentes familiares de inicio temprano de diabetes autosómica dominante tipo 2 y de 1,5% en las mujeres sin antecedentes familiares de esa enfermedad (P < 0,05. Las mujeres del primer grupo tuvieron nueve veces más probabilidades de desarrollar DMG que las

  11. The need for genetic study to diagnose some cases of distal renal tubular acidosis.

    Science.gov (United States)

    Heras Benito, Manuel; Garcia-Gonzalez, Miguel A; Valdenebro Recio, María; Molina Ordás, Álvaro; Callejas Martínez, Ramiro; Rodríguez Gómez, María Astrid; Calle García, Leonardo; Sousa Silva, Lisbeth; Fernández-Reyes Luis, María José

    We describe the case of a young woman who was diagnosed with advanced kidney disease, with an incidental finding of nephrocalcinosis of unknown aetiology, having been found asymptomatic throughout her life. The genetic study by panels of known genes associated with tubulointerstitial disease allowed us to discover autosomal dominant distal renal tubular acidosis associated with a de novo mutation in exon 14 of the SLC4A1 gene, which would have been impossible to diagnose clinically due to the advanced nature of the kidney disease when it was discovered. Copyright © 2016 Sociedad Española de Nefrología. Published by Elsevier España, S.L.U. All rights reserved.

  12. Understanding mitochondrial myopathies: a review

    Directory of Open Access Journals (Sweden)

    Abhimanyu S. Ahuja

    2018-05-01

    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  13. An integrated diagnosis strategy for congenital myopathies.

    Directory of Open Access Journals (Sweden)

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  14. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    OpenAIRE

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

    1992-01-01

    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  15. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Science.gov (United States)

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

    2013-07-01

    frequencies of black race, severe onset, distal weakness, falling episodes, Raynaud phenomenon, cardiac involvement, high CK levels, chronic disease course, frequent hospitalization, and wheelchair use. Characteristic features of the anti-Mi-2 subgroup included Hispanic ethnicity, classic dermatomyositis and malar rashes, high CK levels, and very low mortality. Finally, the most common features of patients without any currently defined MSA or myositis-associated autoantibodies included linear extensor erythema, arthralgia, and a monocyclic disease course. Several demographic and clinical features were shared between juvenile and adult idiopathic inflammatory myopathy subgroups, but with several important differences. We conclude that juvenile myositis is a heterogeneous group of illnesses with distinct autoantibody phenotypes defined by varying clinical and demographic characteristics, laboratory features, and outcomes.

  16. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Directory of Open Access Journals (Sweden)

    Rosana Hermínia Scola

    2005-06-01

    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  17. Adult-onset nemaline myopathy presenting as respiratory failure.

    LENUS (Irish Health Repository)

    Kelly, Emer

    2008-11-01

    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  18. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Directory of Open Access Journals (Sweden)

    Vikas Sharma

    2014-01-01

    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  19. Expanding the clinical spectrum of hereditary fibrosing poikiloderma with tendon contractures, myopathy and pulmonary fibrosis due to FAM111B mutations.

    Science.gov (United States)

    Mercier, Sandra; Küry, Sébastien; Salort-Campana, Emmanuelle; Magot, Armelle; Agbim, Uchenna; Besnard, Thomas; Bodak, Nathalie; Bou-Hanna, Chantal; Bréhéret, Flora; Brunelle, Perrine; Caillon, Florence; Chabrol, Brigitte; Cormier-Daire, Valérie; David, Albert; Eymard, Bruno; Faivre, Laurence; Figarella-Branger, Dominique; Fleurence, Emmanuelle; Ganapathi, Mythily; Gherardi, Romain; Goldenberg, Alice; Hamel, Antoine; Igual, Jeanine; Irvine, Alan D; Israël-Biet, Dominique; Kannengiesser, Caroline; Laboisse, Christian; Le Caignec, Cédric; Mahé, Jean-Yves; Mallet, Stéphanie; MacGowan, Stuart; McAleer, Maeve A; McLean, Irwin; Méni, Cécile; Munnich, Arnold; Mussini, Jean-Marie; Nagy, Peter L; Odel, Jeffrey; O'Regan, Grainne M; Péréon, Yann; Perrier, Julie; Piard, Juliette; Puzenat, Eve; Sampson, Jacinda B; Smith, Frances; Soufir, Nadem; Tanji, Kurenai; Thauvin, Christel; Ulane, Christina; Watson, Rosemarie M; Khumalo, Nonhlanhla P; Mayosi, Bongani M; Barbarot, Sébastien; Bézieau, Stéphane

    2015-10-15

    Hereditary Fibrosing Poikiloderma (HFP) with tendon contractures, myopathy and pulmonary fibrosis (POIKTMP [MIM 615704]) is a very recently described entity of syndromic inherited poikiloderma. Previously by using whole exome sequencing in five families, we identified the causative gene, FAM111B (NM_198947.3), the function of which is still unknown. Our objective in this study was to better define the specific features of POIKTMP through a larger series of patients. Clinical and molecular data of two families and eight independent sporadic cases, including six new cases, were collected. Key features consist of: (i) early-onset poikiloderma, hypotrichosis and hypohidrosis; (ii) multiple contractures, in particular triceps surae muscle contractures; (iii) diffuse progressive muscular weakness; (iv) pulmonary fibrosis in adulthood and (v) other features including exocrine pancreatic insufficiency, liver impairment and growth retardation. Muscle magnetic resonance imaging was informative and showed muscle atrophy and fatty infiltration. Histological examination of skeletal muscle revealed extensive fibroadipose tissue infiltration. Microscopy of the skin showed a scleroderma-like aspect with fibrosis and alterations of the elastic network. FAM111B gene analysis identified five different missense variants (two recurrent mutations were found respectively in three and four independent families). All the mutations were predicted to localize in the trypsin-like cysteine/serine peptidase domain of the protein. We suggest gain-of-function or dominant-negative mutations resulting in FAM111B enzymatic activity changes. HFP with tendon contractures, myopathy and pulmonary fibrosis, is a multisystemic disorder due to autosomal dominant FAM111B mutations. Future functional studies will help in understanding the specific pathological process of this fibrosing disorder.

  20. Distal renal tubular acidosis

    Science.gov (United States)

    ... this disorder. Alternative Names Renal tubular acidosis - distal; Renal tubular acidosis type I; Type I RTA; RTA - distal; Classical RTA Images Kidney anatomy Kidney - blood and urine flow References Bose A, Monk RD, Bushinsky DA. Kidney ...

  1. Centronuclear myopathy in a Border collie dog.

    Science.gov (United States)

    Eminaga, S; Cherubini, G B; Shelton, G D

    2012-10-01

    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  2. Aerobic Training in Patients with Congenital Myopathy

    DEFF Research Database (Denmark)

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

    2016-01-01

    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

  3. The expanding phenotype of mitochondrial myopathy.

    Science.gov (United States)

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana

    2005-10-01

    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  4. Cerebral Autosomal Dominant Arteriopathy with Subcortical Infacts and Leukoencephalopathy (CADASIL)

    Science.gov (United States)

    ... lifestyle with adequate exercise and control of other risk factors for stroke such as high blood pressure, diaetes and high cholesterol are highly recommended. Recently, a randomized trail that tested Donepezil (Aricept), a drug recommended for Alzheimer’s disease, did not find it to be effective ...

  5. Genetics Home Reference: autosomal dominant cerebellar ataxia, deafness, and narcolepsy

    Science.gov (United States)

    ... may help regulate nerve cell (neuron) maturation and specialization (differentiation), the ability of neurons to move (migrate) ... Ataxia Foundation National Sleep Foundation University of Kansas Medical Center Resource List: Deafness and Hard of Hearing ...

  6. Autosomal Dominant Aniridia in A Nigerian Family: A Case Report ...

    African Journals Online (AJOL)

    A 54year old man brought his son to our clinic because of large eyeballs and poor vision from birth. Family history revealed that father and another child had poor vision and used to squeeze their faces especially in bright light. Examination of the boy revealed bilateral aniridia with congenital glaucoma. The father, the other ...

  7. Genetics Home Reference: autosomal dominant hyper-IgE syndrome

    Science.gov (United States)

    ... the brain, which do not affect a person's intelligence. Related Information What does it mean if a ... protein that plays an important role in several body systems. To carry out its roles, the STAT3 ...

  8. Autosomic dominant type II Osteopetrosis (Albers-Schonberg disease)

    International Nuclear Information System (INIS)

    Zambrano, Angela R; Salamanca, Juan C; Ospino, Benjamin

    2003-01-01

    The osteopetrosis type II or albers-schonberg disease is an infrequent disease secondary to the decrease in the bone resorption. The osteoclast is the principal cell involved in the disease. The osteopetrosis is characterized by few symptoms and it also has a benign course, but may further develop medullar insufficiency. We report a case of a young patient that initially shows, thrombocytopenia and bone pain with increase in the bone density, suggestive of osteopetrosis type II. The x ray exam was conclusive of osteopetrosis

  9. Hereditary myopathies with early respiratory insufficiency in adults.

    Science.gov (United States)

    Naddaf, Elie; Milone, Margherita

    2017-11-01

    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  10. Distal digital replantation.

    Science.gov (United States)

    Jazayeri, Leila; Klausner, Jill Q; Chang, James

    2013-11-01

    Hand surgeons have been hesitant to perform distal digital replantation because of the technical challenges and the perception of a high cost-to-benefit ratio. Recent studies, however, have shown high survival rates and excellent functional and aesthetic results, providing renewed enthusiasm for distal replantation. The authors reviewed the literature and summarize key points regarding the surgical treatment, perioperative care, and outcomes of distal digital replantation. They describe specific techniques and considerations for surgical repair in each of four distal zones as described by Sebastin and Chung. Zone 1A replantation involves an artery-only anastomosis of a longitudinal pulp artery. Venous anastomosis first becomes possible in zone 1B. Zone 1C involves periarticular amputations where arthrodesis of the distal interphalangeal joint is usually indicated. Repair of the artery, vein, and nerve is technically optimal in zone 1D, where venous anastomosis should be performed. Overall, survival rates for distal digital replantation are similar to those reported for more proximal replantation. The literature reports good outcomes regarding nail salvage, fingertip sensibility, and range of motion, with restoration of length and aesthetic appearance. Distal replantation performed at institutions that specialize in microsurgery and specifically tailored to the level of injury is associated with good survival, function, and patient satisfaction and superior aesthetic outcome. More prospective data are needed to evaluate the cost of treatment, psychological outcomes, and functional outcomes of distal replantation compared with revision amputation.

  11. Alanyl-tRNA synthetase mutation in a family with dominant distal hereditary motor neuropathy

    Science.gov (United States)

    Zhao, Z.; Hashiguchi, A.; Sakiyama, Y.; Okamoto, Y.; Tokunaga, S.; Zhu, L.; Shen, H.; Takashima, H.

    2012-01-01

    Objective: To identify a new genetic cause of distal hereditary motor neuropathy (dHMN), which is also known as a variant of Charcot-Marie-Tooth disease (CMT), in a Chinese family. Methods: We investigated a Chinese family with dHMN clinically, electrophysiologically, and genetically. We screened for the mutations of 28 CMT or related pathogenic genes using an originally designed microarray resequencing DNA chip. Results: Investigation of the family history revealed an autosomal dominant transmission pattern. The clinical features of the family included mild weakness and wasting of the distal muscles of the lower limb and foot deformity, without clinical sensory involvement. Electrophysiologic studies revealed motor neuropathy. MRI of the lower limbs showed accentuated fatty infiltration of the gastrocnemius and vastus lateralis muscles. All 4 affected family members had a heterozygous missense mutation c.2677G>A (p.D893N) of alanyl-tRNA synthetase (AARS), which was not found in the 4 unaffected members and control subjects. Conclusion: An AARS mutation caused dHMN in a Chinese family. AARS mutations result in not only a CMT phenotype but also a dHMN phenotype. PMID:22573628

  12. Hypothyroid myopathy. A clinical and pathologaical study.

    Science.gov (United States)

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

    1980-09-01

    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  13. Aneurisma gigante do segmento intracavernoso da carótida interna associado a doença renal policística autossômica dominante: relato de caso Giant aneurysm of the intracavernous internal carotid artery associated with autosomal dominant polycystic kidney disease: case report

    Directory of Open Access Journals (Sweden)

    Keven F. Ponte

    2006-09-01

    Full Text Available Apresenta-se o caso de mulher de 60 anos com doença renal policística autossômica dominante (DRPAD que desenvolveu quadro de cefaléia e oftalmoplegia completa à direita. A TC levantou a hipótese de um aneurisma gigante do segmento intracavernoso da carótida interna direita, o que foi confirmado pela arteriografia. Realizou-se, então, tratamento endovascular por oclusão do vaso parental com molas destacáveis no segmento supraclinóideo. A paciente evoluiu com a interrupção da cefaléia e com redução parcial da ptose e da oftalmoplegia. Neste artigo, enfatiza-se a relação entre DRPAD e aneurismas intracranianos. Comenta-se a história natural dos aneurismas originados no segmento intracavernoso da artéria carótida interna e comparam-se as opções terapêuticas no manejo destas lesões.We report the case of a 60 years-old woman with autosomal dominant polycystic kidney disease (ADPKD that presented with headache and right complete ophthalmoplegia. The CT scan raised the possibility of a giant aneurysm of the right intracavernous internal carotid artery, confirmed by angiography. The patient underwent endovascular occlusion of parent vessel with detachable coils, then she presented interruption of headache and partial recovery of ptosis and ophthalmoplegia. We emphasize the relationship between ADPKD and intracranial aneurysms. We also discuss the natural history and compare the therapeutic options for the management of giant aneurysms of the cavernous portion of the carotid artery.

  14. [Cardiac myopathy due to overt hypothyroidism].

    Science.gov (United States)

    Harbeck, B; Berndt, M J; Lehnert, H

    2014-03-01

    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  15. Treatment Opportunities in Patients With Metabolic Myopathies

    DEFF Research Database (Denmark)

    Ørngreen, Mette Cathrine; Vissing, John

    2017-01-01

    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  16. Variable phenotypic expression and onset in MYH14 distal hereditary motor neuropathy phenotype in a large, multigenerational North American family.

    Science.gov (United States)

    Iyadurai, Stanley; Arnold, W David; Kissel, John T; Ruhno, Corey; Mcgovern, Vicki L; Snyder, Pamela J; Prior, Thomas W; Roggenbuck, Jennifer; Burghes, Arthur H; Kolb, Stephen J

    2017-08-01

    Distal hereditary motor neuropathy (dHMN) causes distal-predominant weakness without prominent sensory loss. Myosin heavy chain disorders most commonly result in distal myopathy and cardiomyopathy with or without hearing loss, but a complex phenotype with dHMN, myopathy, hoarseness, and hearing loss was reported in a Korean family with a c.2822G>T mutation in MYH14. In this study we report phenotypic features in a North American family with the c.2822G>T in MYH14. Clinical and molecular characterization was performed in a large, 6-generation, Caucasian family with MYH14 dHMN. A total of 11 affected and 7 unaffected individuals were evaluated and showed varying age of onset and severity of weakness. Genotypic concordance was confirmed with molecular analysis. Electrophysiological studies demonstrated distal motor axonal degeneration without myopathy in all affected subjects tested. Mutation of MYH14 can result in a range of neuromuscular phenotypes that includes a dHMN and hearing loss phenotype with variable age of onset. Muscle Nerve 56: 341-345, 2017. © 2016 Wiley Periodicals, Inc.

  17. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Science.gov (United States)

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  19. [Biologic therapy in idiopathic inflammatory myopathy].

    Science.gov (United States)

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

    2014-09-15

    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  20. Flaccid quadriplegia due to thyrotoxic myopathy.

    Science.gov (United States)

    Couillard, Philippe; Wijdicks, Eelco F M

    2014-04-01

    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  1. A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

    Science.gov (United States)

    Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi

    2014-07-01

    Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Experimental research on preimplantation genetic diagnosis for autosomal dominant polycys-tic kidney disease%常染色体显性多囊肾疾病行胚胎植入前遗传学诊断的实验研究

    Institute of Scientific and Technical Information of China (English)

    朱琴; 徐炳森; 黄学锋; 周颖

    2009-01-01

    目的:建立由PKD1突变所致常染色体显性多囊肾疾病(autosomal dominant polycystic kidney disease,ADPKD)的胚胎植入前遗传学诊断(preimplantation genetic diagnosis,PGD)方法.方法:①通过微卫星连锁分析确定2个多囊肾家系的ADPKD致病基因.检测的微卫星包括为与PKD1连锁的KG8、 SM6、CW4和CW2以及与PKD2连锁的D4S1534、D4S1563、D4S414和D4S423.②对18个淋巴细胞和1个PKD1 突变所致ADPKD成员行常规体外受精胚胎移植后的5个废弃胚胎15个卵裂球行多重巢式PCR和毛细管电泳检测与PKD1连锁的微卫星分型.结果:①KG8、CW4和CW2 可作为连锁微卫星分析外周血和单个细胞的PKD1突变;②2个家系的致病基因均为PKD1;③单个卵裂球扩增成功率为86.67%(13/15),单个淋巴细胞扩增成功率为88.89%(16/18),CW4等位基因脱扣率为25%(4/16),CW2未发现等位基因脱扣,均未发现污染,2个胚胎携带致病基因.结论:PKD1连锁的微卫星分型可作为PKD1突变所致ADPKD的PGD诊断方法.

  3. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    Science.gov (United States)

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  4. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Directory of Open Access Journals (Sweden)

    Özgül Uçar

    2011-04-01

    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  5. A Drosophila model of dominant inclusion body myopathy type 3 shows diminished myosin kinetics that reduce muscle power and yield myofibrillar defects.

    Science.gov (United States)

    Suggs, Jennifer A; Melkani, Girish C; Glasheen, Bernadette M; Detor, Mia M; Melkani, Anju; Marsan, Nathan P; Swank, Douglas M; Bernstein, Sanford I

    2017-06-01

    Individuals with inclusion body myopathy type 3 (IBM3) display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K) in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in decreased in vitro

  6. Identification of the CFTR c.1666A>G Mutation in Hereditary Inclusion Body Myopathy Using Next-Generation Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    Yan Lu

    2018-05-01

    Full Text Available Hereditary inclusion body myopathy (HIBM is a rare autosomal recessive adult onset muscle disease which affects one to three individuals per million worldwide. This disease is autosomal dominant and occurs in adulthood. Our previous study reported a new subtype of HIBM linked to the susceptibility locus at 7q22.1-31.1. The present study is aimed to identify the candidate gene responsible for the phenotype in HIBM pedigree. After multipoint linkage analysis, we performed targeted capture sequencing on 16 members and whole-exome sequencing (WES on 5 members. Bioinformatics filtering was performed to prioritize the candidate pathogenic gene variants, which were further genotyped by Sanger sequencing. Our results showed that the highest peak of LOD score (4.70 was on chromosome 7q22.1-31.1.We identified 2 and 22 candidates using targeted capture sequencing and WES respectively, only one of which as CFTRc.1666A>G mutation was well cosegregated with the HIBM phenotype. Using transcriptome analysis, we did not detect the differences of CFTR's mRNA expression in the proband compared with healthy members. Due to low incidence of HIBM and there is no other pedigree to assess, mutation was detected in three patients with duchenne muscular dystrophyn (DMD and five patients with limb-girdle muscular dystrophy (LGMD. And we found that the frequency of mutation detected in DMD and LGMD patients was higher than that of being expected in normal population. We suggested that the CFTRc.1666A>G may be a candidate marker which has strong genetic linkage with the causative gene in the HIBM family.

  7. A Drosophila model of dominant inclusion body myopathy type 3 shows diminished myosin kinetics that reduce muscle power and yield myofibrillar defects

    Directory of Open Access Journals (Sweden)

    Jennifer A. Suggs

    2017-06-01

    Full Text Available Individuals with inclusion body myopathy type 3 (IBM3 display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in

  8. Congenital myopathy is caused by mutation of HACD1

    OpenAIRE

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

    2013-01-01

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  9. Skeletal muscle repair in a mouse model of nemaline myopathy

    OpenAIRE

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2006-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  10. Aerobic Training in Patients with Congenital Myopathy.

    Directory of Open Access Journals (Sweden)

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

  11. [Distal clavicle fracture].

    Science.gov (United States)

    Seppel, G; Lenich, A; Imhoff, A B

    2014-06-01

    Reposition and fixation of unstable distal clavicle fractures with a low profile locking plate (Acumed, Hempshire, UK) in conjunction with a button/suture augmentation cerclage (DogBone/FibreTape, Arthrex, Naples, FL, USA). Unstable fractures of the distal clavicle (Jäger and Breitner IIA) in adults. Unstable fractures of the distal clavicle (Jäger and Breitner IV) in children. Distal clavicle fractures (Jäger and Breitner I, IIB or III) with marked dislocation, injury of nerves and vessels, or high functional demand. Patients in poor general condition. Fractures of the distal clavicle (Jäger and Breitner I, IIB or III) without marked dislocation or vertical instability. Local soft-tissue infection. Combination procedure: Initially the lateral part of the clavicle is exposed by a 4 cm skin incision. After reduction of the fracture, stabilization is performed with a low profile locking distal clavicle plate. Using a special guiding device, a transclavicular-transcoracoidal hole is drilled under arthroscopic view. Additional vertical stabilization is arthroscopically achieved by shuttling the DogBone/FibreTape cerclage from the lateral portal cranially through the clavicular plate. The two ends of the FibreTape cerclage are brought cranially via adjacent holes of the locking plate while the DogBone button is placed under the coracoid process. Thus, plate bridging is achieved. Finally reduction is performed and the cerclage is secured by surgical knotting. Use of an arm sling for 6 weeks. Due to the fact that the described technique is a relatively new procedure, long-term results are lacking. In the short term, patients postoperatively report high subjective satisfaction without persistent pain.

  12. Association between statin-associated myopathy and skeletal muscle damage.

    Science.gov (United States)

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

    2009-07-07

    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  13. Distintas formas de presentación clínica de un raquitismo hipofosfatémico autosómico dominante por mutación del factor de crecimiento fibroblástico 23 en una familia Different forms of clinical presentation of an autosomal dominant hypophosphatemic rickets caused by a FGF 23 mutation in one family

    Directory of Open Access Journals (Sweden)

    Armando Luis Negri

    2004-04-01

    Full Text Available Describimos distintas formas de presentación clínica de un raquitismo hipofosfatémico autosómico dominante en 4 miembros de una misma familia y su respuesta al tratamiento. Paciente N° 1: de sexo femenino de 60 años que consultó por dolores costales y pélvicos, con osteoporosis densitométrica, hipofosfatemia con bajo umbral renal de fósforo, PTH intacta normal y calcemia normal. Tratada con fósforo neutro y calcitriol logró la normalización bioquímica y una notable mejoría de la densitometría en menos de un año. Paciente N° 2: su nieta, consultó al año y ocho meses de edad por presentar talla en percentil 3 y genu varum. En el laboratorio mostró hipofosfatemia y fosfatasa alcalina total muy elevada y en la Rx de mano, ensanchamiento y deflecamiento epifisario compatible con raquitismo. Tratada con fósforo neutro y calcitriol, normalizó los parámetros bioquímicos y logró un ascenso en el percentil de talla de 3 a 50 a los 20 meses de tratamiento. Paciente N° 3: la madre de la paciente N° 2, quien sin ninguna manifestación clínica y con densitometría ósea normal presentó hipofosfatemia que se normalizó con tratamiento con fosfato neutro. Paciente N° 4: el tío de la paciente N° 2, tuvo raquitismo hipofosfatémico de niño, y luego de los 5 años normalizó el fósforo sin tratamiento. Estudiado a los 29 años presentó fósforo normal y densitometría ósea normal. El análisis del ADN genómico de la paciente N° 3 mostró una mutación con sentido erróneo en el gen del factor de crecimiento fifroblástico 23 (sustitución de arginina por una glutamina en posición 179. Por lo tanto se llegó al diagnóstico de raquitismo/osteomalacia hipofosfatémico autosómico dominante.In this report we describe different forms of clinical presentation of an autosomal dominant hypophosphatemic rickets (ADHR in 4 members of the same family as well as the treatment used in these patients and their response to it. Patient N

  14. A novel PNPLA2 mutation causes neutral lipid storage disease with myopathy (NLSDM) presenting muscular dystrophic features with lipid storage and rimmed vacuoles.

    Science.gov (United States)

    Chen, J; Hong, D; Wang, Z; Yuan, Y

    2010-01-01

    Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.

  15. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    Science.gov (United States)

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  16. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

    2011-01-01

    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  17. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

    2011-01-01

    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  18. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    Science.gov (United States)

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  19. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  20. A novel FLNC frameshift and an OBSCN variant in a family with distal muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Rossi, Daniela; Palmio, Johanna; EvilaÈ, Anni; Galli, Lucia; Barone, Virginia; Caldwell, Tracy A.; Policke, Rachel A.; Aldkheil, Esraa; Berndsen, Christopher E.; Wright, Nathan T.; Malfatti, Edoardo; Brochier, Guy; Pierantozzi, Enrico; Jordanova, Albena; Guergueltcheva, Velina; Romero, Norma Beatriz; Hackman, Peter; Eymard, Bruno; Udd, Bjarne; Sorrentino, Vincenzo (Antwerp); (U. Sofia); (Siena); (Tampere); (J Madison); (Helsinki)

    2017-10-26

    A novel FLNC c.5161delG (p.Gly1722ValfsTer61) mutation was identified in two members of a French family affected by distal myopathy and in one healthy relative. This FLNC c.5161delG mutation is one nucleotide away from a previously reported FLNC mutation (c.5160delC) that was identified in patients and in asymptomatic carriers of three Bulgarian families with distal muscular dystrophy, indicating a low penetrance of the FLNC frameshift mutations. Given these similarities, we believe that the two FLNC mutations alone can be causative of distal myopathy without full penetrance. Moreover, comparative analysis of the clinical manifestations indicates that patients of the French family show an earlier onset and a complete segregation of the disease. As a possible explanation of this, the two French patients also carry a OBSCN c.13330C>T (p.Arg4444Trp) mutation. The p.Arg4444Trp variant is localized within the OBSCN Ig59 domain that, together with Ig58, binds to the ZIg9/ZIg10 domains of titin at Z-disks. Structural and functional studies indicate that this OBSCN p.Arg4444Trp mutation decreases titin binding by ~15-fold. On this line, we suggest that the combination of the OBSCN p.Arg4444Trp variant and of the FLNC c.5161delG mutation, can cooperatively affect myofibril stability and increase the penetrance of muscular dystrophy in the French family.

  1. Distal finger replantation.

    Science.gov (United States)

    Scheker, Luis R; Becker, Giles W

    2011-03-01

    Reconstruction of the fingertip distal to the flexor tendon insertion by replantation remains controversial and technically challenging, but the anatomy of the fingertip has been well described and provides help in surgical planning. The open-book surgical technique is described with potential complications and is illustrated with clinical cases. Copyright © 2011 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  2. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Directory of Open Access Journals (Sweden)

    Abdullah Mishal

    2012-02-01

    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  3. Distal radioulnar joint injuries

    Directory of Open Access Journals (Sweden)

    Binu P Thomas

    2012-01-01

    Full Text Available Distal radioulnar joint is a trochoid joint relatively new in evolution. Along with proximal radioulnar joint , forearm bones and interosseous membrane, it allows pronosupination and load transmission across the wrist. Injuries around distal radioulnar joint are not uncommon, and are usually associated with distal radius fractures,fractures of the ulnar styloid and with the eponymous Galeazzi or Essex_Lopresti fractures. The injury can be purely involving the soft tissue especially the triangular fibrocartilage or the radioulnar ligaments.The patients usually present with ulnar sided wrist pain, features of instability, or restriction of rotation. Difficulty in carrying loads in the hand is a major constraint for these patients. Thorough clinical examination to localize point of tenderness and appropriate provocative tests help in diagnosis. Radiology and MRI are extremely useful, while arthroscopy is the gold standard for evaluation. The treatment protocols are continuously evolving and range from conservative, arthroscopic to open surgical methods. Isolated dislocation are uncommon. Basal fractures of the ulnar styloid tend to make the joint unstable and may require operative intervention. Chronic instability requires reconstruction of the stabilizing ligaments to avoid onset of arthritis. Prosthetic replacement in arthritis is gaining acceptance in the management of arthritis.

  4. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  5. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    NARCIS (Netherlands)

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

    2013-01-01

    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  6. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Directory of Open Access Journals (Sweden)

    Kang Won Lee

    2015-12-01

    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  7. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    Directory of Open Access Journals (Sweden)

    F Binesh

    2007-01-01

    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  8. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Science.gov (United States)

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

    2015-08-01

    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  9. Hoffmann's disease: MR imaging of hypothyroid myopathy

    International Nuclear Information System (INIS)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

    2015-01-01

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  10. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

    2015-11-15

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  11. Glucocorticoid-induced myopathy in the intensive care unit

    DEFF Research Database (Denmark)

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

    2015-01-01

    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  12. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Science.gov (United States)

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

    2014-01-01

    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  13. Congenital myopathy is caused by mutation of HACD1.

    Science.gov (United States)

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

    2013-12-20

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  14. Eosinophilic fasciitis in a child mimicking a myopathy.

    NARCIS (Netherlands)

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

    2006-01-01

    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  15. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Science.gov (United States)

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  16. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    NARCIS (Netherlands)

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

    1998-01-01

    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  17. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Science.gov (United States)

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

    1997-05-01

    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  18. REV-ERB and ROR: therapeutic targets for treating myopathies

    Science.gov (United States)

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  19. Distal corporoplasty for distal cylinders extrusion after penile prosthesis implantation.

    Science.gov (United States)

    Carrino, Maurizio; Chiancone, Francesco; Battaglia, Gaetano; Pucci, Luigi; Fedelini, Paolo

    2017-02-03

    Distal extrusion of cylinders is a potential complication of the penile prosthesis implantation. Several methods have been proposed for repairing a distal penile erosion. We present our preliminary experience in "Distal corporoplasty" technique. We enrolled 18 consecutive patients whose underwent a distal corporoplasty with simultaneous reimplantation of an "AMS 700 inflatable penile prosthesis (LGX)" from January 2013 to November 2015 at our hospital. All procedures were performed by a single surgical team. Intraoperative and postoperative complications have been classified and reported according to Satava6 and Clavien-Dindo (CD) system.7 Mean values with standard deviations (±SD) were computed and reported for all items. Mean age of the patients was 53.61 (±11.90) years. Mean body max index (BMI) was 24.22 (±2.51). Mean operative time was 85.2 (±13.1) minutes. Blood losses were minimal. No intraoperative complications are reported according to Satava classification. Four out of 18 patients (22.22%) experienced postoperative complications according to CD system. All patients had sexual intercourse for the first time postsurgery after a mean of 59.11 ± 2.08 days. Mean follow-up was 22.11 (±9.95). Distal extrusion of cylinders is a potential complication of the penile prosthesis implantation. Distal corporoplasty was first described by Mulcahy. He reported a series of 14 patients with a follow-up of about 2 years with optimal functional outcomes. Moreover, distal corporoplasty resulted in shorter operative time, better function, less pain, and fewer recurrences than Gortex windsock repair.10 In our experience, distal corporoplasty is a simple and safe procedure in the treatment of distal cylinders extrusion when the prosthetic material is not exposed to the exterior.

  20. The effect of coenzyme Q10 in statin myopathy.

    Science.gov (United States)

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

    2012-01-01

    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  1. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Science.gov (United States)

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

    2016-12-01

    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Miopatia ocular descendente Descending ocular myopathy: a case report

    Directory of Open Access Journals (Sweden)

    Marcos R. G. de Freitas

    1975-06-01

    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  3. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Directory of Open Access Journals (Sweden)

    Şenol Kobak

    2013-01-01

    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  4. Analysis of lipid profile in lipid storage myopathy.

    Science.gov (United States)

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  5. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    OpenAIRE

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

    2010-01-01

    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  6. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  7. Diagnosis and treatment of the idiopathic inflammatory myopathies

    OpenAIRE

    Gazeley, David J.; Cronin, Mary E.

    2011-01-01

    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  8. Association between statin-associated myopathy and skeletal muscle damage.

    OpenAIRE

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

    2009-01-01

    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  9. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Science.gov (United States)

    Yamini, B; Schillhorn van Veen, T W

    1988-10-01

    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  10. Search for Pompe disease among patients with undetermined myopathies.

    Science.gov (United States)

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

    2015-07-20

    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    International Nuclear Information System (INIS)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

    2010-01-01

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  12. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

    2010-12-15

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  13. Zidovudine-induced myopathy: A study in Indian patients.

    Science.gov (United States)

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

    2010-07-01

    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  14. Reverse Distal Transverse Palmar Arch in Distal Digital Replantation.

    Science.gov (United States)

    Wei, Ching-Yueh; Orozco, Oscar; Vinagre, Gustavo; Shafarenko, Mark

    2017-11-01

    Refinements in microsurgery have made distal finger replantation an established technique with high success rates and good functional and aesthetic outcomes. However, it still represents a technically demanding procedure due to the small vessel caliber and frequent lack of vessel length, requiring the use of interpositional venous grafts in some instances. We describe a new technique for anastomosis in fingertip replantation, whereby the need for venous grafts is eliminated. Applying the reverse distal transverse palmar arch technique, 11 cases of distal digital replantation were performed between January 2011 and July 2016. The described procedure was used for arterial anastomosis in 10 cases and arteriovenous shunting for venous drainage in 1 case. A retrospective case review was conducted. The technical description and clinical outcome evaluations are presented. Ten of the 11 replanted digits survived, corresponding to an overall success rate of 91%. One replant failed due to venous insufficiency. Blood transfusions were not required for any of the patients. Follow-up (range, 1.5-5 months) revealed near-normal range of motion and good aesthetic results. All of the replanted digits developed protective sensation. The average length of hospital admission was 5 days. All patients were satisfied with the results and were able to return to their previous work. The use of the reverse distal transverse palmar arch is a novel and reliable technique in distal digital replantation when an increase in vessel length is required, allowing for a tension-free arterial repair without the need for vein grafts.

  15. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Energy Technology Data Exchange (ETDEWEB)

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

    1986-01-01

    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  16. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Science.gov (United States)

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-03-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  17. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    OpenAIRE

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-01-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  18. Efficient and reproducible myogenic differentiation from human iPS cells: prospects for modeling Miyoshi Myopathy in vitro.

    Directory of Open Access Journals (Sweden)

    Akihito Tanaka

    Full Text Available The establishment of human induced pluripotent stem cells (hiPSCs has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1 in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70-90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF. These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs.

  19. Efficient and Reproducible Myogenic Differentiation from Human iPS Cells: Prospects for Modeling Miyoshi Myopathy In Vitro

    Science.gov (United States)

    Tanaka, Akihito; Woltjen, Knut; Miyake, Katsuya; Hotta, Akitsu; Ikeya, Makoto; Yamamoto, Takuya; Nishino, Tokiko; Shoji, Emi; Sehara-Fujisawa, Atsuko; Manabe, Yasuko; Fujii, Nobuharu; Hanaoka, Kazunori; Era, Takumi; Yamashita, Satoshi; Isobe, Ken-ichi; Kimura, En; Sakurai, Hidetoshi

    2013-01-01

    The establishment of human induced pluripotent stem cells (hiPSCs) has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1) in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70–90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM) is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF). These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs. PMID:23626698

  20. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    Directory of Open Access Journals (Sweden)

    V. A. Erokhina

    2013-08-01

    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  1. Traumatic Distal Ulnar Artery Thrombosis

    Directory of Open Access Journals (Sweden)

    Ahmet A. Karaarslan

    2014-01-01

    Full Text Available This paper is about a posttraumatic distal ulnar artery thrombosis case that has occurred after a single blunt trauma. The ulnar artery thrombosis because of chronic trauma is a frequent condition (hypothenar hammer syndrome but an ulnar artery thrombosis because of a single direct blunt trauma is rare. Our patient who has been affected by a single blunt trauma to his hand and developed ulnar artery thrombosis has been treated by resection of the thrombosed ulnar artery segment. This report shows that a single blunt trauma can cause distal ulnar artery thrombosis in the hand and it can be treated merely by thrombosed segment resection in suitable cases.

  2. Muscle structural changes in mitochondrial myopathy relate to genotype

    DEFF Research Database (Denmark)

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

    2003-01-01

    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  3. Distribution of skeletal muscle involvement in autosomal recessive distal muscular dystrophy

    International Nuclear Information System (INIS)

    Mizusawa, Hidehiro; Nakanishi, Takao; Kobayashi, Fumie.

    1987-01-01

    Distribution of skeletal muscle involvement in 5 cases with autosomal recessive distal muscular dystrophy was studied clinically and by computed tomography (CT). Manual muscle test showed muscle involvement with a predilection for flexors in the lower leg and adductors in the thigh. Flexion and extension of the thigh and the lower leg was impaired to similar degree. In progressed cases, neck flexors and trunk muscles were also affected mildly. CT disclosed more clearly the preferential involvement of flexors in the lower leg, and involvement of both hamstrings · adductors group and extensors group of the thigh to similar degree. However, m. popliteus was curiously well preserved. In addition, there was a stage showing high density and hypertrophy of m. sartorius, m. gracilis, m. adductor, m. biceps femoris, m. semimenbranosus, m. semitendinosus or m. rectus femoris, which in thought to be compensatory hypertrophy. M. gluteus minimus in the pelvic girdle and m. dorsi proprii in the trunk were also liable to be affected. The CT findings are regarded as characteristic features noted clearly before muscle weakness and atrophy become apparent clinically. CT is very useful for distinguishing distal muscular dystrophy from rimmed vacuolar distal myopathy in which m. quadriceps femoris and flexors of the lower leg are usually well preserved without compensatory hypertrophy on CT. (author)

  4. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Science.gov (United States)

    Váncsa, Andrea

    2016-09-01

    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  5. Statin-associated myopathy: from genetic predisposition to clinical management.

    Science.gov (United States)

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

    2014-01-01

    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  6. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Science.gov (United States)

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  7. Distal protection in cardiovascular medicine: current status.

    Science.gov (United States)

    Ali, Onn Akbar; Bhindi, Ravinay; McMahon, Aisling C; Brieger, David; Kritharides, Leonard; Lowe, Harry C

    2006-08-01

    Iatrogenic and spontaneous downstream microembolization of atheromatous material is increasingly recognized as a source of cardiovascular morbidity and mortality. Devising ways of reducing this distal embolization using a variety of mechanical means--distal protection--is currently under intense and diverse investigation. This review therefore summarizes the present status of distal protection. It examines the problem of distal embolization, describes the available distal protection devices, reviews those areas of cardiovascular medicine where distal protection devices are being investigated, and discusses potential future developments.

  8. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Science.gov (United States)

    Christopher-Stine, Lisa; Basharat, Pari

    2017-04-01

    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  9. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    Directory of Open Access Journals (Sweden)

    R Burnham

    2006-01-01

    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  10. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    NARCIS (Netherlands)

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

    2015-01-01

    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  11. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Science.gov (United States)

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  12. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    NARCIS (Netherlands)

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

    2004-01-01

    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  13. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Science.gov (United States)

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

    2006-01-01

    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  14. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    Directory of Open Access Journals (Sweden)

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  15. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Science.gov (United States)

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

    2017-01-01

    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  16. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Directory of Open Access Journals (Sweden)

    Steven Heireman

    2011-01-01

    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  17. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Directory of Open Access Journals (Sweden)

    Harsh Patel

    2014-01-01

    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.